WO2023020634A1

WO2023020634A1 - Application of superoxide dismutase in preparation of lcda, and genetically engineered bacteria over-expressing same

Info

Publication number: WO2023020634A1
Application number: PCT/CN2022/125874
Authority: WO
Inventors: 张明明; 刘修才
Original assignee: 上海凯赛生物技术股份有限公司; Cibt美国公司
Priority date: 2021-08-18
Filing date: 2022-10-18
Publication date: 2023-02-23
Also published as: CN115710584A

Abstract

Disclosed is a genetically engineered bacteria having enhanced superoxide dismutase activity. Using the genetically engineered bacteria can improve the conversion rate of substrates and the yield of products, and shorten the fermentation time of LCDA.

Description

Application of Superoxide Dismutase in Preparation of LCDA and Genetic Engineering Bacteria Overexpressing it

technical field

The invention belongs to the field of microbial engineering, and in particular relates to the application of superoxide dismutase in preparing LCDA and the genetically engineered bacteria overexpressing it.

Background technique

A dibasic acid is an aliphatic dicarboxylic acid with a carboxyl group at the α and ω positions, and its molecular formula is HOOC(CH ₂ ) _n COOH. According to the different carbon chain lengths, dibasic acids can be divided into long-chain dibasic acids, medium-chain dibasic acids and short-chain dibasic acids. It is generally believed that dibasic acids with n≥7 belong to long-chain dibasic acids (LCDA). As an important monomer raw material, long-chain dibasic acid has been widely used in the fields of fine chemical industry and medicine, such as the synthesis of high-performance engineering plastics, high-grade spices, aviation lubricants, high-grade paints and powder coatings, high-temperature electrolytes, cold-resistant Plasticizers and resins, etc. Materials synthesized from long-chain dibasic acid raw materials not only have better performance, lower cost and practical value, but also can save energy and reduce environmental pollution.

There are mainly three ways to obtain long-chain dibasic acids: vegetable oil cracking method, chemical synthesis method and microbial fermentation method. The production of dibasic acids by pyrolysis of vegetable oil is easily affected by natural factors, and it is difficult to achieve a high level of purity; chemical synthesis often causes chain scission during the synthesis process, resulting in the inability to produce high-purity single products, and the synthesis process is lengthy and cumbersome , high production cost and serious environmental pollution. The microbial fermentation method mainly uses the unique oxidation ability of microorganisms and the characteristics of intracellular enzymes to oxidize the two methyl groups at both ends of long-chain n-alkanes at normal temperature and pressure to obtain dibasic acid products with corresponding carbon chain lengths. Friendly, easy to operate and easy to control, and high-quality products, it has broad development prospects and industrial value.

Candida viesis is one of the main strains for the production of long-chain dibasic acids by microbial fermentation. After alkanes enter cells through passive diffusion or transporter channels, they are co-catalyzed by cytochrome P450 and NADPH-cytochrome P450 reductase to undergo α-oxidation in microsomes to generate fatty alcohols. Subsequently, fatty alcohols enter the cytoplasm, and are gradually oxidized into fatty aldehydes and fatty acids under the catalytic action of fatty alcohol oxidase and fatty aldehyde dehydrogenase in turn. A small amount of monobasic fatty acids are secreted out of the cells, and most of the monobasic acids will enter the microsomes again, where ω-oxidation occurs under the catalysis of the same enzyme system to generate α,ω-dicarboxylic acids. Part of the dibasic and monobasic acids produced by alkane metabolism will be transported into the peroxisome for β-oxidation. In peroxisomes, acylated fatty acids are gradually catalyzed, decomposed into acetyl-CoA or propionyl-CoA, and finally enter the TCA cycle.

At this stage, how to improve the conversion rate is mainly studied from the perspective of fermentation engineering optimization and excellent strain breeding. For example, it is proposed in the literature that adding a certain amount of H ₂ O ₂ in the fermentation broth can increase the oxygen supply in the fermentation process without causing a large toxic effect, thereby increasing the production of tridecanedioic acid (the third of the Chinese Bioengineering Society Abstracts of the Second National Member Congress and Symposium, 2001:1); Knocking out POX4 and POX5 genes can effectively block the β-oxidation pathway, thereby significantly improving the conversion rate of the substrate (Mol Cell Biol, 1991, 11( 9), 4333-4339); introducing a copy of CYP52A14 gene into the dibasic acid production strain can effectively improve the conversion rate of dibasic acid (Chinese invention patent CN103992959B).

Superoxide dismutase (Superoxide Dismutase, SOD) is an antioxidant metalloenzyme that exists in organisms. It has the function of removing oxidative stress factors (oxygen free radicals), and plays a vital role in the balance of oxidation and antioxidant in the body. role. SOD was discovered as early as 1930, and was officially named superoxide dismutase in 1969.

At present, although there are cases of improving the conversion rate of dibasic acid by means of random mutagenesis or genetic engineering, the research on improving the dibasic acid production strain and improving the conversion rate of dibasic acid from the perspective of antioxidant enzyme-superoxide dismutase is still in progress. None reported.

Contents of the invention

Aiming at technical problems such as lack of long-chain dibasic acid (LCDA) production strains for improving oxidative stress in the prior art, and disclosure of the preparation efficiency of LCDA, the invention provides a superoxide dismutase (Superoxide dismutase, SOD) in the preparation of LCDA The application in and the genetically engineered bacteria overexpressing it. When the superoxide dismutase is applied to the fermentation and production of LCDA by microorganisms, the problem of oxidative stress faced by microorganisms can be improved. The genetically engineered bacteria overexpressing the superoxide dismutase can further increase the yield of the original bacteria, the dibasic acid yield and the conversion rate of the substrate, and shorten the fermentation time.

In order to solve the above technical problems, one of the technical solutions provided by the present invention is: the application of superoxide dismutase or superoxide dismutase gene in the production of long-chain dibasic acid by microbial fermentation.

In one embodiment, the present invention provides superoxide dismutase or a gene encoding superoxide dismutase in microbial fermentation to produce long-chain dibasic acids or in the preparation of genetically engineered bacteria for microbial fermentation to produce long-chain dibasic acids Applications. Preferably, the superoxide dismutase comprises the nucleotide sequence shown in SEQ ID NO: 9 or an amino acid sequence encoded by at least about 95% of the nucleotide sequence of SEQ ID NO: 9.

In one embodiment, the nucleotide sequence of the gene encoding superoxide dismutase comprises SEQ ID NO: 9 or a sequence at least about 95% identical to SEQ ID NO: 9. In one embodiment, the gene encoding superoxide dismutase comprises the nucleotide sequence shown in SEQ ID NO: 9 or its degenerate sequence.

Preferably, the nucleotide sequence of the superoxide dismutase gene is as shown in SEQ ID NO: 9, or a sequence having at least about 95% identity with SEQ ID NO: 9, such as at least about 96%, At least about 97%, at least about 98%, at least about 99%, at least about 99.1%, at least about 99.2%, at least about 99.3%, 99.4%, at least about 99.5%, at least about 99.6%, 99.7%, at least about 99.8% , at least about 99.9%, at least about 99.91%, at least about 99.92%, at least about 99.93%, at least about 99.94%, at least about 99.95%, or at least about 99.96% identical;

And/or, the microorganism is Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotroula, Saccharomyces or Yarrowia (Yarrowia), preferably Candida viswanathii (Candida viswanathii) or Candida tropicalis (Candida tropicalis), more preferably Candida visswanathii or strains of strain preservation number CCTCC NO:M 2020048 Candida viesis with preservation number CCTCC NO:M 2021824.

