WO2023024230A1

WO2023024230A1 - COMPOSITION CONTAINING C/EBPα-SARNA

Info

Publication number: WO2023024230A1
Application number: PCT/CN2021/124412
Authority: WO
Inventors: 赵小洋
Original assignee: 赵小洋; 安璞国际医疗科技(深圳)有限公司
Priority date: 2021-08-27
Filing date: 2021-10-18
Publication date: 2023-03-02
Also published as: CN114306367A; CN114306367B

Abstract

Provided is a composition containing C/EBPα‑saRNA targeting a CEBPA transcript, comprising at least one C/EBPα‑saRNA and at least one saRNA or siRNA of a protein bound to C/EBPα. The saRNA is selected from p21‑saRNA. The siRNA is selected from C/EBPβ‑siRNA. Also provided is a use of the composition of the C/EBPα‑saRNA in preparation of medicines.

Description

A composition containing C/EBPa-saRNA

technical field

The present invention relates to compositions of polynucleotides (especially saRNAs) useful for modulating CEBPA and CEBPA pathways, and to therapeutic applications of such compositions in the treatment of metabolic diseases, hyperproliferative diseases (such as tumors), and other liver-related application in disease.

Background technique

Nucleic acid drugs are the frontier of biomedical development, including antisense nucleic acid (ASO), small interfering RNA (siRNA), microRNA (miRNA), small activating RNA (saRNA), messenger RNA (mRNA) aptamer (aptamer) , ribozyme (ribozyme), antibody nucleic acid conjugated drug (ARC), etc., are a hot spot and trend in the development of medical technology. Nucleic acid drugs are essentially a form of gene therapy, and it is also a field that has received widespread attention after small molecule drugs, protein drugs, and antibody drugs.

RNA activation (RNAa) is a mechanism that upregulates gene expression at the transcriptional level, mediated by double-stranded 21 oligonucleotide RNA (dsRNA) targeting specific gene promoter regions. Since saRNA first came out, the exact molecular mechanism of RNA activation has been the focus of scientists' research. Some studies believe that during the process of synthesis and formation of double strands, the sense strand and antisense strand of the recognition gene can use the inherent Argonaute-2-dependent pathway of mammalian cells to initiate the transcriptional activation complex on the seed sequence of the target gene so that Messenger RNA is de novo transcribed. These saRNAs provide a clinically safe and reliable way to arrest or reverse disease progression as a potential non-pharmaceutical molecular target. saRNA can be used as the most powerful biological tool to enhance the expression of the target gene at the transcriptional level. Past studies have demonstrated that such double-stranded saRNA can be synthesized after optimizing the target gene target and serve as an appropriate tool to obtain many expected biological effects. Based on this, prior art designs synthetic double-stranded saRNA to activate the important liver-enriched transcription factor CEBPA. This transcription factor is thought to be repressed in liver disease. In animal models of liver cirrhosis/hepatocellular carcinoma, reactivation of CEBPA expression can significantly improve liver function and reduce tumor burden. Like enhancing CEBPA expression in liver disease models, C/EBPa-saRNA was also applied in a phase I multicenter clinical trial drug (MTL-CEBPA) for patients with advanced liver cancer.

Among transcription factors, the CCAAT/enhancer-binding protein family is involved in many cellular processes such as cell proliferation, metabolism, differentiation and immune response. The first discovered member of this family is C/EBPa, which is enriched in liver tissue, adipose tissue and hematopoietic system. It can inhibit p21, E2F and CDK2/4 signaling pathways, and has good anti-mitotic function, so it is generally considered as a tumor suppressor gene. In the liver, C/EBPa regulates differentiation of mature hepatocytes and maintains metabolic homeostasis and homeostasis. Since HCC patients are often accompanied by poor liver function, this makes CEBPA a very attractive gene up-regulation target in advanced HCC. Because studies have shown that the sensitivity of CEBPA gene knock-in to HCC is reduced in the mouse model, and the expression of CEBPA in the tumor tissue of the rat model is reduced. A retrospective analysis of a human hepatocellular carcinoma sample demonstrated the downregulation of C/EBPa in HCC, which is closely related to the poor prognosis and survival rate of HCC. In addition, other functional studies of C/EBPα have also confirmed that it plays a vital role in the regulation of hepatic glucose and fat homeostasis and its anti-hepatic fibrosis properties. This makes CEBPA a unique target for the improvement of multiple liver diseases, including liver fibrosis, cirrhosis, nonalcoholic fatty liver disease, steatohepatitis, and HCC, among others.

RNA interference (RNAi)-based oligonucleotide therapeutics have enormous therapeutic potential in human diseases. RNA interference (RNAi, RNA interference) refers to the introduction of double-stranded RNA (dsRNA) composed of sense RNA and antisense RNA corresponding to the mRNA into cells, which can specifically degrade the mRNA and cause its corresponding gene to be silenced. Phenomenon. RNAi technology can be divided into two mechanisms: siRNA and miRNA. Double-stranded RNA (dsRNA)-induced RNA interference (RNAi) is a process of sequence-specific post-transcriptional gene silencing. This type of dsRNA is sequence homologous to the messenger transcript. Synthetic small interfering RNA (siRNA) may play a role in developing post-transcriptional genetic screening (PTGS) in mammalian cells in humans. Applications of RNA interference (RNAi)-based technologies now range from genetic research to sequence-specific therapeutics. Small interfering RNA (Small interfering RNA, siRNA), sometimes called short interfering RNA (short interfering RNA) or silencing RNA (silencing RNA), is a double-stranded RNA about 20 to 25 nucleotides in length. Gene silencing caused by siRNA-mediated RNAi is an important way of gene expression regulation. Argonaute (AGO) protein binds into a silencing complex (RNA-induced silencing complex, RISC), siRNA unwinds, its sense strand is sheared and degraded, and RISC bound to the antisense strand is activated, specifically binds to the target mRNA and releases it Cutting off triggers the specific degradation of the target mRNA, hinders the translation of a specific gene and inhibits the expression of the gene to achieve the effect of treating diseases. siRNA is a negatively charged biologically active macromolecule, which does not have the ability to target tissues or cells. its physiological function. Therefore, the delivery system of siRNA is the most critical factor restricting the development of siRNA drugs.

saRNA is a powerful biological tool to enhance the expression of target genes at the transcriptional level. Previous studies have proved that double-stranded saRNA can be synthesized after the optimal target, and can be used as a unique way to obtain many desired biological effects. We found that saRNAs targeting the pancreatic b-cell transcription factor MAFA significantly shortened the transdifferentiation time of mature hematopoietic stem cells CD34+ to an insulin-secreting phenotype sensitive to changes in glucose gradients and greatly enhanced their maturation. This indicates that synthetic saRNA undoubtedly expands the application range of this technology in gene recombination for regenerative medicine, providing a clinically safe and effective option. Studies in related fields have found that C/EBPa-saRNA can recognize an oligonucleotide sequence, and obtain a 2-fold enhanced CEBPAmRNA expression after transfection of the human liver cancer cell line HepG2. At the same time, the up-regulated CEBPA mRNA can also enhance the expression of albumin (album) by 2 times, which is also consistent with the effect of CEBPA on liver function. This saRNA was used in a mouse model of diethylnitrosamine (DEN)-induced spontaneous liver cancer. C/EBPa-saRNA-dendrimer was established using polyamide (PAMAM) dendrimers and injected into diethylnitrosamine (DEN)-treated mice via tail vein. It was subsequently found that the tumor burden in the treatment group was significantly lower than that in the control group. At the same time, the level of serum albumin increased significantly, and the levels of serum bilirubin, aspartate aminotransferase (AST) and alanine aminotransferase (ALT) decreased significantly. Quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis of liver tissues from treated mice confirmed that saRNA-induced upregulation of mRNA expression levels of CEBPA and albumin as well as important hepatocyte markers (HNF1α and HNF4α). At the same time, proteomic analysis on four liver cancer cell organelles (HepG2, Hep3B, PLC/PRF5, SNU475) also confirmed that up-regulation of CEBPA can improve cell metabolism and liver biological function by activating several cell signal transduction pathways. Based on previous studies, we confirmed that C/EBPa can be used as a tumor suppressor gene and a regulator of liver cell function. This also provides a solid foundation for the further development of C/EBPa-saRNA for clinical use.

The gene encoding WAF1, also known as p21, is transcriptionally regulated by the inhibitory protein p53. Overexpression of WAF1 inhibits tumor growth, possibly by inhibiting the activity of cyclin/CDK complex. One consequence of the binding of WAF1 to the cyclin/CDK complex is the inhibition of Rb protein phosphorylation. Induction of WAF1 expression requires wild-type p53 activity in p53-dependent G1-repressed or apoptotic cells. Mutations in the p53 gene, a common event in human cancers, result in the inability to produce WAF1. The result can be uncontrolled cell proliferation.

Studies have shown that: p21 is related to tumor differentiation, invasion depth, proliferation and metastasis, and has the value of judging prognosis. Not only does it have a direct effect on cells, but it may control several other genes involved in decay and disease. In addition, the p21 gene interferes with more than 40 genes related to deoxyribose replication and cell division. The p21 gene also has a role in promoting the activity of about 50 other genes. Many of these genes control the formation of proteins that either prevent surrounding cells from dying or stimulate their growth. This may mean that the p21 gene is also related to cancer.

Argonaute protein

The first reports of activating RNAs have been published for more than 10 years, and the accumulated research working during this time has revealed the mechanism of saRNA activation, highlighted important components related to the action of saRNAs, and illustrated the possible association of saRNA molecules with various proteins. interaction. These include programming a variety of RNA-binding enzymes, and the currently recognized main mechanism of action includes the association of saRNA with the Argonaute (Ago) protein family.

RNA interference and all gene expression silencing mechanisms mediated by small RNA molecules have a common feature, that is, there will be a small RNA molecule responsible for silencing (hereinafter referred to as the guide strand) that interacts with Argonaute family proteins effect. This RNA-Argonaute protein complex constitutes the most basic and core effector element in the RISC complex. In the RISC complex, small RNA molecules play the role of guiding Argonaute proteins to bind to target molecules in a sequence-specific manner through the principle of complementary base pairing. After these target molecules of mRNA are recognized by Argonaute proteins, they will be cleaved or inhibited from translation, and finally degraded by cells.

Argonaute proteins have evolved into various subfamily proteins in the course of evolution. These subfamily proteins can recognize various different types of small RNA molecules and thus play a role in various small RNA silencing pathways. Both siRNA and miRNA can bind to Argonaute subfamily AGO protein, but piRNA can bind to Argonaute subfamily PIWI protein. In the classic RNAi pathway mediated by siRNA molecules, Argonaute proteins can use endonuclease activity to silence mRNA targets, a process called cleavage. In germ cells, in the face of various foreign genetic materials, the Argonaute subfamily protein PIWI protein also uses the cutting mechanism in the piRNA-mediated RNA silencing pathway. During the cleavage reaction, the target RNA molecule is mainly cleaved at the phosphate group, which is mainly the site corresponding to the phosphate group at the 10th and 11th bases from the 5' end of the guide strand. The cleavage reaction will only work if the guide and target strands are perfectly complementary at the cleavage site. Argonaute proteins can also silence RNA independently of cleavage reactions. In the miRNA silencing pathway of animal cells, Argonaute protein can achieve gene silencing by inhibiting the translation of the target mRNA and inducing the degradation of the target mRNA after deadenylation. However, the precise mechanism of miRNA-mediated gene silencing is still not very clear.

Like RNAi, RNAa also requires the participation of Argonaute (Ago) protein, especially Ago2, to process and activate saRNA molecules, and mediate the binding of saRNA to its target sites on its promoter. The double-stranded saRNA is loaded into the Argonaute2 (Ago2) protein, and one of the strands is cut from the middle by Ago2 and falls off from the Ago2 complex; then the Ago2 complex enters the nucleus through an active transport mechanism, and RNA helicase A (RNA helicase A, RHA) forms the Ago2-RHA complex, and the guide strand in the complex finds and binds to its complementary gene sequence, recruiting polymerase-associated factor 1 (polymerase-associated factor 1, PAF1) to form RITA (RNA-induced transcriptional activation, RNA-mediated transcription activation) complex, which further recruits and activates RNApolymerase II (RNA polymerase II), resulting in an increase in mRNA expression.

As an effector molecule in the small RNA-mediated gene silencing pathway, the Argonaute protein must be able to accurately recognize and bind to the guide strand of the small RNA when it binds to the siRNA double-strand or miRNA-miRNA double-strand molecule, and removes non-functional entourage strand and miRNA* strand, and then find the target RNA according to the guidance of the guide strand. Argonaute proteins are recycled multiple times in silencing pathways that require RNA cleavage machinery. During the cycle of Argonaute protein recognition of target molecules, cleavage reaction, and product release, the guide strand continues to bind to the Argonaute protein and will not detach. In the miRNA silencing pathway of multicellular animals, the cleavage mechanism works in a form that does not require a "cutter" (slicer-independent manner). At this time, the Argonaute protein needs to be tightly combined with the target mRNA molecule, so that it can prevent its translation.

Argonaute proteins are multi-domain proteins that contain an N-terminal domain, a PAZ domain, a MID domain and a PIWI domain. The crystal structure of prokaryotic Argonaute proteins shows a bilobate structure. The MID domain and the PIWI domain form one lobe, while the N-terminal domain and the PAZ domain form the other lobe. The folding of the PAZ domain is similar to that of the oligosaccharide/oligonucleotide-binding-fold domain and the Sm-fold domain. The MID and PIWI domains are joined by a well-conserved site in the center of the C-terminus of the covered Argonaute protein. The MID domain is similar to the sugar-binding domain in the lac repressor. The folding mode of the PIWI domain is similar to that of RNaseH, an endoribonuclease that cleaves RNA-DNA hybrid molecules. Biochemical studies have shown that the Argonaute protein of prokaryotes, like RNaseH, can play the role of DNA-guided ribonuclease (DNA-guided ribonuclease), while the Argonaute protein of eukaryotes has RNA-guided ribonuclease (RNA-guided ribonuclease). )effect.

Argonaute protein is the core mechanism in the process of small RNA-induced gene regulation and is the main member of the RISCs complex. They have been characterized since they were first identified in Arabidopsis. Argonautes are approximately 100kDa in size and have double lobes. Argonaute (AGO): AGO protein mainly contains two structural domains: PAZ and PIWI. The PAZ region can non-sequence-specifically recognize and bind to the 2 nucleotides at the 3' end of the double-stranded small RNA, thereby binding to siRNA The 3' dinucleotide overhang; the PIWI region has a catalytic center for cutting mRNA, and the PIWI domain of some AGO proteins endows the slicer with endonuclease activity. The two domains of PAZ and PIWI play a role in the interaction between siRNA and target mRNA, resulting in the cleavage or translation inhibition of the target mRNA. Meanwhile, different Ago proteins have different biological functions. AGO protein also includes an amino terminus (N-terminus), which is necessary for small RNA binding and participates in the unwinding of small RNAs. The degradation of the PAZ domain, which protects the guide strand from damage, produces a specific binding pocket that can recognize and bind the first nucleotide at the 5′ end of the miRNA. There are four variants of the AGO family in humans, AGO1, AGO2, AGO3 and AGO4. Different Ago proteins have different biological functions. Among them, Ago2 is involved in the cleavage process of target mRNA by RISCS and plays an important role; while Ago1 and Ago3 do not have this function.

The relationship and difference between SaRNA and siRNA

The function of saRNA to up-regulate gene expression is completely opposite to the effect of siRNA interference and inhibition of gene expression. However, the two have certain similarities: saRNA consists of 21 pairs of nucleotides and has a similar structure to siRNA targeting mRNA sequences. Moreover, both of them need the same enzyme component to participate in the modification function, that is, Ago. However, saRNA activation was more persistent than siRNA. Place et al. found that, compared with the siRNA-mediated RNA inhibition effect, the saRNA-mediated RNA activation response was delayed by more than 24 hours, up to 48 hours. In addition, saRNA has specificity for different cells, and its effect may be different. This also shows that the mechanism of RNA activation is more complicated. Its optimal window period is 3-7 days, and its activity is usually longer than that of siRNA, which is related to the process that saRNA needs to enter the nucleus to participate in transcription regulation.

p21-saRNA can specifically activate the expression of p21 gene, it is an effective means to up-regulate the expression of p21 in tumor cells, and has a promising application prospect in gene therapy. Studies have shown that the up-regulation of p21 can inhibit cell proliferation. In addition, the loss of expression of cyclin-dependent kinase inhibitor p21 is related to drug resistance in many in vitro molecular models, and the low expression of p21 is related to drug resistance of cells. p21-saRNA can up-regulate target genes in a variety of cells, showing that the saRNA mechanism is ubiquitous in cells, which provides the possibility for further gene therapy development. The decrease in the expression of key proteins is often the main cause of many diseases, and saRNA technology brings a feasible way to restore the expression of these proteins in cells.

SaRNA also faces problems including immunogenicity, off-target, and appropriate delivery methods. SaRNA can be stably constructed in plasmids and viral vectors with the help of vector construction strategies, so as to achieve long-term and high-efficiency expression that cannot be achieved by direct chemical synthesis, and the cycle is short and the cost is low. Of course, saRNA also has its disadvantages, such as the need to screen the target, only activate the background phenotype of the cell, and cannot express the mutant type, etc. However, saRNA has broad development prospects for the treatment of diseases caused by single gene downregulation.

However, an effective delivery system has always been a bottleneck that hinders the development of small nucleic acid therapeutic drugs to the clinic. After confirming the therapeutic effect of the small double-stranded RNA (p21-saRNA-322) with a special sequence on intestinal cancer, the construction of a drug delivery system for p21-saRNA-322 was also studied. Some studies have used the physiological and pathological characteristics of intestinal cancer to create a small nucleic acid delivery system with a special putamen structure-bioadhesive lipid polymer complex. The developed delivery system consists of bioadhesive and tumor The targeting shell is combined with the inner core sensitive to the tumor internal environment.

In the past few decades, DNA nanomaterials have attracted increasing attention due to their unparalleled programmability and multifunctionality. In particular, DNA dendritic macromolecular nanostructures, as their main research focus, have been applied in the fields of biosensing, therapeutics, and protein engineering thanks to their highly branched configurations. With the aid of specific recognition probes and intrinsic signal amplification, DNA dendrimers can achieve ultrasensitive detection of nucleic acids, proteins, cells, and other substances such as lipopolysaccharide (LPS), adenosine triphosphate (ATP), and exosomes. With their interstitial structure and biocompatibility, DNA dendrimers can deliver drugs or functional nucleic acids into target cells in chemotherapy, immunotherapy, and gene therapy. Furthermore, DNA dendrimers are being used in protein engineering to efficiently guide protein evolution. This review summarizes the main research progress of DNA dendrimers, concerning their assembly methods and biomedical applications, as well as new challenges and perspectives for future research. With the in-depth study of the mechanism of tumorigenesis, researchers have found that the occurrence and development of tumors are the result of the combined effects of various factors or pathways, and conventional single chemical drug treatment can only solve one aspect of the problem. , resulting in limited therapeutic efficacy. Combination therapy for tumors refers to the combination of two or more therapeutic methods to inhibit the growth of tumor cells through different mechanisms of action, thereby improving the therapeutic effect of tumors. Early combined treatments include chemotherapy and radiotherapy, chemotherapy and photothermal therapy, and so on.

In recent years, the co-delivery of chemotherapeutic drugs and genes for cancer therapy has become a research hotspot at home and abroad. Chemotherapeutic drugs and genes have different mechanisms for inhibiting tumor cells. On the one hand, the addition of therapeutic genes can greatly reduce the amount of chemotherapeutic drugs used, thereby reducing toxic and side effects, and avoiding multidrug resistance of tumor cells; on the other hand, some studies have shown that chemotherapeutic drugs The use of can effectively improve the expression of genes in cells and enhance the curative effect of therapeutic genes. Therefore, the combined use of drugs and genes can promote and complement each other, and ultimately achieve the purpose of reducing toxic side effects and improving therapeutic effects. However, the biggest challenge in the co-delivery of chemotherapeutic drugs and genes for tumor combination therapy is the synthesis of safe and efficient carrier materials.

Contents of the invention

The present invention provides compositions, methods and kits for modulating the expression and/or function of the CEBPA gene for therapeutic purposes. These compositions, methods and kits comprise nucleic acid constructs targeting CEBPA gene, CEBPB gene, p21 gene, CTR9 gene, DDX3 gene, DDX5 gene or hnRNPA2/B1 gene or the like. Wherein the nucleic acid construct may comprise single or double stranded DNA or RNA with or without modification.

Specifically, the application provides a composition containing C/EBPa-saRNA, which can regulate the expression and/or function of the CEBPA gene in tumor cells, or regulate the expression of the downstream key role protein gene of C/EBPa. application in the treatment of tumors.

The present application also provides the application of the saRNA or siRNA composition containing C/EBPa-saDNA and the downstream key function protein gene of C/EBPa in the preparation of a drug for treating tumors. The composition of the C/EBPa-saDNA and the saRNA or siRNA of the downstream key function protein gene of C/EBPa up-regulates the expression of CEBPA in tumor cells.

The present application also provides an application of a C/EBPa-saRNA composition in preparing a drug for up-regulating CEBPA gene in cells.

Preferably, the cells are cancer cells; preferably, the cancer cells are HCC cells, prostate cancer lines or breast cancer cell lines, further preferably, the cells are hepatocellular carcinoma (HCC) cells.

In some embodiments, the cell is a HepG2, Hep3B, PLC/PRF/5, DU-145 or MCF-7 cell;

In one of the embodiments, the cells are differentiated hepatocellular carcinoma (HCC) cells; preferably, the cells are HepG2, Hep3B cells.

Another object of the present application is to provide an application of a C/EBPa-saRNA composition in the preparation of a drug that up-regulates the expression of p21 in cells; in one of the embodiments, the cells are cancer cells; preferably, The cells are hepatocellular carcinoma (HCC) cells, such as HepG2, Hep3B; further, the cells are differentiated hepatocellular carcinoma (HCC) cells; more preferably, the cells are HepG2 cells.

Another object of the present application is to provide an application of a C/EBPa-saRNA composition in the preparation of a drug for up-regulating the expression of albumin in cells. In one of the embodiments, the cells are cancer cells; preferably, the cells are hepatocellular carcinoma (HCC) cells, such as HepG2, Hep3B cells; further, the cells are differentiated hepatocellular carcinoma (HCC) ) cells; more preferably, said cells are HepG2 cells.

Another object of the present application is to provide an application of a composition of C/EBPa-saRNA in the preparation of a drug for reducing the recurrence rate of HCC.

Another object of the present application is to provide an application of a C/EBPa-saRNA composition in the preparation of anti-cell proliferation drugs. In one of the embodiments, the cells are differentiated HCC cell lines, such as HepG2, Hep3B; preferably HepG2 cell lines. In another embodiment, the cell is an undifferentiated HCC cell line, preferably a PLC/PRF/5 cell line.

Another object of the present application is to provide an application of a composition of C/EBPa-saRNA in the preparation of a medicament for improving liver function by enhancing albumin.

In another aspect, the present invention provides an application of a composition comprising C/EBPα-saDNA and C/EBPβ-siRNA in the preparation of a drug for treating tumors.

The present invention also studies the nucleic acid constructs of the CTR9 gene, DDX3 or DDX5 gene, or hnRNPA2/B1 gene, etc., which have regulatory effects on the downstream proteins of C/EBPa.

C/EBPa-saRNA can up-regulate CEBPA gene. In one embodiment, it is designed to be complementary to a target antisense RNA transcript of the CEBPA gene, and it can have an effect on CEBPA gene expression and/or act by downregulating the target antisense RNA transcript. "Complementary" in this context means capable of hybridizing under stringent conditions to a target antisense RNA transcript. When used to describe nucleic acid sequences in the context of the present invention, the term "sense" means that the sequence is identical to the sequence on the coding strand of a gene. The term "antisense" when used to describe a nucleic acid sequence in the context of the present invention means that the sequence is complementary to that on the coding strand of a gene. It should be noted that the thymidine of DNA is replaced by uridine in RNA and this difference still falls within the understanding of the terms "antisense" or "complementarity".

The target antisense RNA transcript can be up to 100, 80, 60, 40, 20 or 10 kb upstream of the corresponding position of the transcription start site (TSS) of the target gene on the coding strand and the corresponding position of the transcription termination site of the target gene Loci between 100, 80, 60, 40, 20 or 10 kb downstream were transcribed. In one embodiment, the target antisense RNA transcript can be transcribed from a locus on the coding strand that is within +/- 1 kb of the transcription start site of the target gene. In another embodiment, the target antisense RNA transcript can be transcribed from a locus on the coding strand that is within +/- 500, +/- 250, or +/- 100 bp of the target gene's transcription start site. In another embodiment, the target antisense RNA transcript can be transcribed from a locus on the coding strand that is within +/- 2000 nucleotides of the transcription start site of the target gene. In another embodiment, the locus on the coding strand is no more than 1000 nucleotides upstream or downstream from a position corresponding to the transcription start site of the target gene. In another embodiment, the locus on the coding strand is no more than 500 nucleotides upstream or downstream from a position corresponding to the transcription start site of the target gene.

The term "transcription start site" (TSS) as used herein means a nucleotide on the template strand of a gene that corresponds to or marks the location of the start of transcription. The TSS can be located within a promoter region on the template strand of a gene.

The term "transcription termination site" as used herein means a region on the template strand of a gene, which may be one or more nucleotides, which has at least one characteristic, such as but not limited to: encoding a target transcription A region encoding at least one stop codon of the target transcript, a region encoding a sequence preceding the 3' UTR of the target transcript, a region where RNA polymerase releases the gene, a region encoding a splice site or a region preceding a splice site and a region in the template The region on the strand where transcription of the target transcript terminates.

The term "transcribed from a specific locus" in the context of the target antisense RNA transcript of the present invention means that transcription of the target antisense RNA transcript begins at a specific locus.

The target antisense RNA transcript is complementary to the coding strand of the genomic sequence of the target gene, and anytime herein reference to "genomic sequence" is shorthand for "the coding strand of the genomic sequence". The "coding strand" of a gene has the same base sequence as the mRNA produced, with the exception that the T is replaced by a U in the mRNA. The "template strand" of the gene is thus complementary to and antiparallel to the resulting mRNA. Thus, the target antisense RNA transcript may comprise a protein that is located 100, 80, 60, 40, 20, or 10 kb upstream of the transcription start site of the target gene to 100, 80, 60, 40, 20, or 10 kb downstream of the transcription termination site of the target gene. Complementary sequences between genomic sequences. In one embodiment, the target antisense RNA transcript comprises a sequence complementary to a genomic sequence located between 1 kb upstream of the target gene transcription start site and 1 kb downstream of the target gene transcription stop site. In another embodiment, the target antisense RNA transcript comprises a protein that is located 500, 250, or 100 nucleotides upstream of the transcription start site of the target gene to 500, 250, or 100 nucleotides downstream of the transcription termination site of the target gene. Complementary sequences between genomic sequences.

The target antisense RNA transcript may comprise a sequence complementary to a genomic sequence comprising the coding region of the CEBPA gene. The target antisense RNA transcript may comprise a sequence complementary to the genomic sequence aligned to the promoter region of the target gene on the template strand. A gene can possess multiple promoter regions, in which case the target antisense RNA transcript can align with one, two or more promoter regions. An online database of annotated gene loci can be used to identify gene promoter regions. When used in the context of a pair of nucleotide sequences, the term "aligned" means that the pair of nucleotide sequences are complementary to each other or have sequence identity to each other.

The alignment region between the target antisense RNA transcript and the target gene promoter region can be partial and can be as short as a single nucleotide in length. However, it may be at least 15 or at least 20 nucleotides in length, or at least 25 nucleotides in length, or at least 30, 35, 40, 45 or 50 nucleotides in length, or at least 55, 60, 65, 70 or 75 nucleotides in length, or at least 100 nucleotides in length. Each of the following specific arrangements is intended to fall within the scope of the term "alignment":

a) The target antisense RNA transcript and the target gene promoter region are identical in length and they are aligned (ie they are aligned over their entire length).

b) The target antisense RNA transcript is shorter than and aligns with the target gene promoter region throughout its length (ie it aligns with sequences inside the target gene promoter region throughout its length).

c) The target antisense RNA transcript is longer than and fully aligned with the target gene promoter region (ie, the target gene promoter region is aligned with the sequence within the target antisense RNA transcript throughout its entire length).

d) The target antisense RNA transcript and the target gene promoter region are of the same or different lengths and the aligned region is shorter than the length of the target antisense RNA transcript and the target gene promoter region. In one embodiment, the target antisense RNA transcript is at least 1 kb, or at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 kb, eg, 20, 25, 30, 35 or 40 kb in length. In one embodiment, the target antisense RNA transcript comprises a sequence that is at least 75%, or at least 85%, or at least 90%, or at least 95% complementary along its entire length to sequence on the coding strand of the target gene.

The present invention provides saRNAs that target target antisense RNA transcripts and can effectively and specifically downregulate such target antisense RNA transcripts. This can be achieved by saRNAs with a high degree of complementarity to regions within the target antisense RNA transcript. The saRNA will have no more than 5, or no more than 4 or 3, or no more than 2, or no more than 1 mismatches with the region to be targeted within the target antisense RNA transcript or with no mismatch. The antisense strand of the saRNA (whether single-stranded or double-stranded) can be at least 80%, 90%, 95%, 98%, 99% or 100% identical to the reverse complement of the targeted sequence. Thus, the reverse complement of the antisense strand of the saRNA has a high degree of sequence identity to the sequence being targeted. The targeted sequence may be of the same length, ie, the same number of nucleotides, as the reverse complement of the saRNA and/or siRNA. In some embodiments, the targeted sequence comprises at least 14 and less than 30 nucleotides. In some embodiments, the targeted sequence has 19, 20, 21, 22 or 23 nucleotides. In some embodiments, the location of the targeted sequence is within the promoter region of the template strand.

In some embodiments, the targeted sequence is located within the TSS (transcription start site) core of the template strand. In some embodiments, the targeting sequence is located between 1000 nucleotides upstream and 1000 nucleotides downstream of the TSS. In some embodiments, the targeting sequence is located between 500 nucleotides upstream and 500 nucleotides downstream of the TSS. In some embodiments, the targeting sequence is located between 250 nucleotides upstream and 250 nucleotides downstream of the TSS. In some embodiments, the targeting sequence is located between 100 nucleotides upstream and 100 nucleotides downstream of the TSS. In some embodiments, the targeting sequence is located upstream of the TSS within the TSS core. The targeted sequence can be less than 2000, less than 1000, less than 500, less than 250, or less than 100 nucleotides upstream of the TSS. In some embodiments, the targeting sequence is located downstream of the TSS in the TSS core. The targeted sequence can be less than 2000, less than 1000, less than 500, less than 250, or less than 100 nucleotides downstream of the TSS. In some embodiments, the targeting sequence is located +/- 50 nucleotides around the TSS of the TSS core. In some embodiments, the targeting sequence substantially overlaps the TSS of the TSS core. In some embodiments, targeting sequence overlap begins or ends at the TSS of the TSS core. In some embodiments, the targeted sequence overlaps 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 in the upstream or downstream direction of the TSS of the TSS core , 16, 17, 18 or 19 nucleotides.

The position of the targeting sequence on the template strand is defined by the position of the 5' end of the targeting sequence. The 5' end of the targeting sequence can be at any position in the TSS core and the targeting sequence can start at any position selected from position 1 to position 4001 of the TSS core. For reference herein, a targeting sequence is considered upstream of the TSS when the 5'-most end of the targeting sequence is from position 1 to position 2000 of the TSS core, and when the 5'-most end of the targeted sequence is from position 2002 to position 2000 of the TSS core. At 4001, the targeted sequence is considered to be downstream of the TSS. When the 5'-most end of the targeted sequence is at nucleotide 2001, the targeted sequence is considered to be the TSS central sequence and neither upstream nor downstream of the TSS. For further reference, for example, when the 5' end of the targeted sequence is at position 1600 of the TSS core, i.e., it is the 1600th nucleotide of the TSS core, then the targeted sequence begins at position 1600 of the TSS core and Consider it upstream of the TSS.

In one embodiment, a saRNA of the invention may have two strands forming a duplex, one strand being the guide strand. saRNA duplexes are also referred to as double-stranded saRNA. A double-stranded saRNA, or saRNA duplex, as used herein, is a saRNA comprising more than one, and preferably two, strands, wherein interstrand hybridization can form regions of a duplex structure. The two strands of a double-stranded saRNA are called the antisense or guide strand and the sense or passenger strand. The antisense strand of the saRNA duplex (used interchangeably with antisense strand saRNA or antisense saRNA) has a high degree of complementarity to a region within the target antisense RNA transcript. The antisense strand may have no more than 5, or no more than 4 or 3, or no more than 2, or no more than 1 mismatches with the region within the target antisense RNA transcript or targeted sequence or no mismatch with it. Therefore, the antisense strand has a high degree of complementarity to the targeting sequence on the template strand. The sense strand of the saRNA duplex (used interchangeably with sense strand saRNA or sense saRNA) has a high degree of sequence identity to the targeting sequence on the template strand. In some embodiments, the targeted sequence is located within the promoter region of the template strand. In some embodiments, the targeted sequence is located within the TSS core of the template strand. The position of the antisense and/or sense strand of the saRNA duplex is determined relative to the targeted sequence by reference to the TSS core sequence. For example, antisense saRNA and sense saRNA start downstream of the TSS when the targeted sequence is downstream of the TSS. In another example, when the targeted sequence begins at position 200 of the TSS core, the antisense saRNA and sense saRNA begin upstream of the TSS.

"Strand" in the context of the present invention means a contiguous sequence of nucleotides (including non-naturally occurring or modified nucleotides). The two or more chains may be separate molecules or each form part of a separate molecule, or they may be covalently linked, for example, via a linker such as a polyethylene glycol linker. At least one strand of the saRNA can comprise a region that is complementary to the target antisense RNA. This strand is called the antisense or guide strand of the saRNA duplex. The second strand of a saRNA that contains a region that is complementary to the antisense strand of the saRNA is called the sense or passenger strand.

A saRNA duplex can also be formed from a single molecule that is at least partially self-complementary, forming a hairpin structure, including the duplex region. In this context, the term "strand" refers to one of the saRNA regions that is complementary to another internal region of the saRNA. The guide strand of the saRNA will have no more than 5, or no more than 4 or 3, or no more than 2, or no more than 1, or no mismatches with the sequence within the target antisense RNA transcript. mismatch.

In one embodiment, saRNA duplexes can demonstrate efficacy in proliferating cells. The saRNA duplex can have siRNA-like complementarity to a region of the target antisense RNA transcript; that is, between nucleotides 2-6 from the 5' end of the guide strand in the RNA duplex to the region of the target antisense RNA transcript. 100% complementarity between. Additionally, the other nucleotides of the saRNA may be at least 80%, 90%, 95%, 98%, 99%, or 100% complementary to a region of the target antisense RNA transcript. For example, the nucleotides of the saRNA (counted from the 5' end) up to the 3' end can be at least 80%, 90%, 95%, 98%, 99%, or 100% complementary to a region of the target antisense RNA transcript.

The term "small interfering RNA" or "siRNA" in this context means a double-stranded RNA, generally 20-25 nucleotides in length, that participates in the RNA interference (RNAi) pathway and interferes with or inhibits the expression of a specific gene. This gene is the target gene of siRNA. For example, siRNA that interferes with the expression of APOA1 gene is called "APOA1-siRNA" and APOA1 gene is the target gene. siRNAs are typically about 21 nucleotides in length, with 3' overhangs (eg, 2 nucleotides) at each end of both strands.

siRNA inhibits target gene expression by binding to one or more RNA transcripts of the target gene at specific sequences and promoting cleavage of the transcript. Typically, in RNAi, the RNA transcript is mRNA, whereby cleavage of the mRNA results in downregulation of gene expression. In the present invention, without intending to be bound by any theory, one of the possible mechanisms is that the saRNA of the present invention can regulate target gene expression by cleaving target antisense RNA transcripts.

A double-stranded saRNA can comprise one or more single-stranded nucleotide overhangs. In the context of double-stranded saRNA and siRNA, the term "overhang" or "tail" refers to at least one unpaired nucleotide protruding from the duplex structure of the saRNA or siRNA. For example, a nucleotide overhang exists when the 3'-end of one strand of the saRNA extends beyond the 5'-end of the other strand, or vice versa. The saRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 or more nucleotides. Nucleotide overhangs may comprise or consist of nucleotide/nucleoside analogs, including deoxynucleotides/nucleosides. The overhang can be on the sense strand, the antisense strand, or any combination thereof. In addition, the nucleotides of the overhang may be present on the 5' end, the 3' end, or both ends of the antisense or sense strand of the saRNA. Where two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered a mismatch for purposes of determining complementarity. For example, a saRNA comprising one oligonucleotide that is 19 nucleotides in length and another oligonucleotide that is 21 nucleotides in length (where the longer oligonucleotide A sequence of 19 nucleotides that is completely complementary to a shorter oligonucleotide) is referred to as "fully complementary".

In one embodiment, the antisense strand of the double-stranded saRNA has an overhang of 1-10 nucleotides at the 3' end and/or the 5' end. In one embodiment, the antisense strand of the double stranded saRNA has a 1-4 nucleotide overhang at its 3' end or a 1-2 nucleotide overhang at its 3' end. In one embodiment, the sense strand of the double-stranded saRNA has an overhang of 1-10 nucleotides at the 3' end and/or the 5' end. In one embodiment, the sense strand of the double stranded saRNA has a 1-4 nucleotide overhang at its 3' end or a 1-2 nucleotide overhang at its 3' end. In one embodiment, both the sense and antisense strands of the double-stranded saRNA have 3' overhangs. The 3' overhang may comprise one or more uracils, for example, the sequence UU or UUU. In one embodiment, one or more nucleotides in the overhang are replaced by phosphorothioate nucleosides, wherein the internucleoside linkage is a phosphorothioate linkage. In one embodiment, the overhang comprises one or more deoxyribonucleosides, eg, the sequence dTdT or dTdTdT. In one embodiment, the overhang comprises the sequence dT*dT, where * is a phosphorothioate linked internucleoside linkage.

