WO2023008862A1 - LacI 계열 DNA 결합 전사 조절자의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법 - Google Patents

LacI 계열 DNA 결합 전사 조절자의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법 Download PDF

Info

Publication number
WO2023008862A1
WO2023008862A1 PCT/KR2022/010905 KR2022010905W WO2023008862A1 WO 2023008862 A1 WO2023008862 A1 WO 2023008862A1 KR 2022010905 W KR2022010905 W KR 2022010905W WO 2023008862 A1 WO2023008862 A1 WO 2023008862A1
Authority
WO
WIPO (PCT)
Prior art keywords
microorganism
polypeptide
activity
glutamic acid
transcriptional regulator
Prior art date
Application number
PCT/KR2022/010905
Other languages
English (en)
French (fr)
Inventor
권나라
이아름
송규현
이진남
봉현주
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to EP22849838.2A priority Critical patent/EP4379056A1/en
Priority to CA3224713A priority patent/CA3224713A1/en
Priority to AU2022319462A priority patent/AU2022319462A1/en
Priority to MX2024001279A priority patent/MX2024001279A/es
Priority to JP2024504255A priority patent/JP2024526994A/ja
Priority to CN202280052622.1A priority patent/CN117730152A/zh
Publication of WO2023008862A1 publication Critical patent/WO2023008862A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/14—Glutamic acid; Glutamine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present application relates to a microorganism in which the activity of a LacI-based DNA-binding transcriptional regulator is attenuated and a method for producing L-glutamic acid using the same.
  • Patent Document 1 US Patent Publication No. 2011-0027840
  • One object of the present application is to provide a microorganism of the genus Corynebacterium sp. in which the activity of the LacI family DNA-binding transcriptional regulator is attenuated and the ability to produce L-glutamic acid is improved. .
  • Another object of the present application is to provide a method for producing L-glutamic acid, comprising culturing the microorganism of the genus Corynebacterium in a medium.
  • One aspect of the present application provides a Corynebacterium sp. microorganism (or strain, recombinant cell) in which the activity of the LacI family DNA-binding transcriptional regulator is attenuated.
  • the LacI family DNA binding transcriptional regulator protein may be a protein (eg, LacI family transcriptional regulator) having LacI family transcriptional regulator activity, for example, Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC13869 strain, Corynebacterium glutamicum ATCC13032 strain, or Corynebacterium glutamicum ATCC14067 strain, but is not limited thereto.
  • the LacI series DNA binding transcription regulator protein is derived from the Corynebacterium ATCC13869 strain (the sequence can be obtained from NCBI's GenBank, a known database, for example, GenBank Accession No. WP_060564415.1 can be) can be.
  • the LacI family DNA binding transcription regulator protein derived from Corynebacterium glutamicum has, comprises, consists of, or consists of the amino acid sequence of SEQ ID NO: 3, or consists essentially of the amino acid sequence It can essentially consist of.
  • the protein may be composed of a polypeptide described in the amino acid sequence of SEQ ID NO: 3.
  • the LacI family DNA binding transcription regulator protein may be a polypeptide having LacI family DNA binding transcription regulator activity encoded by a LacI family DNA binding transcription regulator gene, but is not limited thereto.
  • the LacI series DNA binding transcriptional regulator gene may be derived from the Corynebacterium glutamicum ATCC13869 strain, specifically the nucleic acid sequence of SEQ ID NO: 4 (GenBank Accession No. Sequence ID: CP016335.1 It may include a sequence from 1,421,016th to 1,422,125th in the nucleic acid sequence, for example, the BBD29_06680 gene).
  • the LacI family DNA binding transcriptional regulator protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, It may contain or consist of an amino acid sequence having 99%, 99.5%, 99.7% or 99.9% or more homology or identity.
  • an amino acid sequence having such homology or identity and exhibiting an efficacy corresponding to that of the LacI family DNA-binding transcriptional regulator protein a variant having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be used. It can be included in the family DNA binding transcriptional regulatory proteins. For example, sequence additions or deletions, naturally occurring mutations, silent mutations or conservations to the amino acid sequence N-terminus, C-terminus and/or within that do not alter the function of the variants of the present application. This is the case with redundant substitution.
  • the "conservative substitution” refers to the substitution of one amino acid with another amino acid having similar structural and/or chemical properties. Such amino acid substitutions can generally occur based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • a polynucleotide or polypeptide “has, includes, consists of, or consists essentially of a specific nucleic acid sequence (nucleotide sequence) or amino acid sequence” means that the polynucleotide It may mean that the nucleotide or polypeptide necessarily includes the specific nucleic acid sequence (base sequence) or amino acid sequence, and the specific function within the scope of maintaining the original function and / or desired function of the polynucleotide or polypeptide It can be interpreted as including (or not excluding) “substantially equivalent sequences” in which mutations (deletions, substitutions, modifications, and/or additions) have been made to nucleic acid sequences (base sequences) or amino acid sequences. .
  • a polynucleotide or polypeptide “has, comprises, consists of, or consists essentially of a specific nucleic acid sequence (nucleotide sequence) or amino acid sequence” means that the polynucleotide or polypeptide (i) essentially comprises the specific nucleic acid sequence (base sequence) or amino acid sequence, or (ii) is 70% or more, 80% or more, 85% or more, 90% or more different from the specific nucleic acid sequence (base sequence) or amino acid sequence 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99% or more, 99.5% or more, or 99.9% or more Consisting of or essentially including a nucleic acid sequence or amino acid sequence having homology or identity, it may mean maintaining an original function and/or a desired function.
  • the desired function may mean a function that increases (enhances) or imparts
  • 'homology' or 'identity' means the degree of similarity between two given amino acid sequences or base sequences and can be expressed as a percentage.
  • the terms homology and identity are often used interchangeably.
  • Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, along with default gap penalties established by the program used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of the sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with polynucleotides containing common codons or codons considering codon degeneracy in polynucleotides.
  • GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or 10 gap opening penalty, 0.5 gap extension penalty); and (3) no penalty for end gaps.
  • microorganism or strain
  • microorganism includes both wild-type microorganisms and naturally or artificially genetically modified microorganisms, and is specific due to causes such as insertion of foreign genes or weakening of the activity of endogenous genes.
  • a microorganism whose mechanism is weakened or enhanced, it may be a microorganism containing genetic modification for the production of a desired polypeptide, protein or product.
  • the term "attenuation" of a polypeptide is a concept that includes both decreased activity or no activity compared to intrinsic activity.
  • the attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.
  • the attenuation is caused by mutation of the polynucleotide encoding the polypeptide (or protein, for example, LacI family DNA-binding transcriptional regulator protein), so that the activity of the polypeptide itself is reduced compared to the activity of the polypeptide originally possessed by the microorganism, or
  • the overall polypeptide activity level and/or concentration (expression level) in the cell is lower than that of the native strain due to inhibition of expression of the gene of the polynucleotide encoding it or inhibition of translation into polypeptide .
  • the expression of the polynucleotide is not achieved at all, and / or when the activity of the polypeptide is absent even when the polynucleotide is expressed, it may also be included.
  • the "intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type or unmodified microorganism before transformation, when the character is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activation before transformation”. "Inactivation, depletion, reduction, downregulation, degradation, attenuation” of the activity of a polypeptide compared to its intrinsic activity means that it is lower than the activity of a specific polypeptide originally possessed by the parent strain or non-transformed microorganism before transformation. do.
  • Attenuation of the activity of such a polypeptide may be performed by any method known in the art, but is not limited thereto, and is not limited thereto. It can be achieved by application of methods (e.g. Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 etc).
  • polypeptide or protein, for example, a LacI family DNA-binding transcriptional regulator protein; hereinafter referred to as a polypeptide
  • modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or attenuated e.g., the nucleic acid sequence of the polypeptide gene to encode a modified polypeptide such that the activity of the polypeptide is eliminated or attenuated) deletion/substitution/addition of one or more nucleotides on the phase;
  • an antisense oligonucleotide eg, antisense RNA
  • introduction of an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide complementary to the transcript of the gene encoding the polypeptide
  • It may be a combination of two or more selected from 1) to 8), but is not particularly limited thereto.
  • the deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement of some nucleotides with a deleted polynucleotide, or replacement with a marker gene. .
  • modification of the expression control region is a deletion, insertion, non-conservative or conservative substitution, or a combination thereof, resulting in mutations in the expression control region (or expression control sequence), or weaker It may be a replacement with an active sequence.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling termination of transcription and translation.
  • 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide encodes another initiation codon with a lower polypeptide expression rate than the endogenous initiation codon, for example. It may be substituted with a nucleotide sequence that is, but is not limited thereto.
  • modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may be a deletion, insertion, non-conservative or modification of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide so as to weaken the activity of the polypeptide.
  • Conservative substitutions or combinations thereof may cause mutations in the sequence, or replacement with amino acid sequences or polynucleotide sequences improved to have weaker activity or amino acid sequences or polynucleotide sequences improved to have no activity, but are not limited thereto. no.
  • expression of a gene may be inhibited or weakened by introducing a mutation in a polynucleotide sequence to form a stop codon, but is not limited thereto.
  • the "stop codon” is a codon that serves as a signal indicating that the protein synthesis process is over without specifying an amino acid among codons on mRNA.
  • three types of UAA, UAG, and UGA can be used as stop codons. .
  • the microorganism according to one embodiment may be one in which a mutation in the sequence is introduced into the open reading frame (ORF) of the gene of endogenous SEQ ID NO: 4 and replaced (substituted) with a stop codon formed, for example, a LacI series DNA binding transcriptional regulator.
  • the 310th amino acid of the protein eg, glutamine, Gln, Q
  • glutamine which is the 310th amino acid in the nucleic acid sequence of SEQ ID NO: 4
  • the polynucleotide encoding glutamine which is the 310th amino acid in the nucleic acid sequence of SEQ ID NO: 4, is “CAG”, and “CAG” is replaced with “TAA”, “TAG”, or “TGA” to replace it with a stop codon.
  • nucleic acid sequence mutated to generate the stop codon may be the nucleic acid sequence of SEQ ID NO: 2 (the 928th C of the wild-type polynucleotide of SEQ ID NO: 4 is substituted with T; C928T).
  • the term "enhancement" of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity.
  • the enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, upregulation, overexpression, and increase may include those that exhibit an activity that was not originally possessed, or those that exhibit enhanced activity compared to intrinsic activity or activity before modification.