Preferably, the long-chain dibasic acid is selected from C ₉ -C ₂₂ long-chain dibasic acids, preferably from one or more of C ₉ -C ₁₈ long-chain dibasic acids, more preferably from decanoic acid One or more of diacid, undecane dibasic acid, dodecane dibasic acid, thirteen carbon dibasic acid, tetradecane dibasic acid, pentadecane dibasic acid and hexadecan dibasic acid species; those skilled in the art can easily select the corresponding long-chain alkane according to the target long-chain dibasic acid;

And/or, the long-chain dibasic acid is a linear long-chain dibasic acid.

In order to solve the above technical problems, the second technical solution provided by the present invention is: an expression element comprising a superoxide dismutase gene, which is a recombinant expression vector obtained by constructing the superoxide dismutase gene on a plasmid , or a recombinant expression fragment comprising a superoxide dismutase gene; the nucleotide sequence of the superoxide dismutase gene is shown in SEQ ID NO: 9, or has at least about 95% identity with SEQ ID NO: 9 Sequences of identity, for example at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.1%, at least about 99.2%, at least about 99.3%, 99.4%, at least about 99.5%, at least About 99.6%, 99.7%, at least about 99.8%, at least about 99.9%, at least about 99.91%, at least about 99.92%, at least about 99.93%, at least about 99.94%, at least about 99.95%, or at least about 99.96% identical .

In a preferred embodiment of the present invention, the plasmid is pCIB2; and/or, the recombinant expression fragment amplifies the superoxide dismutation by the primer sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 Enzyme gene acquisition.

In order to solve the above technical problems, the third technical solution provided by the present invention is: a genetically engineered bacterium comprising a nucleotide sequence such as the superoxide dismutase gene shown in SEQ ID NO: 9, the genetically engineered bacterium The starting bacteria are Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotroula, Saccharomyces or Yarrowia ( Yarrowia), preferably Candida viswanathii (Candida viswanathii) or Candida tropicalis (Candida tropicalis), more preferably Candida vissi of strain preservation number CCTCC NO: M 2020048 or strain preservation number CCTCC NO: Candida viesis of M 2021824.

In one embodiment, the present invention provides a genetically engineered bacterium, which has enhanced superoxide dismutase activity, preferably, said superoxide dismutase comprises the nucleotide sequence shown in SEQ ID NO: 9 Or an amino acid sequence having at least about 95% of the nucleotide sequence encoding of SEQ ID NO:9.

In one embodiment, the genetically engineered bacterium is a genetically engineered bacterium of the following microorganisms: Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotorula, Saccharomyces, or Yarrowia, preferably Wyss Candida or Candida tropicalis, more preferably Candida viesis with a preservation number of CCTCC NO: M 2020048 or Candida viesis with a preservation number of CCTCC NO: M 2021824.

In one embodiment, the overexpression of the genetically engineered bacterium comprises a nucleotide sequence shown in SEQ ID NO: 9 or its degenerate sequence or a nucleotide sequence having at least about 95% identity with SEQ ID NO: 9 superoxide dismutase gene.

In one embodiment, the superoxide dismutase gene described herein may exist in an extrachromosomal form, such as in the form of a plasmid vector or an expression vector, or may be integrated into the genome, such as into a non-protein coding sequence position in the genome, For example the int1 site. The "non-protein-coding sequence position" refers to a nonsense nucleotide sequence in the genome, which does not encode protein or affect protein expression, and usually has no important biological function.

Preferably, the genetically engineered bacteria include recombinant expression fragments in the expression elements described in the second technical solution of the present invention. Preferably, after the recombinant expression fragment is introduced into the starting bacterium, it is integrated into the genome of the starting bacterium through homologous recombination. In a specific embodiment of the present invention, the integration site is the int1 gene or its homologous gene. In addition to int1, other integration sites can also be selected, which can be easily selected by a person skilled in the art without affecting the physiology of the microorganism.

在一个实施方案中，int1基因具有如下核苷酸序列：CGGTTCACTTCTCTCTCACAACCCCCTCTCTTTATATTTATTTATAGTTTACCCTTCCCCCAGTGTGTAGTTACTTCTCTGTTTTCGATGTTAATTGTTAATGTACGCGTCTAGATTGCTCAACAAGAGAGGTGTAATTCTACGGACGAGCTCCGCAGGAACAAAGCAAAAGGAATATACACTTCAATGATACAAACAAGGAGCTGTAACGGGGGAATATCAGTTAGTAGCTGCTTCCACATAGGGAAGCAATGATCGCAAAGGATATTCAGAGACATGTGAAGATACTTGGTACAAACTGGAAAAGCATATACAAAATGAAGAAAAAGAGAACAATTGCACAAAGCAGAACAATCAACGACTGCTACCCCTTTTATACCGCGTTTCCTGTTTACTATCATTTTACTCGCTTAAGTTCGACGCAAATCAGACGAAAATCCCAACTTCCCCCAACTCCCCCTTCAATTCACGTCAA(SEQ ID NO：17)。

Preferably, the peroxidase gene is introduced into the genetically engineered bacteria in a non-integrated manner.

Preferably, the non-integration method is: transforming the starting bacteria with a recombinant expression vector containing the superoxide dismutase gene; more preferably, the starting plasmid of the recombinant expression vector is pCIB2.

The genetically engineered bacteria provided by the third technical solution of the present invention can increase the yield and substrate conversion rate of long-chain dibasic acids compared with microorganisms without recombined superoxide dismutase genes.

In order to solve the above-mentioned technical problems, the fourth technical solution provided by the present invention is: a method for preparing the genetically engineered bacterium as described in the third technical solution of the present invention, said method comprising the following steps: converting the nucleotide sequence such as SEQ ID NO: The superoxide dismutase gene shown in 9 was introduced into Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotroula, yeast Genus (Saccharomyces) or Yarrowia (Yarrowia), preferably Candida viswanathii (Candida viswanathii) or Candida tropicalis (Candida tropicalis), more preferably Candida vissi of strain preservation number CCTCC NO:M2020048 Yeast or Candida viesis of strain deposit number CCTCC NO:M 2021824. The method for preparing genetically engineered bacteria provided by the present invention can solve the problem of damage to biological macromolecules such as lipids, proteins, and DNA caused by oxidative stress in microorganisms, which in turn leads to damage to normal physiological metabolic functions of cells.

In one embodiment, the present invention provides a method for preparing genetically engineered bacteria for fermentative production of long-chain dibasic acids, comprising: enhancing the activity of superoxide dismutase in the long-chain dibasic acid production strains, preferably Preferably, the superoxide dismutase comprises a nucleotide sequence shown in SEQ ID NO: 9 or an amino acid sequence encoded by a nucleotide sequence having at least about 95% identity with SEQ ID NO: 9.

In one embodiment, the method comprises overexpressing a gene encoding superoxide dismutase in a long chain dibasic acid producing strain.

In one embodiment, the long-chain dibasic acid producing strain is selected from Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotorula, Saccharomyces or Yarrowia, preferably Pseudomonas Trichosanthes or Candida tropicalis, more preferably Candida viesis with a preservation number of CCTCC NO: M 2020048 or Candida viesis with a preservation number of CCTCC NO: M2021824.

