WO2023003471A1 - Method for producing cultured fat for animal consumption. - Google Patents

Method for producing cultured fat for animal consumption. Download PDF

Info

Publication number
WO2023003471A1
WO2023003471A1 PCT/NL2022/050432 NL2022050432W WO2023003471A1 WO 2023003471 A1 WO2023003471 A1 WO 2023003471A1 NL 2022050432 W NL2022050432 W NL 2022050432W WO 2023003471 A1 WO2023003471 A1 WO 2023003471A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell surface
cell
surface marker
cells
absence
Prior art date
Application number
PCT/NL2022/050432
Other languages
French (fr)
Inventor
Richard Gerardus Johannes DOHMEN
Joshua Edwin FLACK
Laura JACKISCH
Johanna MELKE
Tobias MESSMER
Original Assignee
Mosa Meat B.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mosa Meat B.V. filed Critical Mosa Meat B.V.
Publication of WO2023003471A1 publication Critical patent/WO2023003471A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0653—Adipocytes; Adipose tissue
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/14—Pretreatment of feeding-stuffs with enzymes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/20—Animal feeding-stuffs from material of animal origin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/158—Fatty acids; Fats; Products containing oils or fats
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L13/00—Meat products; Meat meal; Preparation or treatment thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0658—Skeletal muscle cells, e.g. myocytes, myotubes, myoblasts
    • C12N5/0659—Satellite cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0667—Adipose-derived stem cells [ADSC]; Adipose stromal stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0668—Mesenchymal stem cells from other natural sources
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/05—Inorganic components
    • C12N2500/10—Metals; Metal chelators
    • C12N2500/20—Transition metals
    • C12N2500/24—Iron; Fe chelators; Transferrin
    • C12N2500/25—Insulin-transferrin; Insulin-transferrin-selenium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/32—Amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/38—Vitamins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/90—Serum-free medium, which may still contain naturally-sourced components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/11—Epidermal growth factor [EGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/135—Platelet-derived growth factor [PDGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/165—Vascular endothelial growth factor [VEGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30—Hormones
    • C12N2501/33—Insulin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • C12N2506/1323—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from skeletal muscle cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2513/00—3D culture

Definitions

  • the invention is in the field of cell culturing, and relates to methods for production of cultured fat cells.
  • the present invention relates to methods for production of cultured fat cells from fibro-adipogenic progenitor (FAP) cells for human consumption, and to food products such as cultured fat products comprising those cells.
  • FAP fibro-adipogenic progenitor
  • the invention is also in the field of the production of cultured meat products that include cultured fat cells obtained in accordance with the present invention and cultured muscle cells.
  • FAP fibro-adipogenic progenitor
  • Meat comprises muscle cells and fat cells.
  • a hamburger contains around 87.5% muscle tissue and 12.5% fat tissue.
  • Cultured meat products ideally mimic traditional meat products in order to be most appealing for human consumption, and should therefore also comprise both muscle and fat cells.
  • One important parameter is the composition of cultured fat, which should preferably closely resemble fat from traditional meat products, as it greatly contributes to flavor and texture. It was hitherto unknown whether cultured fat could be produced that closely resembles fat from traditional meat products and whether it therefore could provide for an acceptable substitute.
  • the choice of progenitor fat cell type might be a relevant parameter, potentially together with progenitor cell purification methodology.
  • Different fat cells may produce different lipid profiles and may also vary in terms of lipid accumulation and distribution.
  • the field of cultured fat and/or meat production is a relatively new field and practical guidance in relation to these aspects is currently absent.
  • some general suggestions are provided in relation to cultured meat production, such as, amongst others, that there are multiple potential starting cell types for fat tissue production (Melzener et al., J Sci Food Agric.2020; 101: 7-14), it was hitherto unknown how these suggestions could be practically implemented in advantageous and reproducible cultured fat and/or meat production methods.
  • FAP fibro-adipogenic progenitor
  • Upregulated cell surface markers on SC cells are listed in Table 2. It was found that the generated cultured fat tissue mimicked the properties of cow-derived subcutaneous fat tissue in terms of lipid accumulation, profile, texture and appearance. In addition, it was observed that cultured fat produced in accordance with methods of the invention showed a higher relative percentage of unsaturated triglycerides compared to (uncultured) bovine subcutaneous fat tissue and muscle tissue and is therefore distinguishable from (uncultured) bovine subcutaneous fat tissue and muscle tissue. It is generally known that unsaturated triglycerides are healthier than saturated triglycerides. Another advantage of FAPs is the high level of lipid accumulation that is observed for these cells upon adipogenic differentiation.
  • the invention provides a method for producing cultured fat cells for animal consumption, comprising the steps of: - providing a fibro-adipogenic progenitor (FAP) cell; - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells; - culturing said expanded population of FAP cells in a culture medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells.
  • the FAP cell is a bovine FAP cell.
  • the method is a method for producing cultured fat cells for human consumption.
  • the FAP cell that is provided is obtainable by a method comprising the steps of: - providing a muscle tissue sample, preferably a bovine muscle tissue sample, comprising a progenitor cell; - optionally, removing excess fat and/or fibrous tissue from said sample if present; - optionally, subjecting said sample to enzymatic digestion, preferably using a matrix metalloproteinase such as a collagenase; - optionally, subjecting said optionally digested sample to an erythrocyte lysis buffer; - optionally, (pre)culturing said optionally digested and optionally erythrocyte-lysed sample in a culture medium for expanding FAP cells; - purifying a progenitor cell that is a FAP cell from said sample so as to provide a FAP cell.
