KR102112286B1 - Gene related to acid resistance and methanotrophs comprising the same - Google Patents

Abstract

The present invention relates to a gene related to acid resistance and a methanotroph strain having increased resistance against lactic acid containing the same. A recombinant strain of the present invention is to increase resistance against lactic acid of a methanotroph strain using methane as the only carbon source, in which expression of an AYM39_21120 gene by making some bases of promoters of AYM39_21120 gene, that is a gene contributing to the resistance against lactic acid, deficient. In addition, the recombinant strain of the present invention exhibits a high growth rate in a medium containing a high concentration of lactic acid. Therefore, the recombinant strain of the present invention can be usefully used for production of lactic acid using methane.

Description

Gene-related genes and methane magnetizing bacteria containing them {GENE RELATED TO ACID RESISTANCE AND METHANOTROPHS COMPRISING THE SAME}

The present invention relates to an acid resistance-related gene and methane magnetizing bacteria having increased resistance to lactic acid containing the same.

Lactic acid is a type of organic acid that is widely used in industries such as cosmetics, chemicals, metals, textiles, dyeing, and pharmaceuticals, as well as being used as a food additive in general. Recently, due to rising oil prices, depletion of crude oil, and environmental pollution problems caused by plastic products, interest in environmentally friendly alternative polymer materials has increased, and lactic acid used as a raw material for polylactic acid (PLA), a kind of biodegradable plastic. Demand is increasing significantly.

In the past, lactic acid was mainly produced using sugars and yeast, and research on a method of producing lactic acid having high purity using these methods has been conducted. At this time, yeast uses sugar as a carbon source to be used for the production of lactic acid. Recently, there has been increasing interest in lactic acid production methods that can secure economic efficiency by using cheap carbon sources instead of sugars.

In this regard, methane is the main component of natural gas and biogas, and is a very rich and cheapest carbon source. Recently, research on a method for producing lactic acid using a methane magnetization strain that can use methane as the only carbon source and energy source has been actively conducted. However, the methane magnetization strain has a low resistance to lactic acid, and the methane magnetization strain produces lactic acid, and thus, as the concentration of lactic acid increases, the growth rate of the methane magnetization strain decreases. The methane magnetized strain has low resistance to lactic acid to such an extent that it hardly grows in a medium containing 0.5 g / L of lactic acid. Recently, a study result of producing lactate from methane using M. buryatense 5GB1S has been reported, showing a maximum concentration of 0.8 g / L and a maximum productivity of 0.008 g / L / h (CA Henard et al. ., Sci. Rep. , 6 (2185): 1-9, 2016). However, due to the slow growth rate of methane magnetization bacteria, it is showing limitations in increasing lactic acid production.

Therefore, in order to show a rapid growth rate even in a medium containing a high concentration of lactic acid, there is a need for continuous research on methane magnetization strains with improved resistance to lactic acid.

 C. A. Henard et al., Sci. Rep., 6 (2185): 1-9, 2016

Accordingly, the present inventors have developed a methane magnetization strain with improved resistance to lactic acid, and as a result of research to develop a methane magnetization strain with improved resistance to lactic acid, through adaptive evolution. In addition, by analyzing the genome of the methane magnetization strain, it was confirmed that the 456th and 457th bases (TT) of the promoters of the AYM39_21120 gene were deleted, and the AYM39_21120 gene whose expression was increased by the gene deficiency was affected by the acid resistance of the methane magnetization strain. The present invention was completed by confirming the contribution.

In order to solve the above problems, an aspect of the present invention provides a recombinant strain transformed such that the LysR family transcriptional regulator is overexpressed.

Another aspect of the present invention provides a recombinant strain having the ability to produce lactic acid in which the lactic acid dehydrogenase gene is introduced into the recombinant strain.

Another aspect of the present invention provides a method for producing lactic acid, comprising culturing the recombinant strain having lactic acid production capacity under conditions containing methane.

Another aspect of the present invention provides a promoter consisting of the nucleotide sequence of SEQ ID NO: 4.

Another aspect of the present invention provides an expression vector comprising the promoter and a base sequence encoding a target protein.

The recombinant strain of the present invention is to increase the resistance to lactic acid of a methane magnetization strain using methane as the sole carbon source, and increases the expression of the AYM39_21120 gene by deleting some of the promoters of the AYM39_21120 gene, a gene that contributes to the resistance of lactic acid. Ordered. In addition, the recombinant strain of the present invention showed a high growth rate in a medium containing a high concentration of lactic acid. Therefore, the recombinant strain of the present invention can be usefully used for the production of lactic acid using methane.