In one embodiment, the gene encoding superoxide dismutase comprises the nucleotide sequence shown in SEQ ID NO: 9 or a degenerate sequence thereof or has at least about 95% identity with SEQ ID NO: 9 Nucleotide sequence. In one embodiment, the gene encoding superoxide dismutase comprises the nucleotide sequence shown in SEQ ID NO: 9 or its degenerate sequence.

In one embodiment, the method comprises introducing a gene encoding superoxide dismutase into a long-chain dibasic acid producing strain and placing it under the control of a suitable promoter, such as a strong promoter, which For example shown in SEQ ID NO:7.

In order to solve the above technical problems, the fifth technical solution provided by the present invention is: a method for preparing long-chain dibasic acid, the preparation method is to ferment the genetically engineered bacteria as described in the third technical solution of the present invention in a culture medium Or obtain the long-chain dibasic acid through the genetically engineered bacterium obtained by the method described in the fourth technical solution of the present invention; or, ferment the long-chain dibasic acid production strain in the culture medium, and add superoxide dismutase simultaneously, The long-chain dibasic acid is obtained.

In one embodiment, the superoxide dismutase comprises an amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 9 or at least about 95% of the nucleotide sequence of SEQ ID NO: 9. In one embodiment, the superoxide dismutase comprises the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO:9.

In one embodiment, the long-chain dibasic acid producing strain is selected from the group consisting of Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotorula, Saccharomyces or Yarrowia, preferably Candida vissarius or Candida tropicalis, more preferably the preservation number is the Candida viesis of CCTCC NO:M 2020048 or the preservation number is the Candida viesis of CCTCC NO:M 2021824.

During the fermentation production process, the fermentation medium includes: carbon source, nitrogen source, inorganic salt and nutrient salt.

In some embodiments, the carbon source includes one or more selected from glucose, sucrose and maltose; and/or the carbon source is added in an amount of 1%-10% (w/v), such as 1.5 %, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%.

In some embodiments, the nitrogen source includes one or more selected from peptone, yeast extract, corn steep liquor, ammonium sulfate, urea, and potassium nitrate; and/or the total amount of the nitrogen source added is 0.1% -3% (w/v), eg 0.2%, 0.4%, 0.5%, 0.6%, 0.8%, 1.0%, 1.2%, 1.5%, 1.8%, 2.0%, 2.5%.

In some embodiments, the inorganic salt includes one or more selected from potassium dihydrogen phosphate, potassium chloride, magnesium sulfate, calcium chloride, ferric chloride, copper sulfate; and/or the inorganic salt The total amount added is 0.1%-1.5% (w/v), such as 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%.

In some embodiments, the nutritional factors include one or more selected from vitamin B1, vitamin B2, vitamin C, and biotin; and/or the total added amount of the nutritional factors is 0-1% (w /v), for example 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%.

And/or, the long-chain dibasic acid is a linear long-chain dibasic acid.

Preferably, the medium includes: 7-40 g/L sucrose, 0.5-5 g/L corn steep liquor with a total nitrogen content of 1-3 wt%, 2-12 g/L yeast extract, 0-3 g/L NaCl, KNO ₃ 2-12g/L, KH ₂ PO ₄ 2-12g/L, urea 0.1-3g/L, fermentation substrate 180-400mL/L and acrylic acid 4-10g/L, the fermentation substrate includes C ₉ -C ₂₂ One or more of long-chain alkanes, the pH of the culture medium is 7-8; the culture medium preferably includes: 10 g/L of sucrose, 1 g/L of corn steep liquor with a total nitrogen content of 2.5 wt%, yeast extract 4g/L, KNO ₃ 4g/L, KH ₂ PO ₄ 4g/L, urea 0.5g/L, fermentation substrate 180mL/L and acrylic acid 4g/L, the fermentation substrate includes n-dodecane, n-decane and one or more of n-hexadecane, the pH of the culture medium is 7.5-7.6;

And/or, the conditions of the fermentation are: the inoculation amount of the genetically engineered bacteria is 10-30%, such as 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 22%, 24%, 25%, 27% or 29%, the temperature is 20-40°C, the time is 60-180h, stirring is also carried out during the fermentation, and the stirring speed is 200- 300rpm; the fermentation conditions are preferably: the inoculum amount of the genetically engineered bacteria is 20%, the temperature is 30°C, and the time is 90-144h. Stirring is also carried out during the fermentation, and the stirring speed is 250rpm.

Unless otherwise indicated or inferred from the context, the percentages mentioned in the present invention are mass-volume ratios, ie: w/v; % means g/100mL.

Optionally, before the fermentation, it also includes performing seed liquid culture on the genetically engineered bacteria, which is conventional in the field, preferably after the genetically engineered bacteria are cultivated to 30-fold dilution of the dense optical density of the bacteria. , OD ₆₂₀ ≥ 0.5, more preferably OD ₆₂₀ ≥ 0.8.

In some embodiments, the method further includes the step of isolating long-chain dibasic acids from the culture product, and the step of isolating long-chain dibasic acids is routine in the art.

The long-chain dibasic acid prepared by the technical scheme of the invention can be used to produce products such as nylon filaments, engineering plastics, synthetic spices, cold-resistant plasticizers, high-grade lubricating oils, and polyamide hot-melt adhesives.

In order to solve the above technical problems, the sixth technical solution provided by the present invention is: a recombinant DNA, characterized in that the recombinant DNA includes a superoxide dismutase gene whose nucleotide sequence is shown in SEQ ID NO:9.

On the basis of conforming to common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain preferred examples of the present invention.

The reagents and raw materials used in the present invention are all commercially available.

The positive progress effect of the present invention is:

The invention relates to the application of superoxide dismutase in the preparation of long-chain dibasic acid and the genetic engineering bacteria overexpressing it. The nucleotide sequence of the superoxide dismutase is shown in SEQ ID NO: 9. In the present invention, the catalase sequence is introduced into the long-chain dibasic acid fermentation strain through various methods, so that the catalase is overexpressed, and the conversion rate of the substrate and the yield of the long-chain dibasic acid are improved. It can effectively shorten the fermentation time of dibasic acid and greatly improve the biological fermentation level of long-chain dibasic acid.

Biological Material Deposit Information

Candida vistris CAes2121 of the present invention has been preserved in the China Center for Type Culture Collection (CCTCC) on July 7, 2021, and the preservation address is: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, postcode: 430072 , the deposit number is: CCTCC No: M 2021824, the culture name is Candida viswanathii CAes2121, and the classification name is Candida viswanathii (Candida viswanathii).

Candida vistris CAES2113 of the present invention has been preserved in the China Center for Type Culture Collection (CCTCC) on February 24, 2020, and the preservation address is: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, postcode: 430072 , the deposit number is: CCTCC No: M 2020048, the culture name is Candida viswanathii CAES2113, and the classification name is Candida viswanathii (Candida viswanathii).

Detailed ways

definition:

Long-chain alkanes: the fermentation substrate of the present invention includes long-chain alkanes, which belong to saturated chain hydrocarbons and are a kind of saturated hydrocarbons under hydrocarbons. Most of their overall structures are only composed of carbon, hydrogen, carbon-carbon single bonds and carbon Composed of hydrogen single bonds, it includes alkanes of the chemical formula CH ₃ (CH ₂ ) _n CH3, where n≥7.

Long-chain dibasic acids (LCDA; also called long-chain dicarboxylic acids or long-chain diacids, hereinafter or simply referred to as dibasic acids) include dibasic acids of the chemical formula HOOC(CH ₂ ) _n COOH, where n≧7.