The saRNAs of the invention may alternatively be defined by reference to a target gene. The target antisense RNA transcript is complementary to the genomic region on the coding strand of the target gene, and the saRNA of the present invention is in turn complementary to the region of the target antisense RNA transcript, so that the saRNA of the present invention can be defined as being complementary to the region on the coding strand of the target gene. Regions have sequence identity. All features discussed herein for the definition of saRNA of the invention by reference to the target antisense RNA transcript apply mutatis mutandis to the definition of saRNA of the invention by reference to the target gene such that any Discussions of RNA transcript complementarity are understood to include identity to the genomic sequence of the target gene. Thus, the saRNA of the invention preferably has a high percent identity, eg, at least 80%, 90%, 95%, 98% or 99% or 100% identity to the genomic sequence on the target gene. The genomic sequence can be up to 2000, 1000, 500, 250 or 100 nucleotides upstream or downstream of the transcription start site of the target gene. It can be aligned with the promoter region of the target gene. Thus, the saRNA may have sequence identity to a sequence that aligns with the promoter region of the target gene.

In one embodiment, it is not necessary to determine the presence of a target antisense RNA transcript in order to design a saRNA of the invention. In other words, the design of saRNA does not require identification of the target antisense RNA transcript. For example, the nucleotide sequence of the TSS core can be obtained from the genome sequence of the coding strand of the target gene, by sequencing or by searching in a database, that is, 2000 nucleotides upstream of the transcription initiation site of the target gene to the transcription initiation site of the target gene Sequences in the downstream 2000 nucleotide region. Targeting sequences within the TSS core starting anywhere on the template strand from position 1 to position 4001 of the TSS core can be selected and can then be used to design saRNA sequences. As discussed above, saRNAs have a high degree of sequence identity to the reverse complement of the targeted sequence.

The number of off-target hits, 0-mismatch (0 mm) hits, and 1-mismatch (1 mm) hits for saRNA sequences in the genome-wide genome was then determined. The term "number of off-target hits" refers to the number of other sites in the whole genome that are identical to the targeted sequence of the saRNA on the template strand of the target gene. The term "0 mm hits" refers to the number of protein-coding transcripts known to a saRNA that can hybridize or bind to its complement with 0 mismatches, other than the target transcript of the saRNA. In other words, "0 mm hits" counts the number of protein-coding transcripts known to contain the exact same region as the saRNA sequence in addition to the saRNA's target transcript. The term "1 mm hits" refers to the number of known protein-coding transcripts other than the saRNA's target transcript that can hybridize or bind to its complement with 1 mismatch. In other words, "1 mm hits" counts the number of protein-coding transcripts that contain a region identical to the saRNA sequence with only 1 mismatch, known in addition to the saRNA's target transcript. In one embodiment, only saRNA sequences with no off-target hits, no 0 mm hits and no 1 mm hits are selected. For those saRNA sequences disclosed in this application, each had no off-target hits, no 0 mm hits, and no 1 mm hits.

In some embodiments, saRNAs of the invention can be single-stranded or double-stranded. Double-stranded molecules comprise a first strand and a second strand. If double stranded, each strand of the duplex may be at least 14, or at least 18, eg 19, 20, 21 or 22 nucleotides long. The duplexes may hybridize over a length of at least 12, or at least 15, or at least 17, or at least 19 nucleotides. Each strand can be exactly 19 nucleotides in length. Preferably, the saRNA is less than 30 nucleotides in length, as oligonucleotide duplexes longer than this may have an increased risk of inducing an interferon response. In one embodiment, the saRNA is 19 to 25 nucleotides in length. The strands forming the saRNA duplex can be of equal or unequal length.

In one embodiment, the saRNA of the invention comprises a sequence of at least 14 nucleotides and less than 30 nucleotides that shares at least 80%, 90%, 95%, 98%, 99% with the targeted sequence % or 100% complementarity. In one embodiment, the sequence at least 80%, 90%, 95%, 98%, 99% or 100% complementary to the targeted sequence is at least 15, 16, 17, 18 or 19 nucleotides in length, Or 18-22 or 19 to 21, or exactly 19 nucleotides.

The saRNAs of the invention may comprise short 3' or 5' sequences that are not complementary to the target antisense RNA transcript. In one embodiment, this sequence is at the 3' end of the strand. The sequence may be 1-5 nucleotides, or 2 or 3 nucleotides in length. The sequence may contain uracils such that it may be a 3' stretch of 2 or 3 uracils. The sequence may contain one or more deoxyribonucleosides, such as dT. In one embodiment, one or more nucleotides in the sequence are replaced by phosphorothioate nucleosides, wherein the internucleoside linkage is a phosphorothioate linkage. As a non-limiting example, the sequence comprises the sequence dT*dT, where * is a phosphorothioate internucleoside bond. This non-complementary sequence may be referred to as a "tail". The strand can be longer if a 3' tail is present, eg, 19 nucleotides plus a 3' tail, which can be UU or UUU. This 3' tail should not be considered a mismatch when determining complementarity between the saRNA and the target antisense RNA transcript.

Thus, a saRNA of the invention may consist of: (i) a sequence having at least 80% complementarity to a region of the target antisense RNA transcript; and (ii) a 3' tail of 1-5 nucleotides, said The tail may comprise or consist of uracil residues. The saRNA thus generally has complementarity to the region of the target antisense RNA transcript throughout its length, except for the 3' tail, if present. Any of the saRNA sequences disclosed in this application may optionally comprise such a 3' tail. Accordingly, any saRNA sequence disclosed in the saRNA Listing and Sequence Listing may optionally contain such a 3' tail. The saRNA of the invention may also comprise Dicer or Drosha substrate sequences.

Yet another aspect of the present invention provides a composition comprising a composition of C/EBPa-saDNA and siRNA targeting CEBPA transcripts and at least one pharmaceutically acceptable carrier.

In one embodiment, the siRNA is a C/EBPβ-siRNA; in one embodiment, the siRNA has a sequence shown in SEQ ID NO:63 or SEQ ID NO:64.

In one of the embodiments, the ratio of C/EBPa-saRNA and C/EBPβ-siRNA in the composition is 3:1-1:2, preferably, the C/EBPa-saRNA and C/EBPβ - the ratio of siRNA is 2:1-1:2, more preferably, the ratio of C/EBPa-saRNA and C/EBPβ-siRNA is 1:1-1:2; preferably, the C/EBPa-saRNA and The ratio of C/EBPβ-siRNA is 2:1; preferably, the ratio of C/EBPα-saRNA and C/EBPβ-siRNA is 1:1.

Further, the present invention provides the application of the composition of C/EBPa-saRNA and C/EBPβ-siRNA in the preparation of medicines for up-regulating CEBPA gene in cells.

Further, the application of the composition of C/EBPα-saRNA and C/EBPβ-siRNA in the preparation of a drug for up-regulating the expression of p21 in tumor cells.

Further, the present invention provides the application of the composition of C/EBPa-saRNA and C/EBPβ-siRNA in the preparation of a drug for up-regulating albumin in cells. Furthermore, the present invention provides the application of said method in reducing the recurrence rate of HCC.

Further, the present invention provides the application of the composition of C/EBPα-saRNA and C/EBPβ-siRNA in the preparation of anti-cell proliferation drugs.

Further, the present invention provides the application of the composition of C/EBPα-saRNA and C/EBPβ-siRNA in the preparation of a drug for reducing the recurrence rate of HCC.

Further, the present invention provides the application of the composition of C/EBPa-saRNA and C/EBPβ-siRNA in enhancing the response of undifferentiated HCC cell lines to C/EBPa-saRNA up-regulating CEBPA gene.

Further, the present invention provides the application of the C/EBPa-saRNA and C/EBPβ-siRNA composition in the preparation of a drug for improving liver function through albumin enhancement.

In another aspect, the present invention provides a method for treating tumors with a composition comprising C/EBPa-saDNA and p21-saRNA.

Yet another aspect of the present invention provides a composition comprising a composition of C/EBPa-saDNA and p21-saRNA targeting CEBPA transcripts and at least one pharmaceutically acceptable carrier.

In one of the embodiments, the p21-saRNA has the sequence:

Sense strand: CCAACUCAUUCUCCAAGUA[dT][dT] (SEQ ID NO:48)

Antisense strand: UACUUGGAGAAUGAGTTGG[dT][dT] (SEQ ID NO:49)

In one of the embodiments, the ratio of C/EBPa-saRNA to p21-saRNA in the composition is 3:1-1:2, preferably, the ratio of C/EBPa-saRNA to p21-saRNA is 2:1-1:2, more preferably, the ratio of C/EBPa-saRNA and p21-saRNA is 1:1-1:2; preferably, the ratio of C/EBPa-saRNA and p21-saRNA is 2:1; preferably, the ratio of C/EBPa-saRNA to p21-saRNA is 1:1.

Further, the application of the composition of C/EBPa-saRNA and p21-saRNA in the preparation of a drug for up-regulating the expression of p21 in cells.

Further, the application of the composition of C/EBPa-saRNA and p21-saRNA in the preparation of a drug for up-regulating the expression of p21 in tumor cells.

Further, the present invention provides the application of the composition of C/EBPa-saRNA and p21-saRNA in the preparation of a drug for up-regulating albumin in cells. Furthermore, the present invention provides the application of said method in reducing the recurrence rate of HCC.

Further, the present invention provides the application of the composition of C/EBPa-saRNA and p21-saRNA in the preparation of anti-cell proliferation drugs.

Further, the present invention provides the application of the composition of C/EBPa-saRNA and p21-saRNA in the preparation of a drug for reducing the recurrence rate of HCC.

Further, the present invention provides the application of the composition of C/EBPa-saRNA and p21-saRNA in enhancing the response of undifferentiated HCC cell lines to C/EBPa-saRNA up-regulating CEBPA gene.

Further, the present invention provides the application of the composition of C/EBPa-saRNA and p21-saRNA in the preparation of a drug for improving liver function through albumin enhancement.

The present invention relates to providing a method for optimal activation of CEBPA expression in HCC cells. HCC cell lines were first studied by transfection of different cell lines optimized for saRNA-induced gene activation and siRNA-induced gene repression by exploring whether CEBPA and CEBPB share common pathways in hepatocyte biology and other cancer types. (HepG2, Hep3B and PLC/PRF/5), prostate (DU-145) and breast cancer (MCF-7) cell models. HepG2 and Hep3B represent differentiated phenotypes, while PLC/PRF/5 represent undifferentiated cell lines. In the above cell types, the optimal concentration of C/EBPa-saRNA needed for transfection to activate CEBPA is at least 15-30nm, and the optimal incubation time after transfection is 48-96 hours. Experiments have confirmed that C/EBPa-saRNA up-regulates the activity of CEBPA expression in cells for at least 48-96 hours. The optimal concentration of C/EBPβ-siRNA inhibitory effect is 5-15nm, and the optimal incubation time after transfection is 48-96 hours.

The dual combination of C/EBPa-saRNA and C/EBPβ-siRNA resulted in higher CEBPA expression levels than single transfection. The double transfection of C/EBPa-saRNA and C/EBPβ-siRNA obtained a better up-regulated p21 expression level than the co-transfection of C/EBPa-saRNA, C/EBPβ-siRNA and p21-saRNA. This experiment confirmed that the combination of C/EBPa-saRNA and C/EBPβ-siRNA may be an ideal choice for inhibiting HepG2 cell tumors. In summary, since the combination of C/EBPa-saRNA and C/EBPβ-siRNA resulted in higher expression of CEPBA, p21 and albumin in activated HepG2 cells, it was suggested that the combined use of C/EBPa-saRNA and C/EBPβ-siRNA has more Anti-proliferative effects caused by upregulation of C/EBPA and p21 expression to improve liver function and liver response through albumin enhancement.

The study in this example also found that changing the expression balance of CEBPA and CEBPB may have a profound impact on specific cell types of HCC. As shown in previous data, the combination of CEBPA activation and CEBPB inhibition produces an elevated ratio of CEBPA to CEBPB, leading to better activation of p21 in differentiated HepG2 cells to suppress the effects of the cell cycle on cell proliferation. In addition, it has been proved by experiments that this combination has an unexpected effect when applied to undifferentiated PLC/PRF/5 cells.

C/EBPα-saRNA and C/EBPβ-siRNA co-transfection had cytotoxic and antiproliferative effects in all three cell lines including HepG2, Hep3B cells. Moreover, PLC/PRF/5 cells may be converted from resistance to resistance-sensitivity by co-transfecting cell lines with C/EBPa-saRNA and C/EBPβ-siRNA.

The term "CEBPA transcript" in this context may be located on any strand of the CEBPA gene, antisense RNA of the CEBPA gene, CEBPA mRNA encoding CEBPA protein, or non-coding RNA that regulates expression of the CEBPA gene. An example of a non-coding RNA that regulates CEBPA gene expression is a long non-coding RNA (lncRNA). The antisense RNA of the CEBPA gene is hereinafter referred to as the target antisense RNA transcript.

In one embodiment, a nucleic acid construct targeting a transcript of a gene modulates expression and/or function of that gene. The term "regulate" in this context may include upregulating or downregulating the expression and/or function of a particular gene.

One aspect of the present invention provides a pharmaceutical composition comprising one or several nucleic acid constructs targeting CEBPA or CEBPB, or their upstream and downstream protein transcripts, and at least one pharmaceutically acceptable carrier. An example of such a nucleic acid construct is an activating small RNA (saRNA). "Small activating RNA" or "saRNA" in this context means a single- or double-stranded RNA, generally smaller than 50 nucleotides, that upregulates or has a positive effect on the gene expression of a particular gene. The gene is referred to as the target gene of the saRNA. For example, the CEBPA gene is the target gene of C/EBPa-saRNA of the present invention; for example, the gene that activates the expression of p21 is the target gene of p21-saRNA;

The present invention also relates to "small interfering RNA" or "siRNA", which term in this context means a double-stranded RNA, generally 20-25 nucleotides in length, that participates in the RNA interference (RNAi) pathway and interferes with or inhibits the expression of a specific gene. The gene is the target gene of the siRNA. For example, siRNA that interferes with the expression of CEBPB gene is called "C/EBPβ-siRNA" and the C/EBPB gene is the target gene. For example, siRNA that interferes with the expression of the CEBPA gene is called "C/EBPa-siRNA" and the CEBPA gene is the target gene. For example, siRNA that interferes with CTR9 gene expression is called "CTR9-siRNA"; siRNA that interferes with DDX5 gene expression is called "DDX5-siRNA"; siRNA that interferes with hnRNPA2/B1 gene expression is called "hnRNPA2/B1-siRNA".

siRNAs are typically about 21 nucleotides long, with 3' overhangs (2 nucleotides) at each end of both strands. siRNAs inhibit target gene expression by binding to one or more RNA transcripts of the gene at specific sequences and promoting cleavage of the transcripts. Typically, in RNAi, the RNA transcript is mRNA, whereby cleavage of the mRNA results in downregulation of gene expression. In the present invention, without intending to be bound by any theory, one of the possible mechanisms is that C/EBPa-saRNA can regulate CEBPA gene expression by cleaving target antisense RNA transcripts.

The saRNAs of the present application are defined by their target antisense RNA transcripts, regardless of the mechanism by which the saRNA regulates the expression of a particular gene. The saRNA preferably has a high percent identity to the genomic sequence on the CEBPA or P21 gene, such as at least 75%, 80%, 85%, 90%, 95%, 98% or 99%, preferably 100% identity. The preferred genomic sequence is up to 500 nucleotides upstream or downstream of the CEBPA or P21 gene transcription start site. Most preferably, it is within the CEBPA or P21 gene promoter region. Thus, the saRNA preferably has sequence identity to a sequence within the CEBPA or P21 gene promoter region. The saRNA of the invention may be single-stranded, or preferably double-stranded. Double-stranded molecules comprise a first strand and a second strand. If double stranded, each strand of the duplex is preferably at least 14, more preferably at least 18, eg 19, 20, 21 or 22 nucleotides in length. The duplex preferably hybridizes over a length of at least 12, more preferably at least 15, more preferably 17, still more preferably at least 19 nucleotides. Each strand can be exactly 19 nucleotides in length. Preferably, the saRNA is less than 30 nucleotides in length, as oligonucleotide duplexes longer than this may have an increased risk of inducing an interferon response. The strands forming the saRNA duplex can be of equal or unequal length.

The saRNAs of the invention may comprise short 3' or 5' sequences that are not complementary to the target antisense RNA transcript. In one embodiment, this sequence is 3'. The sequence may be 1-5, preferably 2 or 3 nucleotides in length. The sequence preferably comprises uracil, so it is preferably a 3' stretch of 2 or 3 uracils. This non-complementary sequence may be referred to as a "tail". The strand can be longer if a 3' tail is present, eg, 19 nucleotides plus a 3' tail, which is preferably UU or UUU. The saRNA of the invention may also comprise Dicer or Drosha substrate sequences.

The saRNA of the invention may contain flanking sequences. Flanking sequences can be inserted into the 3' end or the 5' end of the saRNA of the invention. In one embodiment, the flanking sequence is the sequence of the miRNA such that the saRNA has the miRNA configuration and can be processed with Drosha and Dicer. In a non-limiting example, saRNAs of the invention have two strands and are cloned into sequences flanking the amiR-30 backbone.

The saRNA of the invention may comprise a restriction enzyme substrate or recognition sequence. The restriction enzyme recognition sequence may be at the 3' end or the 5' end of the saRNA of the present invention. Non-limiting examples of restriction enzymes include NotI and AscI.

In one embodiment, the saRNA of the invention consists of two strands that are stably base-paired, with a plurality of unpaired nucleotides forming a 3' overhang at the 3' end of each strand. The number of unpaired nucleotides forming the 3' overhang of each strand is preferably in the range of 1 to 5 nucleotides, more preferably 1 to 3 nucleotides and most preferably 2 nucleotides. A 3' overhang can be formed on the above mentioned 3' tail, so that the 3' tail can be a 3' overhang.

Thus, saRNAs of the invention preferably consist of: (i) a sequence that is at least 95% complementary to a region of the target antisense RNA transcript; and (ii) a 3' tail of 1-5 nucleotides that Preferably uracil residues are included. The saRNA of the invention preferably has complementarity to the region of the target antisense RNA transcript throughout its entire length except for the 3' tail (if present). As mentioned above, instead of "complementary to the target antisense RNA transcript", the saRNA of the invention can also be defined as having "identity" to the coding strand of the CEBPA gene.

The saRNA or siRNA of the present invention may be obtained by any suitable method, or purchased as a commercially available product, for example produced synthetically or by expression in cells using standard molecular biology techniques well known to those skilled in the art. For example, saRNAs of the invention can be chemically synthesized or recombinantly produced using methods known in the art.

Chemical modification of saRNA

In saRNA, the term "modification" or (if appropriate) "modified" refers to structural and/or chemical modifications relative to A, G, U or C ribonucleotides. Nucleotides in the saRNA molecules of the invention may include non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. The saRNAs of the invention may include any useful modifications, such as modifications to sugars, nucleobases, or internucleoside linkages (eg, to linking phosphate/phosphodiester linkages/phosphodiester backbones). One or more atoms of the pyrimidine nucleobase can be replaced with optionally substituted amino, optionally substituted mercapto, optionally substituted alkyl (e.g., methyl or ethyl), or halogen (e.g., chloro or fluoro) or replace. In certain embodiments, modifications (eg, one or more modifications) are present in each sugar and nucleoside bond. The modification of the present invention may be a modification of ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), threose nucleic acid (TNA), diol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA) or hybrid molecules thereof . In a non-limiting example, the 2'-OH of U is replaced by -OMe. The saRNAs of the invention may include combinations of modifications to sugars, nucleobases, and/or internucleoside linkages.

The saRNA or siRNA of the invention can be modified uniformly or heterogeneously along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) can be uniformly modified or May not be uniformly groomed in it. In some embodiments, all nucleotides X in the saRNA of the present invention are modified, wherein X can be any of the nucleotides A, G, U, C, or A+G, A+U, A Any combination of +C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C. Different sugar modifications, nucleotide modifications and/or internucleoside linkages (eg, backbone structures) can be present at various positions in the saRNA. Nucleotide analogs or other modifications can be placed anywhere on the saRNA so that the function of the saRNA is not substantially reduced. The saRNAs of the invention may contain from about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any of A, G, U, or C). one or more) or any percentage in between (eg, 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90% %, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100% and 95% to 100%).

The saRNA of the present invention can be modified into a spherical nucleic acid (SNA) or a circular nucleic acid. The ends of the saRNA of the present invention can be connected by means of chemical reagents or enzymes to produce spherical saRNA without free ends. Spherical saRNAs are expected to be more stable and resistant to digestion by RNase R exonucleases than their linear counterparts. The globular saRNA may also comprise other structural and/or chemical modifications relative to A, G, U or C ribonucleotides. In some embodiments, the saRNAs of the invention may comprise reverse abasic modifications. In some embodiments, the reverse abasic modification can be at the 5' end.

The saRNA or siRNA of the invention can be designed to be conjugated to other polynucleotides, dyes, intercalators (e.g., acridine), crosslinkers (e.g., psoralen, mitomycin C), porphyrins (TPPC4 , Texas porphyrin (texaphyrin), thiophyrin (Sapphyrin)), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), alkylating agents, phosphate esters , amino, thiol, PEG (eg, PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled label, enzyme, hapten (eg, biotin), transporter /Absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases, proteins, such as glycoproteins, or peptides, e.g., molecules with specific affinity for a co-ligand, or antibodies, e.g. Types such as cancer cells, endothelial cells or bone cells bind antibodies, hormones and hormone receptors, non-peptide species such as lipids, lectins, sugars, vitamins, cofactors or drugs.

The composition of C/EBPa-saRNA according to the present invention can be combined with RNAi agent, small interfering RNA (siRNA), small hairpin RNA (shRNA), long non-coding RNA (lncRNA), enhancer RNA, enhancer-derived RNA or enhancer-driven RNA (eRNA), microRNA (miRNA), miRNA binding site, antisense RNA, ribozyme, catalytic DNA, tRNA, RNA that induces triple helix formation, aptamers or vectors, etc. used to achieve different functions. One or more RNAi agents, small interfering RNA (siRNA), small hairpin RNA (shRNA), long noncoding RNA (lncRNA), microRNA (miRNA), miRNA binding site, antisense RNA, ribozyme , catalytic DNA, tRNA, triple helix formation inducing RNA, aptamer or vector may comprise at least one modification or substitution. In some embodiments, the modification is selected from chemical substitutions of the nucleic acid at sugar positions, chemical substitutions at phosphate positions, and chemical substitutions at base positions. In other embodiments, the chemical modification is selected from the group consisting of incorporation of modified nucleotides; 3' cap structures; conjugation to high molecular weight, non-immunogenic compounds; conjugation to lipophilic compounds; in the ester backbone. In a preferred embodiment, the high molecular weight, non-immunogenic compound is a polyglycol, and more preferably polyethylene glycol (PEG).

In one embodiment, C/EBPa-saRNA can be linked to an antibody. Methods for generating antibodies directed against target cell surface receptors are well known. The saRNA molecules of the present invention can be linked to such antibodies by known methods, for example using RNA carrier proteins. The resulting complex can then be administered to a subject and taken up by target cells via receptor-mediated endocytosis.

The compositions of the present invention may be provided in combination with other active ingredients known to be active in the particular method under consideration. The other active ingredients may be administered simultaneously, separately or sequentially with the composition of the invention. In one embodiment, compounds of the invention are administered with saRNAs that modulate different target genes. Non-limiting examples include saRNAs that modulate the albumin gene, insulin gene, or HNF4A gene. Regulation of any gene can be achieved using a single saRNA or a combination of two or more different saRNAs.

In one embodiment, the compositions of the invention are administered together with one or more drugs that modulate metabolism, especially liver function. In a non-limiting example, the composition of the present invention is combined with drugs that lower low-density lipoprotein (LDL) cholesterol levels such as statins, simvastatin, atorvastatin, rosuvastatin, ezetimibe, Niacin, PCSK9 inhibitors, CETP inhibitors, clofibrate, fenofibric acid, tocotrienols, phytosterols, bile acid sequestrants, probucol, or combinations thereof are administered together. The C/EBPa-saRNA compositions of the present invention can also be administered with the vanadium biguanide complexes disclosed in US6287586 by Orvig et al. In another example, a C/EBPa-saRNA composition can be administered with a composition disclosed in WO 201102838 to Rhodes, the contents of which are incorporated by reference in its entirety, to lower serum cholesterol. The composition comprises an antigen binding protein that selectively binds to and inhibits PCSK9 protein; and an RNA effector agent that inhibits expression of PCSK9 gene in a cell. In yet another example, a C/EBPa-saRNA composition can be administered with an ABC1 polypeptide having ABC1 biological activity or a nucleic acid encoding an ABC1 polypeptide having ABC1 activity to modulate as described in EP1854880 to Brooks-Wilson et al. Cholesterol levels, the contents of which are hereby incorporated by reference in their entirety.

The pharmaceutical formulations provided by the invention may additionally comprise pharmaceutically acceptable excipients, as used herein, said pharmaceutically acceptable excipients include, but are not limited to, any and all solvents, dispersion media, diluents or other liquid vehicles, dispersion Adjuvants or suspending aids, surfactants, isotonic agents, thickening or emulsifying agents, preservatives and the like, as appropriate for the particular dosage form desired.

In some embodiments, the composition is administered to a human, human patient or subject. For the purposes of this disclosure, the phrase "active ingredient" generally refers to saRNA and siRNA delivered as described herein.

Although the description of pharmaceutical compositions provided herein primarily relates to pharmaceutical compositions suitable for administration to humans, the skilled artisan understands that such compositions are generally suitable for administration to any other animal, for example, to non-human animals, such as non-human mammals.

Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparation methods include the steps of bringing the active ingredient into association with excipients and/or one or more other auxiliary ingredients, and subsequently, if necessary and/or desirable, dividing, shaping and/or Or packaged in the desired single-dose or multi-dose units.

The relative amounts of the active ingredients, pharmaceutically acceptable excipients, and/or any additional ingredients in the pharmaceutical compositions of the present invention will vary depending on the identity, size, and/or condition of the subject being treated and further depending on the composition. route to be administered. By way of example, a composition may comprise between 0.1% and 100%, such as between 0.5% and 50%, between 1-30%, between 5-80%, of at least 80% (w/w) active ingredient.

In some embodiments, the formulations described herein can contain at least one C/EBPa-saRNA and one siRNA. As a non-limiting example, a formulation may contain 1, 2, 3, 4 or 5 saRNAs with different sequences. In one embodiment, the formulation contains at least 3 saRNAs with different sequences. In one embodiment, the formulation contains at least 5 saRNAs with different sequences.

Compositions of saRNA of the invention can be formulated using one or more excipients. In addition to conventional excipients such as any and all solvents, dispersion media, diluents or other liquid vehicles, dispersion or suspension aids, surfactants, isotonic agents, thickening or emulsifying agents, preservatives, this Excipients of the invention may include, without limitation, lipidoids, liposomes, lipid nanoparticles, polymers, lipid-nucleic acid complexes (lipoplex), core-shell nanoparticles, peptides, proteins, cells transfected with saRNA (eg, for transplantation into a subject), hyaluronidase, nanoparticle mimetics, and combinations thereof. Accordingly, formulations of the invention may comprise one or more excipients, each in an amount that together increase the stability of the saRNA and/or increase the transfection of the cell by the saRNA. In addition, self-assembling nucleic acid nanoparticles can be used to formulate saRNAs of the invention.

Combination use: As used herein, the term "administered in combination" or "joint administration" means that two or more drugs (eg, saRNA) are administered to a subject at the same time or at such intervals that each drug There may be overlap in effect on this patient. In some embodiments, they are administered within about 60, 30, 15, 10, 5, or 1 minute of each other. In some embodiments, the administration of the drugs is spaced so closely enough that a combined (eg, synergistic) effect is achieved.

Cancer: As used herein, the term "cancer" refers to the presence in an individual of cells having characteristics common to cells responsible for cancer, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rates, and certain Characteristic morphological features. Often, cancer cells will be in the form of tumors, but such cells can exist independently within an individual, or can circulate in the bloodstream as separate cells, such as leukemia cells.

Suppressing cells: As used herein, "suppressing cells" refers to suppressing, reducing, quiescent cells (e.g., mammalian cells (e.g., human cells)), bacteria, viruses, fungi, protozoa, parasites, prions, or combinations thereof growth, division or multiplication.

Cytotoxicity: As used herein, "cytotoxicity" refers to killing or causing damage to cells (e.g., mammalian cells (e.g., human cells)), bacteria, viruses, fungi, protozoa, parasites, prions, or combinations thereof Harmful, toxic or lethal effects.

Reagent test kit

The invention provides various kits for convenient and/or efficient practice of the methods of the invention. Generally, a kit will contain sufficient amounts and/or numbers of components to allow a user to perform multiple treatments of a subject and/or to perform multiple experiments.

In one embodiment, the present invention provides a kit for regulating gene expression in vitro or in vivo, said kit comprising a C/EBPa-saRNA composition or a C/EBPa-saRNA composition for regulating CEBPA gene expression of the present invention, Combinations of saRNAs, siRNAs or miRNAs that regulate other genes. The kit can also comprise packaging and instructions and/or delivery agents to form a formulated composition. Delivery agents may include saline, buffered solutions, lipidoids, dendrimers, or any of the delivery agents disclosed herein. Non-limiting examples of genes include CEBPA, other members of the CEBPB family, albumin genes, alpha-fetoprotein genes, liver-specific factor genes, growth factors, nuclear factor genes, tumor suppressor genes, pluripotency factor genes.

In one non-limiting example, the buffer solution may include sodium chloride, calcium chloride, phosphate and/or EDTA.

In another non-limiting example, buffer solutions may include, but are not limited to, saline, saline with 2 mM calcium, 5% sucrose, 5% sucrose with 2 mM calcium, 5% mannitol, 5% mannitol with 2 mM calcium , Ringer Lactate, Sodium Chloride, Sodium Chloride with 2mM Calcium and Mannose. In yet another non-limiting example, the buffer solution can be precipitated or it can be lyophilized. The amount of each component can be varied to achieve consistent, reproducible higher concentration saline or simple buffer formulations. Components can also be varied to increase the stability of the saRNA in buffered solutions over time and/or under various conditions.

In another embodiment, the present invention provides a kit for regulating cell proliferation, said kit comprising the C/EBPa-saRNA composition of the present invention in an amount effective to inhibit said cell proliferation when introduced into cells; optionally Optionally include other siRNAs and miRNAs to further regulate the proliferation of target cells; and packaging and instructions and/or delivery agents to form a formulation composition.

In another embodiment, the present invention provides a kit for reducing LDL levels in cells, said kit comprising the C/EBPa-saRNA composition of the present invention; optionally comprising a drug for reducing LDL; and packaging and instructions and and/or a delivery agent to form a formulation composition.

In another embodiment, the present invention provides a kit for modulating miRNA expression levels in cells, said kit comprising a composition of the C/EBPa-saRNA composition of the present invention and siRNA; optionally comprising siRNA, eRNA and lncRNA and packaging and instructions and/or delivery agents to form a formulation composition.

device

The invention provides devices that may incorporate the C/EBPa-saRNA compositions of the invention. These devices contain a stable formulation ready for immediate delivery to a subject in need, such as a human patient. Non-limiting examples of such subjects include subjects with hyperproliferative diseases such as cancer, tumors, especially liver-related diseases.

Non-limiting examples of devices include pumps, catheters, needles, transdermal patches, pressurized olfactory delivery devices, iontophoresis devices, multilayer microfluidic devices. The device can be used to deliver the C/EBPa-saRNA composition of the invention according to a single, multiple or split dosing regimen. The device can be used to deliver the C/EBPa-saRNA composition of the invention across biological tissue, intradermally, subcutaneously or intramuscularly. Further examples of devices suitable for delivering oligonucleotides are disclosed in International Published Application WO2013/090648, the contents of which are incorporated herein by reference in their entirety.

One aspect of the present invention provides methods of using the pharmaceutical composition of the C/EBPa-saRNA composition and at least one pharmaceutically acceptable carrier. C/EBPa-saRNA composition regulates CEBPA gene expression. In one embodiment, the expression of the CEBPA gene is increased by at least 20%, 30%, 40%, more preferably at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, even more preferably at least 80%. In yet another preferred composition embodiment, the expression of the CEBPA gene is increased by at least 2-fold, 3-fold, 4-fold, in the presence of the saRNA of the invention as compared to the expression of the CEBPA gene in the absence of the saRNA composition of the invention 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, more preferably at least 15 times, 20 times, 25 times, 30 times, 35 times, 40 times, 45 times, 50 times, even more preferably Increase at least 60 times, 70 times, 80 times, 90 times, 100 times.

In one embodiment, there is provided a method of modulating liver metabolic genes in vitro and in vivo by therapeutic use of the C/EBPa-saRNA composition of the invention. Also provided is a method of modulating liver genes involved in NAFLD in vitro and in vivo by C/EBPa-saRNA treatment of the invention. These genes include, but are not limited to, sterol regulatory element binding factor 1 (SREBF-1 or SREBF), cluster of differentiation 36 (CD36), acetyl-CoA carboxylase 2 (ACACB), apolipoprotein C-III (APOC3), Microsomal triglyceride transfer protein (MTP), peroxisome proliferator-activated receptor gamma coactivator protein 1α (PPARγ-CoA1α or PPARGC1A), low-density lipoprotein receptor (LDLR), peroxisome proliferation Peroxisome proliferator-activated receptor gamma (PPARγ), acetyl-CoA carboxylase 1 (ACACA), carbohydrate response element binding protein (ChREBP) or MLX1PL), peroxisome proliferator-activated receptor alpha (PPARα or PPARA), FASN (fatty acid synthase), diglyceride acyltransferase-2 (DGAT2), and mammalian target of rapamycin (mTOR ). In one embodiment, the C/EBPa-saRNA composition reduces the expression of the SREBF-1 gene in liver cells by at least 20%, 30%, preferably at least 40%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of CD36 gene in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%. In one embodiment, the C/EBPa-saRNA composition increases ACACB gene expression in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, 100%, 125%, 150% %. In one embodiment, the C/EBPa-saRNA composition reduces APOC3 gene expression in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of MTP gene in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%. In one embodiment, the C/EBPa-saRNA composition increases the expression of PPARγ-CoA1α gene in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, 100%, 125% , 150%, more preferably at least 175%, 200%, 250%, 300%. In one embodiment, the C/EBPa-saRNA composition increases the expression of PPARγ gene in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, 100%, 125%, 150% %, more preferably at least 175%, 200%, 250%, 300%. In one embodiment, the C/EBPa-saRNA composition increases the expression of PPARα gene in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, 100%, 125%, 150% %, more preferably at least 175%, 200%, 250%, 300%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of MLXIPL gene in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of FASN gene in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of DGAT2 gene in liver cells by at least 10%, 20%, preferably at least 30%, 40%, 50%.

The composition of C/EBPa-saRNA also modulates the expression of the above-disclosed hepatic metabolism genes in BAT cells. In another embodiment, the C/EBPa-saRNA composition reduces the expression of the SREBP gene in BAT cells by at least 20%, 30%, preferably at least 40%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of CD36 gene in BAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of LDLR gene in BAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%. In one embodiment, the C/EBPa-saRNA composition increases the expression of PPARGC1A gene in BAT cells by at least 20%, 30%, preferably at least 40%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of APOC gene in BAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, more preferably at least 95%, 99%. In one embodiment, the C/EBPa-saRNA composition reduces ACACB gene expression in BAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%. In one embodiment, the C/EBPa-saRNA composition reduces PERC gene expression in BAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%. In one embodiment, the C/EBPa-saRNA composition increases the expression of ACACA gene in BAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, 100%, 125%, 150% %. In one embodiment, the C/EBPa-saRNA composition reduces the expression of MLXP1 gene in BAT cells by at least 20%, 30%, 40%, preferably at least 50%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of MTOR gene in BAT cells by at least 20%, 30%, 40%, preferably at least 50%, 75%. In one embodiment, C/EBPa-saRNA increases the expression of PPARA gene in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, 100%, 125%, 150%, More preferably at least 200%, 250%, 300%, 350%, 400%. In one embodiment, C/EBPa-saRNA increases the expression of FASN gene in BAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%. In one embodiment, C/EBPa-saRNA increases the expression of DGAT gene in liver cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, 100%, 125%, 150%, More preferably at least 200%, 250%, 300%.

The C/EBPa-saRNA composition of the present invention also modulates the expression of the above-disclosed liver metabolism genes in WAT cells. In another embodiment, the C/EBPa-saRNA composition reduces the expression of SREBP gene in WAT cells by at least 20%, 30%, preferably at least 40%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of CD36 gene in WAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of LDLR gene in WAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%. In one embodiment, the C/EBPa-saRNA composition increases the expression of PPARGC1A gene in WAT cells by at least 20%, 30%, preferably at least 40%. In one embodiment, the C/EBPa-saRNA composition increases the expression of MTP gene in WAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, more preferably at least 95%, More preferably at least 1.5 times, 2.0 times, 2.5 times, 3.0 times, 3.5 times, 4.0 times, more preferably at least 5.0 times, 6.0 times, 7.0 times, 8.0 times, 9.0 times, 10.0 times. In one embodiment, the C/EBPa-saRNA composition increases APOC gene expression in WAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, more preferably at least 95%, 99%. In one embodiment, the C/EBPa-saRNA composition reduces ACACB gene expression in WAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%. In one embodiment, the C/EBPa-saRNA composition reduces PERC gene expression in WAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of ACACA gene in WAT cells by at least 20%, 30%, 40%, 50%, preferably at least 75%, 90%, 95%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of MLX1PL gene in WAT cells by at least 20%, 30%, 40%, preferably at least 50%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of MTOR gene in WAT cells by at least 20%, 30%, 40%, preferably at least 50%, 75%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of FASN gene in WAT cells by at least 5%, 10%, preferably at least 15%, 20%. In one embodiment, the C/EBPa-saRNA composition reduces the expression of DGAT gene in WAT cells by at least 10%, 20%, 30%, more preferably 40%, 50%.

surgical care

Hepatectomy, the surgical removal of the liver or liver tissue, may cause liver failure and decreased production of albumin and clotting factors. Appropriate surgical care is required after hepatectomy. In some embodiments, the C/EBPa-saRNA composition of the present invention is used in post-hepatectomy surgical care to promote liver regeneration and increase survival rate.

hyperproliferative disease

In one embodiment of the invention, the C/EBPa-saRNA composition of the invention is used to reduce cell proliferation of hyperproliferative cells. Examples of hyperproliferative cells include cancer cells, eg, carcinomas, sarcomas, lymphomas, and embryonal cell tumors. Such cancer cells can be benign or malignant. Hyperproliferative cells may result from autoimmune disorders such as rheumatoid arthritis, inflammatory bowel disease or psoriasis. Hyperproliferative cells can also develop in allergen-exposed patients whose immune systems are oversensitized. Such conditions involving an oversensitized immune system include, but are not limited to, asthma, allergic rhinitis, eczema, and allergic reactions, such as anaphylaxis. In one embodiment, tumor cell development and/or growth is inhibited. In a preferred embodiment, solid tumor cell proliferation is inhibited. In another preferred embodiment, tumor cell metastasis is prevented. In another preferred example, the proliferation of undifferentiated tumor cells is inhibited.