Figure 1 shows the growth rate when culturing the wild type DH-1 strain and DH-1 strain (JHM5110) with increased resistance to lactic acid through adaptive evolution in NMS medium or a medium containing 8.0 g / L lactic acid It is a drawing.
2 is a diagram showing a region in which mutation occurs in the genome of the JHM5110 strain.
3 is a diagram comparing the expression of the wild type DH-1 and AHM39_21110, AYM39_21115, AYM39_21120, AYM39_21125 and AYM39_21130 genes of the JHM5110 strain.
Figure 4 is a wild type DH-1 strain, AHM39_21120 gene introduced DH-1 strain (JHM5101), AYM39_21125 and AYM39_21130 gene introduced DH-1 strain (JHM5102) and AYM39_21120, AYM39_21125 and AYM39_21130 gene introduced DH-1 strain It is a diagram showing the growth rate when (JHM5103) was cultured in NMS medium or medium containing lactic acid at a concentration of 0.6 g / L, respectively.
Figure 5 shows the DH-1 strains (JHM5111) and AYM39_21120, AYM39_21125 and AYM39_21130 (JHM5112) strains lacking the JHM5110 strain, AYM39_21125 and AYM39_21130 genes, respectively. It is a view showing the growth rate when cultured in a medium containing a.
6 is a view showing a D-type lactic acid production pathway in methane magnetizing bacteria.
7 is a view showing the lactic acid production of the strain (JHM5120) in which the lactic acid dehydrogenase gene was introduced into the JHM5110 strain.

Hereinafter, the present invention will be described in detail.

One aspect of the present invention provides a recombinant strain transformed such that the LysR family transcriptional regulator is overexpressed.

The strain may be methanotrophs. The methane magnetization bacteria are Methylomonas sp., Methylovulum sp., Methylocaldum sp., Methylomicrobium sp. Or Methylococcus sp. It may be a genus strain. Preferably, the methane magnetization bacteria Methylomonas sp . DH-1 , Methylomonas koyamae, Methylomonas denitrificans, Methylomonas methanica, Methylovulum psychrotolerans, Methylocaldum marinum, Methylomicrobium alcaliphilum or Methylococcus capsulatus , but are not limited thereto.

The term "methanotrophs" used in the present invention is also referred to as methane oxidizing bacteria, and refers to prokaryotes that grow using methane as the only carbon source. Most methane magnetization bacteria use methane in the atmosphere as a carbon source, and usually convert methane to methanol and then use it for metabolism in vivo.

The term " Methylomonas sp. DH-1 strain" used in the present invention means a strain derived from sewage sludge and belonging to the genus Methylomonas sp., Which has not been previously reported. The DH-1 strain refers to a strain that has been deposited with the Korea Research Institute of Bioscience and Biotechnology Biological Resource Center on April 8, 2016, and has been assigned a deposit number KCTC13004BP. As of August 27, 2015, the strain was deposited at the Korea Research Institute of Bioscience and Biotechnology Biological Resource Center, and the strain given the accession number KCTC18400P was converted to the deposit under the Budapest Treaty.The strain of the accession number KCTC13004BP and the strain of the accession number KCTC18400P It is obvious that it is the same thing.

The recombinant strain may be an expression vector containing a nucleotide sequence encoding a LysR family transcriptional regulator.

The term "LysR family transcriptional regulator" used in the present invention is a protein encoded by the AYM39_21120 gene and refers to a LysR family transcriptional regulator. The LysR family transcriptional regulator may be a protein having an amino acid sequence represented by SEQ ID NO: 1. In addition, the nucleotide sequence encoding the LysR family transcriptional regulator may be a nucleotide sequence represented by SEQ ID NO: 2.

As used herein, the term "expression vector" means a recombinant construct capable of expressing a target protein in a host cell, and means a gene construct comprising essential regulatory elements operably linked to express the inserted gene. The expression vector includes expression control elements such as an initiation codon, a termination codon, a promoter, an operator, etc., the initiation codon and the termination codon are generally regarded as a part of a nucleotide sequence encoding a protein, and when a gene construct is administered, in an individual It must be functional and must be in frame with the coding sequence.

The term "operably linked (operably linked)" of the present invention refers to a state in which a nucleic acid sequence encoding a desired protein or RNA and a nucleic acid expression control sequence are functionally linked to perform a general function. . For example, a promoter and a nucleic acid sequence encoding a protein or RNA can be operably linked to affect the expression of the coding sequence. Operational linkage with an expression vector can be made using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage can use enzymes and the like generally known in the art.

The expression vector may be any one selected from the group consisting of plasmid vectors or cosmid vectors.

The plasmid vector may be a commercially developed pUC18 plasmid, pBAD plasmid, pIDTSAMRT-AMP plasmid, pJK001 plasmid, etc., but is not limited thereto.

The method of introducing the expression vector is a method using a liposome containing the expression vector, a method of introducing a recombinant expression vector using PEG, a direct injection method of the recombinant expression vector, a microparticle impact method, a gene gun, an electroporation method ( electroporation), a transformation method using a virus, a vacuum infiltration method, a floral meristem dipping method, and the like. Preferably, the method of introducing the expression vector may be an electroporation method.

The expression vector may express a gene through insertion into the genome of an episomal DNA form or strain, but may preferably be gene expression through insertion into a genome of a methane magnetization strain.

The expression vector may include a promoter consisting of the nucleotide sequence of SEQ ID NO: 4 upstream of the nucleotide sequence encoding the LysR family transcriptional regulator.