  • the method comprises the following steps, preceding said step of providing a fibro-adipogenic progenitor (FAP) cell: - providing a muscle tissue sample, preferably a bovine muscle tissue sample, comprising a progenitor cell; - optionally, removing excess fat and/or fibrous tissue from said sample if present; - optionally, subjecting said sample to enzymatic digestion, preferably using a matrix metalloproteinase such as a collagenase; - optionally, subjecting said optionally digested sample to an erythrocyte lysis buffer; - optionally, (pre)culturing said optionally digested and optionally erythrocyte-lysed sample in a culture medium for expanding FAP cells; and - purifying a progenitor cell that is a FAP cell from said sample so as to provide a FAP cell.
  • FAP fibro-adipogenic progenitor
  • the step of purifying a progenitor cell that is a FAP cell from said muscle tissue sample is performed by antigen-based cell sorting, e.g. fluorescence activated cell sorting (FACS).
  • antigen-based cell sorting e.g. fluorescence activated cell sorting (FACS)
  • FACS fluorescence activated cell sorting
  • the antigen-based cell sorting is performed on the basis of (i) the presence of at least one cell surface marker selected from Table 1, optionally in combination with the absence of at least one cell surface marker selected from Table 2.
  • the antigen-based cell sorting such as fluorescence activated cell sorting (FACS) is performed on the basis of (i) the presence of at least one cell surface marker selected from the group consisting of CD140a (PDGFRa), CD14, CD49e (ITGA5), CD61 (ITGB3), CD9 and ITGA9 and/or (ii) the absence of at least one cell surface marker selected from the group consisting of ITGA7, CD45, CD321 (F11R) and CD56 (NCAM1).
  • FACS fluorescence activated cell sorting
  • the antigen-based cell sorting such as fluorescence activated cell sorting (FACS) is performed on the basis of (i) the presence of at least one cell surface marker selected from the group consisting of CD140a (PDGFRa), CD14, CD49e (ITGA5), CD61 (ITGB3) and ITGA9 and/or (ii) the absence of cell surface markers ITGA7 and CD56 (NCAM1).
  • FACS fluorescence activated cell sorting
  • the method further comprises the step of: - purifying differentiated fat cells.
  • the method further comprises the step of: - incorporating said optionally purified cultured fat cells in a food product, preferably a cultured fat product or cultured meat product, for animal consumption.
  • the culture medium for expanding FAP cells and/or said culture medium for differentiating FAP cells is a serum-free medium, preferably a serum-free medium entirely free of animal components.
  • said culture medium for expanding FAP cells is a serum-free medium, and wherein said serum-free medium comprises: - an albumin; and - a fibroblast growth factor (FGF) such as FGF2.
  • FGF fibroblast growth factor
  • said culture medium for differentiating FAP cells is a serum- free medium
  • said serum-free medium comprises: - at least one peroxisome proliferator-activated receptor gamma (PPARy) agonist; - at least one hormone selected from the group consisting of insulin and hydrocortisone; - at least one cytokine and/or growth factor selected from the group consisting of bone morphogenetic protein 4 (BMP4) and epidermal growth factor (EGF); and - ascorbic acid or a derivative thereof.
  • PPARy peroxisome proliferator-activated receptor gamma
  • BMP4 bone morphogenetic protein 4
  • EGF epidermal growth factor
  • said method is a method for producing cultured fat cells and cultured muscle cells for animal consumption, and wherein said method further comprises the steps of: - providing a muscle progenitor cell, preferably a satellite cell; - culturing said muscle progenitor cell in a culture medium for expanding muscle progenitor cells to thereby provide an expanded population of muscle progenitor cells; - culturing said expanded population of muscle progenitor cells in a culture medium for differentiating muscle progenitor cells to thereby differentiate muscle progenitor cells into muscle cells; - optionally, purifying differentiated muscle cells; - optionally, incorporating said differentiated muscle cells together with said differentiated fat cells in a food product, preferably a cultured meat product, for animal consumption.
  • said method is a method for producing cultured fat cells and cultured muscle cells for human consumption.
  • said muscle progenitor cell is a bovine muscle progenitor cell, preferably a bovine satellite cell (SC).
  • said FAP cell and said muscle progenitor cell are obtainable by a method comprising the steps of: - providing a muscle tissue sample, preferably a bovine muscle tissue sample, comprising a FAP cell and a muscle progenitor cell; - optionally, removing excess fat and/or fibrous tissue from said sample if present; - optionally, subjecting said sample to enzymatic digestion, preferably using a matrix metalloproteinase such as a collagenase; - optionally, subjecting said optionally digested sample to an erythrocyte lysis buffer; - optionally, (pre)culturing said optionally digested and optionally erythrocyte-lysed sample in a culture medium for expanding FAP cells and muscle progenitor cells; - purifying a progenitor cell that is a FAP cell and a muscle progenitor cell from said sample so as to provide a FAP cell and
  • said step of purifying a progenitor cell that is a FAP cell and said step of purifying a progenitor cell that is a muscle progenitor cell are performed by antigen-based cell sorting such as fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • said antigen-based cell sorting such as fluorescence activated cell sorting (FACS)
  • FACS fluorescence activated cell sorting
  • said antigen-based cell sorting such as fluorescence activated cell sorting (FACS) in order to purify said muscle progenitor cell is performed on the basis of the presence of a cell surface marker selected from the group consisting of ITGA7 and CD56 (NCAM1) and/or (ii) the absence of a cell surface marker selected from the group consisting of CD140a (PDGFRa), CD14, CD49e (ITGA5), CD61 (ITGB3) and ITGA9.
  • FACS fluorescence activated cell sorting
  • said FAP cell and said muscle progenitor cell are purified from the same muscle tissue sample and/or are separated from each other during the same antigen-based cell sorting procedure, such as FACS procedure, followed by separate expansion and differentiation into fat cells and muscle cells, respectively.
  • said culture medium for expanding muscle progenitor cells is a serum-free medium, and wherein said serum-free medium comprises: - an albumin; and - a fibroblast growth factor (FGF) such as FGF2.