  • intrinsic activity refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation when the character is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activation before transformation”.
  • Enhancement, “upregulation”, “overexpression” or “increase” of the activity of a polypeptide compared to its intrinsic activity means the activity and/or concentration of a specific polypeptide originally possessed by the parent strain or non-transformed microorganism before transformation It means improved compared to (expression amount).
  • the enhancement can be achieved by introducing an exogenous polypeptide or enhancing the activity and/or concentration (expression level) of an endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from an increase in the activity level, expression level, or amount of a product released from the corresponding polypeptide.
  • the enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before transformation. Specifically, it may be using genetic engineering and / or protein engineering, which is well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance activity of the polypeptide eg, modification of the polynucleotide sequence of the polypeptide gene to encode a modified polypeptide such that activity of the polypeptide is enhanced;
  • It may be a combination of two or more selected from 1) to 8), but is not particularly limited thereto.
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is due to the introduction of a vector into the host cell that can replicate and function independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. may be achieved by Alternatively, it may be achieved by introducing 1 copy or 2 copies or more of the polynucleotide encoding the polypeptide into the chromosome of the host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome of the host cell into the host cell, but is not limited thereto.
  • the expression control region may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating termination of transcription and translation.
  • the original promoter may be replaced with a strong promoter, but is not limited thereto.
  • Examples of known strong promoters include the CJ1 to CJ7 promoter (US Patent US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but are not limited thereto.
  • Base sequence modification encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another initiation codon with a higher polypeptide expression rate than the endogenous initiation codon. It may be substituted with a sequence, but is not limited thereto.
  • Modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or preservation of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide. It may be the occurrence of a mutation in the sequence by an enemy substitution or a combination thereof, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto. no.
  • the replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used at this time may additionally include a selection marker to check whether the chromosome is inserted or not.
  • the codon optimization of the polynucleotide encoding the polypeptide is codon optimization to increase the transcription or translation of the endogenous polynucleotide in the host cell, or the optimization of the transcription or translation of the foreign polynucleotide in the host cell. It may be that its codons are optimized so that
  • Analyzing the tertiary structure of the polypeptide to select and modify or chemically modify the exposed site for example, by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored. Depending on the degree, a template protein candidate may be determined, and based on this, a structure may be confirmed, and an exposed portion to be modified or chemically modified may be selected and modified or modified.
  • the enhancement of such a polypeptide activity is an increase in the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or unmodified microbial strain, or the amount of the product produced from the polypeptide Of may be increased, but is not limited thereto.
  • Modification of some or all of the polynucleotides in the microorganism of the present application is (a) homologous recombination or genetic scissors (engineered nuclease, e.g., CRISPR) using a vector for chromosomal insertion into the microorganism -Cas9) and/or (b) light and/or chemical treatment such as ultraviolet light and radiation, but is not limited thereto.
  • a method of modifying part or all of the gene may include a method using DNA recombination technology.
  • a nucleotide sequence or a vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby deleting a part or all of the gene.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • Attenuation of the polypeptide may be caused by a recombinant method.
  • the recombination method may include homologous recombination.
  • homologous recombination method when a vector containing a partial sequence of a gene encoding a polypeptide is transformed into the microorganism and cultured in the presence of a selectable marker product, a partial sequence of the gene and an endogenous gene in the microorganism undergo homologous recombination can cause
  • microorganisms of the present application include microorganisms in which LacI family DNA-binding transcriptional regulator proteins or polynucleotides encoding them are inactivated or attenuated; Alternatively, it may be a microorganism (eg, a recombinant microorganism) genetically modified through a vector to inactivate or attenuate the LacI family DNA binding transcription regulator protein or the polynucleotide encoding the same, but is not limited thereto.
  • a microorganism eg, a recombinant microorganism
  • the microorganism (or strain, recombinant cell) of the present application may be a microorganism having L-glutamic acid-producing ability or having improved L-glutamic acid-producing ability (or production).
  • the activity of the LacI family DNA-binding transcriptional regulator protein is attenuated and/or the L-glutamic acid-producing ability is imparted or improved to a microorganism naturally having L-glutamic acid-producing ability or a parent strain having no L-glutamic acid-producing ability. It may be a microorganism, but is not limited thereto.
  • the fact that the microorganism (or strain, recombinant cell) has improved L-glutamic acid production capacity (or production capacity) or L-glutamic acid production capacity means that the microorganism (or strain, recombinant cell) is an unmodified microorganism, a cell before recombination, a parent L-glutamic acid-producing ability is improved compared to the strain and/or wild-type strain, or L-glutamic-acid-producing ability is endowed, unlike unmodified microorganisms without L-glutamic acid-producing ability, cells before recombination, parent strain, and/or wild-type strain. can
  • a microorganism in which the activity of a LacI-based DNA-binding transcriptional regulator protein is attenuated may have an improved (increased) ability to produce L-glutamic acid compared to a non-modified microorganism of the same species.
  • non-modified microorganism does not exclude strains containing mutations that may occur naturally in microorganisms, and is either a wild-type strain or a wild-type strain itself, or a change in character due to genetic mutation caused by natural or artificial factors. It may mean a strain before becoming.
  • the unmodified microorganism is a strain in which the activity of the LacI family DNA-binding transcriptional regulator protein is not attenuated or before it is attenuated (or a mutation that induces attenuation of the activity of the LacI family DNA-binding transcriptional regulator protein is present). strains not introduced or before introduction).
  • the "unmodified microorganism” may be used interchangeably with "strain before transformation", “microorganism before transformation”, “non-transformation strain”, “non-transformation strain”, “non-transformation microorganism” or “reference microorganism”. It is as described above that the activity of the LacI family DNA-binding transcriptional regulator protein is attenuated.
  • the non-modified microorganism which is a target strain for comparing the increase in the L-glutamic acid production ability, is Corynebacterium glutamicum ATCC13032 strain, Corynebacterium glutamicum ATCC13869 strain, Corynebacterium glutamicum Corynebacterium glutamicum BL2 strain (KFCC11074 , Korean Patent Registration No. 10-0292299), but is not limited thereto.
  • the microorganism may additionally contain mutations that increase L-glutamic acid production, and the location of the mutation and/or the type of gene and/or protein to be mutated may indicate L-glutamic acid production. It can be included without limitation as long as it is increased.
  • the recombinant cell may be used without limitation as long as it is a cell capable of transformation.
  • the microorganism (or strain, recombinant cell) having improved (or increased) productivity (or production) has an L-glutamic acid producing ability of about 1% or more, about 2.5% or more, compared to the parent strain or non-modified microorganism before the mutation.
  • the microorganism (or strain, recombinant cell) having increased production capacity (or production capacity) has an L-glutamic acid production capacity (or production capacity) of about 1.1 times or more, compared to the parent strain or unmodified microorganism before the mutation, about 1.1 times or more, about 1.12x or more, about 1.13x or more, 1.15x or more, 1.16x or more, 1.17x or more, 1.18x or more, 1.19x or more, about 1.2x or more, about 1.21x or more, about 1.22x or more, 1.25x or more, or about 1.3 times or more (the upper limit is not particularly limited, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less) may be increased, in one example about 1.172 times or more, It may be increased by about 1.214 times or more, about 1.216 times or more.
  • the recombinant strain having increased production capacity has an L-glutamic acid production capacity of about 17.2%, about 21.4%, or about 21.6% (or about 1.17 fold, about 1.21 fold, or about 1.22 fold), but is not limited thereto.
  • the term “about” includes all ranges of ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, etc., and includes all ranges equivalent to or similar to the ranges following the term “about”. Not limited.
  • the Corynebacterium genus ( Corynebacterium sp.) microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium callunae ( Corynebacterium callunae ), Corynebacterium stationis ( Corynebacterium stationis ), Corynebacterium singulare ( Corynebacterium singulare ), Cory Nebacterium halotolerans , Corynebacterium striatum , Corynebacterium ammoniagenes , Corynebacterium pollutisoli , Corynebacterium pollutisoli It may be Corynebacterium imitans ,
  • the activity of some of the proteins in the L-glutamic acid biosynthetic pathway is additionally enhanced, or the activity of some of the proteins in the L-glutamic acid degradation pathway is further inactivated, thereby enhancing the L-glutamic acid production ability.
  • the microorganism of the present application may be a microorganism in which the OdhA protein is further inactivated or the odhA gene is further deleted. More specifically, the microorganism of the present application may be a Corynebacterium glutamicum in which the OdhA protein is inactivated in Corynebacterium glutamicum ATCC13869, or a microorganism in which the odhA gene is deficient in the Corynebacterium glutamicum ATCC13869 there is.
  • the OdhA protein may include the amino acid sequence of NCBI Sequence ID WP_060564343.1 (eg, the amino acid sequence of SEQ ID NO: 23).
  • OdhA protein inactivation or odhA gene deficiency is one example, and is not limited thereto, and the microorganisms of the present application have enhanced protein activity of various known L-glutamic acid biosynthesis pathways or inactivated or weakened protein activity of decomposition pathways. may be microorganisms.
  • Another aspect of the present application provides an L-amino acid production method comprising culturing the microorganism of the present application in a medium.
  • the L-amino acid production method of the present application may include culturing the microorganism of the present application in a medium.
  • the microorganisms of the present application are as described above.
  • culture means growing the Corynebacterium glutamicum strain of the present application under appropriately controlled environmental conditions.
  • the culture process of the present application may be performed according to suitable media and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art according to the selected strain. Specifically, the culture may be batch, continuous and/or fed-batch, but is not limited thereto.
  • “medium” means a material in which nutrients necessary for culturing the Corynebacterium glutamicum strain of the present application are mixed as main components, including water essential for survival and development, nutrients and Supply growth factors, etc.