Inhibiting cell proliferation or reducing proliferation means that proliferation is reduced or completely stopped. Thus, "reducing proliferation" is an embodiment of "inhibiting proliferation." The proliferation of the cells is reduced by at least 20% in the presence of the C/EBPa-saRNA composition of the invention, compared to the proliferation of said cells prior to treatment with the C/EBPa-saRNA composition of the invention, or compared to the proliferation of equivalent untreated cells. %, 30% or 40%, or preferably at least 45%, 50%, 55%, 60%, 65%, 70% or 75%, even more preferably at least 80%, 90% or 95%. In embodiments where cell proliferation is inhibited in hyperproliferative cells, the "equivalent" cells are also hyperproliferative cells. In preferred embodiments, proliferation is reduced to a rate comparable to that of equivalent healthy (non-hyperproliferative) cells. A preferred embodiment of "inhibiting cell proliferation" is to inhibit excessive proliferation or to regulate cell proliferation to achieve a normal healthy level of proliferation.

In one non-limiting example, C/EBPa-saRNA compositions are used to reduce the proliferation of leukemia cells and lymphoma cells. Preferably, the cells include Jurkat cells (acute T-cell lymphoma cell line), K562 cells (erythroid leukemia cell line), U373 cells (glioblastoma cell line) and 32Dp210 cells (myeloid leukemia cell line).

In another non-limiting example, a C/EBPa-saRNA composition is used to reduce the proliferation of ovarian cancer cells, liver cancer cells, pancreatic cancer cells, breast cancer cells, prostate cancer cells, rat liver cancer cells, and insulinoma cells. Preferably, the cells include PEO1 and PEO4 (ovarian cancer cell lines), HepG2 (hepatocellular carcinoma cell line), Panc1 (human pancreatic cancer cell line), MCF7 (human breast adenocarcinoma cell line), DU145 (human metastatic prostate cancer cell line), rat liver cancer cells and MIN6 (rat insulinoma cell line), etc.

In one embodiment, the saRNA compositions of the invention are used to treat hyperproliferative diseases. Tumors and cancers represent a specific class of hyperproliferative diseases and include all types of tumors and carcinomas, such as solid tumors and hematological tumors. Examples of cancers include, but are not limited to, cervical cancer, uterine cancer, ovarian cancer, kidney cancer, gallbladder cancer, liver cancer, head and neck cancer, squamous cell carcinoma, gastrointestinal cancer, breast cancer, prostate cancer, testicular cancer, lung cancer, non- Small cell lung cancer, non-Hodgkin's lymphoma, multiple myeloma, leukemia (eg, acute lymphoblastic leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, and chronic myeloid leukemia), brain cancer (eg, astrocytoma, Glioblastoma, medulloblastoma), neuroblastoma, sarcoma, colon cancer, rectal cancer, stomach cancer, rectal cancer, bladder cancer, endometrial cancer, plasmacytoma, lymphoma, retinoblastoma, Wilm's tumor, Ewing sarcoma, melanoma, and other skin cancers. Liver malignancies may include, but are not limited to, hepatocellular carcinoma (HCC), cholangiocarcinoma, hepatoblastoma, or angiosarcoma, among others.

The present invention utilizes the C/EBPa-saRNA composition to regulate the expression of CEBPA gene and treat liver cirrhosis and HCC. The methods of the invention can reduce tumor volume by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. Preferably, the formation of one or more new tumors is inhibited, eg, a subject treated according to the invention develops fewer and/or smaller tumors. Fewer tumors means that the subject develops fewer tumors than an equivalent subject in a given period of time. For example, the subject develops at least 1, 2, 3, 4 or 5 more tumors less than an equivalent control (untreated) subject. A smaller tumor means that the weight and/or volume of the tumor is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% less than that of an equivalent subject. The methods of the invention reduce tumor burden by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. The given period of time may be any suitable period of time, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 months or years.

In one non-limiting example, a method of treating an undifferentiated tumor comprising contacting a cell, tissue, organ or subject with a C/EBPa-saRNA composition of the invention is provided. Undifferentiated tumors generally have a poorer prognosis than differentiated tumors. Since the degree of differentiation in tumors has an impact on prognosis, it was hypothesized that the use of differentiated biologics might be beneficial antiproliferative agents. C/EBPa is known to restore myeloid differentiation and prevent hematopoietic cell hyperproliferation in acute myeloid leukemia. Preferably, undifferentiated tumors that can be treated with C/EBPa-saRNA include undifferentiated small cell lung cancer, undifferentiated pancreatic adenocarcinoma, undifferentiated human pancreatic cancer, undifferentiated human metastatic prostate cancer, and undifferentiated human metastatic prostate cancer. human breast cancer, etc.

In one non-limiting example, a C/EBPa-saRNA composition is complexed into a PAMAM dendrimer, referred to as a C/EBPa-saRNA-dendrimer, for targeted delivery in vivo. As shown in Example 1, the therapeutic effect of intravenously injected C/EBPa-saRNA-dendrimer was demonstrated in a clinically relevant rat liver tumor model. Treated cirrhotic rats showed a significant increase in serum albumin levels within 1 week after three doses were injected intravenously through the tail vein at 48-hour intervals. Liver tumor burden was significantly reduced in the C/EBPa-saRNA composition dendrimer treatment group. This study demonstrates for the first time that gene targeting with activating small RNA molecules can be used by systemic intravenous administration to simultaneously improve liver function and reduce tumor burden in rats with HCC and cirrhosis.

In one embodiment, the C/EBPa-saRNA of the present invention can be modified by covalent coupling with GalNAc, so as to be delivered in vivo. The principle is based on the fact that ASGRP is highly expressed on the surface of some liver cells and has a high affinity with GalNAc, so it can be widely used in liver diseases. It is currently a method with high maturity and rich clinical pipeline. Such as Alnylam's GalNAc platform, Dicerna's GalXC platform and Ionis' LICA platform.

In one embodiment, the C/EBPa-saRNA composition of the present invention is used to regulate oncogenes and tumor suppressor genes. Preferably, the expression of an oncogene may be down-regulated. The expression of the oncogene in the presence of the C/EBPa-saRNA composition of the invention is reduced by at least 20%, 30%, 40%, more preferably at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. In yet another preferred embodiment, the expression of an oncogene is reduced by at least 2-fold in the presence of the C/EBPa-saRNA composition of the invention as compared to its expression in the absence of the C/EBPa-saRNA composition of the invention , 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, more preferably at least 15 times, 20 times, 25 times, 30 times, 35 times, 40 times, 45 times , 50 times, even more preferably at least 60 times, 70 times, 80 times, 90 times, 100 times. Preferably, the expression of tumor suppressor genes can be suppressed. The expression of the tumor suppressor gene is increased by at least 20%, 30%, 40% in the presence of the C/EBPa-saRNA composition of the present invention, more preferably land 30%.

In another embodiment, the composition of C/EBPa-saRNA of the present invention is used to increase liver function. In one non-limiting example, a C/EBPa-saRNA composition of the invention increases albumin gene expression and thus increases serum albumin levels. The expression of the albumin gene in the presence of the saRNA composition of the invention may be increased by at least 20%, 30%, 40%, more preferably at least 45%, 50%, compared to the expression of the albumin gene in the absence of the saRNA of the invention. %, 55%, 60%, 65%, 70%, 75%, even more preferably at least 80%. In yet another preferred embodiment, the expression of the albumin gene is increased by at least 2-fold, 3-fold, 4-fold in the presence of the saRNA of the invention as compared to the expression of the albumin gene in the absence of the saRNA composition of the invention , 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, more preferably at least 15 times, 20 times, 25 times, 30 times, 35 times, 40 times, 45 times, 50 times, or even more Preferably at least a 60-fold, 70-fold, 80-fold, 90-fold, 100-fold increase.

In another embodiment, the present invention provides a kit for regulating cell proliferation, said kit comprising the C/EBPa-saRNA composition of the present invention in an amount effective to inhibit said cell proliferation when introduced into cells; optionally siRNA and miRNA to further regulate the proliferation of target cells; and packaging and instructions and/or delivery agents to form a formulation composition.

delivery system

The compositions of the present application are applicable to any published research and technology encompassing saRNA delivery by any suitable route for therapeutic, pharmaceutical, diagnostic or imaging use. Delivery can be naked or formulated. The saRNA of the present invention can be delivered naked to cells. As used herein, "naked" refers to the delivery of saRNA without substances that facilitate transfection. For example, the saRNA delivered to the cell may contain no modifications. Naked saRNA compositions can be delivered to cells using routes of administration known in the art and described herein. The saRNAs of the invention can be formulated using the methods described herein. Formulations may contain saRNA compositions that may be modified and/or unmodified. Formulations may also include, but are not limited to, cell penetrating agents, pharmaceutically acceptable carriers, delivery agents, bioerodible or biocompatible polymers, solvents, and sustained release delivery depots. The formulated saRNA compositions can be delivered to cells using routes of administration known in the art and described herein. Composition formulations can also be formulated for direct delivery to organs or tissues by any of several means known in the art including, but not limited to, direct immersion or bathing, via catheters, via gels, powders, ointments , creams, gels, lotions and/or drops, substrates such as fabrics or biodegradable materials coated or impregnated by using the composition. The saRNA compositions of the invention can also be cloned into a retroviral replicating vector (RRV) and transduced into cells.

medication

The saRNAs of the invention can be administered by any route that produces therapeutically effective results. These routes include, but are not limited to, enteral, gastrointestinal, epidural, oral, transdermal, epidural, peridural, intracerebral (into the brain), intraventricular (into the ventricles of the brain), epidermal (applied to on the skin), intradermal (into the skin itself), subcutaneous (under the skin), nasal (through the nose), intravenous (into a vein), intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal (infusion or injection into the peritoneum), intravesical infusion, intravitreal (through the eye), intracavernous injection (into the penis) basal), intravaginal administration, intrauterine, extraamniotic administration, transdermal (diffusion through intact skin for systemic distribution), transmucosal (diffusion through mucous membranes), insufflation (nasal inhalation), sublingual, sublabial, Enema, eye drops (on the conjunctiva), or in ear drops. In specific embodiments, compositions may be administered in a manner that allows them to cross the blood-brain barrier, vascular barrier, or other epithelial barriers. The administration routes disclosed in International Published Application WO2013/090648, the contents of which are hereby incorporated by reference in their entirety, can be used to administer the saRNA composition of the present invention.

dosage form

The pharmaceutical compositions described herein can be formulated into dosage forms described herein, such as topical, intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intracardiac, intraperitoneal, subcutaneous). Liquid dosage forms, injectable preparations, pulmonary forms and solid dosage forms described in WO2013/090648, the contents of which are incorporated herein by reference in their entirety, can be used as dosage forms in the compositions of the present invention.

Pharmaceutically acceptable excipient: As used herein, the phrase "pharmaceutically acceptable excipient" refers to a vehicle other than a compound described herein (e.g., a vehicle capable of suspending or dissolving an active compound) and having a substance that is substantially nontoxic to the patient. and any ingredients with non-inflammatory properties. Excipients may include, for example, antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), softeners, emulsifiers, fillers (diluents), film-forming substances or coatings, flavoring agents, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, adsorbents, suspending or dispersing agents, sweeteners and water of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium (di)phosphate, calcium stearate, croscarmellose, crospovidone, citric acid, Crospovidone, Cysteine, Ethylcellulose, Gelatin, Hydroxypropylcellulose, Hydroxypropylmethylcellulose, Lactose, Magnesium Stearate, Maltitol, Mannitol, Methionine, Methylcellulose, Methylparaben, Microcrystalline Cellulose, Polyethylene Glycol, Polyvinylpyrrolidone, Povidone, Pregelatinized Starch, Propylparaben, Retinyl Palmitate, Shellac, Silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol .

Pharmaceutically acceptable salts: This disclosure also includes pharmaceutically acceptable salts of the compounds described herein. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein by converting an existing acid or base moiety into its salt form (e.g., by reacting the free base group with a suitable organic acid), Modifications are made to the parent compound. Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic and organic acid salts of basic residues such as amines; basic or organic salts of acidic residues such as carboxylic acids, and the like. Representative acid addition salts include acetate, adipate, alginate, ascorbic acid, aspartic acid, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphor salt, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, lauryl sulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, Hemisulfate, Heptanoate, Hexanoate, Hydrobromide, Hydrochloride, Iodate, 2-Hydroxy-ethanesulfonate, Lactobionate, Lactate, Laurate, Lauryl Sulfate Salt, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate Pamoate, pectate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, Tartrate, thiocyanate, tosylate, undecanoate, valerate, etc. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, di Methylamine, trimethylamine, triethylamine, ethylamine, etc. Pharmaceutically acceptable salts of the present disclosure include conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound containing a basic or acidic moiety by conventional chemical methods. Briefly, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent or in a mixture of the two; usually, preferably Non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile.

Pharmaceutically acceptable solvate: As used herein, the term "pharmaceutically acceptable solvate" means a compound of the invention wherein a suitable solvent molecule is incorporated into the crystal lattice. A suitable solvent is one that is physiologically tolerated at the dosage administered. For example, solvates may be prepared by crystallization, recrystallization or precipitation from solutions comprising organic solvents, water or mixtures thereof. Examples of suitable solvents are ethanol, water (e.g. monohydrate, dihydrate and trihydrate), N-methylpyrrolidone (NMP), dimethylsulfoxide (DMSO), N,N'-dimethylformaldehyde Amide (DMF), N,N'-dimethylacetamide (DMAC), 1.3-dimethyl-2-imidazolinone (DMEU), 1.3-dimethyl-3,4,5,6-tetrahydro -2-(1H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, etc. When water is the solvent, the solvates are called "hydrates".

In a non-limiting example, both saRNA and siRNA in the C/EBPa-saRNA composition are complexed into PAMAM dendrimers, which can be C/EBPa-saRNA-dendrimer, C/EBPβ-siRNA-dendrimer , p21-saRNA-dendrimer, CTR9-saRNA-dendrimer, hnRNPA2/B1-dendrimer, use these dendrimers in combination, or, prepare C/EBPa-saRNA and p21-saRNA, CTR9-siRNA separately Or hnRNPA2/B1 combined hybrid dendrimers for targeted delivery in vivo. Therapeutic effect of intravenously injected C/EBPa-saRNA-dendrimer compositions or dendrimers of compositions in a clinically relevant rat liver tumor model as shown in the Examples. Treated cirrhotic rats showed a significant increase in serum albumin levels within 1 week after three doses were injected intravenously through the tail vein at 48-hour intervals. Liver tumor burden was significantly reduced in the C/EBPa-saRNA dendrimer-treated group. This study demonstrates for the first time that gene targeting with activating small RNA molecules can be used by systemic intravenous administration to simultaneously improve liver function and reduce tumor burden in cirrhotic rats with HCC.

Dendrimers are highly branched monodisperse macromolecules with a molecular structure consisting of a central core, repeating units, and terminal groups, with many unique properties. Among them, polyamide-amine (PAMAM) dendrimers, which use ethylenediamine as the core and react with methyl acrylate through Michael addition and amidation reactions, are the most widely studied and applied dendrimers. Accurate molecular structure, high geometric symmetry, cavities in the molecule, a large number of surface functional groups, controllable molecular weight and monodisperse molecular weight distribution, nanometer size of the molecule itself, spherical shape of high algebraic molecules, etc. Advantages, chemical modification of its terminal functional groups can obtain dendrimers with different uses, reduce its negative effects on cells and the body, and make it widely used in drug delivery, gene therapy, and early diagnosis of major diseases. Based on the above-mentioned unique properties exhibited by PAMAM, researchers have developed dendritic polymer materials for various application scenarios. unique advantages. In addition, PAMAM has a large number of terminal groups, and can be modified in different functionalities. It can be used as a carrier for drugs, genes, and vaccines. It is a promising carrier for sustained and targeted drug release. . However, the positive ion group at the end of PAMAM makes it highly toxic to normal cells and erythrocytes. In order to overcome this defect, the terminal can be modified by fluorination, acetylation, polyethylene glycol (PEG) and the like.

At present, recombinant protein biopharmaceuticals are becoming more and more important in the application of disease treatment and prevention. Introducing protein-coding DNA or RNA into cells through a suitable carrier to guide the synthesis of cellular proteins is a hotspot in gene therapy research at present. Concomitantly, a suitable delivery system for small nucleic acid molecules such as DNA or RNA has also become an urgent research direction. . Viral vectors and non-viral vectors have been developed to deliver DNA or RNA exogenous genes to cells. Viral vectors have a certain risk of mutation from replication-deficient to wild-type, and may even lead to mutagenesis of cells. The preparation of viral vectors is complex, tedious, and highly immunogenic. Non-viral vectors represented by cationic liposomes and polymers deliver biologically active macromolecules such as plasmid DNA, siRNA, mRNA, and proteins into cells through a transfection process that is highly efficient in vitro. The nucleic acid forms a complex with the transfection reagent through electrostatic interactions and is subsequently taken up by the cell through endocytosis. Compared with viruses, these nonviral vectors have the advantages of simplicity, ease of synthesis and amplification, and low immunogenicity, but are usually less efficient than viral vectors in various in vivo applications.

Polymers and cationic liposomes are currently one of the delivery vehicles for mRNA. When liposomes or polymers are mixed with cells, they are absorbed by cells through endocytosis or similar mechanisms, and the mRNA loaded on liposomes is released into target cells in vivo, thereby producing proteins and secreting them into the blood circulation, These target cells thus act as depots for the production of this protein. After intradermal, subcutaneous or intramuscular local injection, the protein expression is mainly limited to the injection site and has a sustained expression effect, and the antigen is continuously and slowly released at the injection site. Transdermally injected mRNA-protamine complexes encoding tumor antigens are already being used in clinical trials. Other lipid-based polymers, such as Lipofectamine (invitrogen) or Mirus-Trans IT-mRNA, can effectively transfect mRNA under cultured cell conditions, but these transfection reagents are highly toxic. Most of the existing nucleic acid-cationic liposome structures are covered by phospholipid bilayers.

There is still a need for a safer and more effective mRNA carrier with higher transfection efficiency. Lipid nanoparticles (LNPs) are composed of pH-sensitive cationic lipids and neutral auxiliary phospholipids, which are self-assembled into nanoparticle structures with a size of 100-300nm through microfluidic mixing. After intravenous injection, LNP spontaneously binds to lipoprotein E in the blood, acts as a natural ligand of hepatocytes, and targets the liver. However, the preparation of LNPs requires a set of expensive precision instruments, relatively complex lipid formulations, and corresponding skills to complete, and is more suitable for larger batches of preparation. For the study of the body's immune response to nucleic acid antigens, and the development of nucleic acid vaccines, there is a need for a very simple and practical method that can easily prepare mRNA nanocomplexes that can mediate efficient mRNA transfection and protein expression after local delivery. . Aptamers (Aptamer, Apt) are small single-stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) (30-100nt) oligonucleotides with high selectivity. Apt combined with a drug carrier can selectively target target cells, enhance cell internalization, affect the proliferation of target liver cancer cells, and thereby inhibit the growth of liver cancer cells. In order to overcome the deficiencies of the prior art, the present invention prepares a novel APFHG targeting nanocomposite that enhances the effect of tumor photodynamic therapy, which not only overcomes the defects of poor water solubility and obvious side effects of Gef and Hp, but also utilizes the surface-modified PAMAM The fluorocarbon chain carries a certain amount of oxygen to improve the hypoxic state of the tumor microenvironment, enhance the therapeutic effect of PDT and improve the resistance of liver cancer cells to EGFR-TKIs, and through the dual targeting of EGFR mutant tumor cells by Apt and Gef , improve the bioavailability of the drug, and give full play to the synergistic effect of molecular targeted therapy and photodynamic therapy.

The synthesis of lipidoids has been extensively described and formulations containing these compounds are particularly suitable for delivery of oligonucleotides or nucleic acids (see Mahon et al., Bioconjug Chem. 2010 21:1448-1454; Schroeder et al., JIntern Med. 2010 267 :9-21; Akinc et al., Nat Biotechnol.2008 26:561-569; Love et al., Proc Natl Acad Sci USA.2010 107:1864-1869; Siegwart et al., Proc Natl Acad Sci USA.2011 108:12996 -3001; said references are incorporated herein in their entirety).

Although these lipidoids have been used to efficiently deliver double-stranded small interfering RNA molecules in rodents and non-human primates (see Akinc et al., Nat Biotechnol. 2008 26:561-569; Frank-Kamenetsky et al., Proc Natl Acad Sci USA.2008 105:11915-11920; Akinc et al., Mol Ther.2009 17:872-879; Love et al., Proc Natl Acad Sci U S A.2010 107:1864-1869; Leuschner et al., NatBiotechnol.2011 29:1005-1010; which is incorporated herein in its entirety), this disclosure describes their formulation (formulation) and use in the delivery of saRNA. Complexes, micelles, liposomes or particles containing these lipidoids can be prepared and thus they can lead to efficient delivery of saRNA following injection of lipidoid formulations via localized and/or systemic routes of administration. Lipidoid complexes of saRNA can be administered by various means including, but not limited to, intravenous, intramuscular, or subcutaneous routes.

In vivo delivery of nucleic acids can be influenced by many parameters including, but not limited to, formulation composition, nature of particle PEGylation, degree of loading, oligonucleotide to lipid ratio, and biophysical parameters, but not limited to particle size (Akinc et al., MolTher. 2009 17:872-879; the contents of which are hereby incorporated by reference in their entirety). Especially for different saRNAs in the composition, the siRNA may adopt the type of lipoid complex that is optimal for each or has the best effect on the composition. In vivo activity can be tested on formulations with different lipid classes including, but not limited to, penta[3-(1-laurylaminopropionyl)]-triethylenetetramine hydrochloride (TETA-5LAP; aka98N12 -5, see Murugaiah et al., Analytical Biochemistry, 401:61 (2010)), C12-200 (including derivatives and variants) and MD1. Compositions of saRNA and siRNA of the present invention can also use the "C12-200" lipidoid as a delivery system, which was described by Love et al., Proc Natl Acad Sci USA. 2010 107:1864-1869 and Liu and Huang , Molecular Therapy.2010 669-670 is disclosed; The content of described two documents is fully incorporated herein by reference.

Lipidoid formulations may comprise particles comprising 3 or 4 or more components in addition to the saRNA and siRNA of the invention. As an example, formulations with certain lipidoids include but are not limited to 98N12-5 and may contain 42% lipid, 48% cholesterol and 10% PEG (C14 alkyl chain length). As another example, formulations with certain lipidoids include but are not limited to C12-200 and may contain 50% lipidoid, 10% distearoylphosphatidylcholine, 38.5% cholesterol, and 1.5% PEG-DMG. In one embodiment, saRNA formulated with a lipidoid for systemic intravenous administration can target the liver. For example, one using saRNA and containing a lipid molar composition of 42% 98N12-5, 48% cholesterol, and 10% PEG-lipid resulted in a final weight ratio of about 7.5 to 1 total lipid to saRNA and PEG-lipid A final optimized intravenous formulation with a C14 alkyl chain length on the average particle size of approximately 50–60 nm can result in a distribution of the formulation to the liver of more than 90% (Akinc et al., Mol Ther. 2009 17:872-879; described The content of the document is incorporated herein by reference in its entirety). In another example, an intravenous formulation using C12-200 (see U.S. provisional application 61/175,770 and published international application WO2010129709, the contents of each of which are herein incorporated by reference in their entirety) lipidoid Can have a C12-200/distearoylphosphatidylcholine/cholesterol/PEG-DMG molar ratio of 50/10/38.5/1.5, a total lipid to nucleic acid weight ratio of 7:1 and an average particle size of 80 nm for efficient delivery saRNA (see, Love et al., Proc Natl Acad Sci USA. 2010 107:1864-1869, the contents of which are hereby incorporated by reference in their entirety). In another embodiment, formulations containing MD1 lipidoids can be used to effectively deliver saRNA, siRNA to hepatocytes in vivo. The characteristics of an optimized lipidoid formulation for intramuscular or subcutaneous routes can be significantly enhanced depending on the target cell type and the ability of the formulation to diffuse through the extracellular matrix into the blood. Although a particle size of less than 150 nm may be required for efficient hepatocyte delivery due to adaptation to the size of endothelial fenestrae (see, Akinc et al., Mol Ther. 2009 17:872-879, the contents of which are incorporated herein by reference ), but the use of lipidoid-formulated saRNAs to deliver formulations to other cell types, including but not limited to endothelial cells, myeloid cells, and muscle cells, may similarly not be limited by size. In vivo delivery of siRNA to other non-hepatic cells such as myeloid and endothelial cells has been reported using lipidoid formulations (see Akinc et al., Nat Biotechnol. 2008 26:561-569; Leuschner et al., Nat Biotechnol. 2011 29:1005 -1010; Cho et al. Adv. Funct. Mater. 2009 19:3112-3118; 8th International Judah Folkman Conference, Cambridge, MA October 8-9, 2010). For efficient delivery to myeloid cells such as monocytes, lipidoid formulations may have similar molar ratios of components. Different ratios of lipidoids and other components (including but not limited to distearoylphosphatidylcholine, cholesterol and PEG-DMG) can be used to optimize the formulation of saRNA for delivery to different cell types including but not limited to liver cells, myeloid cells, muscle cells, etc. For example, molar ratios of components may include, but are not limited to, 50% C12-200, 10% distearoylphosphatidylcholine, 38.5% cholesterol, and 1.5% PEG-DMG (see Leuschner et al., Nat Biotechnol. 2011 29: 1005-1010; the contents of said documents are hereby incorporated by reference in their entirety). The use of lipid formulations for local delivery of nucleic acids to cells (such as, but not limited to, adipocytes and muscle cells) by subcutaneous or intramuscular delivery may not require all of the formulation components required for systemic delivery, and may itself contain only the Lipids and saRNA. Liposomes, Lipoplexes and Lipid Nanoparticles The saRNA of the invention can be formulated using one or more liposomes, lipid-nucleic acid complexes or lipid nanoparticles. In one embodiment, the pharmaceutical composition of saRNA comprises liposomes. Liposomes consist essentially of lipid bilayers and can be used as delivery vehicles for the administration of oxygen and pharmaceutical agents. Liposomes can have different dimensions, but are not limited to multilamellar vesicles (MLVs), which can be hundreds of nanometers in diameter and can contain a series of concentric bilayers separated by narrow aqueous compartments; small single cells, which can be less than 50 nm in diameter. Membrane vesicles (SUVs), and large unilamellar vesicles (LUVs) which can be between 50 and 500 nm in diameter. Liposome designs can include, but are not limited to, opsonins or ligands to improve liposome binding to unhealthy tissue or to activate events such as, but not limited to, endocytosis. Liposomes can contain low or high pH to improve drug delivery.

Formation of liposomes can depend on various physicochemical characteristics such as, but not limited to, the drug formulation and liposome components entrapped, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped substance and Its potential toxicity, any additional processes involved during application and/or delivery of the vesicles, optimized specifications, polydispersity and shelf life of the vesicles for the intended application, as well as batch-to-batch reproducibility and large-scale production safety and efficiency Possibility of liposomal products.

In one embodiment, the pharmaceutical compositions described herein may comprise, without limitation, a variety of liposomes, such as liposomes from 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) , DiLa2 liposomes from MarinaBiotech (Bothell, WA), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2- Dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA) and those liposomes formed by MC3 (US20100324120), as well as liposomes that can deliver small molecule drugs.

In one embodiment, the pharmaceutical compositions described herein may comprise, without limitation, a variety of liposomes, such as from the synthesis of stabilized plasmid-lipid particles that have been previously described and shown to be suitable for in vitro and in vivo delivery of oligonucleotides Liposomes formed in (SPLP) or stabilized nucleic acid lipid particles (SNALP) (seeing Wheeler et al., Gene Therapy.1999 6:271-281; Zhang et al., Gene Therapy.1999:1438-1447; Jeffs et al. People, PharmRes.2005 22:362-372; Morrissey et al., Nat Biotechnol.2005 2:1002-1007; Zimmermann et al., Nature.2006 441:111-114; Heyes et al., J ContrRel.2005 107:276- 287; Semple et al., Nature Biotech. 2010 28:172-176; Judge et al., J Clin Invest. 2009 119:661-673; deFougerolles Hum Gene Ther. 2008 19:125-132). Liposome formulations may consist of 3 to 4 lipid components other than saRNA. As an example, liposomes may contain, but are not limited to, 55% cholesterol, 20% distearoylphosphatidylcholine (DSPC), 10% PEG-SDSG, and 15% 1,2-dioleyloxy-N, N-Dimethylaminopropane (DODMA) as described by Jeffs et al. In another example, certain liposome formulations may contain, but are not limited to, 48% cholesterol, 20% DSPC, 2% PEG-c-DMA, and 30% cationic lipids, where the cationic lipids may be 1,2-di Stearoyloxy-N,N-dimethylaminopropane (DSDMA), DODMA, DLin-DMA, or 1,2-Dilinolyloxy-3-dimethylaminopropane (DLenDMA), as described by Heyes et al. . In another example, the nucleic acid-lipid particle can comprise a cationic lipid comprising about 50 mol% to about 85 mol% of the total lipid present in the particle; a non-cationic lipid comprising about 50% of the total lipid present in the particle; 13 mol% to about 49.5 mol%; and a conjugated lipid that inhibits particle aggregation, which accounts for about 0.5 mol% to about 2 mol% of the total lipids present in the particle, as described in patent WO 2009127060, the content of which is adopted by It is incorporated herein by reference in its entirety. In another example, the nucleic acid-lipid particle can be any nucleic acid-lipid particle disclosed in US2006008910, the contents of which are incorporated herein by reference in their entirety. As a non-limiting example, a nucleic acid-lipid particle can comprise a cationic lipid of Formula I, a non-cationic lipid, and a conjugated lipid that inhibits particle aggregation.

In one embodiment, saRNA or siRNA can be formulated in lipid vesicles, which can have crosslinks between functionalized lipid bilayers.

In one embodiment, liposomes may contain sugar-modified lipids as disclosed in US5595756, the contents of which are hereby incorporated by reference in their entirety. Lipids may be gangliosides and cerebrosides in amounts of about 10 mol%.

In one embodiment, saRNA or siRNA can be formulated in liposomes comprising cationic lipids. Liposomes may have a molar ratio of nitrogen atoms in cationic lipids to phosphate esters in saRNA (N:P ratio) between 1:1 and 20:1, as described in International Publication No. WO2013006825, the contents of which Incorporated herein by reference in its entirety. In another embodiment, the liposomes may have an N:P ratio greater than 20:1 or less than 1:1.

In one embodiment, saRNA or siRNA can be formulated in a lipid-polycation complex. Formation of lipid-polycation complexes can be achieved by methods known in the art and/or as described in US Publication No. US0120178702. As a non-limiting example, polycations may include cationic peptides or polypeptides such as, but not limited to, polylysine, polyornithine and/or polyarginine and cationic peptides described in International Publication No. WO2012013326. In one embodiment, saRNA can be formulated in a lipid-polycation complex, which can also comprise a neutral lipid such as, but not limited to, cholesterol or dioleoylphosphatidylethanolamine ( DOPE).

Liposome formulation can be influenced by, but not limited to, the choice of cationic lipid component, degree of cationic lipid saturation, nature of PEGylation, ratio of total components, and biophysical parameters such as size. In one example from the literature (Semple et al., Nature Biotech. 2010 28:172-176), a liposome formulation was composed of 57.1% cationic lipid, 7.1% dipalmitoylphosphatidylcholine, 34.3% cholesterol and 1.4% PEG -c-DMA composition.

In some embodiments, the ratio of PEG in a lipid nanoparticle (LNP) formulation can be increased or decreased and/or the carbon chain length of the PEG lipid can be adjusted from C14 to C18 to alter the pharmacokinetics of the LNP formulation and/or or biodistribution. As a non-limiting example, an LNP formulation may contain PEG-cDOMG, DSPC and cholesterol in a molar ratio of 1-5% lipid compared to cationic lipid. In another embodiment, PEG-c-DOMG can be replaced by PEG lipids such as but not limited to PEG-DSG (1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol) or PEG-DPG (1,2 dipalmitoyl-sn-glycerol, methoxypolyethylene glycol). Cationic lipids can be selected from any lipid known in the art, such as, but not limited to, DLin-MC3-DMA, DLin-DMA, C12-200, and DLin-KC2-DMA.

In one embodiment, saRNA or siRNA can be formulated in lipid nanoparticles such as those described in International Publication No. WO 2012170930.

In one embodiment, the cationic lipids that can be used in the formulations of the present invention can be selected from, but not limited to, the cationic lipids described in the following documents: International Publication Nos. . In another embodiment, the cationic lipid may be selected from, but not limited to, the formulas described in International Publication Nos. WO2012040184, WO2011153120, WO2011149733, WO2011090965, WO2011043913, WO2011022460, WO2012061259, WO2012054365 and WO2012044638. In yet another embodiment, the cationic lipid may be selected from, but not limited to, Formula CLI-CLXXIX of International Publication No. WO2008103276, Formula CLI-CLXXIX of U.S. Patent No. 7,893,302, Formula CLI-CLXXXXII of U.S. Patent No. 7,404,969, and U.S. Patent Publication Formulas I-VI of No. US20100036115. In yet another embodiment, the cationic lipid may be a multivalent cationic lipid such as the cationic lipids disclosed in Gaucheron et al., US Pat. No. 7,223,887, the contents of which are incorporated herein by reference in their entirety. Cationic lipids can have a positively charged head group comprising two quaternary amine groups and a hydrophobic portion comprising four hydrocarbon chains, as described in U.S. Pat. No. 7,223,887, the contents of which are incorporated by reference in their entirety. into this article. In yet another embodiment, the cationic lipid can be biodegradable. The cationic lipid may have one or more biodegradable groups located on the lipid portion of the cationic lipid, as described in Formulas I-IV of US20130195920, the contents of which are incorporated herein by reference in their entirety. As a non-limiting example, the cationic lipid may be selected from (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N, N-Dimethylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N5N-dimethylpentacosa-16,19-dien-8-amine, (13Z ,16Z)-N,N-Dimethyldocos-13,16-dien-5-amine, (12Z,15Z)-N,N-Dimethyldocos-12,15-di En-4-amine, (14Z,17Z)-N,N-Dimethyltricosane-14,17-dien-6-amine, (15Z,18Z)-N,N-Dimethyltetracosamide Carbo-15,18-dien-7-amine, (18Z,21Z)-N,N-dimethylhexacosa-18,21-dien-10-amine, (15Z,18Z)-N, N-Dimethyltetracosan-15,18-dien-5-amine, (14Z,17Z)-N,N-dimethyltricosac-14,17-dien-4-amine, (19Z,22Z)-N,N-Dimethyloctadecano-19,22-dien-9-amine, (18Z,21Z)-N,N-Dimethyloctadecano-18,21 -dien-8-amine, (17Z,20Z)-N,N-dimethylhexadec-17,20-dien-7-amine, (16Z,19Z)-N,N-dimethyl Pentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N-Dimethylheptakadec-22,25-dien-10-amine, (21Z,24Z) -N,N-Dimethyletradeca-21,24-dien-9-amine, (18Z)-N,N-Dimethylheptaka-18-en-10-amine, (17Z) -N,N-Dimethylhexadec-17-en-9-amine, (19Z,22Z)-N,N-dimethyloctadec-19,22-dien-7-amine, N,N-Dimethylheptacosan-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[ (11Z,14Z)-1-Nonyleicos-11,14-dien-1-yl]pyrrolidine, (20Z)-N,N-Dimethylheptosa-20-en-10- Amine, (15Z)-N,N-Dimethylheptosa-15-en-10-amine, (14Z)-N,N-Dimethylnonac-14-en-10-amine, (17Z)-N,N-Dimethylnonacosa-17-en-10-amine, (24Z)-N,N-Dimethyltritridec-24-en-10-amine, (20Z )-N,N-Dimethylnonacosa-20-en-10-amine, (22Z)-N,N-dimethylhexadec-22-en-10-amine, (16Z)- N,N-Dimethylpentacos-16-en-8-amine, (12Z,15Z)-N,N- Dimethyl-2-nonyleco-12,15-dien-1-amine, (13Z,16Z)-N,N-dimethyl-3-nonyleco-13,16 -Dien-1-amine, N,N-Dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine, 1-[(1S,2R)- 2-hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nineteen Carbon-10-amine, N,N-dimethyl-21-[(1S,2R)-2-octylcyclopropyl]eicos-10-amine, N,N-dimethyl-1- [(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]nonadecan-10-amine, N,N-dimethyl-1- [(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl H-[(1R,2S)-2-undecylcyclopropyl]tetradecyl Carbo-5-amine, N,N-dimethyl-3-{7-[(1S,2R)-2-octylcyclopropyl]heptyl}dodecan-1-amine, 1-[(1R ,2S)-2-heptylcyclopropyl]-N,N-dimethyloctadec-9-amine, 1-[(1S,2R)-2-decylcyclopropyl]-N,N- Dimethylpentadecan-6-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]pentadecan-8-amine, R-N,N-dimethyl Base-1-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, S-N,N-dimethyl-1 -[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, 1-{2-[(9Z,12Z)- Octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}pyrrolidine, (2S)-N,N-dimethyl-1-[( 9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-[(5Z)-oct-5-en-1-yloxy]propan-2-amine, 1-{2 -[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}azetidine, (2S)-1-( Hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-2-amine, (2S)-1- (Heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-2-amine, N,N-di Methyl-1-(nonyloxy)-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl- 1-[(9Z)-octadec-9-en-1-yloxy]-3-(octyloxy)propan-2-amine; (2S)-N,N-dimethyl-1-[( 6Z,9Z,12Z)-Octadecyl-6,9 ,12-trien-1-yloxy]-3-(octyloxy)propan-2-amine, (2S)-1-[(11Z,14Z)-eicos-11,14-diene-1 -yloxy]-N,N-dimethyl-3-(pentyloxy)propan-2-amine, (2S)-1-(hexyloxy)-3-[(11Z,14Z)-eicosan -11,14-dien-1-yloxy]-N,N-dimethylpropan-2-amine, 1-[(11Z,14Z)-eicos-11,14-dien-1-yl Oxygen]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(13Z,16Z)-docos-13,16-dien-1-yloxy] -N,N-Dimethyl-3-(octyloxy)propan-2-amine, (2S)-1-[(13Z,16Z)-docos-13,16-dien-1-yl Oxygen]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, (2S)-1-[(13Z)-docos-13-en-1-yloxy]- 3-(Hexyloxy)-N,N-Dimethylpropan-2-amine, 1-[(13Z)-Docos-13-en-1-yloxy]-N,N-Dimethyl -3-(octyloxy)propan-2-amine, 1-[(9Z)-hexadec-9-en-1-yloxy]-N,N-dimethyl-3-(octyloxy) Propan-2-amine, (2R)-N,N-dimethyl-H(1-methyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-diene- 1-yloxy]propan-2-amine, (2R)-1-[(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-deca Octa-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-(octyloxy)-3-({8-[(1S,2S)- 2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1-{[8- (2-octylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine and (11E,20Z,23Z)-N,N-dimethylnonacosa-11, 20,2-Trien-10-amine or a pharmaceutically acceptable salt or stereoisomer thereof.