  • FGF fibroblast growth factor
  • said medium for differentiating muscle progenitor cells is a serum-free medium
  • said serum-free medium comprises: - at least one differentiation inducer selected from the group consisting of a lysophosphatidic acid receptor 1 (LPAR1) agonist, a lysophosphatidic acid receptor 3 (LPAR3) agonist, an oxytocin receptor (OXTR) agonist, a glucagon receptor (GCGR) agonist and a lactate.
  • LPAR1 lysophosphatidic acid receptor 1
  • LPAR3 lysophosphatidic acid receptor 3
  • OXTR oxytocin receptor
  • GCGR glucagon receptor
  • said step of - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells, and/or the step of – culturing said muscle progenitor cell in a medium for expanding muscle progenitor cells to thereby provide an expanded population of muscle progenitor cells is two-dimensional or three-dimensional cell culturing, such as microcarrier-based cell culturing.
  • said step of: - culturing said expanded population of FAP cells in a medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells and/or the step of: - culturing said expanded population of muscle cell progenitor cells in a medium for differentiating muscle progenitor cells to thereby differentiate muscle progenitor cells into muscle cells, is two-dimensional or three-dimensional cell culturing, such as culturing in a hydrogel, preferably a hydrogel comprising alginate.
  • the invention provides a food product for animal consumption, comprising: - a cultured fat cell obtainable by a method according to any one of the previous aspects and/or embodiments; and - optionally, a cultured muscle cell obtainable by a method according to any one of the previous aspects and/or embodiments.
  • said food product is a cell culture-based food product.
  • said food product is a cultured fat product or cultured meat product.
  • said food product comprises cultured fat with a different triglyceride composition compared to the triglyceride composition of a (preferably bovine) subcutaneous fat tissue, preferably (i) wherein the relative contribution of unsaturated triglycerides, preferably triglycerides with a single unsaturation, to the total amount of triglycerides is higher in cultured fat as compared to the relative contribution of unsaturated triglycerides, preferably triglycerides with a single unsaturation, to the total amount of triglycerides in said (preferably bovine) subcutaneous fat tissue or (ii) wherein the relative contribution of saturated triglycerides to the total amount of triglycerides is lower in said cultured fat as compared to the relative contribution of saturated triglycerides to the total amount of triglycerides in said (preferably bovine) subcutaneous fat tissue; - does not comprise inflammatory cells such as immune cells;
  • said food product comprises cultured fat with a different triglyceride composition compared to the triglyceride composition of a (preferably bovine) subcutaneous fat tissue, preferably (i) wherein the relative contribution of unsaturated triglycerides, preferably triglycerides with a single unsaturation, to the total amount of triglycerides is higher in cultured fat as compared to the relative contribution of unsaturated triglycerides, preferably triglycerides with a single unsaturation, to the total amount of triglycerides in said (preferably bovine) subcutaneous fat tissue or (ii) wherein the relative contribution of saturated triglycerides to the total amount of triglycerides is lower in said cultured fat as compared to the relative contribution of saturated triglycerides to the total amount of triglycerides in said (preferably bovine) subcutaneous fat tissue; - does not comprise antibiotics and/or antibiotic residues;
  • the invention provides a use of a fibro-adipogenic progenitor (FAP) cell in the production of cultured fat for animal, preferably human, consumption.
  • FAP fibro-adipogenic progenitor
  • FIG. 1 Isolation and purification of fibro-adipogenic progenitor (FAP) cells.
  • SCs satellite cells
  • FAPs Fibro-adipogenic progenitors
  • SFM1 serum-free proliferation medium identified hereinbelow as “SFM1” in Example 1.
  • PDGFRA+ or ITGA5+/ITGA7- FAPs and PDGFRA- or ITGA5-/ITGA7+ satellite cells (SCs) are indicated.
  • HCA High Content Analyzer
  • Fig. 2 Bioinformatic characterisation of FAP cells.
  • FIG. 3 Characterisation of FAP cell surface expression profiles.
  • FIG. 6 Adipogenic differentiation of FAPs in 3-dimensional hydrogels.
  • A) Maximum intensity projection confocal microscopy images of control (top panels) and adipogenic differentiation induced (bottom) FAP microfibers stained with BODIPY and Hoechst on days 0, 14 and 28 of differentiation. Scale bar 100 ⁇ m.
  • B) Quantification of the lipid droplet volume in A. **** P ⁇ 0.0001.
  • Fig. 7 Adipose Tissue Analysis.
  • D) As C, but with relative percentage of acyl chains containing 0-6 saturations. Data is shown as mean ⁇ sd (n 3).
  • cultured includes reference to the cell cultures of the cells disclosed herein and may refer, depending on the method and type of medium used, to propagation and/or proliferation (expansion) of adipogenic progenitor cells and/or muscle progenitor cells such as bovine fibro-adipogenic progenitor cells and bovine muscle progenitor cells, or to differentiation of bovine adipogenic progenitor cells and/or bovine muscle progenitor cells into adipocytes and muscle cells, respectively.
  • a method of the invention may also be employed to differentiate other non-human, mammalian progenitor cells such as ovine, porcine or murine fibro-adipogenic progenitor cells and/or muscle progenitor cells such as satellite cells (SCs). Therefore, any embodiment described herein in relation to bovine fibro-adipogenic progenitor cells and/or bovine muscle progenitor cells, is also applicable to ovine (such as sheep), porcine (such as pig) and murine (such as mice) progenitor cells, i.e. progenitor cells of ovine, porcine or murine origin.
  • ovine such as sheep
  • porcine such as pig
  • murine such as mice
  • the fibro-adipogenic progenitor cell is a muscle-derived fibro-adipogenic progenitor cell.
  • the adipogenic progenitor cell as disclosed herein is derived from a muscle tissue sample, preferably a skeletal muscle tissue sample, for instance by taking a biopsy.
  • the term ‘fat cell’, as used herein, can be used interchangeably with the term ‘adipocyte’.