In addition, the recombinant strain may be introduced an expression vector containing a promoter consisting of the nucleotide sequence of SEQ ID NO: 4.

The recombinant strain may be a strain having increased acid resistance by introducing an expression vector comprising the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: 4.

The present inventors have researched to develop a methane magnetization strain with improved resistance to lactic acid, and selected methane magnetization strain with significantly improved resistance to lactic acid through adaptive evolution in a medium containing high concentration of lactic acid (FIG. 1). . Base sequence analysis of the genome of the methane magnetization strain confirmed that the 456th and 457th bases (TT) of the promoters of the AYM39_21120 gene represented by the nucleotide sequence of SEQ ID NO: 3 were deleted (FIG. 2). It was confirmed that the expression of the AYM39_21120 gene is increased by the deletion of the base (FIG. 3). In addition, it was confirmed that the AYM39_21120 gene contributes to the acid resistance of the methane magnetization strain (FIGS. 4 and 5). Therefore, the recombinant strain of the present invention has high resistance to lactic acid, and thus can be usefully used for the production of lactic acid using methane.

Another aspect of the present invention provides a recombinant strain having the ability to produce lactic acid in which the lactate dehydrogenase gene is introduced into the recombinant strain.

The recombinant strain is as described above.

The term "lactic acid dehydrogenase" used in the present invention generally refers to an enzyme that releases hydrogen from L-lactic acid or D-lactic acid to make pyruvic acid by using NAD +, and NADH is used to catalyze the corresponding final step, which is a reverse reaction. It is an enzyme that reduces pyruvate to produce L-lactic acid or D-lactic acid. That is, the lactic acid dehydrogenase of the present invention may be L-lactic acid dehydrogenase or D-lactic acid dehydrogenase, and specifically, it may be D-lactic acid dehydrogenase.

The lactic acid dehydrogenase gene has the same activity as wild type lactic acid dehydrogenase, as well as at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology. It may contain the gene of the enzyme. The lactic acid dehydrogenase gene can be identified through NCBI GenBank, etc., Leuconostoc mesentoroides subsp. It may be a gene encoding lactic acid dehydrogenase from mesenteroides ATCC 8293. Specifically, the lactic acid dehydrogenase gene may be a nucleotide sequence encoding the amino acid sequence of GenBank: ABJ62843.1. Preferably, the lactic acid dehydrogenase gene may be a nucleotide sequence of SEQ ID NO: 5.

At this time, the recombinant strain having the lactic acid-producing ability may be a strain in which the glgA (glycogen synthase) gene is deleted. Specifically, the recombinant strain having the lactic acid-producing ability is Leuconostoc mesentoroides subsp. At the gene location at the AYM39_03770 ( glgA ) gene location. It may be a strain introduced with a lactic acid dehydrogenase gene comprising the nucleotide sequence represented by SEQ ID NO: 5 derived from mesenteroides ATCC 8293.

The recombinant strain into which the lactic acid dehydrogenase gene has been introduced may be a strain capable of producing lactic acid by introducing the lactic acid dehydrogenase gene.

Another aspect of the present invention provides a method for producing lactic acid, comprising culturing the recombinant strain having the lactic acid production capacity under conditions containing methane.

 At this time, the recombinant strain having the lactic acid production capacity is as described above.

The method for culturing the recombinant strain having the lactic acid-producing ability is not particularly limited, but can be performed by inoculating the medium and incubating under atmospheric conditions including methane.

The concentration of methane in the atmosphere may be 0.01 to 50% (v / v), specifically, the concentration of methane may be 10 to 40% (v / v) or 20% (v / v).

The culture temperature is not particularly limited, but may be 20 ° C to 40 ° C. Preferably, it may be 25 ° C to 35 ° C. As a specific example of the culture temperature, it may be 30 ℃. The culture may be performed under stirring conditions. Specifically, the stirring conditions may be 100 rpm to 300 rpm, preferably 150 rpm to 250 rpm or 175 rpm. Incubation time can be cultured for 30 to 200 hours, specifically, for 60 to 140 hours. Specifically, it can be cultured for 120 hours.

In the present invention, the method of culturing the recombinant strain having the lactic acid-producing ability can be performed using a method well known in the art. Specifically, the culture is not particularly limited as long as it can produce lactic acid from the recombinant strain. In addition, the culture may be continuously cultured in a batch process or an injection batch or repeated fed batch process.

As the medium used for cultivation, NMS (nitrate mineral salts) medium known to be used for cultivation of methane magnetization bacteria may be used. Depending on the methanogenic bacteria, a medium in which the components contained in the medium or the content thereof is adjusted can be used (http://methanotroph.org/wiki/culturing-tips/). In particular, when salts such as NaCl and KCl are included in the medium, the DH-1 strain or its transformant can be proliferated or the productivity of lactic acid can be improved. At this time, the concentration of the salt contained in the medium may be 0.1% (w / w) to 3.0% (w / w), preferably 1.0% (w / w) to 2.0% (w / w) or 1.5% (w / w).