  • the medium and other culture conditions used for culturing the Corynebacterium glutamicum strain of the present application may be any medium used for culturing common microorganisms without particular limitation, but the Corynebacterium glutamicum of the present application
  • the strain of Leeum glutamicum can be cultured under aerobic conditions in a conventional medium containing appropriate carbon sources, nitrogen sources, phosphorus, inorganic compounds, amino acids, and/or vitamins while controlling temperature, pH, and the like.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, etc., organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine, etc.
  • organic nitrogen sources such as peptone, NZ-amine,
  • the number of persons may include monopotassium phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • the inorganic compound sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and amino acids, vitamins, and/or appropriate precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, it is not limited thereto.
  • the pH of the medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. to the medium in an appropriate manner during the cultivation of the strain of the genus Corynebacterium of the present application.
  • an antifoaming agent such as a fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without gas injection or nitrogen, hydrogen or carbon dioxide gas may be injected to maintain the anaerobic and non-aerobic state. It is not.
  • L-amino acids eg, L-glutamic acid
  • L-glutamic acid L-glutamic acid
  • the L-amino acid production method of the present application includes preparing the microorganism (strain) of the present application, preparing a medium for culturing the microorganism, or a combination thereof (in any order), e.g. For example, prior to the culturing step, it may be further included.
  • the recovery may be to collect the desired L-amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • the L-amino acid production method of the present application may additionally include a purification step.
  • the purification may be performed using suitable methods known in the art.
  • the recovery step and the purification step are performed continuously or discontinuously regardless of order, or simultaneously or integrated into one step. It can be performed, but is not limited thereto.
  • Another aspect of the present application is the microorganism of the present application; medium in which it was cultured; Or to provide a composition for producing L-amino acids (eg, L-glutamic acid) comprising a combination of two or more of them.
  • L-amino acids eg, L-glutamic acid
  • composition of the present application may further include any suitable excipient commonly used in amino acid production compositions, and such an excipient may be, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffer, a stabilizer, or an isotonic agent. However, it is not limited thereto.
  • microorganism strain
  • medium L-amino acid, etc.
  • Another aspect of the present application is the microorganism of the present application; medium in which it was cultured; Or a combination of two or more of them is provided for use in the production of L-amino acids (eg, L-glutamic acid).
  • L-amino acids eg, L-glutamic acid
  • Another aspect of the present application is the microorganism of the present application; medium in which it was cultured; Or a combination of two or more of them is provided for use in the preparation of a composition for producing L-amino acids (eg, L-glutamic acid).
  • L-amino acids eg, L-glutamic acid
  • Example 1 Construction of vectors for expression of LacI family DNA-binding transcriptional regulator protein variants in microorganisms
  • PCR was performed using the gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13869 as a template and the primer pairs of the sequences shown in SEQ ID NOs: 5 and 6 and the primer pairs of the sequences shown in SEQ ID NOs: 7 and 8, respectively. performed. Using the mixture of the two fragments obtained above as a template and primer pairs having sequences of SEQ ID NO: 5 and SEQ ID NO: 8, overlapping PCR was performed again to obtain fragments.
  • Solg TM Pfu-X DNA polymerase was used as the polymerase, and PCR was denatured at 95 ° C for 5 minutes, denatured at 95 ° C for 30 seconds, annealed at 55 ° C for 30 seconds, and polymerized at 72 ° C for 1 minute 30 seconds 30 times. After repeating, polymerization was performed at 72° C. for 5 minutes.
  • the amplified gene fragment and the chromosomal transformation vector pDCM2 (Korean Publication No. 10-2020-0136813) cut with SmaI restriction enzyme were prepared by Gibson assembly (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY). 2009, NEBuilder HiFi DNA Assembly Master Mix) method, and at this time, cloning was performed by mixing Gibson assembly reagent and each gene fragment in the calculated number of moles and then preserving at 50 ° C. for 1 hour.
  • the strain was plated on LB solid medium containing kanamycin (25 mg/l). After selecting a colony into which the target gene was inserted, a vector was obtained using a commonly known plasmid (vector) extraction method. The vector was named pDCM2-BBD29_06680 (Q310*).
  • Table 1 The sequences of the primers used in this Example are shown in Table 1 below.
  • sequence number 1F ATTCGAGCTCGGTACCCGAAAACCCAGAGCTGCTTG SEQ ID NO: 5 2R CATTGATCAGCTTCTaCAGAATCTCAAACGC SEQ ID NO: 6 3F GCGTTTGAGATTCTGtAGAAGCTGATCAATG SEQ ID NO: 7 4R CGACTCTAGAGGATCCCCCCTGTGCCTGCCTGCG SEQ ID NO: 8
  • Example 2 Preparation of wild-type Corynebacterium glutamicum-derived L-glutamic acid producing strain and introduction of LacI series DNA-binding transcriptional regulator protein variant
  • Example 2-1 Production of Corynebacterium glutamicum strain having L-glutamic acid production ability derived from wild-type Corynebacterium glutamicum
  • odhA based on prior literature (Appl Environ Microbiol. 2007 Feb; 73(4): 1308-19. Epub 2006 Dec 8.) to prepare a strain having L-glutamic acid production ability derived from Corynebacterium glutamicum ATCC13869 .
  • a Corynebacterium glutamicum ATCC13869 ⁇ odhA strain lacking the gene was prepared.
  • SolgTM Pfu-X DNA polymerase was used, and the PCR amplification conditions were denaturation at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, and polymerization at 72 ° C for 60 seconds repeated 30 times. After that, polymerization was performed at 72° C. for 5 minutes.
  • a recombinant vector was obtained by cloning the amplified odhA upstream and downstream regions and pDCM2, a vector for chromosomal transformation cut with SmaI restriction enzyme, using the Gibson assembly method, and named pDCM2- ⁇ odhA . Cloning was performed by mixing Gibson Assembly Reagent and each gene fragment in the calculated number of moles and preserving at 50° C. for 1 hour.
  • the prepared pDCM2- ⁇ odhA vector was transformed into the Corynebacterium glutamicum ATCC13869 strain by electroporation, and then a strain in which the odhA gene was deleted on the chromosome was obtained through a secondary crossing process. Deletion of the odhA gene was confirmed through PCR and genome sequencing using SEQ ID NOs: 21 and 22, and the resulting strain was named ATCC13869 ⁇ odhA .
  • the sequences of the primers used in this Example are listed in Table 2 below.
  • sequence number 13F TGAATTCGAGCTCGGTACCCTTGAACGGAATTGGGTGG SEQ ID NO: 17 14R CCCAGGTGGCATCGGTACCTTCACCCAGCGCCACGCAG SEQ ID NO: 18 15R CGCTGGGTGAAGGTACCGATGCCACCTGGGTTGGTCAAG SEQ ID NO: 19 16R GTCGACTCTAGAGGATCCCCGGACAAGGAATGGAGAGA SEQ ID NO: 20 17F CTTACCGTTGTTGCCCTT SEQ ID NO: 21 18R CTCCTTCACCCACATCATT SEQ ID NO: 22
  • Example 2-2 Construction of LacI family DNA-binding transcriptional regulator protein variant introduction strain
  • BBD29_06680 (Q310*) on the chromosome After transforming the vector pDCM2-BBD29_06680(Q310*) prepared in Example 1 into ATCC13869 ⁇ odhA prepared in Example 2-1 by electroporation, BBD29_06680 (Q310*) on the chromosome through a secondary crossing process. A strain into which the mutation was introduced was obtained. The strain into which the BBD29_06680 (Q310*) mutation was introduced was confirmed through PCR and genome sequencing using SEQ ID NOs: 9 and 10, and the produced strain was named CA02-1626. The CA02-1626 strain was named Corynebacterium glutamicum CA02-1626 and was deposited with the Korean Culture of Microorganisms (KCCM) on January 18, 2021 under the Budapest Treaty under the accession number KCCM12930P.
  • KCCM Korean Culture of Microorganisms
  • Example 2-3 Comparison of L-glutamic acid producing ability of strains expressing LacI-based DNA-binding transcriptional regulator protein variants
  • the strain prepared in 2-2 was tested for L-glutamic acid production ability by using ATCC13869 ⁇ odhA strain as a control.
  • the control and CA02-1626 strains were cultured in the following manner.
  • Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium, and incubated at 30° C. for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and incubated at 30° C. for 40 hours with shaking at 200 rpm. After completion of the culture, the production of L-glutamic acid was measured using high performance liquid chromatography (HPLC), and the measurement results are shown in Table 4 below.
  • HPLC high performance liquid chromatography
  • Example 3 Construction of LacI series DNA-binding transcriptional regulator protein deficient strain and measurement of L-glutamic acid production ability
  • Example 3-1 LacI family DNA binding transcriptional regulator Creation of gene-defective vectors
  • BBD29_06680 For the BBD29_06680 deficiency, using the gDNA (genomic DNA) of Corynebacterium glutamicum ATCC13869 as a template, a pair of primers of SEQ ID NOs: 11 and 12 and a primer pair of sequences represented by SEQ ID NOs: 13 and 14, respectively, BBD29_06680 Upstream and downstream regions of the gene were obtained by performing PCR.
  • SolgTM Pfu-X DNA polymerase was used, and the PCR amplification conditions were denaturation at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, and polymerization at 72 ° C for 60 seconds repeated 30 times, Polymerization was performed at 72° C. for 5 minutes.
  • a recombinant vector was obtained by cloning the amplified DNA fragment with the vector pDCM2 for chromosome transformation cut with SmaI restriction enzyme and Gibson assembly method, and named pDCM2- ⁇ BBD29_06680. Cloning was performed by mixing Gibson Assembly Reagent and each gene fragment in the calculated number of moles and preserving at 50° C. for 1 hour.
  • sequence number 7F attcgagctcggtacccCCAGTTCGGTCACAAGAC SEQ ID NO: 11 8R GCTTTTTGGGCTGCTTCGCTTCTTCGGGCTGG SEQ ID NO: 12 9F CCAGCCCGAAGAAGCGAAGCAGCCCAAAAAGC SEQ ID NO: 13 10R GACTCTAGAGGATCCCCGGACAACGCCTTGGCG SEQ ID NO: 14
  • Example 3-2 Construction of LacI-based DNA-binding transcriptional regulator protein deficient strain
  • the vector pDCM2- ⁇ BBD29_06680 constructed in Example 3-1 was transformed into ATCC13869 ⁇ odhA constructed in Example 2-1 by electroporation. Through a secondary crossing process, a strain in which the BBD29_06680 gene was deleted on the chromosome was obtained, which was confirmed through PCR and genome sequencing using the primer pair of SEQ ID NOs: 15 and 16. The selected strain was named CA02-1627. The sequences of the primers used in this Example are shown in Table 6 below.
  • Example 3-3 Measurement of L-glutamic acid producing ability of LacI series DNA-binding transcriptional regulator protein deficient strains
  • Example 2-1 In order to confirm the L-glutamic acid producing ability of the CA02-1627 strain using the ATCC13869 ⁇ odhA strain prepared in Example 2-1 as a control, the evaluation was conducted according to the fermentation titer evaluation method of Example 2-3. , L-glutamic acid production was measured using high-performance liquid chromatography (HPLC), and the measurement results are shown in Table 7 below.
  • HPLC high-performance liquid chromatography
  • Example 4 Construction of a strain into which the NTG mutant-derived LacI-based DNA-binding transcriptional regulator protein variant was introduced and measurement of L-glutamic acid production ability
  • BBD29_06680 (Q310* )
  • the mutant was introduced into Corynebacterium glutamicum BL2 strain (KFCC11074, Korean Patent Registration No. 10-0292299) known as an L-glutamic acid producing NTG mutant strain.
  • Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium, and incubated at 30° C. for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and incubated at 30° C. for 40 hours with shaking at 200 rpm. After completion of the culture, the production of L-glutamic acid was measured through a method using HPLC, and the measurement results are shown in Table 8 below.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 LacI 계열 DNA 결합 전사 조절자 단백질의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법에 관한 것으로, 본 출원의 LacI 계열 DNA 결합 전사 조절자 단백질의 활성이 약화된 코리네박테리움 속 미생물은 L-글루탐산 생산능이 현저히 증가되어, 이를 이용하면 기존의 미생물에 비해 고수율로 L-글루탐산 생산이 가능하다.