Microorganisms producing long-chain dibasic acids: The reported strains that can produce and accumulate dibasic acids include bacteria, yeast, and molds, such as: Corynebacterium, Geotrichum candidum, Candida ), Pichia, Rhodotroula, Saccharomyces, Yarrowia, etc. Among them, many species of Candida are excellent strains for fermentation and production of dibasic acids.

As used herein, "genetically engineered bacteria" refers to a strain artificially altered by biological means, which has one or more changes compared with the original strain before transformation, such as gene deletion, amplification or mutation, thereby having an altered biological Chemical properties such as improved productivity.

As used herein, the initial strain may be the natural strain to which the desired genetic modification is to be made or a strain with other genetic modifications. In some embodiments, the initial strain is selected from the group consisting of Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotroula, Saccharomyces ) or Yarrowia (Yarrowia), preferably Candida viswanathii (Candida viswanathii) or Candida tropicalis (Candida tropicalis), more preferably the Candida vissi with a preservation number of CCTCC NO: M 2020048 or a preservation number of Candida viesis of CCTCC NO:M 2021824.

As used herein, "has enhanced activity" refers to an increase in activity of at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300% or higher, or not The naive strain or the wild-type strain having the activity confers the desired activity.

The activity of the protein (such as an enzyme) can be produced or enhanced by any suitable means known in the art, such as including but not limited to expressing or overexpressing (for example, via a vector such as a plasmid) the corresponding gene encoding the protein in a bacterial strain, introducing the resulting Mutations that increase the activity of the protein, and the like.

In some embodiments, in the genetically engineered bacteria of the present invention, the superoxide dismutase gene or its homologous gene can be integrated into the genome (for example, by homologous recombination), optionally at any site in the genome, (as long as Such integration does not significantly negatively affect the growth and production of the strain), for example one copy of any gene within the genome is replaced by one or more copies of the superoxide dismutase gene or its homologous gene.

Herein, the reference may be a wild-type microorganism or a microorganism prior to the desired genetic manipulation (for example, the initial microorganism for genetic manipulation to increase gene activity). Herein, parental microorganism and initial microorganism are used interchangeably to refer to a microorganism to which a desired genetic manipulation (such as enhancing or attenuating gene or protein activity) is performed.

The gene sod can encode superoxide dismutase, which is an antioxidant metalloenzyme existing in organisms, which can catalyze the disproportionation of superoxide anion free radicals, and plays a vital role in the balance of oxidation and antioxidant in the body.

As used herein, superoxide dismutase (EC 1.15.1.2) catalyzes the disproportionation of superoxide anion radicals into hydrogen peroxide and oxygen, and the resulting superoxide anion radicals are normal metabolites in organisms. As used herein, having or having enhanced superoxide dismutase activity means that the strain has or has increased activity to catalyze the disproportionation of superoxide anion free radicals into hydrogen peroxide and oxygen.

In one embodiment, the superoxide dismutase used herein comprises the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 9, or has at least about 95%, such as at least about 96%, At least about 97%, at least about 98%, at least about 99%, at least about 99.1%, at least about 99.2%, at least about 99.3%, 99.4%, at least about 99.5%, at least about 99.6%, 99.7%, at least about 99.8% , at least about 99.9%, at least about 99.91%, at least about 99.92%, at least about 99.93%, at least about 99.94%, at least about 99.95%, or at least about 99.96% identical to a nucleotide sequence encoding and having superoxide Amino acid sequence for dismutase activity. Preferably, the superoxide dismutase is from the genus Candida (Candida), preferably Candida viswanathii (Candida viswanathii), more preferably the Candida viswanathii whose preservation number is CCTCC NO: M 2020048 or whose preservation number is Candida viesis of CCTCC NO:M 2021824.

In one embodiment, the nucleotide sequence of the gene encoding superoxide dismutase comprises SEQ ID NO: 9 or has at least about 95% of SEQ ID NO: 9, such as at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.1%, at least about 99.2%, at least about 99.3%, 99.4%, at least about 99.5%, at least about 99.6%, 99.7%, at least about 99.8%, at least about 99.9%, at least Sequences that are about 99.91%, at least about 99.92%, at least about 99.93%, at least about 99.94%, at least about 99.95%, or at least about 99.96% identical.

As used herein, the expressions "gene", "nucleic acid sequence", "polynucleotide" and "nucleotide sequence" are used interchangeably and refer to a chain of nucleotides, including DNA and RNA. "Expression of a gene" refers to the transcription of a DNA region operably linked to an appropriate regulatory region, especially a promoter, into biologically active RNA and the translation of RNA into a biologically active protein or peptide.

As used herein, a degenerate sequence refers to a nucleotide sequence that encodes the same amino acid sequence but differs in nucleotide sequence from a given sequence due to the degeneracy of the genetic code.

Homologous genes refer to two or more gene sequences with a sequence similarity of 80%, including orthologous genes (also known as vertical homologous genes, orthologous genes or directed evolution homologous genes), horizontal homologous genes Source genes (also known as paralogous genes, paralogous genes or parallel evolutionary homologous genes) and/or heterologous genes. The homologous gene of the superoxide dismutase coding gene referred to in the present invention can be the orthologous gene of the superoxide dismutase coding gene, also can be its horizontal homologous gene or heterologous gene.

As used herein, the terms "homology", "sequence identity" and the like are used interchangeably herein. Sequence identity can be detected by aligning the number of identical nucleotide bases between a polynucleotide and a reference polynucleotide, as can be determined, for example, by standard alignment algorithm programs using default gap penalties established by each vendor . Whether two nucleic acid molecules have at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% "identical" nucleotide sequences can be determined using known computer algorithms, such as BLASTN, FASTA, DNAStar and Gap (University of Wisconsin Genetics Computer Group (UWG), Madison WI, USA). For example, the percent identity of nucleic acid molecules can be determined, for example, by comparing sequence information using the GAP computer program (e.g., Needleman et al. J. Mol. Biol. 48:443 (1970), by Smith and Waterman (Adv. Appl. Math. 2:482 (revised 1981). Briefly, the GAP program defines similarity in terms of the number of similarly aligned symbols (ie, nucleotides) divided by the total number of symbols in the shorter of the two sequences.

Sequence identity refers to the percentage of residues of a polynucleotide sequence variant that are identical to the non-variant sequence after alignment of the sequences and introduction of gaps. In specific embodiments, polynucleotide variants have at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, At least about 97%, at least about 98%, at least about 99%, at least about 99.1%, at least about 99.2%, at least about 99.3%, 99.4%, at least about 99.5%, at least about 99.6%, 99.7%, at least about 99.8% , at least about 99.9%, at least about 99.91%, at least about 99.92%, at least about 99.93%, at least about 99.94%, at least about 99.95%, or at least about 99.96% polynucleotide or polypeptide homology.

A resistance marker is a type of selectable marker that confers on transformants the ability to survive in the presence of antibiotics. The resistance marker genes include SAT, HYG and CAT, which can respectively resist nourthricin, hygromycin and chloramphenicol.

Homologous recombination refers to the recombination between DNA molecules that relies on sequence similarity, most commonly within cells to repair mutations created during mitosis. Homologous recombination technology has been widely used in genome editing, including gene knockout, gene repair, and introduction of new genes to specific sites. A class of microorganisms represented by Saccharomyces cerevisiae has a very high probability of homologous recombination in cells, does not depend on sequence specificity, and has obvious advantages in genome editing.