  • Adipocytes may be categorized as forming white adipose tissue or brown adipose tissue. Adipocytes are found throughout the body. Adipocytes synthesize and store fat, including but not limited to lipids and triglycerides.
  • for animal consumption includes reference to products and components that are not harmful to healthy, non-allergic animals when consumed under normal circumstances and normal use.
  • for human consumption includes reference to products and components that are not harmful to healthy, non-allergic humans when consumed under normal circumstances and normal use.
  • Bovine as used herein, includes reference to any member of the subfamily Bovinae.
  • the subfamily Bovinae includes the tribes Bovini, Tragelaphini and Boselaphini.
  • bovine as disclosed herein refers to the members of the subfamily Bovinae that are used for human consumption.
  • Non- limiting examples of such members include domestic cattle (Bos taurus and subspecies Bos taurus taurus; Bos taurus indicus), gaur (Bos gaurus), gayal or mithun (Bos frontalis), yak (Bos grunniens; Bos mutus), banteng (Bos javanicus), water buffalo (Bubalus arnee; Bubalus bubalis), American bison (Bison bison), giant eland (Taurotragus derbianus), common eland (Taurotragus oryx), kudu (Tragelaphus strepsiceros; Tragelaphus imberbis), and nilgai (Boselaphus tragocamelus).
  • Bos taurus and its subspecies are Bos taurus and its subspecies.
  • FAP cells generally reside in skeletal muscle and play a role in the production of new myofibers by muscle satellite cells.
  • FAP cells can be purified from muscle tissue samples by methods involving antigen-based cell sorting such as FACS based e.g. on upregulated cell surface markers as listed in Table 1 and optionally the absence of cell surface markers listed in Table 2.
  • FAPs expressed CD9, CD14, CD49e (ITGA5), CD61 (ITGB3), CD140a (PDGFRA), and ITGA9 (Fig. 3A).
  • FAPs lacked expression of hematopoietic marker CD45, endothelial marker CD321 (F11R), and the myogenic progenitor markers CD56 (NCAM1) and ITGA7 (Fig. 3C).
  • FAP cells are inter alia characterized by CD31-, CD45- and integrin ⁇ 7-.
  • the FAP cell is a bovine FAP cell.
  • the terms ‘expansion’ and ‘proliferation’, as used herein, can be used interchangeably.
  • progenitor cells such as bovine progenitor cells
  • progenitor cells are generating other progenitor cells by cell proliferation.
  • Such an expanded progenitor cell population can subsequently be cultured in a differentiation media for differentiating said progenitor cells into muscle cells or fat cells that can subsequently be incorporated into a cell-culture based fat or meat product for human consumption.
  • sufficient amounts of progenitor cells such as bovine progenitor cells, need to be produced by expansion / proliferation.
  • expansion population includes reference to an unspecified number of cells that have previously been subjected to a step of expansion / proliferation.
  • culture medium includes reference to a preferably liquid composition that supports cellular proliferation and/or expansion and/or differentiation by providing the components needed.
  • a medium may be provided in liquid or powdered format. Supplementation may be required for proliferation and/or expansion depending on the cell type.
  • a medium may contain or be supplemented with one or more components selected from the non-limiting group consisting of amino acids, lipids, sugars, carbohydrates, anions, cations, buffering agents, colorants, vitamins, antioxidants, hormones, enzymes, proteins and trace elements.
  • the terms ‘differentiating’ and ‘differentiation’, as used herein, include reference to the process of specialization of cells.
  • muscle tissue sample includes reference to an ex vivo biopsy of the muscle of an animal.
  • the muscle tissue sample may be obtained via needle biopsy or incision biopsy.
  • a muscle tissue sample may either be freshly obtained or pre-digested, i.e. subjected to incubation with proteinases such as matrix metalloproteinases such as a collagenase so as to breakdown ECM and release cells; thus, a muscle tissue sample may have gone through different stages of processing.
  • a muscle tissue sample as disclosed herein is a skeletal muscle tissue sample, i.e. a tissue sample of the skeletal muscle of an animal. Skeletal muscle is typically striated and is activated by the central nervous system.
  • a muscle tissue sample is a semitendinosus muscle tissue sample.
  • the adipogenic progenitor cell is obtained from a (skeletal) muscle tissue sample that is derived from a cadaver, or from a living non- human animal e.g. by taking a biopsy.
  • the term ‘progenitor cell’, as used herein, includes reference to a cell that is able to differentiate into a more specialized cell.
  • Progenitor cell can be used interchangeably with the term ‘precursor cell’.
  • Progenitor cells may for example be stem cells, satellite cells, intermediate progenitor cells, radial glial cells, bone marrow stromal cells, periosteum, pancreatic progenitor cells, angioblasts, blast cells or fibro-adipogenic progenitor cells. No limitation to the stage of development is intended.
  • Progenitor cells as disclosed herein may have any potency, such as pluripotent, multipotent or oligopotent progenitor cells, and can be induced pluripotent stem cells (iPSC).
  • iPSC induced pluripotent stem cells
  • Non-limiting examples of progenitor cells are FAP cells, which may for example differentiate into fat cells, and satellite cells, which may for example differentiate into muscle cells.
  • the term ‘purifying’, as used herein, includes reference to the purification or sorting of a specified cell type or a group of cells from specified cell types, or the exclusion of one or more cell types from a sample. Purification or sorting of cells may be done using antigen-based cell sorting, such as FACS.
  • isolated includes reference to the processing of a muscle tissue sample, wherein the cells that are part of the tissue sample are to become detached from other cells and other components of the tissue sample.
  • isolating involves digestion with one or more enzyme that is able to break down the extracellular matrix, such as collagenase, and may also involve erythrocyte lysis.
  • enzyme that is able to break down the extracellular matrix, such as collagenase, and may also involve erythrocyte lysis.
  • antigen-based cell sorting includes reference to any protocol that allows for sorting of cell types on the basis of the presence or absence of cell surface markers.