Description

LacI 계열 DNA 결합 전사 조절자의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법
관련 출원(들)과의 상호 인용
본 출원은 2021년 7월 26일자 대한민국 특허출원 제10-2021-0098072호에 기초한 우선권의 이익을 주장하며, 해당 대한민국 특허출원의 문헌에 개시된 모든 내용은 본 명세서의 일부로서 포함된다.
본 출원은 LacI 계열 DNA 결합 전사 조절자의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법에 관한 것이다.
L-아미노산 및 기타 유용물질을 생산하기 위하여, 고효율 생산 미생물 및 발효공정기술 개발을 위한 다양한 연구들이 수행되고 있다. 예를 들어, L-글루탐산 생합성에 관여하는 효소를 코딩하는 유전자의 발현을 증가시키거나 또는 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적 접근 방법이 주로 이용되고 있다.
다만, L-글루탐산의 수요 증가에 따라 효과적인 L-글루탐산의 생산능 증가를 위한 연구가 여전히 필요한 실정이다.
선행기술문헌
특허문헌
(특허문헌 1) 미국 공개특허 제2011-0027840 호
본 출원의 하나의 목적은 LacI 계열 DNA 결합 전사 조절자(LacI family DNA-binding transcriptional regulator)의 활성이 약화되고, L-글루탐산 생산능이 향상된 코리네박테리움 속(Corynebacterium sp.) 미생물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 코리네박테리움 속 미생물을 배지에서 배양하는 단계를 포함하는, L-글루탐산 생산 방법을 제공하는 것이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원의 일 양상은 LacI 계열 DNA 결합 전사 조절자(LacI family DNA-binding transcriptional regulator)의 활성이 약화된 코리네박테리움 속(Corynebacterium sp.) 미생물(또는 균주, 재조합 세포)을 제공한다.
본 출원에서 상기 LacI 계열 DNA 결합 전사 조절자 단백질은 LacI 계열 전사 조절(LacI family transcriptional regulator) 활성을 가지는 단백질 (예컨대, LacI family transcriptional regulator)일 수 있으며, 예컨대, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC13869 균주, 코리네박테리움 글루타미쿰 ATCC13032 균주, 또는 코리네박테리움 글루타미쿰 ATCC14067 균주 유래의 것일 수 있으나 이에 제한되는 것은 아니다. 일 예에서, 상기 LacI 계열 DNA 결합 전사 조절자 단백질은 코리네박테리움 ATCC13869 균주 유래의 것(공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_060564415.1일 수 있다.)일 수 있다. 일 예에서, 상기 코리네박테리움 글루타미쿰 유래의 LacI 계열 DNA 결합 전사 조절자 단백질은 서열번호 3의 아미노산 서열을 가지거나, 포함하거나, 상기 아미노산 서열로 이루어지거나, 또는 상기 아미노산 서열로 필수적으로 이루어질(essentially consisting of) 수 있다. 구체적으로 상기 단백질은 서열번호 3의 아미노산 서열로 기재된 폴리펩타이드로 이루어지는 것일 수 있다.
일 예에서, 상기 LacI 계열 DNA 결합 전사 조절자 단백질은 LacI 계열 DNA 결합 전사 조절자 유전자에 의해 코딩되는 LacI 계열 DNA 결합 전사 조절자 활성을 갖는 폴리펩타이드일 수 있으나, 이에 제한되지 않는다. 일 예에서, 상기 LacI 계열 DNA 결합 전사 조절자 유전자는 코리네박테리움 글루타미쿰 ATCC13869 균주에서 유래한 것일 수 있으며, 구체적으로 서열번호 4의 핵산 서열(GenBank Accession No. Sequence ID: CP016335.1의 핵산서열에서 1,421,016번째에서부터 1,422,125번째까지의 서열, 예컨대, BBD29_06680 유전자)을 포함하는 것일 수 있다.
일 예에서, 상기 LacI 계열 DNA 결합 전사 조절자 단백질은 서열번호 3으로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함하거나 상기 서열로 이루어진 것일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 LacI 계열 DNA 결합 전사 조절자 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 변이체도 상기 LacI 계열 DNA 결합 전사 조절 단백질에 포함될 수 있다. 예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 변이체의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이(silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 “보존적 치환(conservative substitution)”은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩타이드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 출원에서, 폴리뉴클레오타이드 또는 폴리펩타이드가 "특정 핵산 서열(염기서열) 또는 아미노산 서열을 가진다, 포함한다, 상기 서열로 이루어진다, 또는 상기 서열로 필수적으로 이루어진다(essentially consisting of)" 라 함은 상기 폴리뉴클레오타이드 또는 폴리펩타이드가 상기 특정 핵산 서열(염기서열) 또는 아미노산 서열을 필수적으로 포함하는 것을 의미할 수 있으며, 상기 폴리뉴클레오타이드 또는 폴리펩타이드의 본래의 기능 및/또는 목적하는 기능을 유지하는 범위에서 상기 특정 핵산 서열(염기서열) 또는 아미노산 서열에 변이(결실, 치환, 변형, 및/또는 부가)가 가해진 "실질적으로 동등한 서열"을 포함하는 것(또는 상기 변이를 배제하지 않는 것)으로 해석될 수 있다. 일 예에서, 폴리뉴클레오타이드 또는 폴리펩타이드가 "특정 핵산 서열(염기서열) 또는 아미노산 서열을 가진다, 포함한다, 상기 서열로 이루어진다, 또는 상기 서열로 필수적으로 이루어진다" 라 함은 상기 폴리뉴클레오타이드 또는 폴리펩타이드가 (i) 상기 특정 핵산 서열(염기서열) 또는 아미노산 서열을 필수적으로 포함하거나, 또는 (ii) 상기 특정 핵산 서열(염기서열) 또는 아미노산 서열과 70% 이상, 80% 이상, 85% 이상, 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 98% 이상, 99% 이상, 99.5% 이상, 또는 99.9% 이상의 상동성 또는 동일성을 갖는 핵산 서열 또는 아미노산 서열로 이루어지거나 이를 필수적으로 포함하고 본래의 기능 및/또는 목적하는 기능을 유지하는 것을 의미할 수 있다. 일 예에서, 상기 목적하는 기능은 미생물의 L-글루탐산 생산능을 증가(향상)시키거나 부여하는 기능을 의미할 수 있다.
본 출원에서, ‘상동성(homology)’ 또는 ‘동일성(identity)’은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오타이드 또는 폴리펩타이드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오타이드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오타이드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오타이드 또는 폴리펩타이드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오타이드 또는 폴리펩타이드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오타이드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스(또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티(또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원에서 용어, "미생물(또는, 균주)"은 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 약화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 폴리펩타이드, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원에서 용어, 폴리펩타이드의 “약화”는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 상기 폴리펩타이드(또는 단백질, 예를 들면 LacI 계열 DNA 결합 전사 조절자 단백질)를 코딩하는 폴리뉴클레오타이드의 변이 등으로 폴리펩타이드 자체의 활성이 본래 미생물이 가지고 있는 폴리펩타이드의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오타이드의 유전자의 발현 저해 또는 폴리펩타이드로의 번역(translation) 저해 등으로 세포 내에서 전체적인 폴리펩타이드 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오타이드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오타이드의 발현이 되더라도 폴리펩타이드의 활성이 없는 경우 역시 포함할 수 있다. 상기 “내재적 활성”은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩타이드의 활성을 의미한다. 이는 “변형 전 활성”과 혼용되어 사용될 수 있다. 폴리펩타이드의 활성이 내재적 활성에 비하여 “불활성화, 결핍, 감소, 하향조절, 저하, 감쇠”한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩타이드의 활성에 비하여 낮아진 것을 의미한다.
이러한 폴리펩타이드(또는 단백질, 예를 들면 LacI 계열 DNA 결합 전사 조절자 단백질)의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 폴리펩타이드(또는 단백질, 예를 들면 LacI 계열 DNA 결합 전사 조절자 단백질; 이하 폴리펩타이드로 기재함)의 약화는
1) 폴리펩타이드를 코딩하는 유전자 전체 또는 일부의 결손;
2) 폴리펩타이드를 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 폴리펩타이드의 활성이 제거 또는 약화되도록 상기 폴리펩타이드를 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 폴리펩타이드의 활성이 제거 또는 약화되도록 상기 폴리펩타이드를 코딩하는 유전자 서열의 변형(예를 들어, 폴리펩타이드의 활성이 제거 또는 약화되도록 변형된 폴리펩타이드를 코딩하도록 상기 폴리펩타이드 유전자의 핵산 염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 폴리펩타이드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
6) 폴리펩타이드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오타이드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩타이드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 폴리펩타이드를 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 폴리펩타이드를 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 폴리펩타이드를 코딩하는 폴리뉴클레오타이드 전체의 제거, 일부 뉴클레오타이드가 결실된 폴리뉴클레오타이드로의 교체 또는 마커 유전자로 교체일 수 있다.