An episomal vector refers to a vector that can be amplified in a cell independently of the replication cycle of the host cell itself. Episomal vectors are widely used in protein expression, gene regulation and editing.

As used herein, "enhancing the activity" means increasing the activity, for example by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% %, at least 90%, at least 95%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, or higher.

Various methods for enhancing desired protein activity are known in the art, including, but not limited to, expression or overexpression of protein-encoding genes, and mutations or other modifications that increase protein activity.

As used herein, "overexpression" means that the expression level of a gene is increased, for example, by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, relative to the level before genetic manipulation. At least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, or higher. Methods for overexpressing genes are well known in the art, including but not limited to using strong promoters, increasing gene copy number, enhancers, and the like. Increasing gene copy number can be achieved, for example, but not limited to, by introducing one or more copies of an exogenous or endogenous gene, such as through an expression vector or integration into the genome.

As used herein, "exogenous gene" refers to a gene from another cell or organism, eg, from the same species or a different species.

As used herein, "endogenous gene" refers to a cell or organism's own genes.

The present invention describes the following technical solutions:

Scheme 1: Application of superoxide dismutase or superoxide dismutase gene in the production of long-chain dibasic acid by microbial fermentation.

Scheme 2: the application as described in scheme 1, it is characterized in that, the nucleotide sequence of described superoxide dismutase gene is as shown in SEQ ID NO: 9, or has at least about 95% identical with SEQ ID NO: 9 sequence of identity;

Scheme 3: An expression element comprising a superoxide dismutase gene, characterized in that, the expression element is a recombinant expression vector obtained by constructing the superoxide dismutase gene on a plasmid, or is a recombinant expression vector comprising a superoxide dismutase gene A recombinant expression fragment of the gene; the nucleotide sequence of the superoxide dismutase gene is shown in SEQ ID NO: 9, or a sequence having at least about 95% identity with SEQ ID NO: 9;

Preferably, the plasmid is pCIB2; and/or, the recombinant expression fragment is obtained by amplifying the superoxide dismutase gene with the primer sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4.

Scheme 4: a kind of genetically engineered bacterium, it is characterized in that, it comprises the superoxide dismutase gene of nucleotide sequence as shown in SEQ ID NO:9, and the starting bacterium of described genetically engineered bacterium is corynebacterium (Corynebacterium), Geotrichum candidum, Candida, Pichia, Rhodotroula, Saccharomyces or Yarrowia, preferably Candida viesis Yeast (Candida viswanathii) or Candida tropicalis (Candida tropicalis), more preferably Candida vissiana with strain deposit number CCTCC NO: M 2020048 or Candida vissi with strain deposit number CCTCC NO: M 2021824.

Scheme 5: the genetic engineering bacterium as described in scheme 4, it is characterized in that, described genetic engineering bacterium comprises the recombinant expression fragment in the expression element as described in scheme 3; Preferably, described recombinant expression fragment imports described starting bacterium Finally, it is integrated into the genome of the starting bacterium through homologous recombination; more preferably, the integration site is the int1 gene or its homologous gene.

Scheme 6: the genetic engineering bacterium as described in scheme 4, is characterized in that, described peroxidase gene utilizes non-integration way to import described genetic engineering bacterium;

Scheme 7: A method for preparing the genetically engineered bacterium described in any one of Scheme 4-6, characterized in that, the method comprises the steps of: superoxidizing the nucleotide sequence as shown in SEQ ID NO: 9 The dismutase gene was introduced into Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotroula, Saccharomyces or Yarrowia Genus (Yarrowia), preferably Candida viswanathii (Candida viswanathii) or Candida tropicalis (Candida tropicalis), more preferably Candida viswanathii of strain preservation number CCTCC NO: M 2020048 or strain preservation number CCTCC NO: Candida viesis of M 2021824.

Scheme 8: a preparation method of long-chain dibasic acid, characterized in that, the preparation method is to ferment the genetically engineered bacteria as described in any one of Scheme 4-6 in the culture medium, or to ferment the rod-shaped bacteria in the culture medium Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotroula, Saccharomyces or Yarrowia, preferably It is Candida viswanathii (Candida viswanathii) or Candida tropicalis (Candida tropicalis), more preferably Candida vissi of strain preservation number CCTCC NO:M 2020048 or the dimension of strain preservation number CCTCC NO:M 2021824 Adding superoxide dismutase to Candida stunis simultaneously, obtains described long-chain dibasic acid; Preferably, described superoxide dismutase is by the nucleotide sequence shown in SEQ ID NO: 9 or with SEQ ID NO :9 has at least about 95% of the nucleotide sequence encoding.

Scheme 9: The preparation method as described in scheme 8, characterized in that, the long-chain dibasic acid is selected from one or more of C ₉ -C ₂₂ long-chain dibasic acids, preferably from C ₉ -C One or more of the long-chain dibasic acids of ₁₈ , more preferably selected from sebacic acid, undecane dibasic acid, dodecane dibasic acid, tridecane dibasic acid, tetradecane dibasic acid, One or more of pentadecanedioic acid and hexadecandioic acid;

And/or, the long-chain dibasic acid is a linear long-chain dibasic acid.

Scheme 10: a kind of recombinant DNA, it is characterized in that, described recombinant DNA comprises the superoxide dismutase gene of nucleotide sequence as shown in SEQ ID NO:9.

As used herein, "optional" or "optionally" means that the subsequently described event or circumstance occurs or does not occur, and that description includes instances where said event or circumstance occurs and instances where it does not. For example, an optionally included step means that the step is present or absent.

As used herein, the term "about" refers to a numerical range that includes the specified value that a person skilled in the art would reasonably consider to be similar to the specified value. In some embodiments, the term "about" means within standard error using measurements generally accepted in the art. In some embodiments, about refers to +/- 10% of a specified value.

A range disclosed herein should be considered to also specifically disclose all possible subranges and individual values within that range. For example, a description of the range 1 to 6 should be deemed to have explicitly disclosed the subranges 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc. , and individual numbers in the range, such as 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the scope.

Example

The present invention will be further illustrated by the following non-limiting examples below. It is well known to those skilled in the art that many modifications can be made to the present invention without departing from the spirit of the present invention, and such modifications also fall within the scope of the present invention.

The following experimental methods are conventional methods unless otherwise specified, and the experimental materials used can be easily obtained from commercial companies unless otherwise specified.

Embodiment 1 culture medium, culture fermentation method and dibasic acid detection method

1. LB medium (w/v): 1% sodium chloride, 1% tryptone and 0.5% yeast extract (OXOID, LP0021). 1.5% agar powder should also be added to the solid medium.

2. YPD medium (w/v): 2% peptone, 2% glucose and 1% yeast extract (OXOID, LP0021). 2% agar powder should also be added to the solid medium.

When cultivating, pick a single colony and place it in a 2mL centrifuge tube containing 1mL YPD liquid medium, and culture it on a shaker at 250rpm at 30°C for 1 day.

3. Seed medium (w/v): 1% sucrose, 0.3% yeast extract, 0.2% corn steep liquor for industrial fermentation (total nitrogen content 2.5wt%), 0.4% KH ₂ PO ₄ , 0.05% urea, fermentation substrate It is n-decane 20mL/L.