  • Non-limiting examples of antigen-based cell sorting protocols are protocols that employ fluorescently labelled antibodies, such as FACS, or protocols that are based on magnetic labelling or isotope labelling of the cell surface marker-binding antibodies.
  • the antigen-based cell sorting is fluorescence-activated cell sorting.
  • FACS fluorescence activated cell sorting
  • cellular components preferably cell surface markers, attach to labeled reporters.
  • the reporters are antibodies that are labeled with fluorophores or quantum dots.
  • FACS includes reference to sorting, cells do not necessarily have to be sorted in order for the procedure to be called FACS.
  • the cells are sorted based on their attachment to fluorescent reporter(s), which is also referred to as cell purification.
  • cells are alive during and directly following FACS.
  • FACS procedure may include reference to the process of cell analysis and optionally cell sorting using FACS.
  • cell surface marker includes reference to proteins that are present on the surface of a cell and that are used to identify cell types. Cell surface markers have a variety of functionalities. Cell surface markers are often indicated by a CD number in the cluster of differentiation (CD) protocol. Antigen-based cell sorting, such as FACS, can be used for the identification of cells by employing cell surface markers.
  • FAP cells examples include CD140a (also referred to as PDGFR ⁇ , PDGFRa or PDGFRA), CD9, CD14, CD49e (also referred to as ITGA5), CD61 (also referred to as ITGB3) and ITGA9.
  • FAPs lack (or have a reduced) expression of ITGA7, CD45 (also referred to as PTPRC), CD321 (also referred to as F11R, JAM-1 and JAM-A) and CD56 (also referred to as NCAM1).
  • pregen-based cell sorting such as FACS, includes reference to the discrimination between cell types on the basis of differential expression of cell surface marker proteins (antigens).
  • antigen-based cell sorting such as FACS allows for discrimination between cell types on the basis of (i) cell surface markers that are expressed on a cell to such an extent that they can be used as a positive selection criterion (i.e. presence; “+”) or (ii) cell surface markers that have a lower or reduced expression on a cell to such an extent that they can be used as a negative selection criterion (i.e. absence, “-”).
  • antigen-based cell sorting e.g. FACS
  • FACS antigen-based cell sorting
  • CD140a and PGFRa as used herein, also referred to as platelet-derived growth factor receptor A, include reference to a cell surface marker and receptor.
  • CD140a is known to be expressed in for example Leydig cells (testicle), Peritubular cells (testicle), fibroblasts (connective tissue), Ito cells (liver), melanocytes (skin)
  • ITGA7 as used herein, also referred to as integrin subunit alpha 7, includes reference to a cell surface marker and receptor.
  • ITGA7 is known to be expressed in for example Sertoli cells (testicle), cardiomyocytes, smooth muscle cells and skeletal muscle cells.
  • CD9 includes reference to a cell surface marker and glycoprotein that is a member of the transmembrane 4 superfamily, also referred to as the tetraspanin family.
  • CD14 includes reference to a cell surface marker and protein that plays a role as a receptor in the innate immune system.
  • CD49e as used herein, also referred to as ITGA5, includes reference to a cell surface marker and membrane protein.
  • CD61 as used herein, also referred to as integrin beta-3 and ITGB3, includes reference to a cell surface marker and protein that is a member of the integrin protein family.
  • ITGB9 includes reference to a cell surface marker and protein that is a member of the integrin protein family.
  • CD45 as used herein, also referred to as protein tyrosine phosphatase receptor type C or PTPRC, includes reference to a cell surface marker and enzyme belonging to the protein tyrosine phosphatase family.
  • CD321 also referred to as F11R and junction adhesion molecule A, includes reference to a cell surface marker and protein related to assembly of tight junctions.
  • CD56 as used herein, also referred to as neural cell adhesion molecule and NCAM, includes reference to a cell surface marker and glycoprotein of the immunoglobulin superfamily.
  • incorporating includes reference to the production of a fat or meat product using cultured fat cells optionally in combination with cultured muscle cells.
  • food product as used herein, includes reference to products that are suitable for human consumption.
  • cell-culture based food product as used herein, includes reference to food products that are manufactured by incorporating cells grown ex vivo or in vitro into a food product, optionally in combination with other cell-culture based components and/or other components.
  • the food product of the invention comprises cultured fat cells, cultured fat tissue, or fat produced by cultured fat cells or cultured fat tissue.
  • Particularly preferred food products of the invention are meat products, which also include (cultured) muscle cells.
  • a meat product generally comprises muscle tissue and fat tissue.
  • Non-limiting examples of a meat product of the invention are a hamburger, a sausage, a steak, minced meat, a meatball, corned beef, a charcuterie product, jerky or stewed meat.
  • Meat products also covers the combination of several types of meat products.
  • suspension culture includes reference to different types of suspension culture such as microcarrier-based cell culture.
  • the expansion or proliferation of progenitor cells as described herein is performed using a microcarrier-based cell culture.
  • a microcarrier-based cell culture preferably involves growing progenitor cells on the surface of microcarriers in suspension cultures.
  • suspension culture refers to suspension cell culture, where cells are cultured in suspensions or aggregates and are not attached to a surface such as a microcarrier surface.
  • expansion or proliferation of progenitor cells as described herein is performed by suspension cell culture.
  • hydrogel as used herein, includes reference to polymers with hydrophilic properties.
  • Hydrogels may be formed by a variety of compounds, such as alginate, agarose, methylcellulose, hyaluronan, elastin-like polypeptides, collagen, chitosan, gelatin and starch. Hydrogels may be advantageously employed in the three-dimensional culturing and differentiation of cells, for example for the achievement of cultured fat.
  • the hydrogel as disclosed herein comprises alginate.
  • serum-free includes reference to the absence of animal serum such as fetal bovine serum (FBS).
  • animal-derived as used herein, includes reference to components that are produced by an animal.