또한, 상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 3) 폴리펩타이드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩타이드 발현율이 더 낮은 다른 개시코돈을 코딩하는 염기서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오타이드 서열의 변형은 폴리펩타이드의 활성을 약화하도록 상기 폴리펩타이드의 아미노산 서열 또는 상기 폴리펩타이드를 코딩하는 폴리뉴클레오타이드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오타이드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오타이드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오타이드 서열 내 변이를 도입하여 종결 코돈(stop codon)을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있으나, 이에 제한되지 않는다. 상기 "종결 코돈(stop codon)"은 mRNA 상의 코돈 중 아미노산을 지정하지 않고 단백질 합성 과정이 끝났음을 알리는 신호로 작용하는 코돈으로, 일반적으로 UAA, UAG, UGA의 3가지가　종결코돈으로 사용될 수 있다.
일 예에 따른 미생물은 내재적 서열번호 4의 유전자의 ORF(open reading frame)에 서열 내 변이가 도입되어 종결 코돈이 형성된 것으로 교체(치환)된 것일 수 있으며, 예를 들면 LacI 계열 DNA 결합 전사 조절자 단백질의 310번째 아미노산(예를 들면, 글루타민, Gln, Q) 대응코돈을 종결 코돈으로 치환시킨 것으로 교체(치환)된 것일 수 있다. 예컨대, 서열번호 4의 핵산 서열에서 310번째 아미노산인 글루타민을 코딩하는 폴리뉴클레오타이드는 "CAG"로, 이를 종결코돈으로 치환하기 위하여 "CAG"가 각각 "TAA", "TAG", 또는 "TGA"로 교체(치환)되는 변이가 도입된 것일 수 있다. 일 예에서, 상기 종결코돈을 생성하도록 변이가 도입된 핵산서열은 서열번호 2의 핵산서열(서열번호 4의 야생형 폴리뉴클레오타이드의 928번째 C가 T로 치환됨; C928T)일 수 있다.
상기 6) 폴리펩타이드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오타이드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩타이드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
상기 8) 폴리펩타이드를 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 폴리펩타이드를 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오타이드를 만들어 활성을 약화하는 것일 수 있다.
본 출원에서 용어, 폴리펩타이드 활성의 “강화”는, 폴리펩타이드의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 “내재적 활성”은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩타이드의 활성을 의미한다. 이는 “변형 전 활성”과 혼용되어 사용될 수 있다. 폴리펩타이드의 활성이 내재적 활성에 비하여 “강화”, “상향조절”, “과발현” 또는 “증가”한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩타이드의 활성 및/또는 농도(발현량)에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 폴리펩타이드를 도입하거나, 내재적인 폴리펩타이드의 활성 및/또는 농도(발현량) 강화를 통해 달성할 수 있다. 상기 폴리펩타이드의 활성의 강화 여부는 해당 폴리펩타이드의 활성 정도, 발현량 또는 해당 폴리펩타이드로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩타이드의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩타이드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩타이드의 강화는
1) 폴리펩타이드를 코딩하는 폴리뉴클레오타이드의 세포 내 카피수 증가;
2) 폴리펩타이드를 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체;
3) 폴리펩타이드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩타이드 활성이 강화되도록 상기 폴리펩타이드의 아미노산 서열의 변형;
5) 폴리펩타이드 활성이 강화되도록 상기 폴리펩타이드를 코딩하는 폴리뉴클레오타이드 서열의 변형 (예를 들어, 폴리펩타이드의 활성이 강화되도록 변형된 폴리펩타이드를 코딩하도록 상기 폴리펩타이드 유전자의 폴리뉴클레오타이드 서열의 변형);
6) 폴리펩타이드의 활성을 나타내는 외래 폴리펩타이드 또는 이를 코딩하는 외래 폴리뉴클레오타이드의 도입;
7) 폴리펩타이드를 암호화하는 폴리뉴클레오타이드의 코돈 최적화;
8) 폴리펩타이드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩타이드를 코딩하는 폴리뉴클레오타이드의 세포 내 카피수 증가는, 해당 폴리펩타이드를 코딩하는 폴리뉴클레오타이드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩타이드를 코딩하는 폴리뉴클레오타이드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오타이드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다.
상기 2) 폴리펩타이드를 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩타이드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩타이드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오타이드 서열의 변형은, 폴리펩타이드의 활성을 강화하도록 상기 폴리펩타이드의 아미노산 서열 또는 상기 폴리펩타이드를 코딩하는 폴리뉴클레오타이드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오타이드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오타이드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오타이드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다
상기 6) 폴리펩타이드의 활성을 나타내는 외래 폴리뉴클레오타이드의 도입은, 상기 폴리펩타이드와 동일/유사한 활성을 나타내는 폴리펩타이드를 코딩하는 외래 폴리뉴클레오타이드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오타이드는 상기 폴리펩타이드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오타이드가 발현됨으로써 폴리펩타이드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩타이드를 암호화하는 폴리뉴클레오타이드의 코돈 최적화는, 내재 폴리뉴클레오타이드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오타이드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 폴리펩타이드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩타이드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 폴리펩타이드 활성의 강화는, 상응하는 폴리펩타이드의 활성 또는 농도 발현량이 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩타이드의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩타이드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 미생물에서 폴리뉴클레오타이드의 일부 또는 전체의 변형(예컨대, 상술한 단백질 변이체를 코딩하기 위한 변형)은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위(engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오타이드 서열을 포함하는 뉴클레오타이드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오타이드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
일 예에서, 상기 폴리펩타이드(또는 단백질, 예를 들면 LacI 계열 DNA 결합 전사 조절자 단백질; 이하 폴리펩타이드로 기재함)의 약화는 재조합 방법에 의하여 야기된 것일 수 있다. 상기 재조합 방법은 상동 재조합(homologous recombination)을 포함할 수 있다. 상기 상동 재조합 방법은 폴리펩타이드를 코딩하는 유전자의 일부 서열을 포함하는 벡터를 상기 미생물에 형질전환하고, 선별 마커 산물의 존재 하에서 배양하는 경우 상기 유전자의 일부 서열과 상기 미생물 내의 내재적 유전자와 상동 재조합을 일으킬 수 있다.
본 출원의 미생물은 LacI 계열 DNA 결합 전사 조절자 단백질 또는 이를 코딩하는 폴리뉴클레오타이드가 불활성화 또는 약화된 미생물; 또는 LacI 계열 DNA 결합 전사 조절자 단백질 또는 이를 코딩하는 폴리뉴클레오타이드가 불활성화 또는 약화되도록 벡터를 통해 유전적으로 변형된 미생물(예컨대, 재조합 미생물)일 수 있으나, 이에 제한되지 않는다.
본 출원의 미생물(또는 균주, 재조합 세포)은 L-글루탐산 생산능을 가지거나 L-글루탐산 생산능(또는 생산량)이 향상된 미생물일 수 있다.
본 출원의 미생물은 자연적으로 L-글루탐산 생산능을 가지고 있는 미생물, 또는 L-글루탐산 생산능이 없는 모균주에 LacI 계열 DNA 결합 전사 조절자 단백질의 활성이 약화 및/또는 L-글루탐산 생산능이 부여되거나 향상된 미생물일 수 있으나 이에 제한되지 않는다.
상기 미생물(또는 균주, 재조합 세포)이 L-글루탐산 생산능(또는 생산량)이 향상되거나 L-글루탐산 생산능을 갖는다는 것은 상기 미생물(또는 균주, 재조합 세포)은 비변형 미생물, 재조합 전의 세포, 모균주, 및/또는 야생형 균주 보다 L-글루탐산 생산능이 향상되거나, L-글루탐산 생산능이 없는 비변형 미생물, 재조합 전의 세포, 모균주 및/또는 야생형 균주와는 달리 L-글루탐산 생산능이 부여된 것을 의미할 수 있다.
일 예에 따른 LacI 계열 DNA 결합 전사 조절자 단백질의 활성이 약화된 미생물은 동종의 비변형 미생물과 비교하여, L-글루탐산 생산능이 향상(증가)된 것일 수 있다. 본 출원에서, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 일 예에 따라 LacI 계열 DNA 결합 전사 조절자 단백질의 활성이 약화되지 않거나 약화되기 전의 균주(또는 LacI 계열 DNA 결합 전사 조절자 단백질의 활성의 약화를 유도하는 변이가 도입되지 않거나 도입되기 전의 균주)를 의미할 수 있다. 상기 "비변형 미생물"은 “변형 전 균주”, “변형 전 미생물”, “비변이 균주”, “비변형 균주”, “비변이 미생물” 또는 “기준 미생물”과 혼용될 수 있다. 상기 LacI 계열 DNA 결합 전사 조절자 단백질의 활성이 약화된다는 것은 전술한 바와 같다. 일 예에서 상기 L-글루탐산 생산능의 증가 여부를 비교하는 대상 균주인, 비변형 미생물은 코리네박테리움 글루타미쿰 ATCC13032 균주, 코리네박테리움 글루타미쿰 ATCC13869 균주, 코리네박테리움 글루타미쿰 ATCC14067 균주, 코리네박테리움 글루타미쿰 야생형에서 odhA 유전자가 결실된 균주(예를 들면, ATCC13869△odhA 균주), 또는 L-글루탐산 생산 NTG 변이 균주로 알려진 코리네박테리움 글루타미쿰 BL2 균주(KFCC11074, 한국 등록특허 제10-0292299호)일 수 있으나, 이에 제한되지 않는다.
상기 미생물(또는 균주, 재조합 세포)은 추가적으로 L-글루탐산 생산이 증가되도록 하는 변이를 포함할 수 있고, 상기 변이의 위치 및/또는 변이 대상이 되는 유전자 및/또는 단백질의 종류는 L-글루탐산 생산이 증가되도록 하는 것이면 제한 없이 포함될 수 있다. 상기 재조합 세포는 형질전환이 가능한 세포라면 제한 없이 사용 가능할 수 있다.