During cultivation, the bacterium solution cultivated in step 1 was inserted into a 500mL shake flask containing 30mL seed medium, the inoculum size was 3%, and cultured in a shaker at 250rpm and 30°C until the _OD620 reached 0.8 (after 30-fold dilution).

4. Fermentation medium (w/v): sucrose 10g/L, corn steep liquor (total nitrogen content 2.5wt%) 1g/L, yeast extract 4g/L, KNO ₃ 4g/L, KH ₂ PO ₄ 4g/L, Urea 0.5g/L, acrylic acid 4g/L, fermentation substrate n-decane 180mL/L, adjust the pH value to 7.5-7.6.

During fermentation, inoculate the seed solution cultivated in step 2 into a 500 mL shake flask containing 15 mL of fermentation medium, the inoculum amount is 20%, and culture on a shaker at 30° C. and 250 rpm for 90-144 h. During the cultivation process, the pH value is adjusted to the range of 7.5-7.6 by adding acid/alkali at intervals.

5. Detection method:

(1) Detection of fermentation broth products and impurity content: gas chromatography.

(2) Detection of purity and impurity content of solid products: detection by gas chromatography.

Example 2 Preparation of Superoxide Dismutase Gene Recombination Fragment

All DNA fragments in this embodiment use Takara company

HS high-fidelity DNA polymerase (Takara, R040A) amplified. After 1% agarose gel electrophoresis, the purified DNA fragments were recovered with an Axygen gel extraction kit (Axygen, AP-GX-250G). The reference of this study (Fungal Genet Biol 2005,42(9):737-748) constructed the recombinant fragment by means of Cre-loxp.

Candida viscera CAES2113 (strain preservation number: CCTCC NO:M 2020048) genomic DNA was extracted using Ezup Yeast Genomic DNA Rapid Extraction Kit (Shenggong, Cat. No. 518257), supplemented by liquid nitrogen grinding to improve the efficiency of wall breaking . 1 μg of genome was added to each 50 μL reaction system as a template for PCR amplification. The primers and PCR reaction conditions used are as follows:

1. For the amplification of overexpressed fragments by homologous recombination, the primer sequences are as follows (the underlined part is the homology arm):

Pro-F: 5' -CGGTTCACTTCTCTCTCCACAACCCCCTCTTTTATATTTATTTAGTT TAC GGCATAAGGATCCAAGAAGAGGAG-3' (SEQ ID NO: 1)

Pro-R: 5'-ATTGAATAATTAGTATGGGGGTGTGGTGTG-3' (SEQ ID NO: 2)

sod-F: 5'- CACACCCCCATACTAATTATTCAAT ATGGTCAAAGCTGGTATGTATCCCAG-3' (SEQ ID NO: 3)

sod-R: 5'- CTCCAATATCAAATCAGAATATTCT CTAGTTACTCAAACCAATGACACCACAG-3' (SEQ ID NO: 4)

Ter-F: 5'-AGAATATTCTGATTTGATATTGGAGTGC-3' (SEQ ID NO: 5)

Ter-R: 5'- CTTCGTATAGCATACATTATACGAAGTTAT CTGTGTGTGCGTGTGTTATGTTATAG-3' (SEQ ID NO: 6)

The PCR reaction conditions are:

Step 1: 98°C for 2min,

Step 2: 98°C for 10s, 58°C for 10s, 72°C for 2min, 30 cycles,

Step 3: 5min at 72°C.

Pro-F/R, Ter-F/R and sod-F/R amplified fragments of about 1.0Kb, 0.5Kb and 0.7Kb in size respectively, and recovered and purified the fragments after gel electrophoresis, which were confirmed to be correct by sequencing. Named Pro, Ter and sod, its sequence is shown in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.

2. The reference resistance selection marker (HYG, hygromycin resistance gene) was amplified using the plasmid PCIB2 (patent number EP3550014B1) as a template, and the primer sequences were as follows (the underlined part is the homology arm):

lox-F: 5'-ATAACTTCGTATAATGTATGCTATACGAAG-3' (SEQ ID NO: 10)

lox-R: 5'- GCGTACATTAACAATTAACATCGAAAACAGAGAAGTAACTACACACTGATAACTTCGTATAGCATACATTATACGAAG -3' (SEQ ID NO : 11)

The PCR reaction conditions are:

Step 1: 98°C for 2min,

Step 2: 98°C 10s, 55°C 10s, 72°C 2min 30s, 30 cycles,

Step 4: 5min at 72°C.

The fragments amplified by lox-F/R were all about 1.8kb in size. After gel electrophoresis, the fragments were recovered and purified. The fragments were confirmed to be correct by sequencing and named lox-hyg. The sequence is shown in SEQ ID NO:12.

3. PCR overlap extension to obtain a complete recombinant template

The equimolar mixture of recovered Pro, Ter, sod and lox-hyg fragments was used as a template, and PCR amplification was performed with Pro-F/lox-R, and the reaction conditions were as follows:

Step 1: 98°C for 2min,

Step 2: 98°C 10s, 55°C 10s, 72°C 2min 30s, 5 cycles,

Step 3: 98°C for 10s, 72°C for 3min, 30 cycles,

Step 4: 5min at 72°C.

A recombinant fragment with a size of about 3.0Kb was recovered by gel electrophoresis.

SEQ ID NO: 7-9 and 12 sequences are as follows:

SEQ ID NO: 7 (promoter Ppxp9)

SEQ ID NO: 8 (terminator Tpxp9)

SEQ ID NO: 9 (sod)

SEQ ID NO: 12 (lox-hyg)

Transformation of embodiment 3 recombinant strains

1. Preparation of yeast electroporation competent cells

Inoculate the yeast cell CAES2113 cultured overnight at 30° C. on a shaker at 250 rpm into 100 mL of YPD medium in Example 1 until the OD ₆₂₀ is 0.1. When cultured to OD ₆₂₀ to 1.3 under the same conditions, the cells were collected by centrifugation at 3000g and 4°C. Wash the cells twice with ice-cold sterile water and collect them, then resuspend the cells in 10 mL of 1 M sorbitol solution pre-cooled on ice, collect the cells by centrifugation at 1500 g at 4°C, resuspend them in 1 mL of the above sorbitol solution, and aliquot 100 μL Cell suspensions are used for genetic transformation.

2. Yeast Competent Electric Shock Transformation

Add 1 μg of the recovered and purified recombinant fragments to the competent cells above, place them on ice for 5 minutes, and then quickly transfer them to a 0.2 cm electroshock cup for electroporation transformation (BioRad, MicropulserTM Electroporator, transformation program SC2, 1.5kV, 25uFD, 200ohms). Quickly add a mixture of 1mL YPD and 1M sorbitol (1:1, v/v), incubate at 30°C and 200rpm for 2 hours, collect the bacterial solution and spread the YPD medium plate containing 100mg/L hygromycin B, Incubate statically at 30°C for 2 to 3 days until a single colony grows.

The screening of embodiment 4 recombinant strains

Pick the single colony obtained in Example 4 and inoculate it into a 2mL centrifuge tube containing 1mL of 1YPD medium (containing 100mg/L hygromycin B), and cultivate overnight at 250rpm and 30°C. Colony PCR identification was carried out the next day, and the primer sequences and PCR reaction conditions used were as follows:

sod-cF:5'-GCTGGTCAAGACGATTTGGGTAAG-3' (SEQ ID NO: 13)

intD-R:5'-TATTCCCCCCGTTACAGCTCCTTG-3' (SEQ ID NO: 14)

Step 1: 95°C for 5 minutes,

Step 2: 95°C for 30s, 55°C for 30s, 72°C for 1min, 35 cycles,

Step 3: 5min at 72°C.