  • Non-limiting examples of animal- derived components are fetal bovine serum, and components isolated from fetal bovine serum. Not animal-derived are for instance recombinantly produced animal proteins or peptides and any other component not produced by an animal but synthesized e.g. in the laboratory. If a medium as disclosed herein does not comprise any components or ingredients that are animal-derived, then the medium is animal component-free. Preferably, a serum-free medium as disclosed herein does not comprise components that are derived (obtained) from an animal.
  • fibroblast growth factor and ‘FGF’, as used herein, include reference to proteins that can stimulate growth and differentiation of animal cells, amongst other functions. FGFs bind to a fibroblast growth factor receptor (FGFR).
  • FGFR fibroblast growth factor receptor
  • FGFs are preferably recombinantly produced.
  • the FGF as disclosed herein is a recombinant FGF.
  • the FGF as disclosed herein is FGF2.
  • fibroblast growth factor and ‘FGF, as used herein, may also include reference to fragments of FGF that retain the biological function of FGF, such as FGF replacement peptides.
  • cytokine as used herein, includes reference to proteins that are involved in cell signaling, more specifically cell signaling related to or associated with the immune system and/or morphogenic pathways. Cytokines may be constituents of media, for example for the induction of expansion and/or differentiation.
  • growth factor includes reference to members of a class of signal molecules that generally have an effect on cell proliferation, growth and/or death. Growth factors may be constituents of media, for example for the induction of expansion and/or differentiation.
  • the terms ‘peroxisome proliferator-activated receptor gamma’, ‘PPARG and ‘PPAR ⁇ ’, as used herein, include reference to a nuclear receptor that is present in cells of different tissue types such as adipose tissue, colon, rumen and placenta, and in macrophages. Alternative names of PPAR ⁇ include NR1C3 and glitazone receptor.
  • PPAR ⁇ agonist includes reference to any chemical that binds to or interacts with PPAR ⁇ , which results or may under certain circumstances result in a biological response.
  • PPAR ⁇ agonist includes reference to endogenous agonists, co-agonists, full agonists, partial agonists, selective agonists, superagonists, inverse agonists, irreversible agonists and biased agonists.
  • PPAR ⁇ agonists include indomethacin, magnolol, amorfrutins (comprising, for example, amorfrutin 1, amorfrutin 2, amorfrutin A, amorfrutin B, amorfrutin C and amorfrutin D), honokiol, lecithine (such as L- ⁇ - lecithine from soy beans), formononetin, bixin, norbixin, catechin, ⁇ 9- tetrahydrocannabinol, (9S, 13R)-12-oxo-phytodienoic acid, odoratin, hydroxy unsaturated fatty acids from Coix lacrymajobi, commipheric acid, glabrone, kaempferol-3-O- ⁇ -glucopyranoside, deoxyelephantopin, acetylated flavonol glycosides, kampferol, citral, alkamides from Echinacae purpera
  • biogenic amine includes reference to a substance that can be produced by life forms and that comprises one or more amine groups. Included in the group of biogenic amines are monoamines and polyamines. Examples of the group of monoamines are ethanolamine and phenylethanolamine. Examples of the group of polyamines are putrescine, agmatine, cadaverine, spermine and spermidine.
  • Putrescine may be produced chemically or biochemically.
  • EGF epidermal growth factor receptor
  • EGFs bind to epidermal growth factor receptor (EGFR).
  • EGFs are preferably recombinantly produced.
  • the EGF as disclosed herein is a recombinantly produced EGF.
  • the terms ‘epidermal growth factor’ and ‘EGF’, as used herein may also include reference to fragments of EGF that retain the biological function of EGF, such as EGF replacement peptides.
  • the term ‘ascorbic acid’ includes reference to a compound represented by the formula C6H8O6. Ascorbic acid is otherwise referred to as vitamin C. Ascorbic acid may be produced chemically or biochemically.
  • the terms ‘bone morphogenetic protein’ and ‘BMP’, as used herein, include reference to a group of growth factors that can be found in the animal body. This group comprises the BMP proteins BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8a, BMP8b, BMP10, BMP11 and BMP15.
  • the BMP as disclosed herein is BMP4.
  • the BMP4 as disclosed herein is recombinantly produced, and can be a human BMP4.
  • the terms ‘bone morphogenetic protein 4’ and ‘BMP4’, as used herein, may also include reference to fragments of BMP4 that retain the biological function of BMP4, such as BMP4 replacement peptides.
  • the term ‘lipid’, as used herein in relation to a source of lipids, includes reference to hydrophobic or partially hydrophobic hydrocarbon molecules such as fatty acids, glycerolipids, glycerophospholipids, sphingolipids, sterols, prenols, saccharolipids and polyketides.
  • a source of lipids is provided as a (chemically defined) lipid concentrate, which can be a mixture of lipids in emulsion.
  • a chemically defined lipid concentrate as disclosed herein may comprise one or more of arachidonic acid, cholesterol, dl- alpha-tocopherol acetate, ethyl alcohol, linoleic acid, linolenic acid, myristic acid, oleic acid, palmitic acid, palmitoleic acid, stearic acid and/or Tween 80.
  • a chemically defined lipid concentrate as disclosed herein comprises a combination of some or all the above-listed compounds.
  • basal medium includes reference to a preferably liquid medium that supports cellular growth by providing essential components for growth.
  • a basal medium may be provided in liquid or powdered format.
  • a basal medium that is not supplemented with any compound may enable cellular growth, but supplementation may be required for growth depending on the cell type.
  • a basal medium may be supplemented with one or more components selected from the non-limiting group consisting of amino acids, lipids, sugars, carbohydrates, anions, cations, buffering agents, colorants, vitamins, antioxidants, hormones, enzymes, proteins and trace elements.
  • the basal medium as disclosed herein is a commercially available basal medium.