In one embodiment, the lipid may be a cleavable lipid, such as those described in International Publication No. WO2012170889, the contents of which are hereby incorporated by reference in their entirety.

In one embodiment, the nanoparticles described herein may comprise at least one cationic polymer described herein and/or known in the art.

在一个实施方案中，阳离子脂质可以通过本领域已知和/或如国际公开号WO2012040184、WO2011153120、WO2011149733、WO2011090965、WO2011043913、WO2011022460、WO2012061259、WO2012054365、WO2012044638、WO2010080724和WO201021865中所述的方法合成； The contents of each of said documents are hereby incorporated by reference in their entirety.

In one embodiment, a LNP formulation of saRNA or siRNA may contain PEG-c-DOMG at a molar ratio of 3% lipid. In another embodiment, the LNP formulation of saRNA may contain PEG-c-DOMG at a molar ratio of 1.5% lipid.

In one embodiment, the pharmaceutical composition of saRNA or siRNA may comprise at least one pegylated lipid described in International Publication No. 2012099755, the contents of which are incorporated herein by reference in their entirety. In one embodiment, the LNP formulation may contain PEG-DMG2000 (1,2-dimyristoyl-sn-glyceroyl-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000). In one embodiment, the LNP formulation may contain PEG-DMG2000, a cationic lipid known in the art, and at least one other component. In another embodiment, the LNP formulation may contain PEG-DMG2000, a cationic lipid known in the art, DSPC and cholesterol. As a non-limiting example, a LNP formulation may contain PEG-DMG2000, DLin-DMA, DSPC and cholesterol. As another non-limiting example, an LNP formulation may contain PEG-DMG 2000, DLin-DMA, DSPC, and cholesterol in a molar ratio of 2:40:10:48 (see, e.g., Geall et al., Nonviral delivery of self-amplifying RNA vaccines, PNAS 2012 PMID:22908294; said literature is incorporated herein by reference in its entirety). As another non-limiting example, the saRNA described herein can be formulated in nanoparticles for delivery by parenteral routes, as described in US Pub. No. 20120207845, the contents of which are incorporated herein by reference in their entirety. The cationic lipid may also be a cationic lipid as disclosed in US20130156845, US20130129785, WO2012047656, WO2010144740, WO2013086322 or WO2012016184, the contents of each of which are incorporated herein by reference in their entirety.

In one embodiment, the saRNA or siRNA of the invention can be formulated with multiple cationic lipids, such as the first and second cationic lipids described in US20130017223, the contents of which are incorporated herein by reference in their entirety. The first cationic lipid can be selected based on a first property and the second cationic lipid can be selected based on a second property, wherein the property can be determined as outlined in US20130017223, the content of which is hereby incorporated by reference in its entirety . In one embodiment, the first and second properties are complementary.

In another embodiment, saRNA or siRNA can be formulated with lipid particles comprising one or more cationic lipids and one or more second lipids and one or more nucleic acids, wherein the lipid particles comprise solid , as described in US Patent Publication No. US20120276209 by Cullis et al., the contents of which are incorporated herein by reference in their entirety.

In one embodiment, a saRNA or siRNA of the invention may be complexed with a cationic amphiphile in an oil-in-water (o/w) emulsion, as described in EP2298358, the contents of which are hereby incorporated by reference in their entirety . The cationic amphiphile may be a cationic lipid, modified or unmodified spermine, bupivacaine or benzalkonium chloride, and the oil may be a vegetable or animal oil. As a non-limiting example, at least 10% of the nucleic acid-cationic amphiphile complex is in the oil phase of an oil-in-water emulsion (see, e.g., the complex described in European Publication No. EP2298358, the contents of which are incorporated by reference incorporated herein in its entirety).

In one embodiment, saRNA compositions of the invention can be formulated with a composition comprising a mixture of cationic compounds and neutral lipids. As a non-limiting example, the cationic compound may be formula (I) disclosed in WO1999010390, the contents of which are fully disclosed herein by way of application, and the neutral lipid may be selected from diacylphosphatidylcholine , diacylphosphatidylethanolamine, ceramide and sphingomyelin.

In one embodiment, the LNP formulation may be formulated by the methods described in International Publication No. WO2011127255 or WO2008103276, each of which is incorporated herein by reference in its entirety. As a non-limiting example, the saRNA of the present invention may be encapsulated in any lipid nanoparticle (LNP) formulation as described in WO2011127255 and/or WO2008103276; the contents of each of which are incorporated by reference in their entirety. into this article. In one embodiment, the LNP formulations described herein may comprise a polycationic composition. As a non-limiting example, the polycation composition may be selected from formulas 1-60 of US Patent Publication No. US20050222064; the contents of which are incorporated herein by reference in their entirety. In another embodiment, LNP formulations comprising polycationic compositions can be used to deliver the saRNA described herein in vivo and/or in vitro.

In one embodiment, the LNP formulations described herein may additionally comprise a penetration enhancing molecule. Non-limiting penetration enhancing molecules are described in US Patent Publication No. US20050222064.

In one embodiment, the pharmaceutical composition may be formulated in liposomes such as, but not limited to, DiLa2 liposomes (Marina Biotech, Bothell, WA), NOV340 (Marina Biotech, Bothell, WA), Liposomes based on neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine) (e.g., for siRNA delivery in ovarian cancer (Landen et al., Cancer Biology & Therapy 2006 5(12) 1708 -1713) and hyaluronan-coated liposomes (Quiet Therapeutics, Israel). In some embodiments, the pharmaceutical composition can be formulated with any amphoteric liposomes disclosed in WO2008/043575 and US8580297, the The content is incorporated herein by reference in its entirety. Amphoteric liposomes may comprise a mixture of lipids comprising cationic amphiphiles, anionic amphiphiles, and optionally one or more neutral amphiphiles The amphiphilic liposomes may comprise an amphiphilic molecule-based amphiphilic compound whose head group is replaced by one or more amphiphilic groups. In some embodiments, the pharmaceutical composition may contain an isoelectric point between 4 and 9 Amphoteric lipid formulation of one or more amphoteric groups, as disclosed in US20140227345.

The nanoparticle formulation can be a carbohydrate nanoparticle comprising a carbohydrate carrier and a nucleic acid molecule (eg, saRNA or siRNA). As a non-limiting example, carbohydrate carriers may include, but are not limited to, anhydride-modified phytoglycogen or glycogen succinate, phytoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta -dextrin.

Lipid nanoparticle formulations can be improved by replacing cationic lipids with biodegradable cationic lipids called rapidly eliminating lipid nanoparticles (reLNPs). Ionizable cationic lipids, such as, but not limited to, DLinDMA, DLinKC2-DMA, and DLin-MC3-DMA, have been shown to accumulate in plasma and tissues over time and may be a potential source of toxicity. The rapid metabolism of rapidly eliminating lipids can improve the tolerability and therapeutic index of lipid nanoparticles in rats by orders of magnitude from 1 mg/kg to 10 mg/kg doses. Incorporation of enzymatically degraded ester linkages could improve the degradation and metabolic profile of the cationic components while still maintaining the activity of the reLNP formulation. The ester bond can be located intrinsically inside the lipid chain or it can be located terminally at the terminal end of the lipid chain. Internal ester linkages can replace any carbon in the lipid chain.

In one embodiment, the saRNA or siRNA is formulated as a lipid-nucleic acid complex, such as, without limitation, the ATUPLEXTM system, DACC system, DBTC system and other siRNA-liposomal DNA from Silence Therapeutics (London, UK) Composite technology, STEMFECT™ from (Cambridge, MA) and polyethyleneimine (PEI) or protamine-based directed and non-directed nucleic acid delivery. In one embodiment, such formulations can also be constructed or compositions altered so that they are passively or actively directed to different cell types in vivo, including but not limited to hepatocytes, immune cells, tumor cells, endothelial cells, antigen presenting cells and leukocyte.

In one embodiment, the saRNA or siRNA is formulated as solid lipid nanoparticles. Solid lipid nanoparticles (SLN) can be spherical in shape with an average diameter between 10 and 1000 nm. SLNs possess a solid lipid core matrix that can dissolve lipophilic molecules and can be stabilized with surfactants and/or emulsifiers. In yet another embodiment, the lipid nanoparticles may be self-assembling lipid-polymer nanoparticles (see Zhang et al., ACS Nano, 2008, 2(8) 1696-1702).

In one embodiment, the saRNA or siRNA of the invention can be formulated for controlled release and/or targeted delivery. As used herein, "controlled release" refers to the release profile of a pharmaceutical composition or compound that conforms to a specific release pattern to achieve a therapeutic result. In one embodiment, saRNA or siRNA can be encapsulated in a delivery agent described herein and/or known in the art for controlled release and/or targeted delivery. As used herein, the term "encapsulate" means to surround, surround or wrap. Encapsulation may be substantial, complete or partial as it relates to the formulation of a compound of the invention. The term "substantially encapsulated" means at least greater than 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.9%, or Greater than 99.999% encapsulation.

A pharmaceutical composition or compound of the invention may be enclosed, surrounded or encapsulated within a delivery agent. "Partially encapsulated" means that less than 10%, 10%, 20%, 30%, 40%, 50% or less of a pharmaceutical composition or compound of the invention may be enclosed, surrounded, or encapsulated within the delivery agent. Advantageously, encapsulation can be determined by measuring escape or activity of a pharmaceutical composition or compound of the invention using fluorescence and/or electron micrographs. For example, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% , 99%, 99.9%, 99.99%, or greater than 99.99% of the pharmaceutical composition or compound of the invention is encapsulated in the delivery agent.

In another embodiment, the saRNA or siRNA can be encapsulated into lipid nanoparticles or rapidly eliminated lipid nanoparticles, and the lipid nanoparticles or rapidly eliminated lipid nanoparticles can then be encapsulated into the and/or rapidly eliminated lipid nanoparticles described herein. Or in polymers, hydrogels and/or surgical sealants known in the art. As a non-limiting example, the polymer, hydrogel, or surgical sealant can be PLGA, ethylene vinyl acetate (EVAc), poloxamer, (Nano therapeutics, Inc. Alachua, FL), (Ha lozyme Therapeutics, San Diego CA), surgical sealants such as fibrinogen polymers (Ethicon Inc. Cornelia, GA), (Baxter International, Inc Deerfield, IL), PEG-based sealants, and (Baxter International, Inc Deerfield , IL).

In another embodiment, lipid nanoparticles can be encapsulated in any polymer known in the art that can form a gel when injected into a subject. As another non-limiting example, lipid nanoparticles can be encapsulated in a polymer matrix that can be biodegradable.

In one embodiment, the saRNA or siRNA formulation for controlled release and/or targeted delivery may further comprise at least one controlled release coating agent. Controlled release coating agents include but are not limited to polyvinylpyrrolidone/vinyl acetate copolymer, polyvinylpyrrolidone, hydroxypropylmethylcellulose, hydroxypropylcellulose, hydroxyethylcellulose, EUDRAGIT EUDRAGIT and cellulose derivatives Such as ethyl cellulose aqueous dispersion.

In one embodiment, the controlled release and/or targeted delivery formulation may comprise at least one degradable polyester which may contain polycationic side chains. Degradable polyesters include, but are not limited to, poly(serine esters), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline esters), and combinations thereof. In another embodiment, the degradable polyester can comprise PEG conjugation to form a pegylated polymer The guide lipid formulation of the guide section. As a non-limiting example, the targeting moiety of formula I of US20130202652 may be selected to facilitate localization of lipids to desired organs, tissues, cells, cell types or subtypes or organelles. Non-limiting targeting moieties included in the invention include transferrin, anisamide, RGD peptide, prostate specific membrane antigen (PSMA), fucose, antibodies or aptamers.

In one embodiment, saRNA or siRNA of the invention can be encapsulated in therapeutic nanoparticles.治疗性纳米粒子可以通过本文所述的和本领域已知的方法配制，如，但不限于国际公开号WO2010005740、WO2010030763、WO2010005721、WO2010005723、WO2012054923、美国公开号US20110262491、US20100104645、US20100087337、US20100068285、US20110274759， US20100068286 and US20120288541 and US Patent Nos. 8,206,747, 8,293,276, 8,318,208 and 8,318,211; the contents of each of which are hereby incorporated by reference in their entirety. In another embodiment, therapeutic polymeric nanoparticles can be identified by the methods described in US Publication No. US20120140790, the contents of which are incorporated herein by reference in their entirety.

In one embodiment, therapeutic nanoparticles can be formulated for sustained release. As used herein, "sustained release" refers to a pharmaceutical composition or compound that is released at a consistent rate over a specified period of time. Time periods can include, but are not limited to hours, days, weeks, months and years. As a non-limiting example, sustained-release nanoparticles may comprise a polymer and a therapeutic agent such as, but not limited to, saRNA of the present invention (see International Publication No. 2010075072 and US Publication Nos. US20100216804, US20110217377, and US20120201859, each of which incorporated herein by reference in its entirety).

In one embodiment, therapeutic nanoparticles can be formulated to be target specific. As a non-limiting example, a therapeutic nanoparticle may comprise a corticosteroid (see International Publication No. WO2011084518; the contents of which are hereby incorporated by reference in their entirety). In one embodiment, therapeutic nanoparticles can be formulated to be cancer specific. As a non-limiting example, therapeutic nanoparticles can be formulated in nanoparticles described in International Publication Nos. WO2008121949, WO2010005726, WO2010005725, WO2011084521, and U.S. Publication Nos. US20100069426, US20120004293, and US20100104655, the contents of each of which are incorporated by reference. manner is incorporated herein in its entirety.

In one embodiment, nanoparticles of the invention may comprise a polymer matrix. As a non-limiting example, nanoparticles may comprise two or more polymers such as, but not limited to, polyethylene, polycarbonate, polyanhydrides, polyhydroxyacids, polypropyl fumarate, polycaprolactone, poly Amides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates , polyurea, polystyrene, polyamine, polylysine, poly(ethyleneimine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4- Hydroxy-L-proline ester) or a combination thereof.

In one embodiment, the therapeutic nanoparticles comprise diblock copolymers. In one embodiment, the diblock copolymer may comprise PEG in combination with polymers such as, but not limited to, polyethylene, polycarbonate, polyanhydrides, polyhydroxyacids, polypropyl fumarate, polycaprolactone , polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyano Acrylates, polyurea, polystyrene, polyamine, polylysine, poly(ethyleneimine), poly(serine ester), poly(L-lactide-co-L-lysine), poly( 4-hydroxy-L-proline ester) or a combination thereof.

As a non-limiting example, the therapeutic nanoparticles comprise PLGA-PEG block copolymers (see US Publication No. US20120004293 and US Patent No. 8,236,330, each of which is herein incorporated by reference in its entirety). In another non-limiting example, the therapeutic nanoparticles are stealth nanoparticles comprising diblock copolymers of PEG and PLA or PEG and PLGA (see U.S. Patent No. 8,246,968 and International Publication No. WO2012166923, each of which The contents are incorporated by reference herein in their entirety).

In one embodiment, the therapeutic nanoparticles may comprise multi-block copolymers such as, but not limited to, those described in U.S. Pat. Nos. 8,263,665 and 8,287,910; the contents of each of which are incorporated by reference Incorporated herein in its entirety.

In one embodiment, the block copolymers described herein can be contained in a multivalent ion complex comprising non-polymeric micelles and the block copolymer. (See eg, US Publication No. 20120076836; the contents of which are hereby incorporated by reference in their entirety).

In one embodiment, the therapeutic nanoparticles may comprise at least one acrylic polymer. Acrylic polymers include, but are not limited to, acrylic acid, methacrylic acid, acrylic and methacrylic acid copolymers, methyl methacrylate copolymers, ethoxyethyl methacrylate, cyanoethyl methacrylate, aminoalkylmethacrylic acid Ester copolymers, poly(acrylic acid), poly(methacrylic acid), polycyanoacrylates, and combinations thereof.

In one embodiment, the therapeutic nanoparticles may comprise at least one amine-containing polymer such as, but not limited to, polylysine, polyethyleneimine, poly(amidoamine) dendrimers, poly(β-amino esters) (see, eg, US Pat. No. 8,287,849; the contents of which are hereby incorporated by reference in their entirety), and combinations thereof.

In one embodiment, the therapeutic nanoparticles can comprise at least one degradable polyester which can contain polycationic side chains. Degradable polyesters include, but are not limited to, poly(serine esters), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline esters), and combinations thereof. In another embodiment, the degradable polyester may comprise PEG conjugation to form a pegylated polymer.

In another embodiment, a therapeutic nanoparticle can include conjugation of at least one targeting ligand. The targeting ligand can be any ligand known in the art, such as, but not limited to, a monoclonal antibody. (Kirpotin et al., Cancer Res. 2006 66:6732-6740; the contents of which are hereby incorporated by reference in their entirety).

In one embodiment, saRNA or siRNA can be encapsulated in, linked to, and/or associated with a synthetic nanocarrier, which can be formulated using methods known in the art and/or described herein. As a non-limiting example, synthetic nanocarriers can be formulated by the methods described in International Publication Nos. WO2010005740, WO2010030763, and WO201213501, and US Publication Nos. US20110262491, US20100104645, US20100087337, and US2012024422.

In one embodiment, synthetic nanocarriers can be formulated for targeted release. In one embodiment, synthetic nanocarriers can be formulated to release saRNA or siRNA at a specified pH and/or after a desired time interval. As a non-limiting example, synthetic nanoparticles can be formulated to release saRNA after 24 hours and/or at pH 4.5 (see International Publication Nos. WO2010138193 and WO2010138194 and US Publication Nos. US20110020388 and US20110027217).

In one embodiment, synthetic nanocarriers can be formulated for controlled and/or sustained release of the saRNA or siRNA described herein. As a non-limiting example, synthetic nanocarriers for sustained release can be formulated by methods known in the art, described herein, and/or as described in International Publication No. WO2010138192 and US Publication No. 20100303850.

In one embodiment, the saRNA or siRNA of the invention can be encapsulated in a lipid formulation to form stable nucleic acid-lipid particles (SNALP) as described in US8546554 by Fougerolles et al. Lipids can be cationic or non-cationic. In one non-limiting example, the lipid to nucleic acid ratio (mass/mass ratio) (e.g., lipid to saRNA ratio) will be in the range of about 1:1 to about 50:1, about 1:1 to about 25:1, About 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1, or 5:1, 6:1, 7:1, 8:1, 9:1, 10:1 or 11:1 range. In another example, SNALP contains 40% 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (lipid A), 10% dioleyl Acylphosphatidylcholine (DSPC), 40% cholesterol, 10% polyethylene glycol (PEG)-C-DOMG (mol%), particle size 63.0±20 nm and nucleic acid/lipid ratio 0.027. In another embodiment, the saRNA or siRNA of the invention can be formulated with nucleic acid-lipid particles comprising endosomal membrane destabilizers as disclosed in Lam et al., US7189705, the contents of which are incorporated by reference in their entirety. into this article. As a non-limiting example, the endosomal membrane destabilizing species can be Ca2 ⁺ ions.

In one embodiment, the saRNA or siRNA of the invention can be delivered to cells using a composition comprising an expression vector in a lipid formulation, as described in US6086913 to Tam et al. The composition disclosed by Tam is serum stable and comprises an expression vector comprising first and second inverted repeats from adeno-associated virus (AAV), a rep gene from AAV, and a nucleic acid fragment. Expression vectors in Tam are complexed with lipids.

In one embodiment, the saRNA or siRNA of the invention may be formulated with a lipid formulation as disclosed in de Fougerolles et al., US20120270921, the contents of which are hereby incorporated by reference in their entirety. In one non-limiting example, the lipid formulation can include a cationic lipid having Formula A described in US20120270921, the contents of which are incorporated herein by reference in their entirety. In another non-limiting example, the exemplary nucleic acid-lipid particle compositions disclosed in Table A of US20120270921 can be used with the saRNA of the invention.

In one embodiment, the saRNA or siRNA of the present invention may be fully encapsulated in a lipid particle as disclosed in Maurer et al. US20120276207, the contents of which are hereby incorporated by reference in their entirety. These particles may comprise a lipid composition having preformed lipid vesicles, a charged therapeutic agent, and a destabilizing agent to form a mixture of preformed vesicles and therapeutic agent in a destabilizing solvent, wherein the The destabilizing solvent effectively destabilizes the membrane of preformed lipid vesicles without disrupting the vesicles.

In one embodiment, the saRNA or siRNA of the invention can be formulated with conjugated lipids. In a non-limiting example, the conjugated lipid may have a formula as described in US20120264810 to Lin et al., the contents of which are hereby incorporated by reference in their entirety. Conjugated lipids can form lipid particles that also contain cationic lipids, neutral lipids, and lipids capable of reducing aggregation.

In one embodiment, the saRNA or siRNA of the present invention may be formulated in a neutral liposomal formulation disclosed in Fitzgerald et al. US20120244207, the contents of which are incorporated herein by reference in their entirety. The phrase "neutral liposome formulation" refers to a liposome formulation that has a near-neutral or neutral surface charge at physiological pH. Physiological pH may be, for example, about 7.0 to about 7.5, or for example about 7.5, or for example 7.0, 7.1, 7.2, 7.3, 7.4 or 7.5, or for example 7.3, or for example 7.4. An example of a neutral liposomal formulation is a dissociable lipid nanoparticle (iLNP). Neutral liposomal formulations may contain ionizable cationic lipids, eg, DLin-KC2-DMA.

In one embodiment, the saRNA or siRNA of the invention can be formulated with charged lipids or amino lipids. As used herein, the term "charged lipid" is intended to include those lipids having one or two fatty acyl or fatty alkyl chains and a quaternary ammonium headgroup. Quaternary amines carry a permanent positive charge. The headgroup can optionally include ionizable groups such as primary, secondary or tertiary amines that can be protonated at physiological pH. The presence of a quaternary amine can alter the pKa of an ionizable group relative to the pKa of the group in a structurally similar compound lacking the quaternary amine (eg, replacing a quaternary amine with a tertiary amine). In some embodiments, charged lipids are referred to as "aminolipids." In a non-limiting example, the amino lipid may be the amino lipid described in Hope et al. US20110256175, the contents of which are incorporated herein by reference in their entirety. For example, amino lipids may have structures disclosed as structure (II), DLin-K-C2-DMA, DLin-K2-DMA, DLin-K6-DMA disclosed in Hope et al. US20110256175, the contents of which Incorporated herein by reference in its entirety. In another example, the amino lipid may have structure (I), (II), (III) or (IV) or 4-(R)-DUn-K-DMA( VI), 4-(S)-DUn-K-DMA (V), the contents of which are incorporated herein by reference in their entirety. In another example, the charged lipid used in any of the formulations described herein can be any of the charged lipids described in Manoharan et al., EP2509636, the contents of which are hereby incorporated by reference in their entirety.

In one embodiment, a saRNA or siRNA of the invention may be formulated with an association complex containing lipids, liposomes, or lipid-nucleic acid complexes (lipoplexes). In a non-limiting example, the association complex comprises one or more compounds each having a structure defined by formula (I), a PEG-lipid having a structure defined by formula (XV), disclosed in US8034376 to Manoharan et al. Steroids and nucleic acids, the contents of which are incorporated herein by reference in their entirety. saRNA can be formulated with any of the association complexes described in US8034376.

In one embodiment, the saRNA or siRNA of the invention can be formulated with inverted head group lipids. As a non-limiting example, saRNA or siRNA can be formulated with a zwitterionic lipid comprising a head group, where the positive charge is located near the acyl chain region and the negative charge is located distal to the head group, as described in WO2011056682 with Leung et al. The lipid of structure (A) or structure (I), the contents of which are incorporated herein by reference in their entirety.

In one embodiment, the saRNA or siRNA of the invention can be formulated in a lipid bilayer carrier. As a non-limiting example, saRNA can be combined with a lipid-detergent mixture comprising an anti-aggregation agent in an amount of about 5 mol% to about 20 mol%, an amount of about 0.5 mol% to about 50 mol% cationic lipids and a lipid mixture of fusion lipids and detergents to provide a nucleic acid-lipid-detergent mixture; and subsequently dialyzing the nucleic acid-lipid-detergent with buffered saline mixture to remove the detergent, and to encapsulate the nucleic acid in the lipid bilayer carrier, and to provide a lipid bilayer-nucleic acid composition, wherein the buffered saline solution has sufficient encapsulation of about 40% to About 80% of the ionic strength of the nucleic acid as described in WO1999018933 by Cullis et al.

In one embodiment, saRNA or siRNA of the present invention can be formulated in nucleic acid-lipid particles capable of selectively directing saRNA to heart, liver or tumor tissue sites. For example, a nucleic acid-lipid particle may comprise (a) a nucleic acid; (b) 1.0 mol% to 45 mol% of a cationic lipid; (c) 0.0 mol% to 90 mol% of another lipid; (d) 1.0 mol% to 10 mol% bilayer stabilizing component; (e) 0.0 mol% to 60 mol% cholesterol; and (f) 0.0 mol% to 10 mol% cationic polymer lipid as described in EP1328254 by Cullis et al. Professor Cullis, varying the amount of each of the cationic lipid, bilayer stabilizing component, another lipid, cholesterol and cationic polymer lipid can confer tissue selectivity against heart, liver or tumor tissue sites, Nucleic acid-lipid particles capable of selectively directing nucleic acid to heart, liver, or tumor tissue sites were thereby identified.

PAMAM dendrimers have a strong containment space and a large number of terminal functional groups, which can interact with many drugs, so as a delivery system, it can reduce the adverse reactions of drugs and improve the therapeutic index. As a gene carrier, PAMAM dendrimers can not only carry a larger number of genes but also have a stable system and high transfection efficiency through the electrostatic interaction between the cations it carries and the anions carried by DNA. The amount of carried genes is higher than that of retroviruses, and the system is more stable than liposomes. In addition, PAMAM dendrimers also have high transport activity for antisense nucleotides. The researchers developed a novel chemical cross-linking "platform" based on dendrimer (PAMAM dendrimer) modification, where spatially adjacent DNA is directly covalently cross-linked together through dendrimer.

In one embodiment, the saRNA or siRNA of the present invention uses a hydrogel as a delivery system. Hydrogels, materials composed of 3D cross-linked networks and 50%-90% water, have been used as wound dressings, vitreous replacements, and regenerative medicine. Commonly used polymers in these systems include PLGA, PEG, poly(vinylpyrrolidone) (PVP), hyaluronic acid or hyaluronic acid (HA), poly(acrylamide), and collagen, as well as natural polymers such as chitosan Sugar, xanthan gum, guar gum and carrageenan. The main strategies for preparing drug-loaded hydrogels include drug absorption, in situ polymerization or cross-linking, and two-phase partitioning. Inhalation involves swelling the gel with a solution of free drug. The saRNA or siRNA delivery hydrogel of the present application can be prepared by in-situ cross-linking and polymerization methods, which specifically include mixing drugs with monomers, cross-linking agents and initiators, and then allowing polymerization to occur. Through this preparation method, therapeutic small molecule nucleic acid constructs are entrapped in the hydrogel network by optimizing the reaction conditions to avoid side reactions between the polymer network and the peptide, including the strategy (i) to remove leachable initiators , monomers and/or crosslinkers and (ii) avoid denaturation and aggregation of proteins during the reaction. Specifically, this application can use acrylated hyaluronic acid cross-linked thermoresponsive hydrogel protein prepared by NIPAAM as a delivery system (S. Awwad, et al. European Journal of Pharmaceutical, 104993, volume 137, 2019), this The hydrogel can be degraded under physiological conditions, and can realize continuous drug delivery, prolonging the action time of small molecule nucleic acid drugs in the body.

Description of drawings

Fig. 1 Light microscope images of HepG2, MCF-7 and DU-145 cells seeded and grown under standard conditions.

Fig. 2 Light microscope images of HepG2, MCF-7 and DU-145 cells transfected with different saRNA concentrations.

Figure 3 CEBPA mRNA expression level in HepG2 cells transfected with saRNA. (A) CEBPA expression levels at final concentrations of C/EBPa-saRNA of 10 nM, 20 nM and 50 nM.

(B) CEBPA transcript levels at 24, 48 and 72 hours after C/EBPa-saRNA transfection.

Figure 4 CEBPA transcription levels after transfection of saRNA in different cancer lines. (A) CEBPA mRNA levels in HCC-Hep3B cells. (B) CEBPA mRNA levels in HCC-PLC/PRF/5 cells. (C) CEBPA mRNA levels in prostate cancer DU-145 cells. (D) CEBPA mRNA levels in breast cancer MCF-7 cells.

Fig. 5 C/EBPa protein expression level after saRNA transfection in HCC. Cells were incubated for 72 hours after transfection with 20 nM scrambled saRNA and C/EBPa-saRNA.

Figure 6 Relative expression levels in HCC and other cell lines after C/EBPa-saRNA transfection. (A) CEBPA, CEBPB, P21 and ALB mRNA levels in HCC-HepG2 cell lines. (B) CEBPA, CEBPB, P21 and ALB transcript levels in HCC-Hep3B cell lines. (C) CEBPA, CEBPB, P21 and ALB mRNA levels in the HCC-PLC/PRF/5 cell line. (D) CEBPA, CEBPB, P21 and ALB transcript levels in the prostate cancer DU-145 cell line. (E) CEBPA, CEBPB and P21 mRNA levels in breast cancer MCF-7 cell line.

Figure 7 Western blot analysis after transfection of C/EBPa-saRNA in different cancer cell lines. Western blot analysis of C/EBPa-saRNA transfection in HepG2 (A), Hep3B (B) and PLC/PRF/5 (C) cell lines, (D) (E) (F) respectively indicate the enhanced activation of CEBPA Protein expression levels of C/EBPα, C/EBPβ, p21 and Albumin.

After Fig. 8 siRNA transfection HepG2 cell, CEBPA and CEBPBmRNA expression level. (A) siRNA at final concentrations of 10 nM and 20 nM knocked down the expression of CEBPA. (B) The transcript level of CEBPβ after transfection with C/EBPβ-siRNA at the final concentration of 10nM and 20nM.

Figure 9 Western Blot analysis of knockdown of C/EBPα and C/EBPβ in HCC-HepG2 cell line. The protein expression levels of CEBPA and CEBPB after knockdown were confirmed by Western blotting in the HepG2 (A) cell line. Relative band intensities are also shown in the HepG2(B) cell line.

Figure 10 Inhibition of CEBPA using siRNA transfection in cancer cell lines. (A) CEBPAmRNA level in HCC-Hep3B cells; (B) CEBPAmRNA level in HCC-PLC/PRF/5 cells; (C) CEBPAmRNA level in prostate cancer DU-145 cells; (D) breast cancer MCF-7 CEBPA mRNA levels in cells.

Figure 11 Western Blot analysis to detect the knockdown of C/EBPα and C/EBPβ in the HCC-HepG2 cell line. In Hep3B (Fig. 11A) and PLC/PRF/5 (Fig. 11B) cell lines, the protein expression levels after knocking down CEBPA and CEBPB were analyzed by Western blot and the results are shown in the figure. Relative band intensities are also shown in the Hep3B (Fig. 11C) and PLC/PRF/5 (Fig. 11D) cells.

Figure 12 uses siRNA to transfect cancer cell lines to study the knockdown effect of CEBPB. The results are shown in Figure 12, where Figure 12A is the level of CEBPB mRNA in HCC-Hep3B cells. Figure 12B shows CEBPB mRNA levels in HCC-PLC/PRF/5 cells. Figure 12C shows CEBPB mRNA levels in prostate cancer DU-145 cells. Figure 12D shows CEBPB mRNA levels in breast cancer MCF-7 cells.

Figure 13. After the activation and knockdown of CEBPA and CEBPB in HepG2 and PLC/PRF/5 cell lines, the expression of CEBPA, CEBPB, P21 and ALB in HepG2 (A), Hep3B (B) and PLC/PRF/5 (C) cells transcript level.

Western blot and relative band intensity analysis of HepG2 (A&D), Hep3B (B&E) and PLC/PRF/5 (C&F) after activation and knockdown of CEBPA and CEBPB in Figure 14.

Figure 15 The expression level of P21mRNA after transfection of p21-saRNA into HepG2 cells.

Figure 16 After co-transfection in HCC-HepG2 cells (A) CEBPA transcript level (B) relative expression level of CEBPBmRNA; (C) p21 transcript level; (D) ALBmRNA expression level; (E) housekeeping in each case Gene-GAPDH Ct value.

Figure 17 (A) analyzed the expression levels of C/EBPα, C/EBPβ and albumin in HepG2 cells after co-transfection by Western blot. Relative band intensities of C/EBPα (B), C/EBPβ (C) and albumin (D).

Figure 18 SRB cytotoxicity test of C/EBPa-saRNA, C/EBPa-siRNA and C/EBPβ-siRNA transfected alone in HepG2(A&D), Hep3B(B&E) and PLC/PRF5(C&F) cell lines.

Figure 19 Transfection of C/EBPa-saRNA, C/EBPa-siRNA and C/EBPβ-siRNA alone within 96 hours after transfection, recorded every 24 hours in HepG2 (A), Hep3B (B) and PLC/PRF Relative cell proliferation in /5 (C) cells. (D), (E), (F) represent cell proliferation within 48 hours of transfection alone, in HepG2 (D), Hep3B (E) and PLC/PRF/5 (F) cells, respectively. Data are shown relative to the untransfected group.

Figure 20 alone transfects C/EBPβ-siRNA, C/EBPα-saRNA, and co-transfects different concentrations of C/EBPα-saRNA and C/EBPβ-siRNA (10nM and 20nM), within 96 hours after transfection, Total cell numbers in HepG2 (A), Hep3B (B) and PLC/PRF/5 (C) cells were recorded every 24 hours. (D), (E), (F) represent the fold change within 48 hours of single or co-transfection in HepG2 (D), Hep3B (E) and PLC/PRF/5 (F) cells, respectively. Data are shown relative to the untransfected group.

Figure 21 Co-transfected WST-1 cell proliferation assay. (A), (B), (C) show the individual transfection of C/EBPβ-siRNA, C/EBPα-saRNA, and When co-transfection of different concentrations of C/EBPa-saRNA and C/EBPβ-siRNA (10 nM and 20 nM), the total cell number was measured at 24-hour time points within 96 hours. Data presented show relative cell proliferation (mean ± SD in triplicate samples). (D), (E), (F) represent the fold change over time (48 hours) after individual and co-transfection in HepG2 (D), Hep3B (E) and PLC/PRF/5 (F) cells . Data are shown relative to the untransfected group. Circles represent the loss of activity after individual transfection or co-transfection after this time point; squares represent single or combined transfection groups of C/EBPa-saRNA and C/EBPβ-siRNA; red arrows represent C/EBPa-saRNA and C/EBPa-saRNA and C/EBPβ-siRNA Co-transfection of EBPβ-siRNA; black represents the individual transfection group of C/EBPα-saRNA.

Figure 22 Schematic diagram of Transwell cell migration analysis results.

Figure 23 Transfection efficiency of biotinylated C/EBPa-saRNA in HCC-HepG2 cells.

Figure 24 SDS-PAGE of proteins separated from protein complexes precipitated from HepG2 cells.

Figure 25. Blot analysis profile of proteins identifying hnRNPU in saRNA complexes. Extraction of nucleoproteins was verified by analyzing the distribution of nucleoproteins and cytosolic proteins using anti-hnRNPU (Abcam, ab20666) (A) and antiPARP (Cell Signaling, 46D11) (B) in saRNA complex pull-down.

Figure 26 The relative expression of biotinylated C/EBPa-saRNA transfection efficiency CEBPA in HCC was calculated with 2 ^-ΔΔC.T using the Livak method, and GAPDH was used as a housekeeping gene. Bars represent expression levels relative to CEBPA±SEM (n=1).