After the PCR product was sequenced and analyzed, the correct strain was named lox2113sod.

Example 5 Recombinant strain lox2113sod fermentative production of ten-carbon long-chain dibasic acid

Strains CAES2113 and lox2113sod were respectively inoculated into 15 mL centrifuge tubes containing 3 mL of the YPD medium described in Example 1, and cultured on a shaker at 250 rpm at 30° C. for 1 day. Get above-mentioned bacterium liquid and insert in the 500mL shake flask that contains 30mL embodiment 1 seed culture medium, inoculum size is 3%, shaker 250rpm, cultivate under the condition of 30 ℃ until _OD620 reaches 0.8 (the OD value is thalline optical density , and is the value measured when diluted 30 times). The seed liquid was inoculated into the shake flask that 15mL of the fermentation medium of Example 1 was housed, the inoculation amount was 20%, and the substrate in the fermentation medium was decane. Continue to culture on a shaking table at 250 rpm and 30° C. until the end of fermentation. And the bacterial strain CAES2113 was used as a control group, and the cultivation and fermentation methods were the same as above.

Take 0.5 g of the above-mentioned fermentation broth samples respectively, and use the method described in Example 1 for GC detection to calculate the content of decanedidioic acid. The results showed that the fermentation of the strain lox2113sod ended at 119h, which was 18h earlier than that of the control strain CAES2113. The dibasic acid production of the other two strains was also significantly different. The dibasic acid production of the strain lox2113sod was 115.85 g/L, while that of the control strain was only 102.35 g/L. This indicates that overexpression of superoxide dismutase contributes to the production of long-chain dibasic acids.

Example 6 Using CAes2121 as a host to evaluate the effect of superoxide dismutase overexpression on fermentation

This patent also selects another strain host to evaluate the influence of superoxide dismutase overexpression on fermentation. The host is obtained from Candida viesis CAES2113 strain through compound mutagenesis and screening with 5-fluorouracil and ARTP. Referring to the transformation of the recombinant strain in Example 3 and the screening of the recombinant strain in Example 4, a superoxide dismutase overexpressing strain was constructed, and the correct strain was verified to be named CAes2121sod. Referring to Example 5, the step of producing ten-carbon long-chain dibasic acid by fermentation of the recombinant strain was used to evaluate the fermentation performance of the recombinant strain. The results are shown in Table 1:

Table 1

菌株strain	CAes2121CAes2121	CAes2121sodCAes2121sod
发酵时间(h)Fermentation time (h)	137137	118118
二元酸产量(g/L)Dibasic acid yield (g/L)	104.54104.54	116.87116.87

It can be seen from Table 1 that when CAes2121 is used as the host, the overexpression of superoxide dismutase also contributes to the production of long-chain dibasic acids.

Example 7 evaluates the impact of overexpressing superoxide dismutase on fermentation by episomal vectors

1. Amplification of overexpression elements

Referring to the overlap extension amplification method in Part 3 of Example 2, using equimolar mixed Pro, Ter and sod as templates, the sod overexpression DNA fragment was prepared by amplification with primers Kpn-pro-F/BamHI-ter-R. The primer sequences are as follows (the underline is the restriction site):

Kpn-pro-F: 5'-GCTC GGTACC GGCATAAGGATCCAAGAAGAGGAG-3' (SEQ ID NO: 15)

BamHI-ter-R: 5'-TATA GGATCC CTGTGTGTGCGTGTGTTATGTTATAG-3' (SEQ ID NO: 16)

2. Preparation of episomal vector overexpression elements

The vector pCIB2 (patent number: EP3550014B1) and overexpressed DNA fragments owned by the company were digested with endonucleases KpnI and BamHI (Thermo, USA), and then the overexpressed elements were integrated into the vector by T4 enzyme ligation method, and finally transformed into The vector psod overexpressing superoxide dismutase was prepared in Escherichia coli.

The enzyme digestion system is:

KpnI and BamHI: 1.0 μl each

10*buffer: 5.0μl

Vector or DNA fragment: 1 μg

ddH2O: make up to 50μl

After digestion at 37°C for 1 h, the fragments were recovered by gel electrophoresis for subsequent ligation reactions.

T4 ligase (Thermo, USA) was used for the ligation reaction, and the reaction system and conditions were as follows:

T4 ligase: 0.5 μl

10*T4 buffer: 1.0μl

DNA fragment: 50ng

Carrier: 50ng

ddH ₂ O: make up to 10 μl

Step 1: 22°C 30m

Step 2: 65℃ 10m,

3. Competent preparation and transformation of Escherichia coli

Pick a single colony of Escherichia coli from the plate and inoculate it in a 250mL shake flask containing 100mL LB medium, culture at 200rpm, 37°C for 3-4h until the OD600 of the bacterial solution reaches 0.2-0.4; place it on ice for 30min to stop the cells Grow, then centrifuge at 4000rpm, 4°C for 10min, collect the cells; resuspend the cells with 10mL pre-cooled 0.1M CaCl ₂ solution, ice-bath for 10min, centrifuge at 4000rpm, 4°C for 10min, remove the supernatant ; Add 8 mL of a pre-cooled mixture of 0.1M CaCl ₂ and 30% glycerol to resuspend the cells, aliquot them into 1.5 mL centrifuge tubes, and store at -80°C.

4. Vector transformation and verification

Take 100 μl of the prepared competent cells and melt on ice; add 10 μl of the ligation product, mix gently, and bathe in ice for 30 minutes; then bathe in a 42°C water bath for 90 seconds, and quickly place it in an ice bath for 2 minutes; add 500 μl of LB medium, 200rpm, cultured at 37°C for 40-45min; centrifuged at 6000rpm for 1min, removed 300μl of supernatant, and mixed the cells; took 100μl and spread it on LB solid plates containing corresponding antibiotics, and cultured at 37°C for 12 -16h. Then the carrier was extracted and verified by PCR and sequencing, and finally the correct carrier was named psod.

5. Evaluate the effect of vector overexpression mutants on fermentation

Referring to the transformation of recombinant strains in Example 3 and the screening step of recombinant strains in Example 4, a superoxide dismutase vector overexpression strain was constructed using bacteria CAES2113 as a host, and the correct strain was verified to be named 2113psod. Referring to Example 5, the step of producing ten-carbon long-chain dibasic acid by fermentation of the recombinant strain was used to evaluate the fermentation performance of the recombinant strain. The results are shown in Table 2:

Table 2

菌株strain	CAES2113CAES2113	2113p sod2113p sod
发酵时间(h)Fermentation time (h)	137137	121121
二元酸产量(g/L)Dibasic acid yield (g/L)	102.35102.35	116.43116.43

It can be seen from Table 2 that the overexpression of superoxide dismutase through episomal vectors also contributes to the production of long-chain dibasic acids.