일 예로, 상기 생산능(또는 생산량)이 향상된(증가된) 미생물(또는 균주, 재조합 세포)은 변이 전 모균주 또는 비변형 미생물에 비하여, L-글루탐산 생산능이 약 1% 이상, 약 2.5% 이상, 약 5% 이상, 약 6% 이상, 약 7% 이상, 약 8% 이상, 약 9% 이상, 약 10% 이상, 약 10.5% 이상, 약 11% 이상, 약 11.5%이상, 약 12% 이상, 약 12.5% 이상, 약 13% 이상, 약 13.5% 이상, 약 14% 이상, 약 14.5% 이상, 약 15% 이상, 약 15.5% 이상, 약 16% 이상, 약 16.5% 이상, 약 17% 이상, 약 17.4% 이상, 약 17.5% 이상, 약 18% 이상, 약 18.5% 이상, 약 19% 이상, 약 19.5% 이상, 약 20% 이상, 약 20.5% 이상, 약 21% 이상, 약 21.1% 이상, 약 21.5% 이상, 약 21.5% 이상, 약 22% 이상, 약 22.5% 이상, 약 23% 이상, 약 23.5% 이상, 약 24% 이상, 약 24.5% 이상, 약 25% 이상, 약 25.5% 이상, 약 26% 이상, 약 26.5% 이상, 약 27% 이상, 약 27.5% 이상, 약 28% 이상, 약 28.5% 이상, 약 29% 이상, 약 29.5% 이상, 약 30% 이상, 약 31% 이상, 약 32% 이상, 약 33% 이상, 약 34% 이상, 또는 약 35% 이상(상한값은 특별한 제한은 없으며, 예컨대, 약 200% 이하, 약 150% 이하, 약 100% 이하, 약 50% 이하, 약 45% 이하, 약 40% 이하, 또는 약 35% 이하일 수 있음) 증가된 것일 수 있으며, 일 예에서 약 17.2% 이상, 약 21.4% 이상, 또는 약 21.6% 이상 증가된 것일 수 있다. 다른 예에서, 상기 생산능(또는 생산량)이 증가된 미생물(또는 균주, 재조합 세포)는 변이 전 모균주 또는 비변형 미생물에 비하여, L-글루탐산 생산능(또는 생산량)이 약 1.1배 이상, 약 1.12배 이상, 약 1.13배 이상, 1.15배 이상, 1.16배 이상, 1.17배 이상, 1.18배 이상, 1.19배 이상, 약 1.2 배 이상, 약 1.21배 이상, 약 1.22배 이상, 1.25배 이상, 또는 약 1.3배 이상(상한값은 특별한 제한은 없으며, 예컨대, 약 10배 이하, 약 5배 이하, 약 3배 이하, 또는 약 2배 이하일 수 있음) 증가된 것일 수 있으며, 일 예에서 약 1.172배 이상, 약 1.214배 이상, 약 1.216배 이상 증가된 것일 수 있다. 보다 구체적으로는, 상기 생산능(또는 생산량)이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, L-글루탐산 생산능이 약 17.2%, 약 21.4%, 또는 약 21.6% (또는 약 1.17배, 약 1.21 배, 또는 약 1.22배) 증가된 것일 수 있으나, 이에 제한되지 않는다. 상기 용어 “약(about)”은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
일 예에서, 상기 코리네박테리움 속 (Corynebacterium sp.) 미생물은 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum), 코리네박테리움 크루디락티스 (Corynebacterium crudilactis), 코리네박테리움 데세르티 (Corynebacterium deserti), 코리네박테리움 이피시엔스 (Corynebacterium efficiens), 코리네박테리움 칼루내 (Corynebacterium callunae), 코리네박테리움 스테셔니스 (Corynebacterium stationis), 코리네박테리움 싱굴라레 (Corynebacterium singulare), 코리네박테리움 할로톨레란스 (Corynebacterium halotolerans), 코리네박테리움 스트리아툼 (Corynebacterium striatum), 코리네박테리움 암모니아게네스 (Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리 (Corynebacterium pollutisoli), 코리네박테리움 이미탄스 (Corynebacterium imitans), 코리네박테리움 테스투디노리스 (Corynebacterium testudinoris), 및/또는 코리네박테리움 플라베스센스 (Corynebacterium flavescens)일 수 있다.
다른 하나의 예로, 본 출원의 재조합 미생물은, L-글루탐산 생합성 경로 내 단백질 일부의 활성이 추가적으로 강화되거나, L-글루탐산 분해 경로 내 단백질 일부의 활성이 추가적으로 불활성화되어 L-글루탐산 생산능이 강화된 미생물일 수 있다.
구체적으로, 본 출원의 미생물은 OdhA 단백질이 추가로 불활성화되거나, odhA 유전자가 추가로 결손된 미생물일 수 있다. 보다 구체적으로, 본 출원의 미생물은 코리네박테리움 글루타미쿰 ATCC13869에서 OdhA 단백질이 불활성화된 코리네박테리움 글루타미쿰, 상기 코리네박테리움 글루타미쿰 ATCC13869에서 odhA 유전자가 결손된 미생물일 수 있다. 상기 OdhA 단백질은 NCBI Sequence ID WP_060564343.1의 아미노산 서열(예컨대, 서열번호 23의 아미노산 서열)을 포함하는 것일 수 있다. 상기 OdhA 단백질은 코리네박테리움 글루타미쿰 균주 유래의 multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit 활성을 가지는 단백질일 수 있다. 상기 odhA 유전자는 코리네박테리움 글루타미쿰 ATCC13869 균주에서 유래한 것일 수 있으며, 구체적으로 서열번호 24의 핵산서열(GenBank Accession No. Sequence ID: CP016335.1의 핵산서열에서 1,276,170번째에서부터 1,279,787번째까지의 서열, 예컨대 BBD29_06050 유전자)을 포함하는 것일 수 있다.
다만, 상기 OdhA 단백질 불활성화 또는 odhA 유전자 결손은 한 가지 예이며 이에 제한되지 않고, 본 출원의 미생물은 다양한 공지의 L-글루탐산 생합성 경로의 단백질 활성이 강화되거나 분해 경로의 단백질 활성이 불활성화 또는 약화된 미생물일 수 있다.
본 출원의 또 다른 하나의 양상은 본 출원의 미생물을 배지에서 배양하는 단계를 포함하는, L-아미노산 생산방법을 제공한다.
본 출원의 L-아미노산 생산방법은 본 출원의 미생물을 배지에서 배양하는 단계를 포함할 수 있다. 본 출원의 미생물에 대해서는 전술한 바와 같다.
더불어, 본 출원의 L-아미노산은 L- 글루탐산일 수 있다.
본 출원에서, "배양"은 본 출원의 코리네박테리움 글루타미쿰 균주를 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서, "배지"는 본 출원의 코리네박테리움 글루타미쿰 균주를 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 코리네박테리움 글루타미쿰 균주의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 코리네박테리움 글루타미쿰 균주를 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 코리네박테리움 속 균주에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아볼 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 라이신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 본 출원의 코리네박테리움 속 균주의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
본 출원의 배양에서 배양온도는 20 내지 45℃ 구체적으로는 25 내지 40℃ 를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 생산된 L-아미노산(예를 들면, L-글루탐산)은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 L-아미노산 생산방법은, 본 출원의 미생물(균주)을 준비하는 단계, 상기 미생물을 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 L-아미노산 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 미생물(코리네박테리움 속 균주)로부터 L-아미노산을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L-아미노산을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-아미노산을 회수할 수 있다.
또한, 본 출원의 L-아미노산 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 L-아미노산 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 또 다른 하나의 양상은 본 출원의 미생물; 이를 배양한 배지; 또는 이들 중 2 이상의 조합을 포함하는 L-아미노산(예를 들면, L-글루탐산) 생산용 조성물을 제공하는 것이다.
본 출원의 조성물은 아미노산 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 조성물에서, 미생물(균주), 배지 및 L-아미노산 등은 상기 다른 양상에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양상은 본 출원의 미생물; 이를 배양한 배지; 또는 이들 중 2 이상의 조합의 L-아미노산(예를 들면, L-글루탐산) 생산에 사용하기 위한 용도를 제공하는 것이다.
본 출원의 또 다른 하나의 양상은 본 출원의 미생물; 이를 배양한 배지; 또는 이들 중 2 이상의 조합의 L-아미노산(예를 들면, L-글루탐산) 생산용 조성물의 제조에 사용하기 위한 용도를 제공하는 것이다.
본 출원의 LacI 계열 DNA 결합 전사 조절자(LacI family DNA-binding transcriptional regulator)의 활성이 약화된 코리네박테리움 속 미생물은 L-글루탐산 생산능이 현저히 증가되어, 이를 이용하면 기존의 미생물에 비해 고수율로 L-글루탐산 생산이 가능하다.
이하, 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 하기 실시예는 본 출원을 예시하기 위한 바람직한 실시양태에 불과한 것이며 따라서, 본 출원의 권리범위를 이에 한정하는 것으로 의도되지는 않는다. 한편, 본 명세서에 기재되지 않은 기술적인 사항들은 본 출원의 기술 분야 또는 유사 기술 분야에서 숙련된 통상의 기술자이면 충분히 이해하고 용이하게 실시할 수 있다.
실시예 1: 미생물내 LacI 계열 DNA 결합 전사 조절자 단백질 변이체 발현을 위한 벡터 제작
본 실시예에서, LacI 계열 DNA 결합 전사 조절자 단백질 아미노산 서열(서열번호 3의 아미노산 서열) 310번째 위치 글루타민(Gln, Q)의 대응코돈이 종결코돈(stop codon(*))으로 치환된 변이체(Q310*; 서열번호 1, 309개 서열)가 L-글루탐산 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13869의 gDNA(genomic DNA)를 주형으로 서열번호 5 및 6로 기재되는 서열의 프라이머 쌍과 서열번호 7 및 8로 기재되는 서열의 프라이머 쌍을 각각 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 5 및 서열번호 8의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. 중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR은 95℃에서 5분간 변성 후, 95℃에서 30초 변성, 55℃에서 30초 어닐링, 72℃ 에서 1분 30초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
증폭된 유전자 단편과 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDCM2(대한민국 공개번호 제10-2020-0136813호)를 깁슨 어셈블리(DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 클로닝 하였고, 이때, 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다. 상기 균주를 카나마이신(25 mg/l)이 포함된 LB 고체배지에 도말 하였다. 목적한 유전자가 삽입된 콜로니를 선별한 후 통상적으로 알려진 플라스미드(벡터) 추출법을 이용하여 벡터를 획득하였다. 상기 벡터는 pDCM2-BBD29_06680(Q310*)로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 1에 기재하였다.