  • muscle progenitor cell includes reference to a cell that is capable of giving rise to a muscle cell or to form muscle tissue.
  • the term “muscle progenitor cell” may include reference to multipotent or pluripotent stem cells such as multipotent stromal cells (mesenchymal stem cells) with the capacity for self-renewal and multipotential differentiation into inter alia fat cells (adipocytes) and muscle cells (myocytes).
  • a preferred muscle progenitor cell is a bovine muscle progenitor cell such as satellite cell.
  • SC satellite cell
  • myosatellite cell as used herein, include reference to a small multipotent cell and can be found in mature muscle tissue.
  • Myosatellite cells are precursors to skeletal muscle cells, able to give rise to satellite cells or differentiated skeletal muscle cells. They are precursor cells that can be obtained from muscle tissue. They have the potential to provide additional myonuclei to their parent muscle fiber, or return to a quiescent state. More specifically, upon activation, satellite cells can re-enter the cell cycle to proliferate or differentiate into myoblasts.
  • Myosatellite cells are generally located between the basement membrane and the sarcolemma of a muscle fibers. Myosatellite cells generally express a number of distinctive genetic markers. Most satellite cells express PAX7 and PAX3.
  • the satellite cell as disclosed herein is a bovine satellite cell.
  • differentiation inducer includes reference to a compound that by itself or in combination with other compounds leads to the differentiation of cells. Differentiation inducers may additionally lead to changes in cell chemistry and/or growth inhibition.
  • agonist includes reference to a substance that binds to a receptor and activates the signaling pathway modulated by said receptor to thereby produce a response in a cell such as a progenitor cell.
  • An agonist mimics the action of an endogenous ligand (and an agonist as used herein can be said endogenous ligand) that has an activating, stimulating or inductive effect on said receptor and/or said signaling pathway modulated by said receptor.
  • the agonist of a receptor is a lysophosphatidic acid receptor (LPAR) agonist, more preferably a lysophosphatidic acid receptor 1 (LPAR1) agonist or a lysophosphatidic acid receptor 3 (LPAR3) agonist; an oxytocin receptor (OXTR) agonist; or a glucagon receptor (GCGR) agonist.
  • LPAR lysophosphatidic acid receptor
  • LPAR1 lysophosphatidic acid receptor 1
  • LPAR3 lysophosphatidic acid receptor 3
  • OXTR oxytocin receptor
  • GCGR glucagon receptor
  • Another myogenic differentiation inducer is a lactate.
  • lysophosphatidic acid receptor 1 (LPAR1) agonist examples include N-palmitoyl serine phosphoric acid, sn-2-aminooxy analogue 12b, 1-oleoyl-2-O- methyl-rac-glycerophospho-thionate isomers 2, 13 and 15, dialkyl thiophosphatidic acid, lysophosphatidic acid (e.g. an oleoyl-L- ⁇ -lysophosphatidic acid, for instance in (sodium) salt form), N-acyl ethanolamide phosphate, alpha-fluoromethylene phosphonate, thiophosphate lipid analogue and oleoyl-thiophosphate.
  • lysophosphatidic acid receptor 1 (LPAR1) agonist examples include N-palmitoyl serine phosphoric acid, sn-2-aminooxy analogue 12b, 1-oleoyl-2-O- methyl-rac-glycerophospho-thionate iso
  • the lysophosphatidic acid receptor 1 (LPAR1) agonist as disclosed herein is one or more of the aforementioned lysophosphatidic acid receptor 1 (LPAR1) agonists, preferably said lysophosphatidic acid receptor 1 (LPAR1) agonist is a lysophosphatidic acid.
  • Routine assays are available that allow a skilled person to assess whether an agent is a lysophosphatidic acid receptor 1 (LPAR1) agonist.
  • SPR Surface plasmon resonance
  • SPR is an example of a widely used technique to measure association and dissociation rates for the binding kinetics between two species of chemicals, e.g., cell receptors and ligands.
  • lysophosphatidic acid receptor 3 examples include lysophosphatidic acid (e.g. an oleoyl-L- ⁇ -lysophosphatidic acid, for instance in (sodium) salt form), thiophosphate lipid analogue, N-palmitoyl serine phosphoric acid, N-acyl ethanolamide phosphate, alpha-hydroxymethylene phosphonate, 1- oleoyl-2-O-methyl-rac-glycerophospho-thionate and its isomers 2, 13 and 15, alpha- fluoromethylene phosphonate, dialkyl thiophosphatidic acid, dodecyl phosphate and oleoyl-thiophosphate.
  • lysophosphatidic acid e.g. an oleoyl-L- ⁇ -lysophosphatidic acid, for instance in (sodium) salt form
  • thiophosphate lipid analogue e.g. an oleoyl-L- ⁇ -
  • the lysophosphatidic acid receptor 3 (LPAR3) agonist as disclosed herein is one or more of the aforementioned lysophosphatidic acid receptor 3 (LPAR3) agonists, preferably said lysophosphatidic acid receptor 3 (LPAR3) agonist is a lysophosphatidic acid.
  • Routine assays are available that allow a skilled person to assess whether an agent is a lysophosphatidic acid receptor 3 (LPAR3) agonist.
  • SPR Surface plasmon resonance
  • SPR is an example of a widely used technique to measure association and dissociation rates for the binding kinetics between two species of chemicals, e.g., cell receptors and ligands.
  • oxytocin receptor (OXTR) agonists examples include peptide agonists such as oxytocin, lipo-oxytocin-1, demoxytocin, vasopressin, carbetocin, desmopressin, and merotocin, and non-peptide agonists such as WAY-267464, WAY 267464 dihydrochloride and TC OT 39.
  • the oxytocin receptor (OXTR) agonist as disclosed herein is one or more of the aforementioned oxytocin receptor (OXTR) agonists, preferably said oxytocin receptor (OXTR) agonist is oxytocin.