In addition, precursors suitable for the culture medium may be used. The above-mentioned raw materials may be added in a batchwise, fed-batch, or continuous manner in an appropriate manner to the culture in the culture process, but are not particularly limited thereto. The pH of the culture can be adjusted by using a basic compound such as sodium hydroxide, potassium hydroxide or ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner. In addition, anti-foaming agents such as fatty acid polyglycol esters can be used to suppress the formation of bubbles.

The step of recovering lactic acid may be performed by methods known in the art, such as dialysis, centrifugation, filtration, solvent extraction, chromatography, crystallization, and the like. For example, a method of recovering lactic acid may be used by centrifuging the culture of the transformant to remove the recombinant strain and applying the obtained supernatant to a solvent extraction method. In addition, any method that can recover the lactic acid by combining a known experimental method according to the characteristics of the lactic acid can be used without particular limitation.

Another aspect of the present invention provides a promoter consisting of the nucleotide sequence of SEQ ID NO: 4. Specifically, the promoter refers to a promoter derived from the Methylomonas sp. DH-1 strain and consisting of the nucleotide sequence of SEQ ID NO: 4.

The term "promoter" used in the present invention means a DNA sequencing to which transcription regulators can bind, and the promoter binds to an RNA polymerase via a transcription regulator, thereby transcribing genes located downstream thereof. Can induce

According to an embodiment of the present invention, by analyzing the genome derived from the strain DH-1 of the genus Methylmonas having increased resistance to lactic acid through adaptive evolution, a promoter of 522 bp having the property of increasing gene expression (sequence No. 4) was excavated. Furthermore, as a result of comparing the gene expression activity of the promoter with a conventional wild-type promoter, it was confirmed that it exhibits about 4 to 10 times better expression activity than a conventional wild-type promoter (SEQ ID NO: 3) (FIG. 3).

Another aspect of the present invention provides an expression vector comprising the promoter and a base sequence encoding a target protein. At this time, the expression vector is the same as described above.

As described above, since the novel promoter provided in the present invention can improve the expression level of a gene compared to a conventional promoter, when using an expression vector containing the promoter or a transformant introduced with the expression vector, The desired protein can be produced in high yield.

The term "target protein" used in the present invention means a protein expressed from a gene introduced into an expression vector in a form operably linked to the novel promoter. The target protein is not particularly limited as long as it can be expressed by the novel promoter provided by the present invention, but as a specific example, it may be a protein such as LysR family transcriptional regulator that contributes to acid resistance of the strain.

Hereinafter, preferred embodiments are provided to help understanding of the present invention. However, the following examples are only provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

Example 1. Selection of strains with increased resistance to lactic acid through adaptive evolution

In order to produce a strain capable of growing in a high concentration of lactic acid, a laboratory-scale adaptive evolution was performed. The genus Methyllomonas ( Metyhlomonas sp. ) The DH-1 strain was purchased from Kyunghee University.

In order to induce adaptive evolution of the DH-1 strain to lactic acid, the DH-1 strain was increased to a concentration of 8 g / L by increasing the concentration of lactic acid by 0.2 g / L, starting with a medium containing 0.5 g / L lactic acid Cultured with lactic acid added medium. Through a total of 35 successive passages, DH-1 strains capable of growing in a medium treated with 8 g / L lactic acid were selected. It was confirmed that the strains selected with the wild-type strain were grown in a medium to which lactic acid was added, thereby improving resistance to lactic acid (FIG. 1). The selected strain was named "JHM5110".

Example 2. Genomic analysis of JHM5110 strain

In order to find the gene contributing to the improvement of resistance to lactic acid of the JHM5110 strain selected in Example 1, whole genome sequencing of the JHM5110 strain was commissioned to Macrogen.

As a result, in the JHM5110 strain, mutations in which two base sequences (TT) were deleted were identified in the promoter between the AYM39_21115 gene and the AYM39_21120 gene (FIG. 2).

Example 3. Confirmation of gene expression of JHM5110 strain

As two bases (TT) were deleted from the promoter located between the AYM39_21115 gene and the AYM39_21120 gene in the JHM5110 strain, RT-qPCR (Real time qPCR) was performed to confirm that the expression of the gene was changed.

Specifically, for the wild-type strain and the JHY5110 strain, a strain was obtained at a time when the OD ₆₀₀ value was 1 to 1.5, and mRNA was extracted according to the manufacturer's manual using the RNeasy Mini Kit (Qiagen). The extracted mRNA was used for cDNA synthesis using random hexamer (cosmogene tech).