명칭 서열 (5’->3’) 서열번호
1F ATTCGAGCTCGGTACCCGAAAACCCAGAGCTGCTTG 서열번호 5
2R CATTGATCAGCTTCTaCAGAATCTCAAACGC 서열번호 6
3F GCGTTTGAGATTCTGtAGAAGCTGATCAATG 서열번호 7
4R CGACTCTAGAGGATCCCCCCTGTGCCTGCCTGCG 서열번호 8
실시예 2: 야생형 코리네박테리움 글루타미쿰 유래 L-글루탐산 생산주 제작 및 LacI 계열 DNA 결합 전사 조절자 단백질 변이체 도입
실시예 2-1: 야생형 코리네박테리움 글루타미쿰 유래 L-글루탐산 생산능을 갖는 코리네박테리움 글루타미쿰 균주 제작
코리네박테리움 글루타미쿰 ATCC13869 유래 L-글루탐산 생산능을 갖는 균주를 제작하기 위해 선행문헌(Appl Environ Microbiol. 2007 Feb;73(4):1308-19. Epub 2006 Dec 8.)을 바탕으로 odhA 유전자(GenBank Accession No. WP_060564343.1, 서열번호 24)를 결손한 코리네박테리움 글루타미쿰 ATCC13869△odhA 균주를 제작하였다.
구체적으로, odhA 결손을 위하여 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 서열번호 17 및 18의 프라이머 쌍 및 서열번호 19 및 20의 프라이머 쌍을 각각 이용하여 odhA 유전자의 업스트림 지역과 다운스트림 지역을 PCR 수행을 통해 수득하였다. 중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95 ℃에서 5분간 변성 후, 95℃에서 30초 변성, 58℃에서 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
증폭된 odhA 업스트림과 다운스트림 지역, 그리고 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDCM2를 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 벡터를 획득하였으며, pDCM2-△odhA로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
제작된 pDCM2-△odhA 벡터를 코리네박테리움 글루타미쿰 ATCC13869 균주에 전기천공법으로 형질전환 후, 2차 교차 과정을 거쳐 염색체 상에서 odhA 유전자가 결손된 균주를 수득하였다. odhA 유전자 결손 여부는 서열번호 21 및 22을 이용한 PCR 과 게놈 시퀀싱을 통해 확인하였으며, 제작된 균주를 ATCC13869△odhA 로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 2에 기재하였다.
명칭 서열 (5’->3’) 서열번호
13F TGAATTCGAGCTCGGTACCCTTGAACGGAATTGGGTGG 서열번호 17
14R CCCAGGTGGCATCGGTACCTTCACCCAGCGCCACGCAG 서열번호 18
15R CGCTGGGTGAAGGTACCGATGCCACCTGGGTTGGTCAAG 서열번호 19
16R GTCGACTCTAGAGGATCCCCGGACAAGGAATGGAGAGA 서열번호 20
17F CTTACCGTTGTTGCCCTT 서열번호 21
18R CTCCTTCACCCACATCATT 서열번호 22
실시예 2-2: LacI 계열 DNA 결합 전사 조절자 단백질 변이체 도입 균주 제작
상기 실시예 1에서 제작한 벡터 pDCM2-BBD29_06680(Q310*)를 상기 실시예 2-1에서 제작한 ATCC13869△odhA에 전기천공법으로 형질전환 후, 2차 교차 과정을 거쳐 염색체 상에서 BBD29_06680(Q310*) 변이가 도입된 균주를 수득하였다. BBD29_06680(Q310*) 변이가 도입된 균주는 서열번호 9 및 10을 이용한 PCR 과 게놈 시퀀싱을 통해 확인하였으며, 제작된 균주를 CA02-1626로 명명하였다. 상기 CA02-1626 균주는 Corynebacterium glutamicum CA02-1626로 명명되었고, 부다페스트 조약 하에 2021년 1월 18일자로 한국미생물보존센터(Korean Culture of Microorganisms, KCCM)에 기탁번호 KCCM12930P로 기탁되었다.
본 실시예에서 사용한 프라이머의 서열은 하기 표 3에 기재하였다.
명칭 서열 (5’->3’) 서열번호
5F GCTGCTCGTGAAGCTGG 서열번호 9
6R GAACCCACCTGAGCATTC 서열번호 10
실시예 2-3: LacI 계열 DNA 결합 전사 조절자 단백질 변이체 발현 균주의 L-글루탐산 생산능 비교
상기 2-2에서 제작된 균주를 ATCC13869△odhA 균주를 대조군으로 하여 L-글루탐산 생산능을 확인하고자 하였다. 대조군 및 CA02-1626 균주를 아래와 같은 방법으로 배양하였다.
종 배지 25㎖을 함유하는 250㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 20 시간 동안, 200rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 25㎖을 함유하는 250㎖ 코너-바플 플라스크에 1㎖의 종 배양액을 접종하고 30℃에서 40시간 동안, 200rpm에서 진탕 배양하였다. 배양 종료 후, 고성능 액체 크로마토그래피(HPLC)를 이용하여 L-글루탐산 생산량을 측정하고, 측정 결과를 하기 표 4에 나타내었다.
<종배지>
포도당 1%, 육즙 0.5%, 폴리펩톤 1%, 염화나트륨 0.25%, 효모엑기스 0.5%, 유레아 0.2%, pH 7.2
<생산배지>
원당 6%, 탄산칼슘 5%, 황산암모늄 2.25%, 일인산칼륨 0.1%, 황산마그네슘 0.04%, 황산철 10 mg/L, 티아민 염산염 0.2 mg/L, 비오틴 50㎍/L
균주명 L-글루탐산 농도(g/L) L-글루탐산 농도 증가율(%)
ATCC13869△odhA 1.90 -
CA02-1626 2.31 21.6
상기 표 4에서 나타난 바와 같이, 대조군인 ATCC13869△odhA 균주에 비하여 BBD29_06680(Q310*) 변이가 도입된 CA02-1626 균주에서 L-글루탐산의 농도가 약 21.6% 증가하는 것을 확인 하였다.
실시예 3: LacI 계열 DNA 결합 전사 조절자 단백질 결손 균주 제작 및 L-글루탐산 생산능 측정
실시예 3-1: LacI 계열 DNA 결합 전사 조절자 유전자 결손 벡터 제작
상기 실시예에서 LacI 계열 DNA 결합 전사 조절자 단백질의 310 번째 아미노산인 글루타민(Gln, Q)의 대응코돈을 종결코돈(stop codon)으로 치환하였을 때 L-글루탐산의 생성능이 향상되는 것을 확인하였다. 이에 본 실시예에서는, LacI 계열 DNA 결합 전사 조절자 (BBD29_06680) 유전자 결실이 L-글루탐산 생산에 미치는 영향을 확인하고자 하였다.
구체적으로, BBD29_06680 결손을 위하여 코리네박테리움 글루타미쿰 ATCC13869의 gDNA(genomic DNA)를 주형으로 서열번호 11 및 12의 프라이머 쌍과 서열번호 13 및 14로 기재되는 서열의 프라이머 쌍을 각각 이용하여 BBD29_06680 유전자의 업스트림 지역과 다운스트림 지역을 PCR 수행을 통해 수득하였다. 중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 58℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. 증폭된 DNA 단편을 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDCM2와 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 벡터를 획득하였으며, pDCM2-△BBD29_06680로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
본 실시예에서 사용한 프라이머의 서열은 하기 표 5에 기재하였다.
명칭 서열 (5’->3’) 서열번호
7F attcgagctcggtacccCCAGTTCGGTCACAAGAC 서열번호 11
8R GCTTTTTGGGCTGCTTCGCTTCTTCGGGCTGG 서열번호 12
9F CCAGCCCGAAGAAGCGAAGCAGCCCAAAAAGC 서열번호 13
10R GACTCTAGAGGATCCCCGGACAACGCCTTGGCG 서열번호 14
실시예 3-2: LacI 계열 DNA 결합 전사 조절자 단백질 결손 균주 제작
상기 실시예 3-1에서 제작한 벡터 pDCM2-△BBD29_06680를 상기 실시예 2-1에서 제작한 ATCC13869△odhA에 전기천공법으로 형질전환 하였다. 2차 교차 과정을 거쳐 염색체 상에서 BBD29_06680 유전자가 결손된 균주를 수득 하였으며, 이는 서열번호 15 및 16의 프라이머 쌍을 이용한 PCR 과 게놈 시퀀싱을 통해 확인하였다. 선별된 균주는 CA02-1627로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 6에 기재하였다.
명칭 서열 (5’->3’) 서열번호
11F GCAAGGCGATGGAACGTC 서열번호 15
12R CTCATCCAAGTGGTGCG 서열번호 16
실시예 3-3: LacI 계열 DNA 결합 전사 조절자 단백질 결손 균주의 L-글루탐산 생산능 측정
상기 실시예 2-1에서 제작된 ATCC13869△odhA 균주를 대조군으로 하여 CA02-1627 균주의 L-글루탐산 생산능을 확인하고자 실시예 2-3의 발효 역가 평가 방법에 따라 평가를 진행하였으며, 배양 종료 후, 고성능 액체 크로마토그래피(HPLC)를 이용하여 L-글루탐산 생산량을 측정하고, 측정 결과를 하기 표 7에 나타내었다.
균주명 L-글루탐산 농도(g/L) L-글루탐산 농도 증가율(%)
ATCC13869△odhA 1.92 -
CA02-1627 2.33 21.4
상기 표 7에서 나타난 바와 같이, 대조군인 ATCC13869△odhA 균주에 비하여 BBD29_06680 유전자가 결손된 CA02-1627에서 L-글루탐산의 농도가 약 21.4% 증가하는 것을 확인하였다.
실시예 4: NTG 변이주 유래 LacI 계열 DNA 결합 전사 조절자 단백질 변이체가 도입된 균주 제작 및 L-글루탐산 생산능 측정
L-글루탐산 생산능이 증가된 NTG(N-Methyl-N'-nitro-N-nitrosoguanidine; N-메틸-N'-니트로-N-니트로소구아니딘) 변이 코리네박테리움 속 유래 균주에서도 BBD29_06680(Q310*) 변이체가 동일한 효과를 나타내는지 확인하기 위하여, L-글루탐산 생산 NTG 변이 균주로 알려진 코리네박테리움 글루타미쿰 BL2 균주(KFCC11074, 한국 등록특허 제10-0292299호)에 상기 변이체를 도입하였다.
실시예 1에서 제작한 pDCM2-BBD29_06680(Q310*)벡터를 KFCC11074 균주에 전기천공법으로 형질 전환 후, 2차 교차 과정을 거쳐 염색체 상에 BBD29_06680(Q310*)변이체가 도입된 균주를 선별하였다. 이는 서열번호 9 및 10을 이용한 PCR 과 게놈 시퀀싱을 통해 확인하였으며, 제작된 균주를 CA02-1630로 명명하였다.
제작한 CA02-1630과 코리네박테리움 글루타미쿰 KFCC11074 균주를 대상으로 아래 명시된 방법으로 발효 역가 실험을 진행하였다.
종 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 40시간 동안, 200 rpm에서 진탕 배양하였다. 배양 종료 후, HPLC를 이용한 방법을 통해 L-글루탐산 생산량을 측정하였으며, 측정 결과는 하기 표 8에 나타내었다.
<종배지>
포도당 1%, 육즙 0.5%, 폴리펩톤 1%, 염화나트륨 0.25%, 효모엑기스 0.5%, 유레아 0.2%, pH 7.2
<생산배지>
원당 6%, 탄산칼슘 5%, 황산암모늄 2.25%, 일인산칼륨 0.1%, 황산마그네슘 0.04%, 황산철 10 mg/L, 티아민 염산염 0.2 mg/L, 비오틴 500㎍/L
균주명 L-글루탐산 농도(g/L) L-글루탐산 농도 증가율(%)
KFCC11074 6.91 -
CA02-1630 8.10 17.2
상기 표 8에서 나타난 바와 같이 CA02-1630 균주는 대조군인 KFCC11074 균주에 비하여 L-글루탐산의 농도가 약 17.2% 증가하는 것을 확인 하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
[수탁번호]
기탁기관명 : 한국미생물보존센터
수탁번호 : KCCM12930P
수탁일자 : 20210118
Figure PCTKR2022010905-appb-img-000001