Figure 27 Percentage of complex proteins identified in different HCC lines. (A) Percentage of sense (SS), antisense (AS) and both (SS&AS) biotinylated saRNA-bound proteins in HepG2 cells. (B) Percentage of protein bound by sense (SS), antisense (AS) and both (SS&AS) biotinylated saRNA in Hep3B cells. (C) Percentage of (A) sense (SS), antisense (AS) and both (SS&AS) biotinylated saRNA-bound proteins in PLC/PRF/5 cells.

Figure 28 Knockdown effect of CEBPA, CTR9, DDX5 and hnRNPA2/B1 in HepG2 cells. (A) Expression levels of C/EBPa-saRNA transfected at final concentrations of 20 nM and 50 nM. (B-D) Knockdown of CTR9, DDX5 and hnRNPA2/B1 by siRNA (10 nM and 20 nM).

Figure 29 CEBPA, CTR9, DDX5 and hnRNPA2/B1 mRNA expression levels in HepG2 cells. (A) Relative expression of CEBPA after transfection with C/EBPa-saRNA at final concentrations of 20 nM and 50 nM. (BD) Transcript levels of CTR9, DDX5 and hnRNPA2/B1 when transfected with C/EBPa-saRNA (50 nM). Relative expression was calculated using the Livak method as 2 ^-ΔΔC.T with GAPDH as the housekeeping gene. Bar graphs represent relative expression levels of CEBPA, CTR9, DDX5 or hnRNPA2/B1 mRNA±SD (n=3). Data represent triplicate biological experiments. *p<0.05, **p<0.01.

Figure 30 CEBPA mRNA expression level after co-transfection of C/EBPa-saRNA and CTR (A), DDX5 (B) or hnRNPA2/B1-siRNA (C) in HepG2 cells. Relative expression levels were calculated using the Livak method as 2 ^-ΔΔC.T , with GAPDH as the housekeeping gene. Bar graphs represent relative expression levels of CEBPA mRNA±SD (n=3). Data represent triplicate biological experiments.

Figure 31 Western blot analysis of saRNA complex protein.

Figure 32 A. The mRNA level of CEBPA of the HepG2 cell transfected with Fluc and C/EBPa-saRNA; B. The CTR9mRNA level of the HepG2 cell transfected with Scramble-siRNA and CTR9-siRNA; and DDX5mRNA levels of HepG2 cells transfected with DDX5-siRNA; D. shows the hnRNPA2/B1mRNA levels of HepG2 cells transfected with Scramble-siRNA and hnRNPA2/B1-siRNA.

Figure 33 After siRNA transfection in HepG2 cells, (A) siRNA (10 nM and 20 nM) knocks down CTR9, DDX5 and hnRNPA2/B1 CEBPA transcript levels. (B) CEBPA transcript levels after co-transfection of C/EBPa-saRNA with CTR, DDX5 or hnRNPA2/B1-siRNA, respectively.

Figure 34 CEBPAmRNA expression level after single transfection and double transfection siRNA and saRNA in HepG2 cells. (A) CEBPA transcript level when 10nM siRNA knockdown of CTR9 combined with CEBPA activation (50nM). (B) CEBPA transcript level when 20 nM siRNA knockdown of DDX5 combined with CEBPA activation (20 nM). (C) CEBPA transcript levels when 10 nM siRNA knockdown of hnRNPA2/B1 combined with CEBPA activation (50 nM).

Figure 35 Summary of Ct values for GAPDH and CEBPA amplification in single transfection and double transfection. (A) Ct values for housekeeping gene amplification in individually transfected cells. (B) Ct values for CEBPA amplification in transfection alone. (C) Ct values for GAPDH amplification in double transfected cells. (D) Ct values for CEBPA amplification in double transfected cells.

Figure 36 is the CEBPA mRNA expression level after the final concentration of 20nM and 50nM C/EBPa-saRNA transfected HepG2 cells. β-ACTIN serves as a housekeeping gene. Bar graphs represent relative expression levels of CEBPA mRNA±SEM (n=1).

Figure 37 Selectivity Ct values for GAPDH amplification in single and double transfections. (A) Ct values for GAPDH amplification in individually transfected cells. (B) Ct values for GAPDH amplification in double transfected cells.

Detailed ways

1. Reagents and instruments

1) The following reagents used in the present invention are commercially available products,

Wherein, the following reagents were purchased from Sigma Company:

Glacial acetic acid, ketone, acetonitrile, agarose (molecular grade), ampicillin, bovine serum albumin (BSA), calcium chloride (CaCl2), cell dissociation solution non-enzyme 1x, crystal violet, dimethylsulfoxide ( DMSO), EDTA (ethylenediaminetetraacetate), Dulbecco's modified Eagle's medium (DMEM), ethanol (molecular grade), ethidium bromide, formaldehyde, glycerol, hydrochloric acid (HCl), methanol, modified Eagle's medium (MEM), Ponceau S, Penicillin/Streptomycin/Glutamine, RPMI-1640 Medium, Sodium Acetate (NaAc), Sodium Bicarbonate (NaHCO3), Sodium Carbonate (NaCO3), Sodium Chloride (NaCl2), 10X Stripping Buffer, sulfabutane B (SRB), trifluoroacetic acid (TFA), trichloroacetic acid (TCA), Tris primer (

Primer), Triton-X (

X-100), Tween 20, trypsin-EDTA (ethylenediaminetetraacetic acid) (1X solution), ultrapure water, potassium chloride (KCL)

Coomassie Brilliant Blue R-250 staining solution: Bo-Rad Company

Fetal Bovine Serum (FBS): American Labtech Co., Ltd.

Luminata ^TM HRP Chemiluminescent Detection Reagent (Luminata Forte Western HRP Substrate, Millipore)

Lysis buffer: Ambion (UK)

Nucleic acid marker (100bp DNA ladder): American VWR company

Nucleic acid marker (1kb DNA ladder): Thermo Fisher Corporation

Precision Plus Protein ^TM Western Blotting Standard (250kDa): Bio-Rad

WST-1: Roche (UK)

2) Commercial kits

In-Gel Trypic Digest Kit: Thermo Fisher Scientific

Lipofectamine 2000 transfection kit: Invitrogen, Thermo Fisher

Nanofectamine Transfection Kit: PAA (UK)

Pierce ^TM Mass Spectrometry Sample Preparation Kit: Thermo Fisher Scientific

QuantiTect Reverse Transcription Kit: QIAGEN (USA)

QuantiFast SYBR Green PCR Kit: QIAGEN (USA)

RNeasy Mini Kit: QIAGEN (USA)

Thermo Scientific BCA Protein Assay Kit: Thermo Fisher Scientific

3) Consumables

C18 Spin Column: Thermo Fisher Scientific

Eppendorf microcentrifuge tubes: Greiner, Germany

Falcon tissue culture dish (35×10mm): Greiner, Germany

Multichannel Pipettes: Fisher Scientific

Pipettes (15ml and 25ml): Greiner, Germany

Pipette tips (0.2–10, 5–200 and 250–1000 μl): Greiner, Germany

PCR tubes (0.2 and 0.5ml): QIAGEN

Precast polyacrylamide gels (

gel): Invitrogen, Thermo Fisher

Streptavidin Beads: Thermo Fisher Scientific

Clear flat bottom polystyrene cell culture plates (6, 24 and 96 wells): Corning

Tissue Culture Petri Dish (10cm): Greiner

24-well with 8.0 μm pore size polycarbonate membrane insert

Corning

4) Equipment

Applied Biosystem 7900HT Fast Real-Time System: Thermo Fisher Scientific

Microplate Reader: Biotechnology

Microscope: Olympus (Japan)

Orbital Plate Shaker: Stewart

SpeedVac Vacuum Concentrator: Thermo Fisher Scientific

2. Cell lines

The tumor cells used in the present invention were all purchased from the American Type Culture Collection (ATCC).

1) HepG2: HepG2 is a highly differentiated hepatocellular carcinoma cell line derived from the liver tissue of a 15-year-old Caucasian American male. Cells do not contain hepatitis virus.

2) Hep3B: Hep3B is a differentiated hepatocellular carcinoma cell line derived from the liver tissue of an 8-year-old adolescent black male. The cells contain the hepatitis B virus.

3) PLC/PRF/5: PLC/PRF/5 is an undifferentiated liver cancer cell line. The cells contain the hepatitis B virus.

4) MCF-7 (Michigan Cancer Foundation-7): MCF-7 is a differentiated breast cancer cell line isolated from the breast tissue of a 69-year-old Caucasian woman.

5) DU-145: DU-145 is a prostate cancer cell line isolated from a 69-year-old male Caucasian, metastatic from prostate adenocarcinoma to the brain.

For the above selected cell lines, the effect of CEBPA compositions on different types of tumor cells was investigated. HepG2 and Hep3B belong to HCC and belong to differentiated type, while PLC/PRF/5 cells belong to undifferentiated HCC. Breast cancer cell line MCF-7 and prostate cancer cell line DU-145 served as controls for HCC lines.

3. Antibodies

Table 1 primary antibody

抗原antigen	来源/Cat.No.Source/Cat.No.	浓度concentration
C/EBPαC/EBPa	Abcam(ab40761)Abcam (ab40761)	1:10001:1000
C/EBPβC/EBPβ	Abcam(ab18336)Abcam (ab18336)	1:10001:1000
p21p21	Abcam(ab18209)Abcam (ab18209)	1:10001:1000
AlbuminAlbumin	Abcam(ab106582)Abcam (ab106582)	1:10001:1000
hnRNPUwxya	Abcam(ab20666)Abcam (ab20666)	1:10001:1000
PARPPARP	Cell Signaling(46D11)Cell Signaling(46D11)	1:10001:1000
ACTINACTIN	Abcam(ab8226)Abcam (ab8226)	1:10001:1000
TUBLINTUBLIN	Sigma Aldrich(T9026)Sigma Aldrich(T9026)	1:10001:1000

Table 2 Secondary Antibodies

4. Preparation of Buffers, Solutions and Media

1.1 Tissue culture

1.1.1 Growth medium

Commercially available RPMI-1640, MEM and DMEM supplemented with 100 units/ml penicillin, 0.1 mg/ml streptomycin and 2 mmol/L glutamine (Labtech International), and 10% pre-warmed fetal bovine serum (FBS, Sigma ) and stored at 4°C.

1.1.2 Freezing medium for cell culture

Make freezing medium by mixing 90% FBS and 10% DMSO.

1.2 Reagents for western blotting

PBS (Phosphate Buffered Saline): PBS tablets (Sigma) and Tween-20 solution were added to distilled water (4 tablets with 0.8 mL Tween/800 mL) and mixed using a magnetic stirrer until completely dissolved.

Western Blotting Blocking Buffer: Add 5 g of skimmed milk powder to 100 ml of phosphate-buffered saline containing Tween (PBST).

10% SDS (Sodium Lauryl Sulfate): Add 10% SDS to distilled water, heat to 68°C, and adjust to pH 7.2 with HCl.

10X Running Buffer for Western Blotting: For a one liter solution, use 250mM Tris base (30.3g), 10% SDS (10g) and 2.5M Glycine (144g) in distilled water and mix on a magnetic stirrer until completely dissolved .

1X Running Buffer for Western Blotting: Dilute 10% of 10X Running Buffer in 90% distilled water for western blotting.

1X Transfer Buffer for Western Blotting: To make one liter of buffer, add 25mM Tris (2.44g), 192mM Glycine (11.26g) and 20% Methanol (200ml) in distilled _H2O and place on a magnetic stirrer Mix until completely dissolved.

Lysis Buffer for Western Blotting: Contains the following components:

0.1% SDS

150mM NaCl

0.5% NP-40

50mM Tris HCl

0.5% Triton X100

5% glycerin

PIC (Protease Inhibitor Cocktail) 5 μl/mL

PMSF (phenylmethylsulfonyl fluoride) 1mM

Ponceau S staining solution: 1 g Ponceau S, 50 ml acetic acid, make up ₁ L with ddHO

1.3 Reagents for agarose gel electrophoresis

50X TAE (Tris Acetate-EDTA) Buffer: 242 g of Tris base, 57.1 mL of glacial acetic acid and 18.6 g of EDTA (or 0.5 mL of sodium EDTA in 100 mL) were completely dissolved in 1 L of distilled water.

1X TAE (Tris Acetate-EDTA) Buffer: Dilute 1% of 50X running buffer into 49% distilled water for agarose gel electrophoresis (or dilute 20ml of 50X running buffer into 980ml of distilled water).

5X Orange G Gel Loading Buffer: Dissolve 7.5ml glycerol and 100mg Orange G dye in 50ml distilled water.

1.4 Gel fixative:

50% methanol

10% acetic acid

40% _ddH2O

1.5 Coomassie Brilliant Blue Decolorization Solution

10% acetic acid

50% methanol

40% _ddH2O

1.6 SRB working solution

0.057% (wt/vol) SRB in 1% (v/vol) acetic acid

1.7 Water-soluble tetrazole-1 (WST-1) working solution

Add 10 μl/well of cell proliferation reagent (commercial WST-1 kit) to the cells grown at 100 μl/well (1:10 dilution).

The p21-saRNA used in the present invention has the sequence:

Sense strand: CCAACUCAUUCUCCAAGUA[dT][dT] (SEQ ID NO:48)

Antisense strand: UACUUGGAGAAUGAGTTGG[dT][dT] (SEQ ID NO:49)

The sequence of the CTR9-siRNA used in the present invention is:

Sense strand: GCACGUAUAGAUGGCAAUU[dT][dT] (SEQ ID NO:50)

Antisense strand: AAUUGCCAUCUAUACGUGC[dT][dT] (SEQ ID NO:51)

Or sense strand: CCAAAUGCGUGGGAGCAUU[dT][dT] (SEQ ID NO:52)

Antisense strand: AAUGCUCCCACGCAUUUGG[dT][dT] (SEQ ID NO:53)

The hnRNPA2/B1-siRNA used in the present invention has a sequence of:

Sense strand: GCAAGACCUCAUUCAAUUGUU (SEQ ID NO:54)

Antisense strand: CCAUUGAAUGAGGUCUUGCUU (SEQ ID NO:55) or

Sense strand: GAACAAUGGGGAAAGCUUAUU (SEQ ID NO: 56)

Antisense strand: UAAGCUUUCCCCAUUGUUCUU (SEQ ID NO:57) or

Sense strand: GUUCAGAGUUCUAGGAGUCUU (SEQ ID NO:58)

Antisense strand: CACUCCUAGAACUCUGAACUU (SEQ ID NO:59) or

Sense strand: GAAGAGUAGUUGAGCCAAAUU (SEQ ID NO: 60)

Antisense strand: UUUGGCUCAACUACUCUUCUU (SEQ ID NO: 61)

The DDX5-siRNA used in the present invention has a sequence shown in SEQ ID NO:62. The negative control of siRNA, CTR9-siRNA, DDX5-siRNA and hnRNPA2/B1-siRNA were purchased from Life Technologies.

Example 1 Design of small activating RNA (saRNA) for CEBPA

The design of C/EBPa-saRNA has been described previously. According to the parameters mentioned in the literature (Schuster et al., Biochim Biophys Acta, 2006.1766 (1): p.88-103; Paul, C.P., et al., Nature Biotechnology, 2002.20 (5): p.505-508) , the sequence of CEBPA was selected to design small activating RNA molecules for specific gene regulation. To design saRNAs for specifically activating CEBPA, the following bioinformatics approach was used. The gene sequence of CEBPA was collected for saRNA design for specific activation, including four parameters: (1) download target gene annotation; (2) identify target sequence from antisense; (3) select promoter antisense sequence; (4) ) to identify candidate saRNAs. First, the information includes the genomic localization, location and transcriptional configuration of the target obtained from available databases (UCSC RefSeq).

All saRNAs were synthesized and refolded in water. 90% purity by RP-HPLC. The double-stranded nucleotide screened out in the sequence of the obtained oligonucleotide sample, its antisense strand has as shown in SEQ ID No.2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 The sequence shown; the sense strand comprises a sequence selected from SEQ ID No. 1, 3, 5, 7, 9, 11, 13, 19 and 21.

Embodiment 2 cell culture and transfection method

2.1 Cell culture

HCC cell lines (HepG2, Hep3B, PLC/PRF/5), breast cancer (MCF-7) and prostate cancer (DU-145) cells were purchased from the American Type Culture Collection (ATCC). HepG2, MCF-7 and DU-145 cells were cultured in Roswell Park Memorial Institute Medium (RPMI); Hep3B and PLC/PRF/5 cells were cultured in Modified Eagle Medium (MEM) and cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Sigma), 100 units/ml penicillin, 0.1 mg/ml streptomycin and 2 mmol/L glutamine (Labtech International) in 5% humidity _CO2 Incubate at 37°C in an incubator. These cells were maintained at sub-confluency (80%) and were seeded and passaged at a 1:6 dilution during the seeding period. Remove the initial cell culture medium from the 10 cm dish and add 5 ml PBS to wash the cells. After removing the PBS, incubate the cells with 1 ml of 1X trypsin-EDTA for 3 min at 37 °C in a 5% _CO2 incubator. To stop trypsinization, detached cells were resuspended in a total volume of 5 ml of fresh medium containing FBS, then pelleted by centrifugation at 1300 rpm for 5 min at room temperature, and the trypsin-containing supernatant was removed. Finally, resuspend the cell pellet in 5 ml medium and aliquot the suspension into a new Petri dish containing 10 ml complete medium. All cells were grown at 37°C in a 5% _CO2 incubator.

2.2 Freezing and Thawing Cells

Freezing cells: Trypsinize cells as above and centrifuge at 1300 rpm for 5 min at room temperature. After removing the supernatant, resuspend the cell pellet in a 1 ml aliquot of freezing medium and pipet into a cryovial. After labeling with cell line name, date and concentration, store the tube in liquid nitrogen for future use.

To thaw cells: Remove cells from liquid nitrogen and immediately thaw in a 37°C water bath. Then, transfer the cell suspension to a 5 ml test tube, and add 4 ml of pre-warmed complete medium, and then centrifuge at 1300 rpm for 5 minutes at room temperature to remove the preservative medium containing DMSO. Finally, resuspend the cell pellet in complete medium as previously described.

2.3 Cell count

Cells were passaged and cytologically counted by using a standard hemocytometer. The cell concentration (number of cells/ml) and dilution factor were confirmed by multiplying by 10 ⁴ . Dilute the cells with trypan blue at a ratio of 1:6 (dilution factor is 6), and determine the cell density as follows:

Density (total viable cells/ml) = total number of viable cells 4 sq/2.4 x 10 ⁵ .

2.4 Transfection of RNA oligonucleotides

For C/EBPa-siRNA, C/EBPa-siRNA and C/EBPa-saRNA transfection, cultured cells were grown to 60% confluency in 24-well plates and transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. The final transfection concentration of siRNA was 10 nM. The final transfection concentration of saRNA was 20 nM. Cells were harvested 72 hours after RNA transfection and extracted for mRNA expression analysis. This process was performed at least three times.

The analysis of embodiment 3 RNA

3.1 Total RNA extraction

Total RNA was extracted using RNeasy Mini Kit (QIAGEN) according to the operating instructions of RNeasy Mini. The cell suspension collected from the plate was centrifuged at 3500 rpm for 5 minutes at 4°C, and then the supernatant was removed. Cell pellets in each sample tube were lysed with 350 μl BufferRLT. The lysate was then transferred to a QIAshredder (cell disruptor) column and centrifuged at 13,200 rpm for 30s. Each sample was mixed with 350 μl of 100% ethanol and transferred to the RNeasy Mini spin column in a 2ml collection tube. After centrifugation at 13,200 rpm for 30 s, the samples were washed and eluted with 700 μl buffer RW1 (once) and 500 μl buffer RPE (twice), respectively. Afterwards, 35 μl of RNase-free water was pipetted directly onto each spin column membrane and centrifuged at 13,200 rpm for 1 min. The total RNA in the collection tube was then quantified with a Nanodrop spectrophotometer. The gDNase removal was performed at 42°C for 5 minutes, and the reverse transcription reaction was performed with a transcription kit (QIAGEN) for 30 minutes. Finally, cDNA was synthesized for RT-PCR. All RT-PCR reactions were performed with 500 ng of reverse transcribed mRNA.

3.2 Relative quantitative polymerase chain reaction (qRT-PCR)

After cDNA reverse transcription, QuantiFast SYBR Green PCR Kit (QIAGEN) was used to quantitatively analyze the expression of CEBPA (CEBPB) and two housekeeping genes [GAPDH (glucoaldehyde-3-phosphate dehydrogenase) and ACTIN]. Briefly, 1.8 μl of gene-specific primers and cDNA template were added to the SYBR real-time fluorescent quantitative PCR kit (

Green I dye, AmpliTaq

polymerase, dNTPs79 with dUTP, passive reference 1 and optimized buffer; QIAGEN).

Take 10 μl from each sample, and use the Applied Biosystem 7900HT fast real-time system to amplify cDNA in one cycle at 95°C for 10 minutes. Forty cycles (95°C for 15 seconds, 60°C for 40 seconds) were performed for fluorescence data collection. Applied Bio-System RQ Manager was used to analyze the relative expression levels of the amplified cDNA samples (triplicate). The relative expression of target genes was experimented using the comparative Ct method and described as normalized housekeeping gene fold difference. The Livak method was used to calculate the relative amount between the non-transfected group and the C/EBPa-saRNA transfected group. The steps are described below:

1. For the non-transfected group and the C/EBPa-saRNA transfected group, normalize the Ct of CEBPA to the Ct of the housekeeping gene:

ΔCt(C/EBPa-saRNA)=Ct(CEBPA gene, C/EBPa-saRNA)-Ct(housekeeping gene, C/EBPa-saRNA)

ΔCt(scramble-saRNA)=Ct(CEBPA gene, scramble-saRNA)-Ct(housekeeping gene, scramble-saRNA)

ΔCt (non-transfection) = Ct (CEBPA gene, non-transfection) - Ct (housekeeping gene, non-transfection)

2. Normalize the ΔCt of the C/EBPa-saRNA group to the ΔCt of the non-transfected group:

ΔΔCt=ΔCt(scramble-saRNA)-ΔCt(non-transfected)

ΔΔCt=ΔCt(C/EBPa-saRNA)-ΔCt (non-transfected)

3. Relative expression between C/EBPa-saRNA/scramble-saRNA and non-transfection group

Calculate each group: Relative amount = 2 ^{- ΔΔCt}

For statistical analysis, we performed nonparametric tests according to the obtained data distribution.

Table 4 Primers for real-time RT-PCR

基因Gene	目录标号catalog designation	生产厂商manufacturer
ALBALB	QT00063693QT00063693	QIAGENQIAGEN
BETA-ACTINBETA-ACTIN	QT01680476QT01680476	QIAGENQIAGEN
CEBPΑCEBPA	QT00203357QT00203357	QIAGENQIAGEN
CEBPBCEBPB	QT00998498QT00998498	QIAGENQIAGEN
CTR9CTR9	QT00029981QT00029981	QIAGENQIAGEN
DDX5DDX5	QT00033369QT00033369	QIAGENQIAGEN
GAPDHGAPDH	QT01192646QT01192646	QIAGENQIAGEN

hnRNPA2/B1hnRNPA2/B1	QT00070931QT00070931	QIAGENQIAGEN
P21(CDKN1A)P21 (CDKN1A)	QT02588621QT02588621	QIAGEQIAGE

Example 4 Protein Analysis

4.1 Bio-RadDC protein assay

A 2 mg/ml stock solution of BSA was prepared and dissolved in lysis buffer for serial dilution (0 μg/ml, 1.8 μg/ml, 3.9 μg/ml, 7.8 μg/ml, 15.6 μg/ml, 31.25 μg/ml, 62.5 μg/ml, 125μg/ml, 250μg/ml, 500μg/ml, 1mg/ml and 1.5mg/ml) as a standard curve. BCA Working Reagent A is prepared by mixing BCA Reagent A with BCA Reagent S in a 50:1 ratio. Add 5 μl of standards and protein samples to a 96-well microplate before pipetting 25 μl of Working Reagent A into each well. Then, add 200 μl of Reagent B to each well and mix well. After reacting for 15 minutes at room temperature, absorbance was measured at 750 nm by a Bio-tek microplate reader. According to the standard curve, load 5 mg of protein sample in each well and calculate the loading amount.

4.2 Separation of proteins by SDS-polyacrylamide gel electrophoresis (SDS-PAGE)

According to the manufacturer's instructions, remove the polyacrylamide gel (purchased from Invitrogen

Gel), and then assemble the electrophoresis system (XCell SureLock ^TM Mini Cell, Invitrogen). Gel pots were filled with pure glycerol-based running buffer, and 5 mg of total protein samples were loaded into each well. Then, the protein sample is separated in the system. Electrophoresis was performed at 125 volts direct current for approximately 2 hours.

4.3 Protein transfer to nitrocellulose

Prepare proteins separated on SDS-polyacrylamide gels for transfer to nitrocellulose membranes (using a semi-dry transfer system). Prior to assembly of the semi-dry system, immerse the membrane and electrode paper in transfer buffer for 3 min to equilibrate the paper. Place eight layers of electrode paper on the system, making sure there are no air bubbles between each layer. The nitrocellulose membrane is then placed on top, followed by SDS-PAGE and finally another layer of electrode paper. Protein transfer was performed at 400 mA for two hours. The successful transfer of the protein band to the blotted membrane can be confirmed by detecting the protein using Ponceau S staining solution.

4.4 Blot analysis

use

The Western blotting procedure was performed with the Protein Detection System (Millipore). Primary antibodies against β-ACTIN (ab8226), C/EBPα (ab40761), C/EBPβ (ab18336), p21 (ab18209) and albumin (ab106582) and secondary goat anti- Rabbit (ab97051) and goat anti-mouse (ab97023). Primary and secondary antibodies were diluted 1:1000 and 1:2000 in 10X phosphate buffered saline containing Tween 20 (PBST) containing 0.5% nonfat dry milk, respectively. Then, the protein-transferred nitrocellulose membrane was placed on the blot holder (

Mini, Millipore), pre-wet with distilled water and roll to remove air bubbles. The scaffold was placed in the system and the blot was washed three times with 30 ml PBST. Then 5 ml of primary antibody was added to the membrane surface, incubated for 10 min at room temperature, and removed by washing the blot 3 times. Follow the same steps for secondary antibody incubation. Finally, the secondary antibody was detected using Luminata ^™ HRP Chemiluminescent Detection Reagent (Luminata Forte Western HRP Substrate, Millipore). By using Image Studio ^TM software (LI-CORBiotech), in

Blots were visualized on a blot scanner (LI-COR Biotech). For probing again, the membranes were stored in PBST at 4°C. To detect new antibodies, previous antibodies in the blot were removed by stripping the membrane with 1X stripping buffer (Sigma) for 15 min, followed by washing 3 times for 5 min each with PBST at room temperature.

Example 5 Chromatin Immunoprecipitation (ChIP) Analysis

5.1 Genomic DNA Precipitation

Sufficient cells (4×10 ⁶ ) were seeded on Falcon dishes (35×10 mm, 353001 ), cross-linked with 1% formaldehyde at 37° C. for 10 minutes, and collected. 200 μl (10 ⁶ cells) of SDS lysis buffer supplemented with protease inhibitor cocktail (PIC) and phenylmethylsulfonyl fluoride (PMSF) were added to the lysed cells. Lysates were sonicated with constant pulses throughout the fragmentation of chromatin fragments. After _reverse cross-linking with 10 μl 5M NaCl, DNA samples were extracted with 200 μl phenol/chloroform/isoamyl alcohol and extracted with chloroform/isoamyl alcohol, and then precipitated by adding 500 μl 100% ethanol and 20 μl 3M NaAc. Precipitated genomic DNA was resuspended in NaAc solution.

5.2 Agarose gel electrophoresis

To investigate optimal sonication efficiency for ChIP assays, agarose gels were used. The concentration of agarose is determined by the target size range of the DNA molecules (Table 5).

Table 5 Agarose Gel Concentration

浓度(％w/v)Concentration (%w/v)	DNA分子的目标尺寸范围(bp)Target Size Range of DNA Molecules (bp)
0.30.3	5000–6000005000–600000
0.60.6	1000–200001000–20000
0.90.9	500–7000500–7000
1.21.2	400–6000400–6000
1.51.5	200–3000200–3000
2.02.0	100–2000100–2000

Since 200–300bp is the target range for DNA molecules, a 1.5% gel was used to detect DNA fragments. Each DNA sample was diluted with 10–15 μl of distilled water and mixed well.

Add 2 μl of sample complex to 8 μl of 10X DNA loading buffer containing loading dye (orange G). Before loading the sample, place the gel in an electrophoresis chamber containing 1X TAE buffer. Add 10 μl of sample to the electrophoresis chamber. The electrophoresis chamber contains two additional swimming lanes, which respectively contain DNA fragments of known length, 100bp and 1kb DNA bands. The electrophoresis was run at 120V for about 1 hour, and the DNA fragments were separated on the gel by migration of the loading dye (orange G). Finally UV light from a UV GeneFlash Photo Imager (Syngene, UK) was used to visualize and photograph the isolated DNA samples.

Embodiment 6 sulforhodamine B colorimetric method (SRB)

On the basis of detecting the amount of staining, the cytotoxicity was determined by SRB to measure the cell protein stained with sulforhodamine B. Briefly, standard plates containing different cell number conditions (8000, 10000, 20000, 40000, 60000, 80000) were incubated for 2-3 hours and placed for no growth controls. At the same time, place the remaining assay plates in a 37° C. carbon dioxide incubator at 5% humidity and incubate for 24, 48, 72 and 96 hours, respectively. The cells were fixed with 10% TCA at 4°C for 1 hour, then washed 4 times with slow-flowing water, air-dried at room temperature, and stained with 0.057% SRB solution, and then the protein-binding dye was dissolved with 10mM Tris alkali solution. Optical density (OD) values were measured at 510 nm using a BIO-TEK microplate reader. Since the SRB standard curve was used from a standard plate (no growth control), the absolute cell number for each treatment was calculated using the SRB standard curve.

Example 7 WST-1 cell proliferation assay

Cell proliferation assays were performed by analyzing cells for mitochondrial dehydrogenase using WST-1 reagent (Roche, UK) 24, 48, 72, 96 hours after transfection. Briefly, cells were seeded into 96-well plates and then transfected with 20 nmol RNA using Lipofectamine 2000 (Invitrogen). The initial medium was removed, and a 1:100 dilution of WST-1 reagent was added to each well, incubated for one hour, and assayed every 10 minutes. At each 10 minute interval, the value was read at 420 nm using a BIO-TEK plate reader, and the reading was taken at 620 nm for reference.

Example 8 Transwell cell migration assay

Cell migration assays were performed using Transwell ^™ permeable scaffolds (24-well format, Corning Costar, USA) with a pore size of 8.0 μm. The protocol is as follows: cells from tissue culture plates are trypsinized, pelleted and resuspended in serum-free medium. 100 [mu]l of cell suspension was placed on top of the filter in the upper Transwell chamber and incubated for 10 minutes (37[deg.]C, 5% _CO2 ) to pellet the cells. The lower compartment was pipetted with 600 μl of 10% fetal bovine serum medium to create a chemotaxis ramp. After 16 hours of incubation, the remaining cells on the upper filter side were removed with a cotton swab, while the cells that had migrated through the top membrane were fixed with 1 ml of 70% ethanol for 10 min, stained with 1% crystal violet in 2% ethanol, and washed with water. rinse. Migrated cells are detected by crystal violet dye binding to proteins and DNA. Migrated cells at the bottom of the filter were observed under a 10x magnification microscope (Olympus, Japan) and counted in 10 high power fields, allowing the average number of migrated cells per insert to be calculated. Crystal violet-stained cells were dissolved in 33% acetic acid and the absorbance was measured at 600 nM (FIGS. 2-3). Results are expressed as mean cell number ± standard deviation per field of view.

Example 9 saRNA complex immunoprecipitation (IP)

Cells were transfected with 20 nM biotin-labeled Scramble and C/EBPa-saRNA (reverse and forward transfection), and harvested at 72 hours. The cells were lysed with SDS ChIP buffer, and the supernatant was collected by centrifugation after immunoprecipitation. The saRNA complexes were then immunoprecipitated overnight with streptavidin beads, and proteins were resolved on SDS-PAGE and stained with Coomassie blue. Gel bands of interest were excised and digested with the In-Gel Trypic Digestion Kit (Thermo Scientific, USA). Peptide samples were purified and concentrated using Pierce C18 spin columns (Thermo Scientific, USA). Samples were dried in a SpeedVac, suspended in 1-2ul of matrix solution, and analyzed by liquid chromatography-mass spectrometry (LC-MS).

Optimal Activation of C/EBPa Expression in Example 10 HCC Cells

This example investigates the critical role of C/EBPα and C/EBPβ in HCC cell lines. Both are involved in numerous key cellular events including cell cycle control, liver regeneration, differentiation, energy metabolism and apoptosis. Studies over the past decade have shown that the expression of C/EBPa is downregulated in most HCC cases compared with corresponding non-tumor areas. Reebye et al. (Reebye, V., et al, Hepatology. 201459(1): P.216-227) have demonstrated for the first time a novel injectable saRNA-oligonucleotide that positively regulates C/EBPa Expression of , can reduce liver tumor burden and improve liver function in cirrhosis/HCC model.

One of the objectives of this example was to establish optimal activation of C/EBPa expression in HCC cells. It also involves exploring whether C/EBPα and C/EBPβ share common pathways in hepatocyte biology and other cancer types. To this end, transfection of different cell lines optimized for saRNA-induced gene activation and siRNA-induced gene repression was first performed. The experimental subjects of this embodiment selected HCC cell lines (HepG2, Hep3B and PLC/PRF/5), prostate (DU-145) and breast cancer (MCF-7) cell models. HepG2 and Hep3B represent differentiated phenotypes, while PLC/PRF/5 represent undifferentiated cell lines.

10.1 Establishing Optimal Activation of C/EBPa Expression in Hepatoma Cells

In order to obtain the maximum effect of saRNA-induced gene activation, the optimization procedure of transfection for maximum efficacy is a key step, which is a necessary procedure for specific cell types and saRNA screening experiments. A successful saRNA-induced gene activation experiment is determined by several key parameters to maximize saRNA performance including cell culture conditions, transfection method, and saRNA quality and quantity.

1) Optimizing cell culture conditions

Cell culture conditions are an important factor in the transfection process. Cells should be healthy and usable within ten passages, especially for liver cancer cells. Because after higher passage levels, multiple divisions and the freeze/thaw process lead to many mutations, triggering more DNA damage and chromosome collapse within the cells. Additionally, gene expression can be altered to adapt cells to growth conditions. Here, passage cells are used to optimize transfection, because high passage cells are constantly changing and it is difficult to achieve high transfection efficiencies. Cell seeding density also affects the overall transfection efficiency. Sparse or overcrowded cultures can stress cells further, leading to changes in gene expression profiles. For adherent HCC cells, a maximum transfection efficiency of 80% is achieved at confluence, with a suggested range from 40% to 90%. To achieve the optimal cell seeding density to achieve the desired efficiency, cells were seeded at different densities (20, 50, 80, 100,000 cells/well) to establish the desired transfection confluency. Figure 1 shows the light micrographs of HepG2, MCF-7 and DU-145 cells seeded and grown under standard conditions, the culture medium is RPMI-1640, supplemented with 10% FBS and PSG. HepG2, MCF-7 and DU-145 cells were seeded into 24-well plates, and different cell confluency (60, 80, 100, 120,000 cells per well) were tested and then transfected. According to the light microscope images (Fig. 1), the optimal densities of HepG2, MCF-7 and DU-145 cells in 24-well plates were 100 and 80 thousand cells per well, respectively.

2) Optimize the saRNA transfection method and conditions

The choice of transfection method and conditions is another key parameter to obtain high transfection efficiency level of transfection efficiency. Here, we used both reverse and forward transfection procedures. Forward transfection requires pre-seeding the cultured cells the day before transfection to allow the cells to reach an actively dividing cell population at the time of transfection. Reverse transfection is an advanced transfection method improved by Ziauddin and Sabatini (Ziauddin, J. and Sabatini, et al., Nature, 2001.411(6833): p.107-10) in which it is still in suspension after transformation state of the transfected cells. This suggests increasing the exposure of cells to the transfection complex for high-throughput applications.

Transfection conditions include the ratio of transfection agent to saRNA, saRNA and incubation time. Commercial lipofectamine 2000 transfection reagent (Invitrogen) was chosen to transfect cells and was applied at a 1:1 ratio following the manufacturer's instructions. In addition, the concentration and incubation time of saRNA need to be optimized. The ideal concentration of transfection reagent is to achieve effective activation of the target gene. Five different concentrations (10 nM, 20 nM, 50 nM, 100 nM and 150 nM) were investigated in this example for transfection optimization. After three cell lines (HepG2, MCF-7 and DU-145) were transfected with different concentrations (10nM, 20nM, 50nM, 100nM and 150nM), the C/EBPa-saRNA concentration (RPMI-1640 , supplemented with 10% FBS and PSG) were recorded with a light microscope.

From the light microscope images (Fig. 2), the remaining cells (HepG2, MCF-7 and DU-145) in the wells of 24 wells after transfection with more than 50nM of C/EBPa-saRNA were significantly smaller than those at concentrations below 50nM much less. In order to clarify the effect of saRNA concentration in liver cancer, HepG2 cells were transfected with C/EBPa-saRNA concentrations of 10 nM, 20 nM and 50 nM, and total RNA was extracted 72 hours after reverse and forward transfection and analyzed by qRT-PCR. Figure 3 shows the relative expression of CEBPA mRNA obtained from the C/EBPa-saRNA group. Among them: (A) CEBPA expression at the final concentration of C/EBPa-saRNA at 10nM, 20nM and 50nM; (B) CEBPA transcription level at 24, 48 and 72 hours after C/EBPa-saRNA transfection. Relative expression was calculated using the Livak method of 2 ^-ΔΔC.T with GAPDH as the housekeeping gene. The bar graph represents the relative expression level ± SD of CEBPA mRNA (n=3). Data represent triplicate experiments. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

The results in Figure 3 show the highest level (3.5 fold) when transfected with 20 nM C/EBPa-saRNA in HepG2 cells. This indicates that 2OnM is the optimal concentration of saRNA transfected under these cell conditions.