RT-qPCR was performed using primer pairs specific to the AYM39_21110, AYM39_21115, AYM39_21120, AYM39_21125 or AYM39_21130 genes for the synthesized same amount of cDNA. RT-qPCR was performed on a LightCycler ^® 480 Instrument II (Roche) instrument using a LightCycler ^® 480 SYBR ^® GreenI Master (Roche).

primer Base sequence Sequence number RT 21110 F TCCGCATTTATTGGTGGTGC SEQ ID NO: 6 RT 21110 R TGCTGGAAACTTCGCCTTCC SEQ ID NO: 7 RT 21115 F AGCAGCGCAAACAACAGTCG SEQ ID NO: 8 RT 21115 R CTAGTTCCTGGTGCGCCAAC SEQ ID NO: 9 RT 21120 F TATCTGGAACGCTGCCAGCA SEQ ID NO: 10 RT 21120 R TGACCGCCTTTCAGCACCAT SEQ ID NO: 11 RT 21125 F GGCTAAGCCTGAGCGTCAAC SEQ ID NO: 12 RT 21125 R GGGCCGTGTTGGTCAAGCTT SEQ ID NO: 13 RT 21130 F AATCCCAACGCCGTGCTGAT SEQ ID NO: 14 RT 21130 R ACAGAACGTTGTCCGCTGCG SEQ ID NO: 15

As a result, it was confirmed that the expression of the AYM39_21120 gene and the AYM39_21125 gene significantly increased in the JHM5110 strain (FIG. 3).

Example 4. Confirmation of increase in resistance to lactic acid of DH-1 strain according to AYM39_21120 gene expression increase

In order to confirm the effect of the AYM39_21120 and AYM39_21125 genes with increased expression in the JHM5110 strain on acid resistance, mutant strains capable of overexpressing the genes were prepared using a homologous recombination system.

Embodiments to produce the dielectric insert plasmid comprising the mutated gene, the two bases in the promoter of AYM39_21120 gene through Overlap PCR using the genomic DNA of JHM5110 strain as a template, deletion promoter identified in 2 (P _{△ tt)} And AYM39_21120, AYM39_21125 or AYM39_21130 genes, respectively, were obtained and cloned into pJK001 vector using SpeI and KpnI restriction enzymes. The vectors thus obtained were named pJK002, pJK003, and pJK004, respectively.

In addition, in order to delete the AYM39_21120 gene from the methane magnetization strain, upstream 1 kb and downstream 1 kb of the gene were obtained through PCR using the genomic DNA of the strain selected in Example 1 as a template, and then cloned into a pJK001 vector. . The vectors thus obtained were named pJK005 and pJK006, respectively.

The strains and plasmids used in this experiment are shown in Tables 2 and 3 below.

Strain name genotype source DH-1 KCTC18400P JHM5101 DH-1 containing P _ΔTT -21120 -T _rrnB - JHM5102 DH-1 containing P _ΔTT -21125,21130 -T _rrnB - JHM5103 DH-1 containing P _ΔTT -21120,21125,21130 -T _rrnB - JHM5110 Evolved strain from DH-1 - JHM5111 JHM5110 Δ21125,21130 :: KanR - JHM5112 JHM5110 Δ21120,21125,21130 :: KanR -

Plasmid Characteristic pJK001 Plasmid providing genomic integration site pJK002 Plasmid providing genomic integration site with P _ΔTT - 21120 -T _rrnB pJK003 _{Plasmid providing genomic integration site with P ΔTT} - 21125, 21130 -T rrnB pJK004 _{Plasmid providing genomic integration site with P ΔTT} - 21120, 21125,21130 -T rrnB pJK005 Plasmid containing 21125,21130 deletion cassette pJK006 Plasmid containing 21120, 21125,21130 deletion cassette

For transformation of the DH-1 strain, the plasmid vectors pJK002, pJK003, pJK004, pJK005 or pJK006 were transformed with DH-1 strain by electroporation using Micropulser ^TM Electroportor (Biorad). The DH-1 strain transformed with the pJK002 plasmid vector was named "JHM5101", the DH-1 strain transformed with the pJK003 plasmid vector was named "JHM5102", and the DH-1 strain transformed with the pJK004 plasmid vector. It was named "JHM5103". In addition, the DH-1 strain transformed with the pJK005 plasmid vector was named “JHM5111”, and the DH-1 strain transformed with the pJK006 plasmid vector was named “JHM5112”.

JHM5101, JHM5102, JHM5103, JHM5111 and JHM5112 strains transformed with DH-1 strain were NMS (0.488 g / L MgSO ₄ , 1 g / L KNO ₃ , 0.228 g / L CaCl ₂ -2H ₂ O, 3.8% Fe- EDTA, 0.1% Na ₂ MoO ₄ -2H ₂ O, Trace element solution) was cultured in a medium in which phosphoric acid solution, vitamin, and CuSO ₄ at a concentration of 10 μM were added.

At this time, the trace element solution is 500 mg / L FeSO ₄ -7H ₂ O, 400 mg / L ZnSO ₄ -7H ₂ O, 15.71 mg / L MnCl ₂ -4H ₂ O, 50 mg / L CoCl ₂ -6H ₂ O, 10 ㎎ / L Nicl ₂ -6H consists of _{2 O, 15 ㎎ / LH 3} BO 3, 250 ㎎ / L EDTA. In addition, the phosphoric acid solution is composed of 26 g / L KH ₂ PO ₄ , 32.83 g / L Na ₂ HPO ₄ , _and vitamins are 2.0 mg / L biotin, 2.0 mg / L folic acid, 5.0 mg / L Thiamine HCl, 5.0 It consists of ㎎ / L Ca pantothenate, 0.1 ㎎ / L Vitamin B12, 5.0 ㎎ / L Riboflavin, and 5.0 ㎎ / L Nicotinamide.