Comparative example 1 evaluates the effect of POX4 knockout on the fermentation of CAES2113 bacteria

References Mol Cell Biol, 1991, 11(9), 4333-9 described in the methods and materials section, this study constructed the POX4 knockout strain 2113pox4 in Candida viesis CAES2113. At the same time, the superoxide dismutase gene recombination fragment prepared in Example 2 was taken as the host with the 2113pox4 strain, and the transformation of the recombinant strain in Reference Example 3 and the screening steps of the recombinant strain in Example 4 were overexpressed. The correct strain was named 2113pox4-sod. Then its fermentation performance was evaluated with reference to Example 5, and the fermentation time was 137h. The specific results are shown in Table 3.

table 3

菌株strain	CAES2113CAES2113	2113pox42113pox4	2113pox4-sod2113pox4-sod
二元酸产量(g/L)Dibasic acid yield (g/L)	102.35102.35	89.0189.01	99.4599.45

It can be known from Table 2 that the overexpression of superoxide dismutase through episomal vectors also contributes to the production of long-chain dibasic acids.

The patent found that the production of dibasic acid decreased after POX4 knockout, which is presumed to be due to the insufficient energy supply of cells due to POX4 knockout, which in turn affected the synthesis of dibasic acid. After overexpressing superoxide dismutase on the basis of the POX4 knockout strain, although the production of dibasic acid did not recover to the level of the control strain, it was higher than that of the 2113pox4 strain, which again showed that overexpression of superoxide dismutase also helped Produced in long-chain dibasic acids.

Claims

A genetically engineered bacterium, characterized in that it has enhanced superoxide dismutase activity,

Preferably, the superoxide dismutase comprises a nucleotide sequence shown in SEQ ID NO: 9 or an amino acid sequence encoded by a nucleotide sequence having at least about 95% identity with SEQ ID NO: 9,

Preferably, the genetically engineered bacterium is a genetically engineered bacterium of the following microorganisms: Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotroula ), Saccharomyces (Saccharomyces) or Yarrowia (Yarrowia), preferably Candida viswanathii (Candida viswanathii) or Candida tropicalis (Candida tropicalis), more preferably the preservation number is CCTCC NO: M 2020048 Vissia Trichosanthes or candida viesis with the preservation number of CCTCC NO: M 2021824,

Preferably, the genetically engineered bacterium overexpresses a superoxidative agent comprising a nucleotide sequence shown in SEQ ID NO: 9 or its degenerate sequence or a nucleotide sequence having at least about 95% identity with SEQ ID NO: 9. dismutase gene.
The genetically engineered bacterium according to claim 1, wherein said genetically engineered bacterium overexpresses a recombinant expression fragment comprising a superoxide dismutase gene;

Preferably, the recombinant expression fragment is obtained by amplifying the superoxide dismutase gene with the primer sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4,

Preferably, the recombinant expression fragment is integrated into the genome of the engineered bacterium through homologous recombination; more preferably, the integration site is a non-protein coding sequence position, such as int1 gene or its homologous gene.
The genetically engineered bacterium according to claim 1 or 2, wherein the peroxidase gene is introduced into the genetically engineered bacterium in a non-integrated manner;

Preferably, the non-integration method is: transforming the starting bacteria with a recombinant expression vector containing the superoxide dismutase gene; more preferably, the starting plasmid of the recombinant expression vector is pCIB2.
A method for preparing the genetically engineered bacterium according to any one of claims 1-3, characterized in that the method comprises: enhancing the activity of superoxide dismutase in the long-chain dibasic acid production strain,

Preferably, the superoxide dismutase comprises a nucleotide sequence shown in SEQ ID NO: 9 or an amino acid sequence encoded by a nucleotide sequence having at least about 95% identity with SEQ ID NO: 9.
The method of claim 4, characterized in that, the method comprises: overexpressing the gene encoding superoxide dismutase in the long-chain dibasic acid production strain,

Preferably, the long-chain dibasic acid producing strain is selected from the group consisting of Corynebacterium, Geotrichum candida, Candida, Pichia, Rhodotorula, Saccharomyces or Yarrowia, preferably Candida viscus or Pseudomonas tropicalis Trichosanthes, more preferably Candida viesis with a preservation number of CCTCC NO: M 2020048 or Candida viesis with a preservation number of CCTCC NO: M 2021824,

Preferably, the gene encoding superoxide dismutase comprises a nucleotide sequence shown in SEQ ID NO: 9 or its degenerate sequence or a nucleotide having at least about 95% identity with SEQ ID NO: 9 sequence.
A preparation method for long-chain dibasic acid, characterized in that, the preparation method is to ferment the genetically engineered bacterium as claimed in any one of claims 1-3 or obtain according to the method of claim 4 or 5 in a culture medium Genetically engineered bacteria, or ferment long-chain dibasic acid production strains in the medium while adding superoxide dismutase to obtain the long-chain dibasic acid,

Preferably, the long-chain dibasic acid producing strain is selected from the group consisting of Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotorula, Saccharomyces or Yarrowia, preferably Candida viscus or tropical Candida, more preferably the preservation number is CCTCC NO:M 2020048 Candida viesis or the preservation number is CCTCC NO:M 2021824 while adding superoxide dismutase;

Preferably, the superoxide dismutase comprises the nucleotide sequence shown in SEQ ID NO: 9 or an amino acid sequence encoded by at least about 95% of the nucleotide sequence of SEQ ID NO: 9, more preferably, composed of The nucleotide sequence shown in SEQ ID NO: 9 may have at least about 95% nucleotide sequence coding with SEQ ID NO: 9.
preparation method as claimed in claim 6, is characterized in that:

The long-chain dibasic acid is selected from one or more of C 9 -C 22 long-chain dibasic acids, preferably selected from one or more of C 9 -C 18 long-chain dibasic acids, More preferably selected from sebacic acid, undecanedioic acid, dodecanedioic acid, tridecanedioic acid, tetradecanedioic acid, pentadecanedioic acid and hexadecandioic acid one or more; and/or,

The long-chain dibasic acid is a linear long-chain dibasic acid.
Application of superoxide dismutase or a gene encoding superoxide dismutase in microbial fermentation to produce long-chain dibasic acids or in the preparation of genetically engineered bacteria for microbial fermentation to produce long-chain dibasic acids,

Preferably, the superoxide dismutase comprises the nucleotide sequence shown in SEQ ID NO: 9 or an amino acid sequence encoded by at least about 95% of the nucleotide sequence of SEQ ID NO: 9.
The use according to claim 8, wherein the nucleotide sequence of the gene encoding superoxide dismutase comprises SEQ ID NO: 9 or has at least about 95% identity with SEQ ID NO: 9 sequence;

And/or, the microorganism is Corynebacterium, Geotrichum candidum, Candida, Pichia, Rhodotorula, Saccharomyces or Yarrowia, preferably Candida viesis or Candida tropicalis, more It is preferably Candida viesis with a preservation number of CCTCC NO: M 2020048 or a Candida viesis of M 2021824 with a preservation number of CCTCC NO: M 2021824.
An expression element comprising a gene encoding superoxide dismutase, characterized in that the expression element is a recombinant expression vector obtained by constructing a gene encoding superoxide dismutase on a plasmid, or is a recombinant expression vector comprising a gene encoding superoxide dismutase A recombinant expression fragment of the gene of dismutase, wherein the nucleotide sequence of the gene encoding superoxide dismutase comprises SEQ ID NO: 9 or its degenerate sequence, or has at least about 95% identity with SEQ ID NO: 9 sequence of identity;

Preferably, the plasmid is pCIB2; and/or,

The recombinant expression fragment is obtained by amplifying the gene encoding superoxide dismutase with the primer sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4.
A recombinant DNA, characterized in that, said recombinant DNA comprises the nucleotide sequence shown in SEQ ID NO: 9 or its degenerate sequence.