Cell exposure time (incubation time) of the transfection complex should also be optimized to maximize saRNA activity. Here, the medium containing the transfection reagent was replaced with fresh medium 24 h after each transfection, and saRNA activity was measured by qRT-PCR at the indicated time points (24, 48, and 72 h) for analysis. In FIG. 3B , at the above different time points, it can be observed that the activity of saRNA reaches the peak (a 5-fold increase in CEBPA at 72 hours after transfection). This suggests an optimal post-transfection incubation time of 72 hours.

3) Validation of optimal transfection in other cancer cell lines

Transfection in the HepG2 cell line was also optimized and it was verified that the same transfection method and conditions would be applicable to other cancer lines, where HCC-Hep3B cells were specifically validated as well as PLC/PRF/5 cells, prostate cancer DU-145 cells and saRNA activity in breast cancer MCF-7 cells. The experimental results are shown in Figure 4.

This experiment was to detect the transcript level of CEBPA after transfection of C/EBPa-saRNA in other cancer lines. Cells were transfected with C/EBPa-saRNA at a concentration of 20 nM and harvested 72 h after seeding for total RNA extraction and reverse transcription. Among the results shown in Figure 4, wherein, (A) represents the CEBPA mRNA level in the HCC-Hep3B cell; (B) represents the CEBPA mRNA level in the HCC-PLC/PRF/5 cell; (C) represents the prostate cancer DU-145 CEBPA mRNA levels in cells; (D) represents CEBPA mRNA levels in breast cancer MCF-7 cells. Livak's method for relative expression of 2 ^-ΔΔC.T was calculated with GAPDH as a housekeeping gene. Bars represent relative expression levels ± SD of CEBPA mRNA (n=3). Data represent triplicate biological experiments. *p<0.05, **p<0.01, ***p<0.001.

Compared to the significantly increased expression of C/EBPa in HepG2 cells (3.5-fold, see Figure 3), when we transfected with 20 nM of C/EBPa-saRNA, C/EBPa was activated 2.6-fold in Hep3B cells (Figure 4A). Under the same transfection conditions, a 1.6-fold increase in transcript level was observed in C/EBPa-saRNA transfected PLC/PRF/5 cells (Fig. 4B).

The transfection effect was also investigated using Western blot experiments. Cells were incubated for 72 hours after transfection with 20 nM scrambled saRNA and C/EBPa-saRNA. Protein lysates of 40 μg of transfected and untransfected cells were analyzed by Western blot. SDS-polyacrylamide gels (PAG) were transferred to PVDF membranes and immunoprobed with anti-CEBPA antibodies. β-actin was used as a loading control. Data represent triplicate biological experiments. According to the experimental results of western blotting, C/EBPa-saRNA only activated the protein expression of C/EBPa in HepG2 and Hep3B cells ( FIG. 5 ). These suggested that C/EBPa-saRNA had no activity in PLC/PRF/5 cells, but showed activity in HepG2 and Hep3B cells. In addition, expression of C/EBPa levels showed a 5-fold increase in DU-145 cells (Fig. 4C) and a 1.6-fold increase in MCF-7 cells (Fig. 4D), which indicated that the activity of C/EBPa-saRNA in DU-145 cells Stronger than in HepG2 and Hep3B cells. C/EBPa-saRNA lacked activity in MCF-7, similar to PLC/PRF/5 cells, because the response of signaling pathways to C/EBPa-saRNA in these cell lines may be different in these cell lines, and PLC The metabolic rate of /PRF/5 and MCF-7 cells may be higher than that of DU-145, HepG2 and Hep3B cells. Here, Western blot experiments will further confirm the expression activation activity of CEBPA brought by C/EBPa-saRNA in DU-145 and MCF-7 cell lines.

Example 11 CEBPA activation upregulates expression of downstream targets (CEBPB, P21 and ALB) in specific cancer cell lines

There is a dynamic transcriptional switch between CEBPA and CEBPB. A high ratio of CEBPA/CEBPB enhances metabolism while suppressing acute phase response genes. Conversely, low ratios inhibit metabolism and activate acute phase or cell cycle genes. P21(WAF-1/CIP-1) plays an important anti-proliferative role and inhibits cell cycle progression of HCC. Albumin reduces the phosphorylated protein of the tumor suppressor retinoblastoma (Rb) protein and suppresses the proliferation of HCC G0/G1 cell populations and enhances the expression of p21 to inhibit cell spreading by increasing HCC (Nojiri, S. et al. Int J Mol Sci. 2014 15(3):p5163-74). According to Reeye, V et al. (Reeye, et al., Hepatology. 2014 59(1):p216-227), CEBPA activation can improve liver function through upregulation of albumin in an in vivo model. Studies of functional CEBPA-regulated downstream factors, mainly focusing on studies of CEBPΒ, P21, and ALB, have been performed in HCC and other cancer lines. Here, we selected five different cell lines to study CEBPA target engagement including three HCC cell lines (HepG2, Hep3B and PLC/PRF/5), one prostate cancer line (DU-145) and one breast cancer line ( MCF-7). Among the widely used HCC cell lines, we used HepG2, Hep3B and PLC/PRF/5 cells because HepG2 and Hep3B cells represent well-differentiated HCC cell lines, while PLC/PRF/5 cells represent undifferentiated cells. HepG2 has a high expression of CEBPA, while Hep3B has a relatively low endogenous level. This may be because the metabolic rate of Hep3B is higher than that of HepG2, which means that more energy will be consumed for the metabolism of Hep3B than for the endogenous synthesis of C/EBPa. DU-145 and MCF-7 cells were compared to HCC to identify differences in target impact and whether these cells shared signaling pathways with HCC cells.

In this example, CEBPB was selected to study the factors of C/EBPα and C/EBPβ functional synergy. CEBPA activation upregulated the expression of C/EBPβ in HepG2, Hep3B, DU-145 and MCF-7 cells, but not PLC/PRF/5 cells. This may be because PLC/PRF/5 cells are an undifferentiated cell line that tend to grow faster, spread more extensively and be more aggressive than differentiated cells. This property limits the timing of CEPBA transcriptional activation and inhibits its downstream target effects. Cells were transfected with C/EBPa-saRNA at a concentration of 20 nM and harvested 72 hours after seeding for total RNA extraction and reverse transcription. Relative expression was calculated using the Livak method of 2 ^-ΔΔC.T with GAPDH as a housekeeping gene. Bar graphs represent the relative expression levels of CEBPA, CEBPB, P21 and ALB mRNA±SD (n=3). Data represent triplicate experiments. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. The result is shown in Figure 6.

Figure 6 shows the relative expression levels in HCC and other cell lines after C/EBPa-saRNA transfection. (A) CEBPA, CEBPB, P21 and ALB mRNA levels in HCC-HepG2 cell lines. (B) CEBPA, CEBPB, P21 and ALB transcript levels in HCC-Hep3B cell lines. (C) CEBPA, CEBPB, P21 and ALB mRNA levels in the HCC-PLC/PRF/5 cell line. (D) CEBPA, CEBPB, P21 and ALB transcript levels in the prostate cancer-DU-145 cell line. (E) CEBPA, CEBPB and P21 mRNA levels in breast cancer MCF-7 cell line.

When C/EBPa-saRNA was transfected, the transcript level of CEBPB in HepG2 cells was significantly increased, reaching 2.5 times (Figure 6A), and it was also increased to 1.7 times in Hep3B (Figure 6B), and in DU-145 (Figure 6D) and It even reached 6-fold and 5-fold, respectively, in MCF-7 (Fig. 6E), while CEBPB expression did not change significantly in PLC/PRF/5 cells (Fig. 6C).

The HCC cell lines - HepG2 (Fig. 7A) and PLC/PRF/5 (Fig. 7C) cells were assayed for target-acting proteins, as well as relative band intensities, by immunoblotting. Similar to the analysis results of qRT-PCR, the expression of p21 protein was detected to be 5.5 times up-regulated by C/EBPa activation in HepG2 cells (Fig. 7D), and the expression was up-regulated 2 times in Hep3B cells (Fig. 6E). A slight downregulation was observed in PRF/5 (Fig. 7F). These data suggest that activation of C/EBPa upregulates the expression of p21 protein, a downstream protein factor of C/EBPa, in HepG2 and Hep3B cells. But in PLC/PRF/5 cells, the activation of C/EBPa had no obvious effect on p21.

Many studies have shown that a high serum albumin level is an important indicator of good prognosis, because a low HCC recurrence rate is associated with high albumin levels in patients. It has been reported that upregulation of C/EBPa reduces tumor burden and improves liver function in liver cirrhosis/HCC models. Therefore, upregulation of albumin expression through CEBPA activation may reduce the rate of HCC recurrence. Enhancement of CEBPA caused a significant increase (2.7-fold) in ALB mRNA expression levels in HepG2 cells (Fig. 6A), but no obvious downstream effects against albumin in Hep3B cells (Fig. 6B) and PLC/PRF/5 cells (Fig. 6C ).

In this example, Western blot experiments were also carried out to confirm the target effect of CEBPA, and to analyze the protein expression relative to the intensity of the bands. Western blot analysis of C/EBPa activation in different cancer cell lines is shown in FIG. 7 . Western blot confirmed that C/EBPα enhanced the protein expression levels of C/EBPα, C/EBPβ, p21 and albumin in HepG2 (Fig. 7A), Hep3B (Fig. 7B) and PLC/PRF/5 (Fig. 7C) cell lines. Relative band intensities were also tested in the HepG2 (Fig. 7D), Hep3B (E) and PLC/PRF/5 (Fig. 7F) cell lines. Cells transfected with 20nM Scramble and C/EBPa-saRNA were incubated for 72 hours. 40 μg protein lysates of transfected and untransfected cells were analyzed by Western blot. SDS-polyacrylamide gels (PAG) were transferred onto PVDF membranes and immunoprobed with C/EBPα, C/EBPβ, p21 and albumin antibodies. β-actin was used as a loading control. The expression level of albumin was increased 6.5-fold in HepG2 cells (Fig. 7D); however, no significant effect of albumin due to C/EBPa activation was observed in Hep3B and PLC/PRF/5 cells (Fig. 7F) (Fig. 3-8E). These indicate that albumin is a downstream target of CEBPA in HepG2 cells.

Example 12 Knockdown effect of C/EBPα and C/EBPβ in HCC

RNA interference (RNAi) is an RNA-dependent gene silencing process triggered by small molecules. After a certain amount of exogenous double-stranded RNA (dsRNA) enters cells, it is cut into short 21~ 23bp double-stranded small interfering RNA (siRNA), siRNA combined with helicase and other factors to form RNA-induced silencing complex (RISC). As multiple factors can affect the extent of siRNA-induced knockdown, proper optimization is critical to ensure experimental success. Failure to optimize will make the RNAi effect undetectable. We first optimize the transfection efficiency to achieve the maximum inhibitory effect of exogenously introduced siRNA. Here, we performed in vitro siRNA experiments, optimized transfection efficiency, and confirmed by quantitative real-time PCR and by western blotting.

12.1 Optimization of CEBPA and CEBPB knockdown in HepG2 cells

To study the biological role of CEBPA gene knockdown in different cell lines, small interfering RNA (siRNA) was used to silence CEBPA expression, and the effect of this process on cellular function was then investigated to study specific genes in cultured cells function. In this example, in order to study the optimal concentration for knocking down CEBPA, HepG2 cells were selected for transfection at final concentrations of 10 nM and 20 nM. When HepG2 cells were transfected with a concentration of 10nM C/EBPa-siRNA, the transcript level of CEBPA (0.76 times) was significantly reduced, and the reduction was smaller than the transfection concentration of 20nM (0.81 times) (Figure 8A). However, it has been shown that siRNAs are not always specific, and when high concentrations of siRNAs are used to silence their intended targets, many off-targets occur. Although CEBPA in the 20nM group has a better effect on reducing transcription, 10nM is selected as the optimal inhibitory concentration of C/EBPa-siRNA in HepG2 cells in this example because it can avoid off-target effects.

This example also used siRNA to inhibit the expression of CEBPB to assess its proliferative effect, and in different cancer lines, and to explore the results produced under different CEBPA and CEBPB interaction states. The experimental results are shown in Figure 8, representing the expression levels of CEBPA and CEBPB mRNA after siRNA transfection into HepG2 cells. (FIG. 8A) siRNA at final concentrations of 10 nM and 20 nM knocked down the expression of CEBPA. ( FIG. 8B ) Transfection of C/EBPβ-siRNA with a final concentration of 10 nM and 20 nM, the transcript level of CEBPB. Relative expression was calculated using the Livak method of 2 ^-ΔΔC.T with GAPDH as the housekeeping gene. Bar graphs represent relative expression levels of CEBPA/CEBPB mRNA±SD (n=3). Data represent triplicate biological experiments.

Similar to CEBPA knockdown, we performed transfections in HepG2 using C/EBPβ-siRNA at final concentrations of 1OnM and 20nM to optimize the optimal concentration for knockdown of CEBPΒ in this cell. CEBPB expression showed a 0.8-fold reduction at a concentration of 10 nM, and a 0.7-fold reduction at 20 nM (Fig. 3-9B). This indicates that 10 nM is the optimal concentration for knocking down C/EBPβ-siRNA. Since 10 nM is an ideal concentration for CEBPA and CEBPB knockdown, Western blot analysis was also performed on HepG2 cells (Fig. 9A) to determine whether this concentration had an ideal inhibitory effect on target protein expression. The experimental results are shown in FIG. 9 , Western-Blot analysis detected the knockdown of C/EBPα and C/EBPβ in the HCC-HepG2 cell line. The protein expression levels of C/EBPa and C/EBPβ after the knockdown experiment were confirmed by Western blotting in the HepG2 cell line (Fig. 9A). Relative band intensities were also shown in the HepG2 (Fig. 9B) cell line. After transfection with 10 nM scrambled siRNA, C/EBPa-siRNA and C/EBPβ-siRNA, the cells were incubated for 48 hours. 40 μg of protein lysates were analyzed by Western blot for transfected and untransfected cells. SDS-polyacrylamide gels (PAG), transferred to PVDF membranes, and immunoprobed with anti-C/EBPα and C/EBPβ antibodies. β-ACTIN was used as a loading control.

From the relative band intensity analysis of western blot analysis, when C/EBPa-siRNA knocked down CEBPA, the protein expression level of C/EBPa was reduced by 0.8-fold (Fig. 9B). For CEBPB inhibition, transfection by C/EBPβ-siRNA (Fig. 9B), the expression of C/EBPβ protein was reduced by 0.9 times.

Based on these, knockdown of C/EBPα and C/EBPβ using siRNA has been optimized, and 10 nM is the optimal concentration for further study.

12.2 Validation of conditions for optimal knockdown of C/EBPα and C/EBPβ in other cancer cell lines

In order to verify whether the optimal concentration of CEBPα and C/EBPβ combination obtained above is applicable to other cancer lines, we performed Hep3B, PLC/PRF/5, DU-145 and MCF under the same transfection method and conditions, respectively. -7 cells were transfected with Scramble-siRNA, C/EBPα-siRNA and C/EBPβ-siRNA. As previously shown in HepG2 cells. Knockdown of CEBPA (Figure 10) and CEBPB (Figure 12) was also successfully accomplished in these cell lines. The results shown in Figure 10 are for inhibition of CEBPA using siRNA transfection in cancer cell lines. Figure 10 (A) CEBPA mRNA levels in HCC-Hep3B cells. Figure 10(B) CEBPA mRNA levels in HCC-PLC/PRF/5 cells. Figure 10(C) CEBPA mRNA levels in prostate cancer DU-145 cells; Figure 10(D) CEBPA mRNA levels in breast cancer MCF-7 cells. Cells were transfected with C/EBPa-siRNA at a concentration of 10 nM, harvested 72 hours after inoculation, and used for total RNA extraction and reverse transcription. Relative expression was calculated using 2 ^-ΔΔC.T with GAPDH as a housekeeping gene. Bar graphs represent relative expression levels of CEBPA mRNA±SD (n=3).

For CEBPA inhibition, CEBPA transcript levels (Fig. 10C) in DU-145 and MCF-7 cells (Fig. 10D) are shown, respectively. We observed a significant knockdown effect of more than 0.9-fold, which was more effective than Hep3B (Fig. 10A) and PLC/PRF/5 (Fig. 10B), which were reduced by 0.84 and 0.79 when transfected with C/EBPa-siRNA times.

Figure 11 shows the knockdown of C/EBPα and C/EBPβ detected in the HCC-HepG2 cell line by Western Blot analysis. In Hep3B (Fig. 11A) and PLC/PRF/5 (Fig. 11B) cell lines, the protein expression levels after knocking down C/EBPα and C/EBPβ were analyzed by Western blot and the results are shown in the figure. Relative band intensities are also shown in the Hep3B (Fig. 11C) and PLC/PRF/5 (Fig. 11D) units. Cells transfected with 10nM Scramble-siRNA, C/EBPα-siRNA and C/EBPβ-siRNA were incubated for 48 hours. 40 μg of protein lysates from transfected and untransfected cells were analyzed by western blot. SDS polyacrylamide gels (PAG) were transferred to PVDF membranes and immunodetected with anti-C/EBPα and C/EBPβ antibodies. β-actin was used as a loading control. Data represent triplicate biological experiments.

To determine the knockdown effect of C/EBPa on protein expression, Western blot and relative band intensity analysis were performed on the HCC cell line Hep3B (Figure 11A and Figure 11C) and the PLC/PRF/5 cell line (Figure 11B and Figure 11D ). From the analysis of relative band intensity, both Hep3B ( FIG. 11C ) and PLC/PRF/5 ( FIG. 11D ) cells had the effect of reducing C/EBPa protein by more than 0.9 times. These suggest that CEBPA knockdown was successful in other HCC cell lines, except HepG2 cells.

Figure 12 The effect of knocking down CEBPB on cancer cell lines transfected with siRNA was studied. The results are shown in Figure 12, where Figure 12A is the level of CEBPB mRNA in HCC-Hep3B cells. Figure 12B shows CEBPB mRNA levels in HCC-PLC/PRF/5 cells. Figure 12C shows CEBPB mRNA levels in prostate cancer DU-145 cells. Figure 12D shows CEBPB mRNA levels in breast cancer MCF-7 cells. Cells were transfected with C/EBPβ-siRNA at a concentration of 10 nM, incubated for 72 hours after seeding, and harvested for total RNA extraction and reverse transcription. Relative expression was calculated using the Livak method of 2 ^-ΔΔC.T and GAPDH as a housekeeping gene. Bar graphs represent relative expression levels of CEBPB mRNA±SD (n=3). Data represent triplicate experiments. **p<0.01.

Knockdown of CEBPB transcription was evident in C/EBPβ-siRNA transfected cells, Hep3B (Fig. 12A), PLC/PRF/5 (Fig. 12B), DU-145 (Fig. 12C) and MCF-7 (Fig. 12D) Cell lines are down more than 0.8-fold. Western blot was performed to confirm the knockdown effect of C/EBPβ on the protein expression level. Gene analysis of relative band intensity in HCC cell lines - Hep3B (Figure 11A and C) and PLC/PRF/5 (Figure 11B and D) cells confirmed siRNA-induced protein knockdown. CEBPB transcripts were reduced by 0.9-fold in Hep3B cells (Fig. 11C) when transfected with 10 nM C/EBPβ-siRNA, and by 0.7-fold in PLC/PRF/5 (Fig. 11D) cells.

Example 13 Comparison of C/EBPa downstream target effects in differentiated HepG2 cells and undifferentiated PLC/PRF/5 cells

13.1 C/EBPα and C/EBPβ play different roles in different differentiated HCC cell lines

The experimental results of activation and knockdown of CEBPA and CEBPB in HepG2 and PLC/PRF/5 cell lines are shown in FIG. 13 . With 20nM of Scramble-saRNA and C/EBPa-saRNA and 10nM of scrambling-siRNA, C/EBPa-siRNA treated HepG2 (Fig. 13A), Hep3B (Fig. 13B) and PLC/PRF/5 (Fig. 13C) cells Transcript levels of CEBPA, CEBPB, P21 and albumin.

CEBPA activates upregulation of downstream targets (CEBPB, P21 and albumin) in specific cancer cell lines

CEBPA exerts an important anti-proliferative effect through p21 (WAF-1/CIP-1), which is a regulator of cell cycle progression, gene transcription and DNA repair. In addition, many studies have shown that albumin inhibits the proliferation of HCC, and high serum albumin level is the main indicator of better prognosis, leading to a low recurrence rate of HCC. Therefore, in studying the function of CEBPA in regulating downstream factors, we focused on CEBPβ, p21 and albumin as downstream targets. Studies by Harris et al. have confirmed that CEBPA inhibits cell proliferation and promotes cell differentiation through the mechanism mediated by p21, wherein p21 is an inhibitor of CDKs, which proves that the regulation of CEBPA is through the interaction between its protein expression product and p21 and CDK2 proteins interaction is achieved. Previous studies have shown that in hepatocytes and liver cancer cells, CEBPA can stabilize p21 protein through protein-protein interaction, activate p21 gene and promote its expression, thereby exhibiting the effect of inhibiting cell proliferation.

Since HepG2 and Hep3B represent differentiated HCC, while PLC/PRF/5 represent undifferentiated, these three cell lines were chosen to study CEBPA and its downstream targets. There is a dynamic interaction between CEBPA and CEBPB. A higher ratio of CEBPA to CEBPB suppressed cell proliferation activation and acute phase response gene suppression through cell cycle and metabolic genes, whereas a low ratio of CEBPA to CEBPB had the opposite effect. In HCC cell lines – HepG2 (Fig. 13A), Hep3B (Fig. 13B) and PLC/PRF/5 (Fig. 13C), a high ratio of CEBPA to CEBPB (greater than 1) was formed for CEBPA activation and CEBPB reduction, the data showed Acute phase response or cell cycle genes may be suppressed, and metabolic genes may be enhanced. In contrast, this ratio was reduced (<1) when CEBPA expression was inhibited, suggesting that cell proliferation may be accelerated and metabolic genes enhanced. These effects were also confirmed by Western blot and relative band intensity analysis of HepG2 (Figure 14A&D), Hep3B (Figure 14B&E) and PLC/PRF/5 (Figure 14C&F).

13.2 Downstream target impact of CEBPA

CEBPA activates upregulated downstream targets (CEBPB, p21 and ALB) in specific cancer cell lines

CEBPA exerts an important anti-proliferative effect through p21 (WAF-1/CIP-1), which is a regulator of cell cycle progression, gene transcription and DNA repair. In addition, many studies have shown that albumin inhibits the proliferation of HCC, and high serum albumin level is the main indicator of better prognosis, leading to a low recurrence rate of HCC. Therefore, in studying the function of CEBPA in regulating downstream factors, we focused on CEBPΒ, P21 and ALB as downstream targets. Studies by Harris et al. have confirmed that CEBPA inhibits cell proliferation and promotes cell differentiation through the mechanism mediated by p21, wherein p21 is an inhibitor of CDKs, which proves that the regulation of C/EBPa is through the interaction of its protein expression product with p21 and CDK2 proteins to realize the interaction between them. Studies have shown that in hepatocytes and liver cancer cells, C/EBPa can stabilize p21 protein through protein-protein interaction, activate p21 gene and promote its expression, thereby inhibiting cell proliferation.

Activation of C/EBPa by saRNA could significantly enhance p21 expression in HepG2 cells (6-fold) (Fig. 13A) and Hep3B cells (1.8-fold) (Fig. 13B) in differentiated cells, but not observed in undifferentiated PLC/PRF/5 cells The fold reduction to p21 expression was 0.4-fold (Fig. 13C). Albumin expression was enhanced 3.5-fold by C/EBPa in HepG2 cells (Fig. 13A), but not in Hep3B (Fig. 13B) and PLC/PRF/5 cells (Fig. 13C).

Western blot and relative band intensity analysis were used to determine this effect, respectively. The protein expression level of p21 was upregulated (5.5-fold increase) in HepG2 (Figure 14A&D) and Hep3B (1.8-fold increase) cells (Figure 14B&E), but PLC/PRF/5 cells were unchanged (Figure 14C&F). Albumin expression was only upregulated by C/EBPa enhancement, a 6-fold increase in HepG2 cells (Fig. 14A & D). These suggest that p21 and albumin are downstream factors of C/EBPa in differentiated HepG2 cells, but probably not in undifferentiated PLC/PRF/5 cell cells. p21 is also a downstream factor of C/EBPa in Hep3B. The expression of C/EBPβ was greatly changed in differentiated HepG2 and Hep3B (Fig. 3-14A) and (Fig. 13B) cells, but not in undifferentiated PLC/PRF/5 cells (Fig. 13C). C/EBPβ inhibition enhanced C/EBPa (2-fold) and p21 expression (2-fold) in HepG2 cells (Fig. 13A), but had no effect in Hep3B (Fig. 13B) and PLC/PRF/5 (Fig. 13C). Table 6 shows the on-target effects of C/EBPa under different conditions of saRNA or siRNA treatment. As summarized in Table 6, differentiated HepG2 and Hep3B cells responded to enhanced C/EBPa, whereas high expression of C/EBPβ prevented undifferentiated PLC/PRF/5 cells from responding to C/EBPa activation. In differentiated HepG2 and Hep3B cells, p21 is a downstream factor of C/EBPa in promoting cell cycle arrest. The mechanism of action in cells in PLC/PRF/5 may not be the case. Albumin is a downstream factor of C/EBPa in HepG2 cells. In Hep3B and PLC/PRF/5 cells, C/EBPa had no significant effect on the restoration of albumin expression.

Table 6 The target effect of CEBPA

13.3 Synergistic effects of CEBPA and its downstream targets in HepG2 cell line

13.3.1 Optimization of p21 activation in HepG2 cells

In order to determine the ideal saRNA dosage for transfection, the expression level of p21 mRNA was determined after saRNA transfection of HepG2 cells. Cells were transfected with p21-saRNA at concentrations of 20 nM and 50 nM and harvested 72 hours after seeding for total RNA extraction and reverse transcription. Relative expression was calculated using the Livak method of 2 ^-ΔΔC.T GAPDH was used as a housekeeping gene. Bar graphs represent relative expression levels CEBPA mRNA±SD (n=3). Data represent triplicate experiments. ****p<0.0001. We transfected p21-saRNA at final concentrations of 20 nM and 50 nM in HepG2 cells. Both the concentration of saRNA at 20nM and 50nM (Figure 15) successfully activated the transcription level of p21 in cells, the transcription level increased by more than 3 times when the concentration was 50nM, and increased by 2.5 times when the concentration was 20nM (Figure 3-16). Although 50 nM p21-saRNA reached higher levels, in order to avoid potential off-target effects in HepG2 cells, 20 nM p21-saRNA was used to activate p21 in HepG2 cells.

13.3.2 Synergy between C/EBPα-saRNA and C/EBPβ-siRNA and/or p21-saRNA

To elucidate the synergistic activity of CEBPA with downstream targets CEBPB and p21, we co-transfected C/EBPα-saRNA with C/EBPβ-siRNA or p21-saRNA, and C/EBPα-saRNA, C/EBPβ-siRNA and p21 -saRNA was triple transfected in HepG2 cells. Cells were transfected with C/EBPα-saRNA mixed with C/EBPβ-siRNA or p21-saRNA at a concentration of 20 nM, and harvested 72 hours after seeding for total RNA extraction and reverse transcription. Figure 17 shows the relative expression level of (A) CEBPA transcript level (B) CEBPBmRNA after HCC-HepG2 cell co-transfection; (C) p21 transcript level; (D) ALBmRNA expression level; (E) in each case Ct value of lower housekeeping gene-GAPDH. Relative expression by the Livak method of 2 ^-ΔΔC.T using GAPDH as a housekeeping gene. Bar graphs represent expression levels relative to CEBPA, CEBPB, P21 and ALB mRNA±SD (n=3). Data represent triplicate biological experiments.

The data in Table 3-2 indicate that synergy is more active than monotherapy in CEBPA. The dual combination of C/EBPa-saRNA and C/EBPβ-siRNA resulted in a higher CEBPA expression level (2.2-fold) than that of single transfection, and the effect of transfection of C/EBPa-saRNA alone was 2-fold. (Figure 16A)

This was also confirmed by immunoblotting (Fig. 17A). Western blot analysis was performed after co-transfection in HCC-HepG2 cells. Cells were co-transfected with C/EBPα-saRNA and C/EBPβ-siRNA or p21-saRNA, and harvested 72 hours after seeding for total RNA extraction and reverse transcription. 40 μg of protein lysates from transfected and untransfected cells were analyzed by Western blot. SDS-polyacrylamide gels (PAG) were transferred to PVDF membranes and immunoprobed with anti-C/EBPα, C/EBPβ and albumin antibodies. β-actin was used as a loading control. The data represent triplicate biological experiments. The protein expression levels of C/EBPα, C/EBPβ and albumin after co-transfection were confirmed by Western blot analysis in HepG2 cells ( FIG. 17A ). The relative band intensities of C/EBPα (FIG. 17B), C/EBPβ (FIG. 17C) and albumin (FIG. 17D) are shown respectively. Relative band intensity analysis showed that CEBPA increased (4-fold) after co-transfection of C/EBPa-saRNA ( FIG. 17B ), and the expression level of C/EBPa protein increased. Whereas by comparison C/EBPa-saRNA transfection only caused a 2-fold increase in C/EBPa protein ( FIG. 17B ). The triple combination of C/EBPa-saRNA, p21-saRNA and C/EBPβ-siRNA resulted in more potent CEBPA activation (6-fold) (Fig. 17B), compared to the combination of C/EBPa-saRNA and C/EBPβ-siRNA. The improvement effect was 4 times, and the effect of co-transfecting C/EBPa-saRNA with P21-saRNA was 2 times ( FIG. 17B ).

Double transfection of C/EBPa-saRNA and C/EBPβ-siRNA achieved better up-regulated p21 expression levels than co-transfection of C/EBPa-saRNA, C/EBPβ-siRNA and p21-saRNA. P21, a downstream target of CEBPA in HepG2 cells, exerts antiproliferative effects by promoting cell cycle arrest. Double transfection of C/EBPa-saRNA and C/EBPβ-siRNA resulted in higher p21 transcript levels (3.5-fold) (Fig. 16C), compared to C/EBPa-saRNA, C/EBPβ-siRNA and p21 - triple transfection of saRNA increased p21 expression levels by 2-fold (Fig. 16C). However, whitening was observed in both double transfection of C/EBPa-saRNA and C/EBPβ-siRNA (Fig. 16D) and triple combination of C/EBPa-saRNA, C/EBPβ-siRNA and p21-saRNA (Fig. 17D). Protein expression increased two-fold. This effect was also confirmed by immunoblotting (FIG. 17A), and relative band intensity analysis showed a 15-fold increased activation by albumin (FIG. 17D). Double transfection of C/EBPa-saRNA and C/EBPβ-siRNA showed 3-fold higher than triple transfection of C/EBPa-saRNA, C/EBPβ-siRNA and p21-saRNA. This may be due to competitive inhibition of C/EBPa and p21.

Competitive inhibition of C/EBPa and p21 may exist in combined transfections in HepG2 cells, including double and triple transfections. Single transfection of C/EBPa-saRNA and p21-saRNA achieved 3.5-fold and 4.5-fold activation of p21 expression, which was 2.5-fold higher than the combination of C/EBPa-saRNA and p21-saRNA, respectively (Fig. 16C). As shown before, double transfection of C/EBPa-saRNA and C/EBPβ-siRNA compared with triple transfection of C/EBPα-saRNA, C/EBPβ-siRNA and p21-saRNA (1.3-fold) (Fig. 17B) Better C/EBPa activation (2.3-fold) was achieved. A similar effect was also obtained in P21 activation. Double transfection of C/EBPα-saRNA and C/EBPβ-siRNA (Fig. 16C) achieved 3.8-fold and 5-fold activation of p21 activation, which was higher than that of C/EBPα-saRNA, C/EBPβ-siRNA and p21-saRNA ( 1.8-fold) (Fig. 16C) was higher for triple transfection. Furthermore, a 15-fold activation of albumin expression was observed in double transfection of C/EBPa-saRNA and C/EBPβ-siRNA, while triple transfection of C/EBPa-saRNA, C/EBPβ-siRNA and p21-saRNA ratio is higher (2-fold) (Fig. 17D). This experiment confirmed that C/EBPa-saRNA and C/EBPβ-siRNA may be the ideal choice for inhibiting HCC.

Table 7 Synergy of CEBPA and its downstream targets in cells.

In conclusion, the combined use of C/EBPa-saRNA and C/EBPβ-siRNA resulted in higher activated C/EPBA, p21 and albumin expression in HepG2 cells due to the combination of C/EBPa-saRNA and C/EBPβ-siRNA It has a better anti-proliferation effect caused by up-regulation of C/EBPa and p21 expression, so as to improve liver function and inhibit tumor effect through albumin enhancement.

HCC is a heterogeneous disease that can be divided into two phenotypes - differentiated and undifferentiated. Among the cell lines selected in this example, HepG2 and Hep3B represent differentiated cell lines and PLC/PRF/5 represent undifferentiated. In the present study, we found that HepG2 cells were responsive to C/EBPa activation, whereas PLC/PRF/5 cells were resistant, and that C/EBPβ levels prevented PLC/PRF/5 cells from responding to C/EBPa-enhanced response. This prompted us to investigate whether C/EBPβ knockdown in PLC/PRF/5 cells would affect the response to C/EBPα, prompting a shift from a different resistance to a sensitive response to it. This example also focuses on whether the combination of C/EBPa activation and C/EBPa knockdown has an effect on the downstream targets of C/EBPa - p21 and albumin.

By first validating the effect of co-transfection in HepG2 cells and demonstrating that the combination of C/EBPa-saRNA and C/EBPβ-siRNA may result in higher levels of C/EBPa, p21 and Activation of albumin. Thus, this selection would lead to a better antiproliferative response caused by upregulation of C/EBPa and p21. There is a dynamic interaction between CEBPA and CEBPB: a high ratio of CEBPA to CEBPB inhibits cell proliferation through activation of cell cycle and metabolic genes and repression of acute phase response genes. A low ratio of CEBPA to CEBPB has the opposite effect.

The study in this example also found that changing the expression balance of CEBPA and CEBPB may have profound effects on specific cell types of HCC. As shown in previous data, the combination of CEBPA activation and CEBPB inhibition produces an elevated ratio of CEBPA to CEBPB, leading to better activation of p21 in differentiated HepG2 cells to suppress the effect of the cell cycle on cellular antiproliferation. However, whether this combined effect can be applied to undifferentiated PLC/PRF/5 cells remains unclear.

According to the above studies, when C/EBPa-saRNA and p21-saRNA were co-transfected, the competitive inhibitory effect of C/EBPa and p21 may appear. p21 is a downstream factor of C/EBPa in differentiated HepG2 cells. The experimental results showed that when C/EBPa-saRNA or p21-saRNA was transfected once, the expression level of p21 was higher than that under the co-transfection condition of the two. Given that HepG2 cells have sufficient endogenous C/EBPa, it may have a specific mechanism to self-regulate the expression of C/EBPa, which may contribute to the inhibition of dual activation, leading to the suppression of p21 expression.

Example 14. In Vitro Study of C/EBPa-saRNA Composition in Human Hepatocytes

Human primary hepatocytes (Life Technologies, HMCPTS) were placed in non-proliferating medium. On the day of seeding, the cells were subjected to a reverse transfection step in which the saRNA transfection complex was added to the cells prior to attachment of the cell monolayer. After 24 hours, the medium was changed and forward transfection was performed. The next day, the medium was changed and the cells were incubated for an additional 24 hours before harvesting for analysis. Hepatocytes were transfected with AP2 (preferably C/EBPa-saRNA). CEBPA mRNA levels and ALB mRNA levels were measured at 48 hours and 72 hours. Aha-1-siRNA and Fluc were used as controls.

experiment method

Refolding of saRNA: Resuspend each lyophilized saRNA strand to 1mM in RNase-free 10mM Tris-HCl, 20mM NaCl, 1mM EDTA. Mix them well to completely resuspend. Mix together equal volumes of sense and antisense strands by gentle vortexing. The tube containing the merged strands was placed in a beaker with water heated to 95°C. Cover the beaker and allow to cool to room temperature. Use RNase-free water for subsequent dilutions. Typically for a 24-well format, dilute the stock solution to 10 μM. Aliquots of refolded saRNA samples were stored at -20°C.

Thawing and plating of primary hepatocytes:

Warm CHRM and plating medium to 37 °C in a water bath. Frozen hepatocytes were thawed in a 37 °C water bath until no ice crystals remained. The vial was sterilized with 70% ethanol. In a sterile tissue culture fume hood, transfer the thawed hepatocytes directly into the CHRM. Hepatocytes were centrifuged at 100 x g (900 rpm in a Thermo F-G1 fixed angle rotor) for 10 min at room temperature. Carefully decant the supernatant into a waste bottle. Resuspend the pellet at ^1x106 frozen cells in 1 mL of plating medium. Cells were counted using the NucleoCounterNC-200 Aggregate Cytometer to determine cell viability. Plate 2.0 x ¹⁰⁵ viable cells in 500 μL per well of plating medium in a 24-well plate.

Reverse transfection (immediately after inoculation):

For each well to be transfected, 12 μL of 10 μM saRNA was diluted in 85 μL of Opti-MEM. For each well to be transfected, add 3 μL of HiPerFect and mix well by vortexing. The transfectants were incubated for 15 minutes at room temperature. 100 μL of transfection complex was added to each well for a final saRNA concentration of 200 nM. Plates were incubated in a humidified incubator at 37 °C 5% _CO2 . After 5 h, the medium was replaced with 500 μL of pre-warmed maintenance medium.