The strain culture was performed at 170 ° C. at a temperature of 30 ° C. using a shake incubator. As a culture condition, the initial inoculation cell concentration is OD _600. It was fixed to 0.1, proceeded to 12.5 ml medium in a 125 ml shake flask, and supplied with 20% of methane using a gas syringe (Agilent 50 ml gas tight syringe 5190-1547).

 As a result of confirming the growth of JHM5101, JHM5102, and JHM5103 strains in the medium treated with lactic acid at a concentration of 0.6 g / L in addition to the wild-type DH-1 strain, it was confirmed that the resistance to lactic acid of JHM5101 and JHM5103 strains overexpressing AYM39_21120 was increased. There was (Fig. 4). In addition, as a result of confirming the growth of the JHM5112 strain in which the AYM39_21120 gene of the DH-1 strain was deleted, it was confirmed that lactic acid at a concentration of 8 g / L did not grow in the treated medium (FIG. 5).

Example 5. Methylomonas  sp. Identification of methane magnetizing bacteria with homology of DH-1 strain and AYM39_21120 gene

Methylomonas sp . In the DH-1 strain, since the AYM39_21120 gene is an important gene that contributes to resistance to lactic acid, the degree of genetic preservation of the AYM39_21120 gene was confirmed using the BLAST (Basic Local Alignment Search Tool) technique. As a result, as shown in Table 4, it was confirmed that it was preserved in a total of 7 types of methane magnetization bacteria.

Strain name E-value Methylomonas koyamae LM6 0 Methylomonas denitrificans FJG1 0 Methylomonas methanica MC09 0 Methylovulum psychrotolerans HV10_M2 2.00E ^-113 Methylocaldum marinum S8 1.00E ^-60 Methylomicrobium alcaliphilum 20Z 9.00E ^-49 Methylococcus capsulatus bath 4.00E ^-34

Example 6. Confirmation of lactic acid production through introduction of lactic acid dehydrogenase

Leuconostoc mesentoroides subsp. In the AYM39_03770 ( glgA ) gene location of the JHM5110 strain with improved resistance to lactic acid selected in Example 1. A methane magnetization strain (JHM5120) capable of producing D-type lactic acid was prepared by introducing a lactic acid dehydrogenase gene containing the nucleotide sequence represented by SEQ ID NO: 5 from mesenteroides ATCC 8293. The strains and plasmids used in this experiment are shown in Tables 5 and 6 below.

Strain name genotype source DH-1 KCTC18400P JHM5110 Evolved strain from DH-1 - JHM5120 JHM5110 △ glgA :: Lm.ldhA- T _rrnB -KanR -

Plasmid Characteristic pJK010 Plasmid providing Lm.ldhA with glgA deletion site

In order to confirm the lactic acid production capacity of the JHM5120 strain, the initial inoculation was such that the OD ₆₀₀ value was 0.2, and 20% (v / v) of methane gas was added to NMS medium treated with kanamycin at a concentration of 10 µg / ml. Incubated for 48 hours while feeding. Thereafter, the concentration of lactic acid in the medium was measured.

As a result, it was confirmed that lactic acid at a concentration of 0.19 g / L was produced.