Claims (13)

  1. LacI 계열 DNA 결합 전사 조절자 단백질의 활성이 약화된 코리네박테리움 속 미생물.
  2. 제1항에 있어서, 상기 LacI 계열 DNA 결합 전사 조절자 단백질은 코리네박테리움 속 유래인 것인, 미생물.
  3. 제1항에 있어서, 상기 LacI 계열 DNA 결합 전사 조절자 단백질은 서열번호 3의 아미노산 서열로 기재된 폴리펩타이드로 이루어지는 것인, 미생물.
  4. 제1항에 있어서, 상기 LacI 계열 DNA 결합 전사 조절자 단백질은 서열번호 4의 염기서열로 기재된 폴리뉴클레오타이드에 의해 코딩되는 것인, 미생물.
  5. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인, 미생물.
  6. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 LacI 계열 DNA 결합 전사 조절자 단백질의 활성이 약화되지 않은 모균주 또는 야생형에 비하여 L-글루탐산 생산능이 증가된, 미생물.
  7. LacI 계열 DNA 결합 전사 조절자 단백질의 활성이 약화된 코리네박테리움 속 미생물을 배지에서 배양하는 단계를 포함하는, L-글루탐산 생산방법.
  8. 제7항에 있어서, 상기 배양에 따른 배지 또는 미생물로부터 L-글루탐산을 회수하는 단계를 추가로 포함하는, L-글루탐산 생산방법.
  9. 제7항에 있어서, 상기 LacI 계열 DNA 결합 전사 조절자 단백질은 코리네박테리움 속 유래인 것인, L-글루탐산 생산방법.
  10. 제7항에 있어서, 상기 LacI 계열 DNA 결합 전사 조절자 단백질은 서열번호 3의 아미노산 서열로 기재된 폴리펩타이드로 이루어지는 것인, L-글루탐산 생산방법.
  11. 제7항에 있어서, 상기 LacI 계열 DNA 결합 전사 조절자 단백질은 서열번호 4의 염기서열로 기재된 폴리뉴클레오타이드에 의해 코딩되는 것인, L-글루탐산 생산방법.
  12. 제7항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인, L-글루탐산 생산방법.
  13. 제7항에 있어서, 상기 코리네박테리움 속 미생물은 LacI 계열 DNA 결합 전사 조절자 단백질의 활성이 약화되지 않은 모균주 또는 야생형에 비하여 L-글루탐산 생산능이 증가된, L-글루탐산 생산방법.
PCT/KR2022/010905 2021-07-26 2022-07-25 LacI 계열 DNA 결합 전사 조절자의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법 WO2023008862A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP22849838.2A EP4379056A1 (en) 2021-07-26 2022-07-25 Microorganism having weakened activity of laci family dna-binding transcriptional regulator, and l-glutamic acid production method using same
CA3224713A CA3224713A1 (en) 2021-07-26 2022-07-25 Microorganism having weakened activity of laci family dna-binding transcriptional regulator, and l-glutamic acid production method using same
AU2022319462A AU2022319462A1 (en) 2021-07-26 2022-07-25 Microorganism having weakened activity of laci family dna-binding transcriptional regulator, and l-glutamic acid production method using same
MX2024001279A MX2024001279A (es) 2021-07-26 2022-07-25 Microorganismo que tiene actividad debilitada del regulador transcripcional de union a adn de la familia laci, y metodo de produccion de acido l-glutamico usando el mismo.
JP2024504255A JP2024526994A (ja) 2021-07-26 2022-07-25 ＬａｃＩ系ＤＮＡ結合転写調節因子の活性が弱化した微生物およびこれを用いたＬ－グルタミン酸の生産方法
CN202280052622.1A CN117730152A (zh) 2021-07-26 2022-07-25 具有减弱的LacI家族DNA结合性转录调节因子活性的微生物及使用其的L-谷氨酸的生产方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0098072 2021-07-26
KR1020210098072A KR20230016505A (ko) 2021-07-26 2021-07-26 LacI 계열 DNA 결합 전사 조절자의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법

Publications (1)

Publication Number Publication Date
WO2023008862A1 true WO2023008862A1 (ko) 2023-02-02

Family

ID=85087016

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/010905 WO2023008862A1 (ko) 2021-07-26 2022-07-25 LacI 계열 DNA 결합 전사 조절자의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법

Country Status (10)

Country Link
EP (1) EP4379056A1 (ko)
JP (1) JP2024526994A (ko)
KR (1) KR20230016505A (ko)
CN (1) CN117730152A (ko)
AR (1) AR126567A1 (ko)
AU (1) AU2022319462A1 (ko)
CA (1) CA3224713A1 (ko)
MX (1) MX2024001279A (ko)
TW (1) TW202307201A (ko)
WO (1) WO2023008862A1 (ko)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100292299B1 (ko) 1999-03-22 2001-06-01 손경식 글루탐산 생산 미생물 및 이를 이용한 글루탐산 생산방법
US20020068336A1 (en) * 2000-08-26 2002-06-06 Degussa Ag Nucleotide sequences which code for the CcpA2 gene
US20020151001A1 (en) * 2000-08-26 2002-10-17 Degussa Ag Nucleotide sequences coding for the ccpA1 gene
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
US20110027840A1 (en) 2006-10-16 2011-02-03 Cj Cheiljedang Corporation Microorganism producing glutamic acid in high yield and a process of producing glutamic acid using the same
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof
KR20200136813A (ko) 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100292299B1 (ko) 1999-03-22 2001-06-01 손경식 글루탐산 생산 미생물 및 이를 이용한 글루탐산 생산방법
US20020068336A1 (en) * 2000-08-26 2002-06-06 Degussa Ag Nucleotide sequences which code for the CcpA2 gene
US20020151001A1 (en) * 2000-08-26 2002-10-17 Degussa Ag Nucleotide sequences coding for the ccpA1 gene
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
US20110027840A1 (en) 2006-10-16 2011-02-03 Cj Cheiljedang Corporation Microorganism producing glutamic acid in high yield and a process of producing glutamic acid using the same
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof
KR20200136813A (ko) 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"GenBank", Database accession no. WP_060564415.1
"Guide to Huge Computers", 1994, ACADEMIC PRESS
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
"NCBI", Database accession no. WP_060564343.1
APPL ENVIRON MICROBIOL, vol. 73, no. 4, 8 December 2006 (2006-12-08), pages 1308 - 19
ASAKURA YOKO, KIMURA EIICHIRO, USUDA YOSHIHIRO, KAWAHARA YOSHIO, MATSUI KAZUHIKO, OSUMI TSUYOSHI, NAKAMATSU TSUYOSHI: "Altered Metabolic Flux due to Deletion of odhA causes L-Glutamate Overproduction in Corynebacterium glutamicum", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 73, no. 4, 15 February 2007 (2007-02-15), US , pages 1308 - 1319, XP093010516, ISSN: 0099-2240, DOI: 10.1128/AEM.01867-06 *
ATSCHUL, [S.] [F., J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO, SIAM JAPPLIED MATH, vol. 48, 1988, pages 1073
DATABASE PROTEIN ANONYMOUS : "LacI family transcriptional regulator [Corynebacterium glutamicum] ", XP093029103, retrieved from NCBI *
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
DG GIBSON ET AL., NATURE METHODS, vol. 6, no. 5, May 2009 (2009-05-01)
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
NAKASHIMA N ET AL.: "Bacterial cellular engineering by genome editing and gene silencing", INT J MOL SCI, vol. 15, no. 2, 2014, pages 2773 - 2793, XP055376889, DOI: 10.3390/ijms15022773
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RAVCHEEV DMITRY A., KHOROSHKIN MATVEI S., LAIKOVA OLGA N., TSOY OLGA V., SERNOVA NATALIA V., PETROVA SVETLANA A., RAKHMANINOVA ALE: "Comparative genomics and evolution of regulons of the LacI-family transcription factors", FRONTIERS IN MICROBIOLOGY, vol. 5, XP093029104, DOI: 10.3389/fmicb.2014.00294 *
RICE ET AL.: "Trends Genet.", vol. 16, 2000, article "EMBOSS: The European Molecular Biology Open Software Suite", pages: 276 - 277
SAMBROOK ET AL., MOLECULAR CLONING, 2012
SITNICKA ET AL.: "Functional Analysis of Genes", ADVANCES IN CELL BIOLOGY, vol. 2, 2010, pages 1 - 16
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
WEINTRAUB, H. ET AL.: "Antisense-RNA as a molecular tool for genetic analysis", REVIEWS - TRENDS IN GENETICS, vol. 1, no. 1, 1986

Also Published As

Publication number Publication date
EP4379056A1 (en) 2024-06-05
TW202307201A (zh) 2023-02-16
MX2024001279A (es) 2024-02-15
AR126567A1 (es) 2023-10-25
JP2024526994A (ja) 2024-07-19
CA3224713A1 (en) 2023-02-02
KR20230016505A (ko) 2023-02-02
CN117730152A (zh) 2024-03-19
AU2022319462A1 (en) 2024-01-18

Similar Documents

Publication Publication Date Title
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022231368A1 (ko) 신규한 글루타메이트 합성 효소 서브 유니트 알파 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022231369A1 (ko) 신규한 포르메이트 의존성 포스포리보실글리신아미드 포밀 전이효소 변이체 및 이를 이용한 imp 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163923A1 (ko) 신규한 atp 포스포리보실트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163939A1 (ko) 신규한 mfs 트랜스포터 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022215796A1 (ko) 신규한 전사 조절자 변이체 및 이를 이용한 l-발린 생산 방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163914A1 (ko) 신규한 미코티온 리덕타제 변이체 및 이를 이용한 l-라이신 생산 방법
WO2023008862A1 (ko) LacI 계열 DNA 결합 전사 조절자의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법
WO2022163924A1 (ko) 신규한 5,10-메틸렌테트라하이드로폴레이트 리덕타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163941A1 (ko) 신규한 스퍼미딘 신타아제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163919A1 (ko) 신규한 우레아제 부속 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163926A1 (ko) 신규한 프롤린 탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163938A1 (ko) 신규한 리보뉴클레아제 p 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163921A1 (ko) 신규한 스퍼미딘 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163940A1 (ko) 신규한 갈락토사이드 o-아세틸트랜스퍼라제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163937A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22849838

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3224713

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2022319462

Country of ref document: AU

Ref document number: 806753

Country of ref document: NZ

Ref document number: AU2022319462

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2401000012

Country of ref document: TH

WWE Wipo information: entry into national phase

Ref document number: 202437001901

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2022319462

Country of ref document: AU

Date of ref document: 20220725

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12024550159

Country of ref document: PH

ENP Entry into the national phase

Ref document number: 2024504255

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2024/001279

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 202280052622.1

Country of ref document: CN

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112024001514

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2022849838

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 11202400237R

Country of ref document: SG

ENP Entry into the national phase

Ref document number: 2022849838

Country of ref document: EP

Effective date: 20240226

ENP Entry into the national phase

Ref document number: 112024001514

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20240125