Forward transfection (24 hours after inoculation): For each well to be transfected, dilute 12 μL, 10 μM saRNA in 85 μL Opti-MEM. Add 3 μL of HiPerFect to each well to be transfected and mix thoroughly by vortexing. The transfectants were incubated for 15 minutes at room temperature. During the incubation period, the medium was replaced with 500 μL per well of pre-warmed fresh maintenance medium. 100 μL of transfection complex was added to each well for a final saRNA concentration of 200 nM. Return the plate to the incubator. After 24 h, replace the medium with 500 μL of pre-warmed fresh maintenance medium. The highest gene activation occurs 72 hours after cell seeding. Cells and/or supernatant were collected at this point for downstream analysis.

saRNA Transfection Protocol in Proliferating Human Primary Hepatocytes

Human primary hepatocytes (Life Technologies, HMCPTS) were placed in proliferation medium. On the day of seeding, the cells were subjected to a reverse transfection step in which the saRNA transfection complex was added to the cells prior to attachment of the cell monolayer. After 24 hours, the medium was changed and forward transfection was performed. The next day, the medium was changed and the cells were incubated for an additional 24 hours before harvesting for analysis. Hepatocytes were transfected with AP2 (preferably C/EBPa-saRNA). CEBPA mRNA levels and albumin mRNA levels were measured at 48 hours and 72 hours. Aha-1-siRNA and Fluc were used as controls.

saRNA refolding:

Each lyophilized saRNA strand was resuspended to 1 mM in RNase-free 10 mM Tris-HCl, 20 mM NaCl, 1 mM EDTA. Mix them well to completely resuspend. Mix together equal volumes of sense and antisense strands by gentle vortexing. Place the tube with the combined strands in a beaker with water heated to 95°C. Cover the beaker and allow to cool to room temperature. Use RNase-free water for subsequent dilutions. Typically for a 24-well format, dilute the stock solution to 10 μM. The refolded saRNA was aliquoted and stored at -20°C.

Thawing and plating of primary hepatocytes:

Warm CHRM and plating medium to 37 °C in a water bath. Frozen hepatocytes were thawed in a 37 °C water bath until no ice crystals remained. The vial was sterilized with 70% ethanol. In a sterile tissue culture fume hood, transfer the thawed hepatocytes directly into the CHRM. Hepatocytes were centrifuged at 100 x g (900 rpm in a Thermo F-G1 fixed angle rotor) for 10 min at room temperature. Carefully decant the supernatant into a waste bottle. Resuspend the pellet at ^1x106 frozen cells in 1 mL of plating medium. Cells were counted using the NucleoCounterNC-200 Aggregate Cytometer to determine cell viability. ^1.0x105 viable cells were plated in 24-well plates with 500 μL of plating medium per well.

Reverse transfection (immediately after inoculation):

For each well to be transfected, dilute 3 μL of 10 μM saRNA in 94 μL of Opti-MEM. For each well to be transfected, add 3 μL of HiPerFect and mix well by vortexing. The transfectants were incubated for 15 minutes at room temperature. 100 μL of transfection complex was added to each well for a final saRNA concentration of 50 nM.

Plates were incubated in a humidified incubator at 37 °C 5% _CO2 . After 5 h, the medium was replaced with 500 μL of pre-warmed maintenance medium.

Forward transfection (24 hours after inoculation):

For each well to be transfected, dilute 3 μL of 10 μM saRNA in 94 μL of Opti-MEM. For each well to be transfected, add 3 μL of HiPerFect and mix well by vortexing.

The transfectants were incubated for 15 minutes at room temperature. During the incubation period, the medium was replaced with 500 μL per well of pre-warmed fresh maintenance medium. 100 μL of transfection complex was added to each well for a final saRNA concentration of 50 nM. Return the plate to the incubator. After 24 h, replace the medium with 500 μL of pre-warmed fresh maintenance medium. The highest gene activation occurs 72 hours after cell seeding. Cells and/or supernatant were collected at this point for downstream analysis.

The experimental results show that the C/EBPa-saRNA composition upregulates C/EBPa and albumin in hepatocytes when the hepatocytes are exposed to the proliferation medium. Therefore, C/EBPa-saRNA showed efficacy in proliferating cells. siRNA showed efficacy in both proliferating and non-proliferating cells.

Example 15 The synergistic effect of C/EBPα-saRNA combined with C/EBPβ-siRNA on the growth of HCC cell lines in vitro.

The results of the cytotoxicity assay of SRB transfected alone are shown in FIG. 18 . Cytotoxicity in HepG2, Hep3B and PLC/PRF5 cells following transfection of various genes (inhibition/activation of CEBPA or CEBPB) was confirmed by SRB assay. Cells were grown and transfected in standard 96-well plates, then stained with 10% TCA and with 0.057% SRB. The protein-binding dye was dissolved with 10 mM Tris alkali solution, and the OD value was measured by a spectrophotometer plate reader. The SRB standard curve was established using the OD values from the no-growth control, and the absolute cell number for each treatment was calculated from the curve.

(A), (B) and (C) of Figure 18 respectively represent the C/EBPβ in HepG2 (A), Hep3B (B) and PLC/PRF5 (C) cells within 96 hours after transfection of C/EBPa-siRNA - siRNA and C/EPBα-saRNA increase in total cell number, measured at 24-hour intervals. Data represent absolute cell numbers showing viable cells (mean ± SD in triplicate samples). (D), (E) and (F) of Figure 18 represent HepG2 (D), Hep3B (E) and PLC/PRF5 (F) for a period of time (48, 96 and 72 hours) after transfection of C/EBPa-siRNA Fold changes of C/EBPβ-siRNA and C/EPBα-saRNA in cells, the values shown are relative to the data of the untransfected group. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Circles represent time points after siRNA or saRNA inactivation; boxes represent siRNA or saRNA treatment group; arrows represent C/EBPa-saRNA transfection group.

Proliferation assay of WST-1 cells transfected alone. Cell proliferation of various gene transfection treatments (inhibition/activation of CEBPA or CEBPB) in HepG2, Hep3B and PLC/PRF5 cells was assessed by WST-1 assay. The experimental method is to inoculate and transfect cells in a standard 96-well plate, and then add WST-1 reagent at a 1:100 dilution. OD values were tested at 10 min intervals by a spectrophotometer plate reader. Figure 19 (A), (B), (C) represent respectively in HepG2 (A), Hep3B (B) and PLC/PRF5 (C) cell transfection C/EBPa-siRNA, C/EBPβ-siRNA and C/ Relative increase in cell proliferation up to 96 hours after EBPa-saRNA, measured at 24-hour intervals. Data represent relative cell proliferation (mean ± SD in triplicate samples). Figure 19 (D), (E), (F) represent HepG2 (D), Hep3B (E) and PLC/PRF/5 after transfection C/EBPα-siRNA, C/EBPβ-siRNA and C/EBPα-saRNA (F) Fold increase in cells. Values shown are relative to the untransfected group. **P<0.01. Circles represent time points after siRNA or saRNA inactivation; boxes represent siRNA or saRNA treatment group; arrows represent C/EBPa-saRNA transfection group.

The purpose of this example is to confirm the synergistic anti-proliferation effect of C/EBPα-saRNA combined with C/EBPβ-siRNA in vivo. The cytotoxic and antiproliferative effects of C/EBPα-saRNA and C/EBPβ-siRNA conjugation were explored using SRB and WST-1 assays. This was achieved by testing equivalent dose combinations (10 nM and 20 nM) of the two drugs at two different concentrations. This experiment was performed in HCC cell lines including HepG2, Hep3B and PLC/PRF/5 cells. The results of the SRB cytotoxicity assay of the co-transfected cells are shown in FIG. 20 . In HepG2, Hep3B and PLC/PRF/5 cells, the cytotoxicity (inhibition/activation of CEBPA or CEBPB) of various co-transfection groups was confirmed by SRB analysis. Cells were grown and transfected in standard 96-well plates, then fixed with 10% TCA and stained with 0.057% SRB. The protein-bound dye was dissolved with 10 mM Tris alkali solution, and the OD value was measured with a spectrophotometer plate reader. The OD values were used to establish a SRB standard curve, and this curve was used to calculate the absolute cell number for each treatment. Figure 20 (A), (B), (C) respectively after transfection of C/EBPβ-siRNA, C/EPBα-saRNA, and co-transfection of different concentrations of C/EBPα-saRNA and C/EBPβ-siRNA ( 10 nM and 20 nM), the total cell number in HepG2 (A), Hep3B (B) and PLC/PRF/5 (C) cells was recorded every 24 hours within 96 hours after transfection. Data show absolute cell numbers of viable cells (mean ± SD in triplicate samples). Figure 21 (D), (E), (F) represents the fold change within 48 hours of single or co-transfection, respectively in HepG2 (Figure 21D), Hep3B (Figure 21E) and PLC/PRF/5 (Figure 21F) in cells. Data are shown relative to the untransfected group. The circles represent the time points of single or co-transfection loss of activity; the squares represent the combination of single or co-transfection of C/EBPa-saRNA and C/EBPβ-siRNA; the red arrow represents the co-transfection of C/EBPa-saRNA and C/ EBPβ-siRNA; black arrows represent single C/EBPa-saRNA transfected groups.

Regarding the SRB analysis, Figure 21 shows the increase in absolute cell number at four different time points (24, 48, 72 and 96 hours) after transfection in HCC cell lines. The results are the data after a single transfection of 20nMC/EBPa-saRNA and C/EBPβ-siRNA, or a combination of 10nM or 20nM C/EBPa-saRNA and C/EBPβ-siRNA. In the HepG2 cell line, in the C/EBPa-saRNA alone transfection group, the number of cells decreased from 25,000 to 15,000 within the first 48 hours after transfection, but peaked at the next 24 hours, and then decreased again to finally reach 35,000 cells (Figure 21). Compared with the 10nMC/EBPa-saRNA and C/EBPβ-siRNA co-transfection group (50,000 cells), the transfection group at 20nM concentration resulted in a decrease in the absolute cell number (40,000 cells) at 96 hours from 150,000 after 24 hours (FIG. 19A). It is noteworthy that C/EBPβ-siRNA had the best inhibitory effect on cell proliferation at 96 hours (20,000 cells) compared to 15,000 cells within 24 hours after transfection (Fig. 21A). However, knockdown of CEBPB experienced an increase in HepG2 cell numbers from 15,000 to 40,000 at the time point after 48 hours. This phenomenon did not appear in other transfection groups (Fig. 21D).

Similar results were also observed in Hep3B cells. The absolute cell number data of Hep3B cells at four time points (24, 48, 72 and 96 hours) in single transfection group or co-transfection group are shown in Figure 21B. The absolute cell number of a single C/EBPa-saRNA transfection In the first 48 hours after transfection, the cell number was in a relatively stable state, about 7000 cells. There was then an ramp up to 12,000 cells over the remaining 48 hours (FIG. 21B).

Compared with the 10nM C/EBPα-saRNA and C/EBPβ-siRNA co-transfection group (17,000 cells), the 20nM combination had a lower absolute cell number (6,000 cells) in the first 48 hours, from the treatment The 14,000 drop in the next 24 hours (FIG. 21B). Furthermore, the absolute cell number in the 20 nM co-transfection group fluctuated after a period, reaching 10,000 cells within 96 hours, while the 10 nM group had 8,000 cells after a sustained decline (Fig. 21B).

Similar to HepG2 cells, transfection of a single C/EBPβ-siRNA also had a better cytostatic effect (absolute cell number from 7,000/24 hours to 8,000/96 hours) than other groups ( FIG. 21B ). At the 48-hour time point, the combination group at 20 nM had a better anti-proliferative effect (7,000 absolute Hep3B cells) compared to the other treatments (FIG. 21E). However, CEBPA alone and combined transfection groups had opposite effects in PLC/PRF/5 cells.

In Figure 20C, the absolute cell number increased in all transfected PLC/PRF/5 cells, from 10,000 cells to approximately 70,000 cells within 96 hours (Figure 20C). However, within 72 hours after transfection, the combined transfection of 20 nM C/EBPa-saRNA and C/EBPβ-siRNA produced the best antiproliferative effect, which was superior to other combinations ( FIG. 20F ). These results indicated that co-transfection with C/EBPa-saRNA and C/EBPβ-siRNA had cytotoxic and antiproliferative effects in all three cell lines including HepG2, Hep3B cells. Moreover, PLC/PRF/5 cells may be converted from resistance to resistance-sensitivity by co-transfecting cell lines with C/EBPa-saRNA and C/EBPβ-siRNA.

The proliferation assay of co-transfected WST-1 cells is shown in FIG. 21 . Cell proliferation of various transfection therapies was assessed by WST-1 assay (inhibition/activation of CEBPA or CEBPB) in HepG2 and PLC/PRF5 cells. Cells were seeded and transfected in 96-well standard plates, and then WST-1 reagent diluted 1:100 was added. OD values were tested at 10 min intervals by a spectrophotometer plate reader. Figure 22 (A), (B), (C) show that in HepG2 (A), Hep3B (B) and PLC/PRF/5 (C) cells, single transfection C/EBPβ-siRNA, C/EPBα- When co-transfected with saRNA, and different concentrations of C/EBPa-saRNA and C/EBPβ-siRNA (10 nM and 20 nM), the total cell number was measured at 24-hour intervals within 96 hours. Data presented show relative cell proliferation (mean ± SD in triplicate samples). Figure 22 (D), (E), (F) represent in HepG2 (D), Hep3B (E) and PLC/PRF/5 (F) cells carry out the fold change ( 48 hours). Data are shown relative to the untransfected group. **P<0.01, ***P<0.001, ****P<0.0001. Circles represent the loss of activity after individual transfection or co-transfection after this time point; squares represent single or combined transfection groups of C/EBPa-saRNA and C/EBPβ-siRNA; red arrows represent C/EBPa-saRNA and C/EBPa-saRNA and C/EBPβ-siRNA Co-transfection of EBPβ-siRNA; black represents the individual transfection group of C/EBPα-saRNA.

To investigate the therapeutic application of C/EBPa-saRNA combined with C/EBPβ-siRNA with a synergistic antiproliferative effect, cells co-transfected with C/EBPa-saRNA and C/EBPβ-siRNA were subjected to WST-1 assay. The data showed that 20nM C/EBPα-saRNA and C/EBPβ-siRNA co-transfection combination inhibited the proliferation of human liver cancer cells HepG2 (Figure 21A & D) and Hep3B (Figure 21B & E) cells. In PLC/PRF/5 cells, the relative cell growth of single-transfected C/EPBα-saRNA and double-transfected C/EBPβ-siRNA showed a similar trend, and decreased more than 0.2-fold in the first 48 hours, followed by There was a 0.2-fold increase in the last 48 hours (Fig. 21C & F). These results indicated that co-transfection of 20nMC/EBPa-saRNA and C/EBPβ-siRNA had better cell anti-proliferation ability in HepG2 cells, and the combination of 10nM was more conducive to transformation-resistant PLC/PRF/5 cells into Responsive. This antiproliferative effect was maintained for 96 hours in HepG2, sensitive to C/EBPa activation, and 48 hours in PLC/PRF/5 cells.

Example 16 Effects of C/EBPα Activation and C/EBPβ Silencing Combined on HCC Cell Migration

Cell migration plays a crucial role in cellular processes including invasion and metastasis. Tumor cells Since cell migration has a strong correlation with intratumoral angiogenesis and distant metastasis in liver cancer, we elucidated the biological function of C/EBPa on the migration of Hep3B cells in vitro. In Figures 4-7, CEBPA activation and CEBPB inhibition when normalized to untransfected cells showed a significant reduction in cell migration, 0.8-fold and 0.6-fold, respectively. No significant fold change was observed in the CEBPA knockdown group, indicating that CEBPA enhancement and CEBPB knockdown may induce related signaling pathways to inhibit tumor migration.

Since cell migration plays a crucial role in various biological functions, such as tumor cell invasion and metastasis, we chose the Hep3B cell line. Because of its stability, it can be used as a cell model for us to study the cell migration process to evaluate the single and synergistic effects of C/EBPa. C/EBPβ, another form of the C/EBP family, was selected as a partner of C/EPBα to study synergistic effects. Because C/EBPβ is also related to many physiological and pathophysiological processes including HCC, and there is also a highly dynamic interaction between C/EPBα and C/EBPβ as well as a large number of cis-regulatory elements to maintain the metabolic state of human cells.

The results of the Transwell cell migration assay are shown in FIG. 21 . C/EPBα activation inhibits cell migration in Hep3B cells. Hep3B cells in non-serum medium were seeded into the upper chamber (8 μm pore size; Corning, NY, USA, cat. no. 3422). Add MEM medium containing 10% fetal bovine serum to the lower chamber. After a period of incubation, cells remaining on the upper membrane were removed with cotton swabs, while cells that migrated through the membrane were fixed with formaldehyde (3.7% in PBS) and stained with 1% crystal violet in 2% ethanol. To image the migrated cells, crystal violet on the membrane was dissolved in 33% acetic acid, and the absorbance was measured using a microplate reader (BIO-TEK, USA).

The purpose of this example was to characterize the biological activity of C/EPBα. To determine the cytotoxic and antiproliferative effects of C/EPBα, we performed SRB and WST-1 cell proliferation assays in more representative HCC cell lines, including HepG2, Hep3B and PLC/PRF/5 cell lines. A high ratio of C/EPBα to C/EBPβ enhances metabolism and represses acute phase response genes, whereas a low ratio does the opposite (repression of metabolism and activation of acute phase genes).

Studies of CEPBA alone transfection (Fig. 19 and Fig. 20) suggested that C/EPBα had anti-proliferative effect in HepG2 and Hep3B cells, but lacked effect in PLC/PRF/5 cells. In HepG2 cells, the effect lasted up to 48 hours after transfection, and in Hep3B cells up to 96 hours. HepG2 and Hep3B cells were sensitive to C/EPBα, while PLC/PRF/5 cells were resistant to it. For the co-transfection study, because in HepG2 and Hep3B cells, C/EBPβ-siRNA had a longer anti-proliferation effect (96 hours), while C/EBPα-saRNA had a shorter inhibitory effect time (48 hours). Hours), the combined use of C/EBPa-saRNA and C/EBPβ-siRNA may improve drug efficacy and prolong drug action time (Figure 21 and Figure 22). In addition, this experiment also found that PLC/PRF/5 cells can be transformed from a drug-resistant cell line to a sensitive cell line by co-transfection with C/EBPa-saRNA and C/EBPβ-siRNA. From the results of our cell migration studies (Fig. 23), it was shown that C/EPBα activation and C/EBPβ inhibition jointly suppressed cell migration in the Hep3B cell line. This suggests that there may be a specific signaling pathway that inhibits tumor cell migration, and similar mechanisms may exist in other HCC cell lines including HepG2 and PLC/PRF/5.

Example 17 The research on the mechanism of action of saRNA

RNA activation (RNAa) is a small RNA-induced gene regulation process in which small double-stranded RNAs (dsRNAs) select specific promoter regions to enhance expression of target genes at the transcriptional level. The precise molecular mechanism of RNAa has remained elusive since it was first reported by Li et al. in 2004. One theory is that the saRNA is first loaded and processed by the AGO2 protein to promote the RNA-induced transcriptional assembly-activating (RITA) complex. It is very important to study the molecular mechanism, and the research on the key interaction proteins with saRNA can provide better guidance for clinical trials.

The purpose of this example is to ascertain the components related to the transcription mechanism in the precipitated C/EBPa-saRNA complex, and the mechanism of gene activation using this double-stranded RNA molecule. Here, cells were transfected with biotinylated saRNA and protein-protein interactions and protein-nucleic acid interactions were studied to identify whether saRNA interacts with proteins when transfected into cells and to identify these possibly associated proteins. Based on the biological functions of these identified proteins, more information on the mechanism of action of saRNA was obtained.

For the study of protein interactions, we applied the streptavidin-biotin system. Streptavidin can bind up to four molecules of biotin to form a streptavidin-biotin complex, an interaction ideal to facilitate protein purification and detection strategies. In particular, non-covalent interactions (Kd = 10 ⁻¹⁵ M) between proteins and ligands enable high-strength binding interactions between biotin and avidin. The bond-forming interaction between streptavidin and biotin is rapid and unaffected by extreme conditions, including temperature, denaturants, pH, and organic solvents.

Due to the high affinity and stability of the streptavidin-biotin system, we synthesized C/EBPa-saRNA strands (sense and antisense) with biotin moieties at both ends of both strands. At an appropriate time point when saRNA-driven activation is optimal, it is transfected into HCC cells. Cells were fixed to maintain the structure of the saRNA-protein complex and used for ChIP studies. The purpose of this ChIP is to identify directly bound proteins related to saRNA function that participate in the associated saRNA-protein complex.

The study of protein-protein interactions (PPI) was performed to elucidate the binding proteins that form part of the saRNA protein complex, as it is fundamental to most biological processes, including cell signaling and cycling, protein transport, localization, folding and modification . Characterizing functional protein interactions is critical to understanding the function of a molecule's druggable target protein as well as its cellular biology. Studying the protein sequence, structure, and complex binding proteins provides an important avenue to infer the function of CEBPA-activating saRNAs. Available methods in PPI detection include co-immunoprecipitation, affinity purification and chromatography, cross-linked PPI analysis (mass spectrometry), NMR spectroscopy and X-ray crystallography. The detection method used in this example is mass spectrometry analysis, after extraction and protein purification, the ChIP protein of the saRNA complex was identified.

To identify nucleic acid-binding proteins, protein complexes interacting with saRNA are precipitated from DNA, purified and eluted. Mass spectrometry was then performed. To elucidate the specific information of each protein in the complex, immunoblotting experiments were performed. This has the potential to reveal how complex proteins enable saRNAs to carry out their biological roles, including transcription, translation, DNA replication and repair, and RNA processing and translocation.

17.1 Validation of optimal transfection of biotinylated saRNA

Since biotin is synthesized on the saRNA duplex, the biological properties of this oligo may be altered. The focus of saRNA-protein complex research is to establish the optimal transfection of biotinylated saRNA to confirm that biotinylated saRNA is still effective, and when 20nM biotinylated C/EBPa-saRNA is transfected, CEBPA-targeting activity is still observed. effect. The effect of transfecting C/EBPa-saRNA on the expression level of C/EBPa was analyzed in HCC cell line-HepG2 cells. Three concentrations (10 nM, 20 nM and 50 nM) were chosen to determine the optimal response concentration in selected cell lines. Figure 23: The results of transfection efficiency of biotinylated C/EBPa-saRNA in HCC-HepG2 cells are shown in the figure. Cells were transfected with three different concentrations (10 nM, 20 nM and 50 nM) of biotinylated C/EBPa-saRNA and harvested 72 hours after seeding for total RNA extraction and reverse transcription. Relative expression was calculated using the Livak method of 2 ^-ΔΔC.T with GAPDH as a housekeeping gene. Bars represent expression levels relative to CEBPA±SD (n=3). When transfected with 20 nM biotinylated C/EBPa-saRNA, CEBPA transcript levels increased 4-fold compared to 10 nM and 50 nM groups ( FIG. 23 ). This confirms that the activity of biotinylated C/EBPa-saRNA is still obtained at 2OnM.

17.2 Identification of saRNA protein complex

To identify proteins that interact with saRNA, we first characterized proteins associated with the C/EBPa-saRNA protein complex. Since protein-protein interactions, which occur as part of individual cascades or other metabolic functions, are transient within cells, we have developed methods of cross-linking to stabilize components of interacting protein complexes and maintain protein-protein interaction. Fixed cells were then lysed by commercial reagents for cytoplasmic and nuclear extraction. Since saRNA differs from siRNA in that its activity occurs at the transcriptional level, the mechanism of activity in the nucleus is relatively more relevant. After optimization of cell lysis by sonication, protein purification was carried out by precipitation with streptavidin beads, and the precipitated protein and its bound protein were electrophoresed on 4%-20% sodium dodecyl sulfate-polyacrylamide gel (SDS -PAGE) and stained with Coomassie brilliant blue.

Proteins were separated from precipitated protein complexes by SDS-PAGE. HepG2 cells were transfected with 20nM Bio-scramble and Bio-C/EBPa-saRNA. After precipitation with streptavidin beads, RNA-protein complexes were resolved on SDS-PAGE and stained with Coomassie blue. Gel bands of interest are excised and digested. Peptide samples were then purified and concentrated using Pierce C18 Spin Columns. Before LC-MS, samples were dried in SpeedVac and suspended in 1-2 μl Matrix solution. The results are shown in Figure 25.

In Figure 25, we detected bands of interest representing binding proteins of protein complexes bound to biotinylated saRNA and resolved on SDS-PAGE. Different protein bands were clearly visible on SDS-PAGE. Untransfected cells show no bands. Several bands were observed in both biotinylated scramble-saRNA and biotinylated C/EBPa-saRNA groups. However, the biotinylated C/EBPa-saRNA group had much more protein bands compared to the other two groups of precipitated samples ( FIG. 25 ). This indicates that protein precipitation and purification were performed successfully. To elucidate the binding proteins of the saRNA complex, the group of biotinylated C/EBPa-saRNA was selected and all visible bands were divided into 19 groups, excised and digested with a commercial in-gel trypsin kit (Invitrogen , Cat. No. 89871) digestion. After excising each protein band, Pierce C-18 spin columns (Invitrogen, Cat#89870) were used for protein purification and subsequent concentration operations. The purified protein was then dried by SpeedVac before being sent for mass spectrometric identification.

Precise protein identification and analysis is a key proteomics strategy for studying biological compounds. Due to their high sensitivity and accuracy, mass spectrometry is an important tool for detecting saRNA complex-bound proteins, including matrix-assisted laser desorption ionization (MALDI) and electrospray ionization (ESI) mass spectrometry (MS). To elucidate the function and relevance of these saRNA-binding proteins in forming the saRNA complex to initiate transcription, putatively related proteins were clustered according to their functions into five groups, including shuttling, stabilization, folding, transcription, and metabolism , see Table 8 below.

Table 8 Binding proteins detected by mass spectrometry

In addition to the key functions of these identified proteins in biological processes, the subcellular localization of cells is another important parameter that should be considered when selecting proteins, as well as elucidating their primary locations. Because the oligonucleotide interacts with various proteins in the cytoplasm after transfection, it may also interact with nucleic acid proteins when it is transported to the nucleus. For a comprehensive analysis of protein identification, proteins were divided into three groups. One is characterized as a cytoplasmic protein, one as a nuclear protein, and one as both. Since it was assumed that transiently transfected saRNAs would be processed in the cytoplasm and then translocated to the nucleus to exert their transcriptional effects. Therefore, information on all identified proteins will help elucidate their roles in mediated saRNA activity. On this basis, we performed a library search for the target protein and selected some interesting ones. They are heterogeneous nuclear ribonucleoprotein U (hnRNPU), pyruvate kinase isozyme M1/M2 (PKM2) and elongation factor 1alpha1, respectively,

Among these proteins, hnRNPU was selected for further analysis because this RNA-binding protein contains unique nucleic acid-binding properties, such as a scaffold-associated region (SAR)-specific dyad DNA-binding domain and an RNA-binding domain. hnRNPU is involved in the formation of ribonucleoprotein complexes from heterogeneous nuclear RNA (hnRNA). It may also shuttle between the nucleus and cytoplasm and affect pre-mRNA processing and mRNA trafficking and metabolism. Studies have found that ribonucleoprotein (hnRNP) can interact with the small double chain associated with the promoter to mediate transcriptional activation. Cell fractionation is the process of isolating cellular components and identifying the respective retained functions of each component. To verify whether the protein of one of the -hnRNPU of interest is primarily a shuttle protein and involved in the shuttling of oligonucleotides from the nucleus to the cytoplasm, cell fractionation was performed to confirm whether it was present in the cytoplasm or nucleus. For this purpose, HepG2 cells were seeded and fractionated. Subcellular fractions were separated on SDS-polyacrylamide gels (SDS-PAG). A poly(ADP-ribose) polymerase (PARP) probe was used to confirm the validity of the extracts, as the subcellular location of the PARP protein is partially in the nucleus. Also, use an anti-hnRNPU antibody to confirm if hnRNPU is indeed in the nucleus.

To verify the extraction of nuclei, a Western blot was performed using a protein probed against PARP obtained by cell fractionation and precipitated for RNA complex extraction (Fig. 24A). Figure 24 is a Western blot analysis experiment used to identify hnRNPU in saRNA complexes. HepG2 cells were transfected with 20nM Bio-Scramble-saRNA or Bio-C/EBPa-saRNA, incubated for 72 hours and then cross-linked with 1% formaldehyde. Extracted saRNA complexes from the cytoplasm or nucleus were pulled down with streptavidin beads by precipitation (Invitrogen, 5942-050). The distribution of nuclear and cytosolic proteins was analyzed using anti-hnRNPU (Abcam, ab20666) (A) and antiPARP (Cell Signaling, 46D11) (B) in the saRNA complex pull-down to verify the extraction of nuclear proteins.

In Figure 24A, it can be seen that PARP protein is located in the nuclear extracted group, but not in the cytoplasmic group, which indicates that nuclear protein extraction was successfully achieved. In order to analyze the distribution of hnRNPU protein, Western blot analysis probe hnRNPU antibody experiment was carried out after the extraction of saRNA protein complex ( FIG. 24B ). For the cytoplasmic protein extraction, the hnRNPU protein band appeared only in the lanes that were not present in the pellet group (Fig. 24A). However, hnRNPU protein was present in the complex of importin and IP protein during nuclear protein extraction (Fig. 24B). Unexpectedly, in nuclear extraction, when the same amount of sample was loaded, the precipitated C/EBPa-saRNA protein complex obtained stronger binding compared with the other two controls (untransfected and scramble-saRNA) force. This means that the C/EBPa-saRNA complex recruits more hnRNPU (Fig. 24B). This suggests that hnRNPU is part of a saRNA complex involved in CEBPA activation.

17.3 Validation and optimization of biotinylation

SaRNA Transfection in Different HCC Cell Lines The effect of sense or antisense biotinylated Scramble-saRNA and C/EBPa-saRNA on CEBPA expression was analyzed in a panel of HCC cell lines including HepG2, Hep3B and PLC/ PRF/5 cells. Figure 25 shows biotinylated C/EBPa-saRNA transfection efficiency in HCC. Cells were transfected with sense or antisense biotinylated negative control (Scramble-saRNA), and two different concentrations of C/EBPa-saRNA (20nM and 50nM), harvested for total RNA extraction and reverse transcription. The relative expression of CEBPA was calculated using the Livak method as 2 ^-ΔΔC.T with GAPDH as the housekeeping gene. Bars represent expression levels relative to CEBPA±SEM (n=1). Data represent triplicate of one biological experiment.

Two concentrations (20 nM and 50 nM) respectively were chosen to determine the best response in the selected cell line. CEBPA transcription was increased 8-fold ( FIG. 25A ) and 3.5-fold ( FIG. 25B ) in HepG2 and HepG2 normalized to GAPDH, respectively. A 0.5-fold reduction was observed when PLC/PRF/5 cells were transfected with 20 nM sense biotinylated C/EPBα-saRNA ( FIG. 25C ). Therefore, 20 nM sense biotinylated C/EPBα-saRNA is the optimal concentration for transfecting this RNA to study the mechanism of C/EBPa-saRNA in HepG2 and Hep3B cell lines, while PLC/PRF/5 cell line was used For comparison. In addition, the expression of CEBPA in HepG2, Hep3B and PLC/PRF/5 cell lines also suggested that HepG2 and Hep3B are sensitive to C/EBPa, while PLC/PRF/5 is insensitive to C/EBPa (Figure 25).

17.4 Isolation of protein complexes in different HCC cell lines by biotinylated saRNA pull-down assay

HepG2 and Hep3B are HCC cell lines sensitive to C/EBPa-saRNA, while PLC/PRF/5 is a drug-resistant cell line, and biotinylated saRNA pull-down experiments were performed in these cell lines to obtain The saRNA complex for the protein complex was identified in HCC. This assay allowed us to isolate the saRNA complex and verify whether AGO2 is involved in direct loading into saRNA for transcription initiation. In the assay, 3' biotinylated saRNAs (SS and AS) are transfected into selected cells, followed by formaldehyde cross-linking, saRNA complex isolation and sonication. Proteins associated with biotinylated saRNA are eluted from the beads using streptavidin precipitation of biotinylated protein complex beads and purification by washing. It was then processed using a commercial mass spectrometry preparation kit following the manufacturer's instructions for double digestion. Proteins on the gel were separated using SDS-PAGE throughout and visualized using Coomassie staining. Protein bands were excised from the gel, destained and fully proteinized using Lys-C and trypsin. After reduction, alkylation, and enzymatic protein digestion procedures, protein complex peptides were purified and concentrated by C-18 spin columns following the manufacturer's instructions. Purified peptides are suspended in matrix solution and sent for mass spectrometry analysis.

Precipitated protein complexes identified by mass spectrometry, in the HepG2 and Hep3B cell lines, there were 34 and 49 proteins in the saRNA complex, respectively, while 12 proteins were found in the PLC/PRF/5 cell line. Figure 27 shows the percentage of complex proteins identified in HCC-HepG2 (Figure 27A), Hep3B (Figure 27B) and PLC/PRF/5 (Figure 27C). In HepG2 and PLC/PRF/5 cells, proteins bound to sense biotinylated saRNA accounted for 53% (Fig. 27A) and 83% (Fig. Only 4% (Fig. 27C). 86% of the total protein bound to the antisense in the Hep3B cell line (Fig. 27C). This indicates that the sense strand of saRNA may bind to most of the proteins in HepG2 and PLC/PRF/5 cell lines, however, more proteins in the Hep3B cell line may bind to the antisense strand. In addition, from the amount of protein bound to saRNA in these three cell lines, it can also be speculated that the resistance of PLC/PRF/5 cells to C/EBPa-saRNA may be because these cells may not be able to express the key required for saRNA activity Element. In addition, the strand that is heavily bound to the protein may be regarded as the guide strand of the saRNA duplex. It may also be a chain of Argonaute proteins processed to induce transcriptional activation.

Figure 27 shows the percentage of complex proteins identified in different HCC lines. (A) Percentage of sense (SS), antisense (AS) and both (SS&AS) biotinylated saRNA-bound proteins in HepG2 cells. (B) Percentage of sense (SS), antisense (AS) and both (SS&AS) biotinylated saRNA-bound proteins in Hep3B cells. (C) Percentage of (A) sense (SS), antisense (AS) and both (SS&AS) biotinylated saRNA-bound proteins in PLC/PRF/5 cells.

Example 18 confirms the relationship between C/EBPa activation and optimal targeting knockdown of saRNA interacting protein

saRNAs are a class of 21 oligonucleotide double-stranded RNA molecules that are selectively engineered to activate genes and have clinical therapeutic potential. The C/EBPa-saRNA we used before is AP1, which can enhance the expression of C/EBPa, which can reduce the tumor burden and improve the liver function of the liver cirrhosis/hepatoma model. To develop this novel oligonucleotide as a clinical candidate, AP2 was the preferred sequence designed based on nucleotide walks around hotspots in the CEBPA sequence. Compared with AP1, C/EBPa-saRNA (AP2) has better activity on the activation of CEBPA. In order to further study the activation of CEBPA by AP2, the transcriptional level of CEBPA after AP2 transfection in HCC cell line-HepG2 cells was analyzed according to the following steps. Two concentrations (20 nM and 50 nM) were chosen for experiments to investigate the optimal response in selected cell lines. Figure 27 shows the knockdown effects of CEBPA, CTR9, DDX5 and hn RNPA2/B1 in HepG2 cells, respectively. (A) CEBPA expression was upregulated by saRNA at final concentrations of 20 nM and 50 nM RNA. (BD) Knockdown of CTR9, DDX5 and hnRNPA2/B1 by siRNA (10 nM and 20 nM). Relative expression was calculated using the Livak method of 2 ^-ΔΔC.T . GAPDH serves as a housekeeping gene. Bar graphs represent relative expression levels of CEBPA, CTR9, DDX5 or hnRNPA2/B1 mRNA±SD (n=3).

CEBPA expression levels increased 4-fold after transfection with 50 nM MAP2 compared to the 20 nM group. This indicates that 50 nM is the optimal concentration for studying the mechanism of C/EBPa-saRNA after AP2 transfection.

For a comprehensive analysis of saRNA-interacting proteins, in addition to classification by localization (cytoplasmic and nuclear), identified proteins were annotated by their function and putative roles related to saRNA activity. On this basis, CTR9, DDX5 and hnRNPA2/B1 were selected to investigate their role in mediating saRNA activity.

hnRNPA2/B1 was chosen for further study because this protein is associated with the nucleus of pre-mRNA in mRNA and appears to affect pre-mRNA processing and other aspects of mRNA metabolism and trafficking. HnRNPA2/B1 has two repeat quasi-RNA recognition motif (RRM) domains involved in RNA binding and single-stranded DNA binding. This protein can also form complexes with other hnRNPs in the nucleus. In the process of saRNA-induced RNAa, hnRNPA2/B1 may contribute to the transport of RNA guide strand-loaded Argonaute 2 protein from the cytoplasm to the nucleus, targeting the transcription initiation site to initiate transcription. Meanwhile, hnRNPA2/B1 can be considered as part of the hnRNP complex that recruits other hnRNP family members (hnRNPU, hnRNPH, etc.), as well as the RNA-induced transcriptional activation complex (RITA), to regulate gene expression. The protein also stabilizes transcription and shuttles mature mRNA from the nucleus to the cytoplasm.

For the likely ATP-dependent RNA helicase DDX5, the DEAD box protein is characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD) associated with many RNA secondary structures that alter cellular processes, including translation initiation, nuclear and Mitochondrial splicing, and ribosome and spliceosome assembly. On this basis, DDX5 may assist the RNA-Argonaute 2 complex to shuttle to the nucleus, form a RITA complex with hnRNPA2/B1, and CTR-9 and RNA polymerase II can initiate transcription and regulate gene expression.

CTR9 is a subunit of the polymerase-associated factor 1 (PAF1) complex, which can regulate RNA polymerase Ⅱ and participate in the formation of embryonic organs and the maintenance of pluripotency of embryonic stem cells. To study the molecular mechanism of RNA polymerase Ⅱ-associated factor 1 complex (PAF1c) skeleton protein CTR9 regulating the proliferation, migration and invasion of liver cancer cells. The expression of CTR9 in liver cancer and adjacent tissues was detected by Western bolt and immunohistochemical method. CTR9 was silenced or transiently transfected with exogenous CTR9 in HepG2 and Huh7 cells. EdU experiments, colony formation experiments, and Transwell experiments were used to analyze the regulation of CTR9 on the proliferation, migration, and invasion of liver cancer cells. It was found that CTR9 was highly expressed in liver cancer tissues. Silencing CTR9 can inhibit the proliferation, migration, and invasion of liver cancer cells, while overexpression of CTR9 promotes the proliferation, migration, and invasion of liver cancer cells. CTR9 can positively regulate Akt/p-Akt. It is clear that by positively regulating Akt/p-Akt, CTR9 can promote the proliferation, migration and invasion of liver cancer cells.