<110> Seoul National University R & DB Foundation          University-Industry Cooperation Group of Kyung Hee University <120> GENE RELATED TO ACID RESISTANCE AND METHANOTROPHS COMPRISING THE          SAME <130> FPD / 201809-0035 <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 300 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of LysR family transcriptional regulator          (Methylomonas sp.DH-1) <400> 1 Met Asp Lys Leu Thr Ser Met Asn Val Phe Val Arg Val Ala Lys Ala   1 5 10 15 Gly Ser Phe Ala Gly Ala Ala Lys Asp Leu Asp Ile Ser Arg Ala Met              20 25 30 Ala Thr Lys His Ile Met Gln Leu Glu Ser Glu Leu Asn Thr Arg Leu          35 40 45 Phe Asn Arg Thr Thr Arg Ser Leu Ser Leu Thr Glu Ala Gly Glu Ala      50 55 60 Tyr Leu Glu Arg Cys Gln Gln Val Leu Leu Asp Val Ala Glu Met Glu  65 70 75 80 Ser Ala Ile Thr His Leu Gln Thr Glu Pro Arg Gly Thr Leu Lys Ile                  85 90 95 Leu Ala Pro Pro Val Ile Gly Ala Ser His Ile Ser Pro Gly Leu Thr             100 105 110 Glu Tyr Leu Lys Asn Tyr Pro Asp Leu Ser Val Glu Met Val Leu Lys         115 120 125 Gly Gly Gln Val Asp Leu Ile Asp Glu Gly Val Asp Leu Ala Ile Tyr     130 135 140 Leu Gly Gln Leu Asn Asp Thr Ser Leu Val Ala Arg Lys Leu Ala Ser 145 150 155 160 Ser Ser Leu Val Val Cys Ala Ser Pro Glu Tyr Leu Lys Asn His Gly                 165 170 175 Ile Pro Gln Asp Pro Glu Asp Leu Glu Asp His Ser Cys Leu Ile Asn             180 185 190 Trp Ala Ile Pro Pro Arg Asn Lys Trp Arg Phe Lys Gly Ile Leu Gly         195 200 205 Glu Arg Thr Val Thr Val Thr Gly Arg Met Gln Ala Asn Met Ala Asp     210 215 220 Pro Ile Arg Asn Ala Ala Val Asn Gly Leu Gly Leu Ile Met Leu Pro 225 230 235 240 Arg Tyr Ile Val Gly Arg Asp Ile Glu Gln Gly Arg Leu Gln Val Val                 245 250 255 Met Glu Gln Tyr Gly Ile Ala Pro Leu Glu Ile Tyr Ala Val Tyr Pro             260 265 270 His Arg Lys Tyr Leu Ser Ala Lys Val Arg Ser Phe Leu Glu Phe Ile         275 280 285 Gln Ala Trp Leu Pro His Arg Ile Gly Met Asn Pro     290 295 300 <210> 2 <211> 903 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of LysR family transcriptional regulator          (Methylomonas sp.DH-1) <400> 2 atggacaaac taaccagcat gaacgttttt gtccgcgtcg ccaaggccgg cagcttcgcc 60 ggggccgcca aggatttgga tatctctcga gctatggcca ccaagcacat catgcaattg 120 gagagcgagc tgaatacccg cctgttcaac cgtacgaccc gcagcttaag cctgactgaa 180 gccggcgagg cttatctgga acgctgccag caggtgttgc tggacgtcgc ggaaatggaa 240 tcggccatca cccatctgca aaccgaaccg cgcggcactt taaaaattct ggcaccaccg 300 gtaatcggcg ccagccacat ctcgcccggc ctgaccgagt atctgaaaaa ctacccggat 360 ctttcggtgg agatggtgct gaaaggcggt caggtggatt tgatcgacga aggcgtcgac 420 ttagcgattt atctcggcca gctcaacgac accagcctgg tcgcccgcaa actggccagc 480 tcctcgctgg tagtctgcgc gtcgccggaa tacctgaaaa accacggcat cccgcaagac 540 ccggaagact tggaagacca tagctgcctg attaactggg ccatcccgcc gcgcaacaaa 600 tggcgcttca aaggcatcct cggcgaacgc accgtcactg tgaccggcag gatgcaagcc 660 aacatggccg acccgatccg caatgcggcc gttaacggcc taggcttgat tatgttgccg 720 cgctacatcg tcggccgtga catcgaacaa ggccgtctgc aagtggtgat ggaacaatac 780 ggcatcgccc cgttggagat ttacgcggtt tacccacacc gcaagtatct ttccgctaaa 840 gtccgttcct ttctggaatt tatccaagcc tggctaccgc accggatcgg catgaaccca 900 tga 903 <210> 3 <211> 524 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of promoter (Methylomonas sp. DH-1) <400> 3 gactattaat ctcgatttcg aacgggctga atcatagcat gacgcccaaa ctgccggaaa 60 aactgcgggc aaaaaaaacc tcccaatgct cgcgcagagg gaggcaagaa aaccagcgga 120 gtgcttggaa ggaggttacc gctcgttaat tacaacacca ggaggtagtt acaaattctg 180 gggatcagcg gctcgcttgg gtattgagcg agatattgct gaacattgag gtcgctgcaa 240 acaggacagt ggaaattacg aacaggccgg aaagaaaatt caaaatgccg gcaataaaca 300 aagtaccgac cagtacatct tttttaaatt cattcattgt gctcaaatcc tctgtttaat 360 cttgcatttg gcaagatttt ctgtgctttc tcgttaagtt gccgcacact ataccggaga 420 taaaaaagtt tacaattagg cgtttattaa ataaattgta tgaaattaag aaacaataaa 480 aatgtcaacg ttttttagca acttccaacg ccaccggagg caga 524 <210> 4 <211> 522 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of mutated promoter (Methylomonas sp.DH-1) <400> 4 gactattaat ctcgatttcg aacgggctga atcatagcat gacgcccaaa ctgccggaaa 60 aactgcgggc aaaaaaaacc tcccaatgct cgcgcagagg gaggcaagaa aaccagcgga 120 gtgcttggaa ggaggttacc gctcgttaat tacaacacca ggaggtagtt acaaattctg 180 gggatcagcg gctcgcttgg gtattgagcg agatattgct gaacattgag gtcgctgcaa 240 acaggacagt ggaaattacg aacaggccgg aaagaaaatt caaaatgccg gcaataaaca 300 aagtaccgac cagtacatct tttttaaatt cattcattgt gctcaaatcc tctgtttaat 360 cttgcatttg gcaagatttt ctgtgctttc tcgttaagtt gccgcacact ataccggaga 420 taaaaaagtt tacaattagg cgtttattaa ataaagtatg aaattaagaa acaataaaaa 480 tgtcaacgtt ttttagcaac ttccaacgcc accggaggca ga 522 <210> 5 <211> 996 <212> DNA <213> Leuconostoc mesenteroides <400> 5 atgaagattt ttgcttacgg cattcgtgat gatgaaaagc catcacttga agaatggaaa 60 gcggctaacc cagagattga agtggactac acacaagaat tattgacacc tgaaacagct 120 aagttggctg agggatcaga ttcagctgtt gtttatcaac aattggacta tacacgtgaa 180 acattgacag ctttagctaa cgttggtgtt actaacttgt cattgcgtaa cgttggtaca 240 gataacattg attttgatgc agcacgtgaa tttaacttta acatttcaaa tgttcctgtt 300 tattcaccaa atgctattgc agaacactca atgattcaat tatctcgttt gctacgtcgc 360 acgaaagcat tggatgccaa aattgctaag cacgacttgc gttgggcacc aacaattgga 420 cgtgaaatgc gtatgcaaac agttggtgtt attggtacag gtcatattgg ccgtgttgct 480 attaacattt tgaaaggctt tggggccaag gttattgctt atgacaagta cccaaatgct 540 gaattacaag cagaaggttt gtacgttgac acattagacg aattatatgc acaagctgat 600 gcaatttcat tgtatgttcc tggtgtacct gaaaaccatc atctaatcaa tgcagatgct 660 attgctaaga tgaaggatgg tgtggttatc atgaacgctg cgcgtggtaa tttgatggac 720 attgacgcta ttattgatgg tttgaattct ggtaagattt cagacttcgg tatggacgtt 780 tatgaaaatg aagttggctt gttcaatgaa gattggtctg gtaaagaatt cccagatgct 840 aagattgctg acttgattgc acgcgaaaat gtattggtta cgccacacac ggctttctat 900 acaactaaag ctgttctaga aatggttcac caatcatttg atgcagcagt tgctttcgcc 960 aagggtgaga agccagctat tgctgttgaa tattaa 996 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for RT 21110 <400> 6 tccgcattta ttggtggtgc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for RT 21110 <400> 7 tgctggaaac ttcgccttcc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for RT 21115 <400> 8 agcagcgcaa acaacagtcg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for RT 21115 <400> 9 ctagttcctg gtgcgccaac 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for RT 21120 <400> 10 tatctggaac gctgccagca 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for RT 21120 <400> 11 tgaccgcctt tcagcaccat 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for RT 21125 <400> 12 ggctaagcct gagcgtcaac 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for RT 21125 <400> 13 gggccgtgtt ggtcaagctt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for RT 21130 <400> 14 aatcccaacg ccgtgctgat 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for RT 21130 <400> 15 acagaacgtt gtccgctgcg 20

Claims (15)

As a recombinant strain transformed to overexpress the LysR family transcriptional regulator,
The LysR family transcriptional regulator is a protein consisting of the amino acid represented by SEQ ID NO: 1,
The strain is a methanotroph (methanotrophs), a recombinant strain. delete According to claim 1,
The methane magnetization bacteria are Methylomonas sp., Methylovulum sp., Methylocaldum sp., Methylomicrobium sp. Or Methylococcus sp. Recombinant strains that are genus strains. According to claim 1,
The methane magnetization bacteria Methylomonas sp. DH-1 , Methylomonas koyamae, Methylomonas denitrificans, Methylomonas methanica, Methylovulum psychrotolerans, Methylocaldum marinum, Methylomicrobium alcaliphilum or Methylococcus capsulatus . According to claim 1,
The recombinant strain is a recombinant strain into which an expression vector comprising a nucleotide sequence encoding a LysR family transcriptional regulator is introduced. The method of claim 5,
The nucleotide sequence encoding the LysR family transcriptional regulator is a nucleotide sequence represented by SEQ ID NO: 2, a recombinant strain. The method of claim 5,
The expression vector is a recombinant strain comprising a promoter consisting of the nucleotide sequence of SEQ ID NO: 4 upstream of the nucleotide sequence encoding the LysR family transcriptional regulator. According to claim 1,
The recombinant strain is to increase the acid resistance, recombinant strain. A recombinant strain having the ability to produce lactic acid, wherein the lactic acid dehydrogenase gene is introduced into the recombinant strain of claim 1. The method of claim 9,
The lactic acid dehydrogenase gene is a nucleotide sequence of SEQ ID NO: 5, a recombinant strain having lactic acid production capacity. The method of claim 9,
The recombinant strain is capable of producing lactic acid, a recombinant strain having the ability to produce lactic acid. A method for producing lactic acid, comprising culturing a recombinant strain having the ability to produce lactic acid according to claim 9 under conditions containing methane. A promoter consisting of the nucleotide sequence of SEQ ID NO: 4. An expression vector comprising the nucleotide sequence encoding the promoter of claim 13 and a target protein. The method of claim 14,
The target protein is a LysR family transcriptional regulator, an expression vector.

Images