As a component of the PAF1 complex (PAF1C), CTR9 was chosen for this study because it includes SH2 domain binding and RNA polymerase II core binding and is involved in transcriptional elongation. Therefore, CTR-9 may be a component of the RITA complex that prolongs the transcription of RNA polymerase II during saRNA-induced RNA activation.

To establish optimal targeted knockdown, transfection was performed with siRNAs targeting saRNA interacting proteins (CTR9, DDX5 and hnRNPA2/B1 ) in HepG2 cells. Fig. 28B shows the verification results of the knockdown effect of CTR9-siRNA in the HepG2 cell line. Compared with untransfected cells, CTR9 transcription decreased by 0.7-fold at 10nM CTR9-siRNA group, and 0.6-fold at 20nM. When transfected with C/EBPa-saRNA, the transcript level of CTR-9 increased 2.5-fold (Fig. 29B). Figure 28C shows validation of the knockdown effect of DDX5-siRNA on the HepG2 cell line. In the DDX5-siRNA group, DDX5 transcription decreased 0.8-fold at 10 nM concentration and 0.9-fold at 20 nM concentration.

At the same time, HepG2 cells were transfected with C/EBPa-saRNA. Figure 29 shows CEBPA, CTR9, DDX5 and hnRNPA2/B1 mRNA expression levels in HepG2 cells. saRNA at final concentrations of 20 nM and 50 nM RNA upregulated the expression of CEBPA. When transfected with C/EBPa-saRNA (50 nM) (FIG. 29B-D), the transcript levels of CTR9, DDX5 and hnRNPA2/B1 are shown. Relative expression was calculated using the Livak method as 2 ^-ΔΔC.T with GAPDH as a housekeeping gene. Bar graphs represent relative expression levels of CEBPA, CTR9, DDX5 or hnRNPA2/B1 mRNA±SD (n=3).

In the presence of C/EBPa-saRNA, the transcript level of DDX5 increased 2.3-fold (Fig. 29C). Figure 29D shows the validation of the knockdown effect of hnRNPA2/B1-siRNA in HepG2 cell line. The hnRNPA2/B1-siRNA transfection group showed a 0.9-fold decrease in hnRNPA2/B1 transcription at 10 nM and a 0.8-fold decrease at 20 nM. The transcript level of hnRNPA2/B1 increased 2-fold when C/EBPa-saRNA was transfected ( FIG. 29D ).

In conclusion, knockdown of putative saRNA-interacting proteins (CTR9, DDX5 and hnRNPA2/B1) by siRNA was confirmed experimentally and all expression levels of CTR9, DDX5 and hnRNPA2/B1 in the presence of C/EBPa-saRNA Both increased more than 2 times (Figure 29). This may be because CTR9, DDX5 and hnRNPA2/B1 are the main factors of the core RNA-induced transcriptional activation (RITA) complex are used to enhance the expression of CEBPA.

Knockdown of CTR9, DDX5 and hnRNPA2/B1 disrupts C/EBPa-saRNA activity in HepG2 cells.

The expression level of CEBPA mRNA after co-transfection in HepG2 cells is shown in Figure 30. Among them, the relative expression levels of C/EBPa-saRNA and CTR (A), DDX5 (B) or hnRNPA2/B1-siRNA (C) after co-transfection were calculated using the Livak method with 2 ^-ΔΔC.T , and GAPDH as Housekeeping genes. Bar graphs represent relative expression levels of CEBPA mRNA±SD (n=3).

According to the CEBPAmRNA levels in the HepG2 cells of various transfection groups shown in Figure 30, after transfection with CTR9-siRNA (Figure 30A), the expression level of CEBPAmRNA was shown to be reduced by 0.65 times, and in a single transfection of C/EBPa-saRNA , the expression level of C/EBPA mRNA increased by 3.5 times, and when combined transfection with 50nM C/EBPa-saRNA and 10nM Scramble-siRNA, its expression activation was 2.5 times. When 50nM C/EBPa-saRNA and 10nM CTR9-siRNA were co-transfected, the expression of C/EBPa-saRNA increased by 1.4 times.

Figure 30B shows that the CEBPA transcript level was increased by 2.5 times when 50nM C/EBPa-saRNA and 10nM Scramble-siRNA were co-transfected, while in the DDX5-siRNA transfection group of 50nM C/EBPa-saRNA and 10nM, it was increased by 1.2 times. When DDX5-siRNA was added, the activation caused by the presence of C/EBPa-saRNA was reduced by 1.5-fold. This means that lack of DDX5 expression may lead to loss of saRNA transcriptional activation activity. A similar effect was also seen in hnRNPA2/B1. In Figure 30C, after a single transfection of C/EBPa-saRNA, the relative expression of CEBPA increased by 3.5 times compared with the non-transfected group, compared with 50nM of C/EBPa-saRNA and 10nM of hnRNPA2/B1-siRNA After co-transfection, the expression level of CEBPA mRNA decreased by 0.6-fold ( FIG. 30C ). Co-transfection of 50nM C/EBPa-saRNA and 10nM Scramble-siRNA increased the relative expression level by 2.5-fold, while C/EBPa-saRNA alone increased by 3.5-fold relative to the non-transfected group (Fig. 30C).

Based on the above data, the addition of hnRNPA2/B1-siRNA co-transfection in the presence of C/EBPa-saRNA resulted in a 3-fold decrease in activity. This suggests that hnRNPA2/B1 may be a key component of the RITA complex and influences the activity of RNA-mediated gene activation. Lack of hnRNPA2/B1 expression may directly block the activity of C/EBPa-saRNA in HCC-HepG2 cells. Taken together, the above data indicated that the activity of C/EBPa-saRNA was disrupted by CTR9, DDX5 and hnRNPA2/B1 knockdown, whereas they were identified as saRNA-interacting proteins by biotinylated saRNA pull-down assay analysis.

The purpose of this example is to explain the mechanism of saRNA action by studying protein-aRNA interaction. saRNA is considered as a novel tool to enhance gene expression and has a wide range of clinical applications, especially for the treatment of HCC. In in vitro studies, proteins in the saRNA complex were identified by using RNA pull-down assays. To elucidate the components of the saRNA-protein complex, we first performed studies in HepG2 cells.

For the analysis of saRNA directly binding proteins, protein strips separated by SDS-PAGE were excised and sent for protein identification C/EBPa-saRNA panel. However, there are still some non-direct binding proteins among these proteins, which need to be removed. Therefore, protein bands from untransfected and scrambled saRNA, as a control for the C/EBPa-saRNA group, will also be subjected to protein profiling. In addition, the intensity of protein bands will affect the excision of bands, because some lighter bands will lose several proteins of interest, thus weakening the experimental effect of this operation method. Mass spectrometry detected hnRNPU protein but not AGO2 and RNA polymerase II. Because the experimental excision operation was difficult to extract shallow protein bands, protein bands in the size range of AGO2 and RNA polymerase II could not be excised for further analysis. Gene transcription is a cell cycle-dependent and dynamic process. Transcription factors are always present to adapt the on/off conditions of gene transcription. Therefore, we need to be able to control the time point of the experiment when AGO2 or the transcriptional machinery will be most prominent at its target site.

To improve the technique, we used commercial kits and performed nanospray (mass spectrometry) instead of MALDI-TOF to avoid bias due to excision and loading of proteins for SDS-PAGE. In addition, three HCC cell lines were selected for experiments to compare the results with each other. We found that HCC cell lines belonging to distinct domains of differentiation displayed unique interactions. Because HepG2 and Hep3B are highly differentiated HCCs with more identified complex binding proteins, but undifferentiated PLC/PRF/5 have much fewer functional binding proteins. In addition, hnRNPA2/B1 was detected in both HepG2 and Hep3B cells, implying that this protein may be an important factor directly promoting gene activation.

in conclusion

Much less functional protein bound to saRNA in undifferentiated PLC/PRF/5 cells may explain why PLC/PRF/5 cells are resistant to C/EBPa-saRNA. saRNA-induced RNA activation works by interacting with many proteins identified from differentiated HCC, hnRNPA2/B1, DDXn, and proteins interacting with C/EBPa-saRNA were identified from this interaction array. Upregulating the expression of saRNA-specific binding proteins can promote the activity of saRNA, thereby converting undifferentiated cell lines into differentiated cells to increase the expression of C/EBPa.

In this study, five cancer cell lines were employed, including HCC lines (HepG2, Hep3B, and PLC/PRF/5 cells), prostate cancer lines (DU-145 cells), and breast cancer lines (MCF-7 cells). Among them, the HCC line is the core study of this application, while prostate and breast cancer are used as comparisons to verify whether the same results will occur in different cancer lines. Among the HCC lines, HepG2 and Hep3B represent differentiated cells, while PLC/PRF/5 represent undifferentiated cells. We selected these cells to clarify whether the phenotypes of different HCCs would be affected by C/EBPa-saRNA.

This example also determines whether C/EBPa and other members of the C/EBP family play similar roles in HCC, and if so whether these roles are relevant to other cancer types. To this end, we also investigated prostate (DU145) and breast cancer (MCF) cell models. We found that altering the expression balance of CEBPA and CEBPB had profound effects in each cell type. Activation and knockdown of CEBPA or CEBPB resulted in the highest response in DU-145 cells but the lowest in MCF-7. This indicated that DU-145 prostate cancer cells were sensitive to C/EBPa-saRNA, C/EBPa-siRNA and C/EBPβ-siRNA, while MCF-7 breast cancer cells were resistant to the antiproliferative effect of C/EBPa-saRNA, which suggested that One conclusion is obtained through WST-1 and SRB analysis.

In this study, we found that HepG2 and Hep3B (differentiated HCC) had higher responses, and PLC/PRF/5 (undifferentiated HCC) were resistant to C/EBPa-saRNA. P21 and albumin are downstream targets of CEBPA in HepG2 and Hep3B cells, but not PLC/PRF/5 cells. This suggests that there may be other associated protein networks in PLC/PRF/5 cells. From proteomic analysis, we found that the saRNA complex-binding protein Integrin A1 (ITGA-1) may have an effect on C/EBPa-saRNA in PLC/PRF/5 cells. This will be verified by knocking down ITGA1 to determine whether ITGA1 alters the activity of C/EBPa-saRNA. Furthermore, undifferentiated PLC/PRF/5 cells were unable to rely on C/EBPa to elevate albumin expression reconstitution. We also found that C/EBPβ expression prevented PLC/PRF/5 cells from responding to C/EBPα activation. When knocking down C/EBPβ expression in HepG2 and Hep3B, C/EBPa expression levels were upregulated but significantly downregulated in PLC/PRF/5 cells. This suggests that the effect of CEBPB gene knockdown on C/EBPa expression is different in differentiated and undifferentiated HCC cells. This prompted us to determine whether the combination of C/EBPβ affects the response to C/EBPα activation in drug-resistant PLC/PRF/5 cells, and whether C/EBPα activation and C/EBPβ inhibition in combination would have better anti-inflammatory effects. Proliferation. We found by PCR and Western blotting that this combined strategy resulted in better activation of C/EBPa. In addition, WST-1, SRB analysis also confirmed its antiproliferative effect.

For co-transfection studies, determination of C/EBPα activation and C/EBPβ inhibition by WST-1 and SRB assays may improve drug efficacy and prolong drug action time in HepG2 cells. Because C/EBPβ-siRNA has a longer effective time of anti-proliferation (96 hours); and C/EBPα-saRNA has better anti-proliferation efficacy than other treatment methods. Cell migration experiments also proved this point, C/EBPα activation and C/EBPβ inhibition of both cancer cell migration.

Example 19 saRNA interacting protein: CTR9, DDX5 and hnRNPA2/B1

To verify whether the proteins extracted from the saRNA complex (CTR-9, DDX5 and hnRNPA2/B1) would indeed affect the activity of saRNA. In this example, HepG2 cells were first used for preliminary research to verify different protein repressor genes separately, so as to determine whether effective knockdown of target genes can be achieved before performing combined transfection.

19.1 Experimental method

^1X105 HepG2 cells were cultured in 24-well plates and transfected with Fluc(scramble-saRNA), Scramble-siRNA, C/EBPa-saRNA, CTR9-siRNA, DDX5-siRNA or hnRNPA2/B1, respectively. Cells were harvested 72 hours after transfection, and total RNA was extracted by a commercial kit. Using the Livak calculation method of 2 ^-ΔΔCT , GAPDH was used as a housekeeping gene, and the data of protein expression levels were normalized.

Experimental results

It was confirmed that after C/EBPa-saRNA transfection, the expression of C/EBPa was activated in HepG2 cells, and after transfection of CTR9, DDX5 and hnRNPA2/B1 corresponding siRNA in HepG2 cells, CTR9, DDX5 and hnRNPA2/B1 were knocked down fall.

Figure 32A shows CEBPA mRNA levels in HepG2 cells transfected with Fluc and C/EBPa-saRNA. Compared with untransfected cells, the C/EBPa-saRNA group showed a 4-fold increase in CEBPA transcription at 20 nM, and a 26-fold increase at 50 nM.

Figure 32B shows the CTR9 mRNA levels of HepG2 cells transfected with Scramble-siRNA and CTR9-siRNA. In the CTR9-siRNA group, CTR9 transcripts were reduced by 0.7 times at 10 nM and 0.4 times at 20 nM.

Figure 32C shows DDX5 mRNA levels in HepG2 cells transfected with Scramble-siRNA and DDX5-siRNA. The DDX5-siRNA group showed a 0.8-fold reduction in DDX5 transcription at 10 nM and a 0.9-fold reduction at 20 nM relative to untransfected cells.

Figure 32D shows the level of hnRNPA2/B1 mRNA in HepG2 cells transfected with Scramble-siRNA and hnRNPA2/B1-siRNA. In the hnRNPA2/B1-siRNA transfection group, the transcription of hnRNPA2/B1 decreased by 0.9 times at 10nM and 0.8 times at 20nM.

19.2 CTR9-siRNA transfection caused the change of CEBPA mRNA level in HepG2 cells, and DDX5 or hnRNPA2/B1-siRNA did not show this effect.

After carrying out siRNA transfection in HepG2 cell, the expression level of CEBPAmRNA is shown in Figure 33, wherein

(A) CEBPA transcript levels when siRNA (10 nM and 20 nM) knocked down CTR9, DDX5 and hnRNPA2/B1.

(B) CEBPA transcript levels after co-transfection of C/EBPa-saRNA with CTR, DDX5 or hnRNPA2/B1-siRNA, respectively.

According to FIG. 33A , when we knocked down the expression of CTR9 mRNA by 10 nM of siRNA, the transcript level of CEBPA increased 4-fold ( FIG. 33A ). However, knockdown of DDX5 (Fig. 33A) and hnRNPA2/B1 (Fig. 33A) did not cause significant changes. In addition, CEBPA mRNA increased more than 3-fold when transfected with 10 nM of DDX-siRNA or 20 nM of hnRNPA2/B1-siDNA ( FIG. 33A ). In Fig. 33B, after transfection with 50 nM C/EBPa-saRNA and 10 nM CTR9-siRNA, we observed a more than 4-fold increase in CEBPA mRNA. The same increase was observed when co-transfected with 50 nM of C/EBPa-saRNA and 10 nM of DDX5-siRNA (Fig. 33B). When co-transfected with 50 nM of C/EBPa-saRNA and 10 nM of hnRNPA2/B1-siRNA, the expression of CEBPA mRNA increased 2-fold ( FIG. 33B ).

19.3. CTR9, DDX5 and hnRNPA2/B1 knockdown can attenuate C/EBPa-saRNA activity in HepG2 cells.

In order to study the effect of specific knockdown of related proteins on the activity of saDNA, CTR9, DDX5 and hnRNPA2/B1 protein siRNA and C/EBPa-saRNA were co-transfected, respectively, and the CEBPA mRNA expression level in HepG2 cells after transfection was measured.

In HepG2 cells, 50 nM of C/EBPa-saRNA and 10 nM of CTR9-siRNA were co-transfected. Figure 34A shows that the expression level of CEBPAmRNA of the single transfection of 50nM C/EBPa-saRNA showed an increase of 27 times, after transfection of CTR9-siRNA (Figure 34A), the expression level of CEBPAmRNA of the CTR9-siRNA group of 10nM increased by 4 times, The combined transfection of 50nM C/EBPa-saRNA and 10nM CTR9-siRNA showed a 4.6-fold activation of CEBPA mRNA expression, which was lower than the activation level of C/EBPa-saRNA single transfection.

Figure 34B shows that the CEBPA transcription level of the 20nM C/EBPa-saRNA transfection group reached 4.7 times, and the combined transfection with 20nM C/EBPa-saRNA and 20nM DDX5-siRNA increased the expression by 3 times. CEBPA expression did not change after a single transfection of DDX5-siRNA relative to the untransfected group.

FIG. 34C shows that the expression level of CEBPA mRNA in a single transfection of 50 nM C/EBPa-saRNA showed a 27-fold increase. After transfection with hnRNPA2/B1-siRNA ( FIG. 34C ), 50 nM C/EBPa-saRNA and 10 nM hnRNPA2/B1-siRNA were combined for transfection, and the expression increased by 2 times after transfection. hnRNPA2/B1-siRNA single transfection showed no change in CEBPA expression relative to the untransfected group.

The purpose of this experiment was to determine whether specific knockdown of siRNA would affect the ability of C/EBPa-saRNA to be active in relevant cell lines by affecting ChIP pull-down of identified proteins. HepG2 cells were used for co-transfection of 50nM and 10nM specific siRNA for C/EBPa-saRNA. In the presence of C/EBPa-saRNA (50 nM), a 27-fold increase in CEBPA transcription was detected. This increased level is not consistent with previous studies; therefore, the expression levels seen need to be revalidated. To this end, the relative Ct values of the genes of each group were analyzed ( FIG. 35 ). Clearly the level fluctuations of GAPDH amplification among the groups suggest that GAPDH is an unsuitable housekeeping gene for relative quantification of CEBPA. This applies both to cells transfected alone and to cells with saRNA and siRNA combinations. Therefore, it is necessary to identify better housekeeping genes for this preliminary study of knockdown-related interacting proteins. Through research, there are several housekeeping genes that can be selected for this experiment: 1. UBC: ubiquitin C; 2. TBP: TATA binding protein; 3. HPRT1: hypoxanthine phosphoribosyltransferase 14. HMBS: hydrogen Methylcholan synthase.

However, a 3-fold increase in CEBPA mRNA transfected with C/EBPa-saRNA (20 nM) could be observed in the following conditions ( FIG. 36 ). In addition, after analyzing the Ct values of related genes, the amplification level of ACTIN for single transfection and the amplification level of GAPDH for double transfection transfection groups did not show great fluctuation among the selected groups (Figure 37) . This suggested that ACTIN and GAPDH were used as selected single (20nM C/EBPa-saRNA, DDX5-siRNA and hnRNPA2/B1-siRNA; 10nM CTR9-siRNA) (Fig. 37A) and double (20nM C/EBPa-saRNA With 20nM of CTR9-siRNA or hnRNPA2/B1-siRNA; 50nM of C/EBPa-saRNA and 10nM DDX5-siRNA (Fig. 37B) transfection group is reliable.The above experiments further illustrate the DDX5 protein, and hnRNPA2/B1-siRNA B1 has little effect on the activity of C/EBPa-saRNA in HepG2 cells, while CTR9 protein may reduce the ability of C/EBPa-saRNA to increase the relative expression level of CEBPA.

The applicant studies the characteristics of saRNA-related proteins to further understand its mode of action. We used a proteomics approach to identify C/EBPa-saRNA-associated proteins in different HCC cell lines and identified novel candidate proteins. We classified these proteins into six major functional groups, including those involved in mRNA shuttling, transcription, translation, transcriptional stability, metabolism and apoptosis. Eleven proteins that directly bind to C/EBPa-saRNA were identified from moderately and well-differentiated HCC cells (HepG2 and Hep3B) and undifferentiated HCC cells (PLCPRF5). Among them, CTR9, DDX5 and hnRNAP2B1 are generally considered to combine with p21-saRNA, suggesting that they are important regulators of saRNA activity. Compared with undifferentiated and insensitive PLC/PRF/5 cells, C/EBPa-saRNA bound a large number of proteins in moderately and well-differentiated HepG2 and Hep3B cells that were sensitive to C/EBPa activation. These preliminary findings suggest that undifferentiated HCC cells may exhibit reduced sensitivity to C/EBPa-saRNA compared with moderately and well-differentiated HCC cells. Because they may lack or reduce the endogenous expression of factors that directly bind to saRNA or mediate the transcriptional activity of saRNA. This observation provides an opportunity to explore whether non-responsive HCC is transformed into HCC that is more sensitive to saRNA-induced activity through upregulation of key RITA components such as CTR9, hnRPNPA2/B1, or DDX5. Since the expression levels of endogenous CTR9, hnRNPA2/B1, and DDX5 are critical for enhancing saRNA activity; modulating their expression may be another important link in optimizing saRNA therapy. The characteristics of the transcriptional activation mechanism of saRNA in diseased cell types will undoubtedly provide a more effective means for developing the clinical application of saRNA in the future. Figure 36 shows CEBPA mRNA expression levels in HepG2 cells. CEBPA expression is upregulated by saRNA. Final concentrations were 20 nM and 50 nM RNA. Relative expression was calculated using the Livak method of 2 ^-ΔΔC.T , with β-ACTIN used as a housekeeping gene. Bar graphs represent relative expression levels of CEBPA mRNA±SEM (n=1).

Example 20 The relationship between the expression of C/EBPa and the invasion and metastasis of HCC

Inclusion criteria for patients in this study: surgery is radical resection, the standard is: complete resection of the tumor, negative margins in histological examination; pathologically confirmed HCC; complete and reliable clinical records and follow-up data. Fresh HCC cancer tissues and paired paracancerous tissue specimens were collected to extract RNA and protein in the tissues, and the expression of C/EBPα was detected by qRT-PCR and Western blot; the resected specimens were made into pathological sections, and immunohistochemistry was used to compare the tumor The expression of C/EBPa in liver tissues and adjacent liver tissues; compare the expression levels of C/EBPa in relapsed patients and non-relapsed patients, and study the relationship between C/EBPa expression and HCC invasion and metastasis.

Basic method of invasion test: Melt Matrigel at 4°C, dilute it with serum-free 1640 culture medium to a final concentration of 1.0mg/ml, apply 100ul per well evenly on the upper surface of the pre-cooled Transwell filter membrane, and incubate at 37°C for 2h; The upper chamber of the Transwell chamber was immersed in the culture medium of the lower chamber, and 100ul cell suspension (1×10 ⁵ cells) was added to the upper chamber, and incubated at 37°C, 5% CO ₂ , and saturated humidity for 24 hours; Chamber culture solution, washed with PBS, fixed with formaldehyde, wiped off Matrigel and non-passed cells on the surface of the microporous membrane with a cotton swab, stained with Giemsa, washed with PBS; counted the lower chamber of the microporous membrane under a light microscope at 200 times invading tumor cells.

Basic method of in situ tumor formation and lung metastasis test in vivo: tumor cells were injected into the liver of SCID mice to form tumors in situ, observed for 6-8 weeks, and compared the effects of siRNA-mediated tumor cell lines with low expression of C/EBPa on tumor formation and lung metastasis. At the same time, it is also observed whether the saRNA-mediated high expression of C/EBPa tumor cell lines has the effect of inhibiting tumor growth and inhibiting lung metastasis.

Example 21 Functional analysis of saRNA composition-mediated activation of C/EBPa in organelles of different differentiation types in HCC

21.1 Cell cycle analysis:

To distinguish HCC organelles from different cell cycles and to verify the anti-proliferative activity of C/EBPa-saRNA and C/EBPβ-siRNA in combination. G2/M phase analysis was performed using the Flow Cytometry Bivariate Cell Cycle Kit (Millipore). In the control group and the C/EBPa-saRNA transfection group, the cell cycle G2/M phase pathway exploration antibody (Millipore, 15-120) was applied, and the G2/M phase (DNA replication phase) distribution was evaluated by flow cytometry. Likewise, the S phase (cell growth and proliferation phase) distribution was assessed using the Flow Cytometry Bivariate Cell Cycle Kit for DNA Replication Analysis (Millipore) and the Cell Cycle-S Phase Pathway Probe Antibody (Millipore). Through the above analysis, the intrinsic nature of the antiproliferative activity of C/EBPa-saRNA and C/EBPβ-siRNA in combination was elucidated. The same method was also used to analyze and elucidate the nature of the different cycle responses of HCC tumor cells transfected with C/EBPa-saRNA respectively and combinations of p21-saRNA, CTR9-siRNA and hnRNPA2/B1.

According to the above experimental method, the compositions of C/EBPa-saRNA and p21-saRNA, CTR9-siRNA and hnRNPA2/B1 were used respectively, and the experimental results were recorded and analyzed.

21.2 Cell apoptosis analysis:

• TUNEL assay (terminal deoxynucleotidyl transferase (TdT) dUTP nickel end labeling): to assess whether C/EBPa compositions induce endonuclease cleavage products by detecting DNA fragmentation, a biochemical marker of apoptosis. Cells were transfected with GFP (green fluorescent protein)-labeled C/EBPa-saRNA. Subsequently, Br-dUTP (brominated deoxyuridine triphosphate nucleotide) was associated with DNA strand breaks, and was identified and analyzed by TUNEL assay kit (Abcam) and red fluorescently labeled anti-BrdU monoclonal antibody.

·Caspase 9 assay: Detect the activity of Caspase 9 (Caspase9) to clarify that the combined use of C/EBPA and C/EBPβ-siRNA induces cell destruction and collapse. The Caspase 9 Kit is used to detect the cleavage of labeled substrates that can be quantified with a spectrophotometer. The same experiment was carried out in cells transfected with C/EBPa-saRNA and p21-saRNA, CTR9-siRNA and hnRNPA2/B1 respectively, and the effect of each composition could be obtained.

21.3 Cell signaling pathway analysis

Over the past decade, we have made tremendous progress in identifying the molecular mechanisms underlying tumor pathogenesis. A large number of signaling pathways involved in tumorigenesis have been identified as new molecular therapeutic targets. In HCC, several cellular signaling pathways are involved in tumorigenesis. These include WNT/β-catenin, mitogen-activated protein kinase (MAPK), vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), phosphatidylinositol 3-kinase (PI3k)/protein kinase B ( AKT)/mammalian target of rapamycin (mTOR), MYC/signaling transducer and activator of transcription 3 (STAT3)/interleukin 6 (IL6R), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), epidermal growth factor Factor receptor (EGFR) and transforming growth factor beta (TGFβ) pathways. Our previous study demonstrated that C/EBPa-saRNA down-regulated MYC, STAT3 and IL6R pathways in C/EBPa-saRNA transfected HepG2 cells. However, whether the same event occurs in other types of HCC cells (Hep3B, hu-7, SK-Hep-1, SMMC-7721, Bel-7402, PG5, HCC-9204) is unclear. Based on this, in order to evaluate whether transfection of C/EBPa-saRNA in other types of liver cancer cells will affect the expression of the following signaling pathway factors (WNT/b-catenin, MAPK, VEGF, FGF, PI3k/AKT/mTOR, MYC/STAT3/ IL6R, HGF, IGF, EGFR, and TGFβ), kinase assays were used to elucidate whether these target factors were phosphorylated and downregulated by C/EBPa-saRNA. And by Western blot to determine the expression of these factors in the phosphorylation state and protein level.

21.4 CDKs (cyclin-dependent kinases) and phosphorylation analysis

We determined the enzymatic activities in different CDK complexes of different types of HCC organelles transfected with C/EBPa-saRNA by CDKs and phosphorylation analysis to clarify whether cell signaling factors (MYC/STAT3/IL6R, PI3K/AKT/MTOR, WNT /β-catenin, etc.) phosphorylation and down-regulated expression under the regulation of C/EBPa-saRNA.

These complexes are separated by specific antibodies and incubated with fluorescently labeled substrates. Then, the active substrates of these CDKs were quantified by qRT-PCR and displayed by Western Blot.

Example 22 Application Research in Mouse Liver Cancer Model

In this example, the application of the combination of C/EBPa-saRNA and p21-saRNA, CTR9-siRNA and hnRNPA2/B1 of the present invention in a mouse liver cancer model was studied. The selected model is a mouse model of spontaneous liver cancer induced by diethylnitrosamine (DEN). Male Wistar rats were treated with DEN to induce HCC. Briefly, animals were treated with DEN for 9 weeks followed by 3 weeks without treatment. Animals were then randomly assigned to three groups (6 to 7 males/group) based on body weight. Animals in Group 1 were sacrificed on Day 1 to serve as pre-treatment controls, and animals in

Groups

2 and 3 were treated 3 times intravenously with non-targeting dsRNA formulated in NOV340 (siFLUC) or MTLCEBPA at a dose of 4 mg/kg (Day 1). 1, 3rd and 5th days). On day 12, blood was drawn and all animals were sacrificed. Tumor and liver weights were measured and liver tissue sections were immediately snap frozen for mRNA analysis. CEBPA mRNA levels and ALB mRNA levels were determined by qRT-PCR (housekeeping gene: GAPDH; measured in triplicate).

Polyamide (PAMAM) dendrimers were used to build dendrimers of C/EBPa-saRNA and p21-saRNA, CTR9-siRNA and hnRNPA2/B1 compositions, or C/EBPa-saRNA-dendrimer The polymers were used in combination with p21-saRNA dendrimer, CTR9-siRNA dendrimer and hnRNPA2/B1 dendrimer respectively, and were injected into diethyl Nitrosamine (DEN) treated mice in vivo. It was subsequently found that the tumor burden in the treatment group was significantly lower than that in the control group. At the same time, the level of serum albumin increased significantly, and the levels of serum bilirubin, aspartate aminotransferase (AST) and alanine aminotransferase (ALT) decreased significantly. Quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis of liver tissues from treated mice confirmed that the saRNA composition induced upregulation of the mRNA levels of C/EBPa and albumin as well as important hepatocyte markers (HNF1α and HNF4α). The experiment was carried out on four liver cancer cell organoids (HepG2, Hep3B, PLC/PRF5, SNU475) at the same time, and samples were taken for proteomic analysis. It also confirmed that up-regulation of CEBPA gene can activate several cell signal transduction pathways and improve cell metabolism. and liver biological function.

In vivo study of C/EBPa-saRNA formulated in wild-type mice

Compositions of C/EBPa-saRNA and p21-saRNA, CTR9-siRNA and hnRNPA2/B1 combinations were formulated in Dendrimer-MTL-501 and NOV340 (Marina), respectively. The above samples were separately tested in wild-type mice (n=5 in each study). The specific method is to give three doses of the dendrimer-C/EBPa-saRNA composition and the NOV340-C/EBPa-saRNA composition to the wild-type mice respectively, and kill them 2 days after the last dose. Albumin levels were measured separately and serum albumin levels were calculated based on ELISA readings.

The experimental results showed that the above two samples both up-regulated albumin. The mRNA levels of CEBPA and ALB were measured. Total RNA was extracted and measured after reverse transcription. The results showed that the relative expression levels of C/EBPa and ALB were also up-regulated. Different dose levels of C/EBPa/NOV340 (0.5 mg/kg and 3 mg/kg) were also administered to wild-type mice for detection, and the results proved that the up-regulation level was dose-related.

In vivo study of the formulated C/EBPa-saRNA composition in DEN rats

An in vivo study was performed in DEN rats (n=6). HCC model induces cirrhosis and spontaneous liver tumors. Rats were fed with diethylnitrosamine (DEN) for 7 weeks, followed by water for 3 weeks. Treatment with various C/EBPa-saRNA composition preparations was initiated immediately after tumor formation. Rats received three IV injections over 5 days and were subsequently monitored for 7 days. They were subsequently sacrificed for histological examination and measurement of liver mRNA and serum protein. The experimental results showed the body weight, liver weight and tumor volume of DEN rats. Tumor volume was significantly reduced for all formulations/doses.

Example 23. Application research of C/EBPa-saRNA composition in human body

Dendrimers of C/EBPa-saRNA-compositions were tested in clinical studies. Generation 4 (G4) diaminobutane (DAB)-core-PAMAM dendrimers (NanoSynthons LLC, Michigan) were used to form complexes with C/EBPa-saRNA. The ratio of C/EBPa-sRNA to DAB-core-PAMAM was 1:3 by weight.

The effect of C/EBPa-saRNA composition-dendrimer therapy was tested on liver cancer patients. In this study, three doses of C/EBPa-saRNA composition-dendrimer were administered to tumor patients at approximately 0.5 mg/kg on

days

1, 3 and 5. Serum albumin levels were measured until day 3. A marked increase in serum albumin levels is observed around day 15, at which point serum albumin levels rise to the normal range. Serum albumin levels were maintained in the normal range until day 34.

In another study, C/EBPα-saRNA-dendrimer and C/EBPβ-siRNA-dendrimer were used to increase white blood cell count in cirrhotic patients. Three doses of the C/EBPa-saRNA-dendrimer composition were administered to cirrhotic patients at about 0.5 mg/kg on

days

1, 3 and 5. The patient's white blood cell count is measured. A single dose given to Patient 1 contained 10 mg C/EBPα-saRNA, 10 mg C/EBPβ-siRNA and 30 mg dendrimer. A single dose given to Patient 3 contained 20 mg C/EBPα-saRNA, 20 mg C/EBPβ-siRNA and 60 mg dendrimer. Observed changes in white blood cell counts in patients were recorded and analyzed at intervals of one day.

The results of the human studies suggest that the C/EBPa-saRNA composition-dendrimer may be used as a therapeutic agent in the treatment of patients with liver disease and to increase white blood cell counts in patients in need.

Claims

A composition containing C/EBPa-saRNA, containing at least one saRNA or siRNA of C/EBPa-saRNA and at least one downstream key acting protein of C/EBPa, and the downstream key acting protein of C/EBPa includes One or more of p21, C/EBPβ, CTR9, DDX3, DDX5, and hnRNPA2/B1.
The composition according to claim 1, wherein said saRNA is p21-saRNA.
The composition according to claim 1, wherein the siRNA is C/EBPβ-siRNA having a sequence such as SEQ ID No.63 or 64.
The composition according to claim 1, wherein the p21-saRNA has a sense strand such as SEQ ID No.48 and an antisense strand such as SEQ ID No.49.
The composition according to any one of claims 1-4, wherein at least 80% of C/EBPa-saRNA is complementary to the region on SEQ ID No.47, and wherein said saRNA has 14-30 nucleotides.
The composition according to any one of claims 1-4, wherein the C/EBPa-saRNA is double-stranded and comprises an antisense strand and a sense strand.
The composition according to claim 6, wherein said antisense strand comprises a sequence selected from SEQ ID No.2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 , 30, 32, 34, 36, 38, 40, 42, 44, 46 sequence.
The composition according to claim 6, wherein said sense strand comprises a sequence selected from SEQ ID No.1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27 , 29, 31, 33, 35, 37, 39, 41, 43, 45 sequence.
The composition of claim 1, wherein the C/EBPa-saRNA is modified.
The composition according to claim 3, wherein the molar ratio of C/EBPα-saRNA to C/EBPβ-siRNA in the composition is 1:3-2:1.
The composition according to claim 2, wherein the molar ratio of C/EBPa-saRNA and p21-saRNA in the composition is 1:3-2:1
Application of the composition containing C/EBPa-saRNA described in any one of claims 1-4 in the preparation of medicines for up-regulating CEBPA gene expression in cells.
The use according to claim 12, wherein said cells are cancer cells.
The use according to claim 13, wherein the cancer cells are prostate or breast cancer cells.
The use according to claim 12, wherein the cells are hepatocellular carcinoma (HCC) cells.
The use according to claim 15, wherein the cells are differentiated hepatocellular carcinoma (HCC) cells.
The use according to claim 16, wherein said cells are HepG2 cells.
The use according to claim 12, wherein CEBPA gene expression is up-regulated by at least 20%.
The application according to claim 12, wherein CEBPA gene expression is up-regulated at least 2 times.
Use of the C/EBPa-saRNA composition according to any one of claims 1-4 in preparing a drug for up-regulating p21 expression in cells.
The use according to claim 20, wherein said cell is a cancer cell.
The use according to claim 21, wherein the cells are hepatocellular carcinoma (HCC) cells.
The use according to claim 22, wherein the cells are differentiated hepatocellular carcinoma (HCC) cells.
The use according to claim 22, wherein said cells are HepG2 cells.
Use of the composition containing C/EBPa-saRNA according to any one of claims 1-4 in the preparation of medicines for up-regulating albumin in cells.
Use according to claim 25, wherein said cells are cancer cells.
The use according to claim 26, wherein the cells are hepatocellular carcinoma (HCC) cells.
The use according to claim 27, wherein the cells are differentiated hepatocellular carcinoma (HCC) cells.
The use according to claim 28, wherein said cells are HepG2 cells.
Use of the containing composition described in any one of claims 1-4 in the preparation of medicines for reducing the recurrence rate of HCC.
Use according to claim 30, wherein said cell is a cancer cell.
The use according to claim 31, wherein the cells are hepatocellular carcinoma (HCC) cells.
The use according to claim 32, wherein the cells are differentiated hepatocellular carcinoma (HCC) cells.
The use according to claim 33, wherein said cells are HepG2 cells.
Use of the composition containing C/EBPa-saRNA according to any one of claims 1-4 in the preparation of anti-cell proliferation medicines.
The use according to claim 35, wherein the cells are differentiated HCC cell lines.
The use according to claim 36, wherein the cell is a HepG2 cell line.
The use according to claim 35, wherein the cells are PLC/PRF/5 cell lines.
Use of the composition according to any one of claims 1-4 in the preparation of a medicament for improving liver function by enhancing albumin.
The pharmaceutical application of the composition described in any one of claims 1-4 in improving the sensitivity of undifferentiated HCC cell lines to antitumor drugs.