  • Routine assays are available that allow a skilled person to assess whether an agent is an oxytocin receptor (OXTR) agonist.
  • OXTR oxytocin receptor
  • SPR Surface plasmon resonance
  • GCGR glucagon receptor
  • Glucagon and peptide derivatives thereof such as glucagon 1-6 and glucagon 1-21, and also NNC1702 and oxyntomodulin.
  • the glucagon receptor (GCGR) agonist as disclosed herein is one or more of the aforementioned glucagon receptor (GCGR) agonists, preferably said glucagon receptor (GCGR) agonist is glucagon.
  • Routine assays are available that allow a skilled person to assess whether an agent is a glucagon receptor (GCGR) agonist.
  • SPR Surface plasmon resonance
  • SPR is an example of a widely used technique to measure association and dissociation rates for the binding kinetics between two species of chemicals, e.g., cell receptors and ligands.
  • lactate‘ includes references to lactate as a free acid (lactic acid), lactate in salt form such as sodium lactate and potassium lactate, or lactate in ionic form or in any other form.
  • preculturing’ or ‘preculture’ include reference to the maintenance of one or more cell in a medium, with the main objective to keep the cells alive and furthermore to rid the cells from non-adherent cells and other components that may be disadvantageous or non-beneficial to purification of cells, cell culturing, expansion and/or differentiation.
  • Preculturing is done before the step that has the objective to result in the expansion of a cell or cell population, and is preferably performed in serum-free medium for expanding progenitor cells as disclosed herein, and also as disclosed in PCT/NL2021/050066, the contents of which are incorporated herein by reference.
  • preculturing precedes the step of purification of a FAP cell or muscle progenitor cell, as non-adherent cells and other components may thereby be removed prior to purification in for example an antigen-based cell sorting protocol such as FACS.
  • the term ‘triglyceride’ includes reference to a lipid that is derived from glycerol and three fatty acids.
  • a triglyceride is an ester with three covalently linked fatty acids.
  • the term ‘unsaturated fatty acid’, as used herein, includes reference to fatty acids with at least one C C double bond.
  • Unsaturated and/or saturated fatty acids may be constituents of lipids, such as triglycerides.
  • unsaturated fatty acids are more beneficial to animal health than saturated fatty acids.
  • inflammatory cells includes reference to cells that are part of the immune system of animals. Examples include macrophages, neutrophils, dendritic cells, innate lymphoid cells, mast cells, eosinophils, basophils, natural killer cells, B cells, T cells and/or granulocytes.
  • antibiotics includes reference to antimicrobial substances that are active against bacteria, for example by killing bacteria or by inhibiting growth of bacteria. Antibiotics may be used in livestock, such as cattle. Antibiotics, or residues thereof, may be passed on to meat products after slaughtering of the animal.
  • antibiotics used in cattle include bacitracin, bambermycin, laidlomycin, lasalocid, monensin, neomycin, and virginiamycin.
  • blood residues includes reference to components typically found in blood, such as serum, serum proteins, erythrocytes, leukocytes and thrombocytes.
  • microbial contamination includes reference to undesired presence of one or more microbe, such as bacteria, viruses, fungi and archaea. It also includes reference to pathogenic contamination of food products in general.
  • the term ‘cartilage’ includes reference to elastic animal tissue that is for example found at the end of bones at joints, in the rib cage, in the ear and in the nose.
  • the term ‘cartilage’ includes reference to the three types of cartilage, i.e. elastic cartilage, hyaline cartilage and fibrocartilage. Cartilage in meat products is not desirable for consumption.
  • the term ‘fibrous tissue’, as used herein, also referred to as fibrous connective tissue includes reference to a tissue type with a high amount of fibers, such as elastic and collagenous fibers. In meat products, fibrous tissue may render the meat product tough and therefore less desirable for consumption.
  • the invention provides a method for producing cultured fat cells for animal consumption, and in some embodiments a method for producing cultured fat cells and cultured muscle cells for animal consumption.
  • the invention further comprises a food product for animal consumption comprising a cultured fat cell obtained by a method of the invention, and optionally a cultured muscle cell obtained by a method as disclosed herein.
  • the invention provides a method for producing cultured fat cells for animal consumption, comprising the steps of: - providing a fibro-adipogenic progenitor (FAP) cell, preferably a bovine FAP cell; - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells; and - culturing said expanded population of FAP cells in a culture medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells.
  • FAP fibro-adipogenic progenitor
  • said FAP cell is provided by a method comprising the step of - providing a muscle tissue sample, preferably a bovine muscle tissue sample, comprising a progenitor cell; - optionally, removing excess fat and/or fibrous tissue from said sample if present; - optionally, subjecting said sample to enzymatic digestion, preferably using a matrix metalloproteinase such as a collagenase; - optionally, subjecting said optionally digested sample to an erythrocyte lysis buffer; - optionally, (pre)culturing said optionally digested and optionally erythrocyte-lysed sample in a culture medium for expanding FAP cells; - purifying a progenitor cell that is a FAP cell from said sample so as to provide a FAP cell.
  • a muscle tissue sample preferably a bovine muscle tissue sample, comprising a progenitor cell
  • - optionally, removing excess fat and/or fibrous tissue from said sample if present - optionally,
  • said muscle tissue sample comprising at least one progenitor cell comprises a FAP cell and in embodiments also a muscle progenitor cell. More preferably, said muscle tissue sample comprising at least one progenitor cell comprises both FAP cells and muscle progenitor cells.
  • the muscle tissue sample as disclosed herein is obtained via biopsy on an animal. Prior to said biopsy, animals may be sedated. Sedation may for example be done by injecting Xyla-Ject 2% at 0.15 ml/100 kg in the tail vain.
  • the animal is given local anesthetic at the biopsy site. Local anesthetic may for example be applied via subcutaneous injection, and may be done using procamidor.
  • the biopsy is taken via skin incision in order to expose muscle.
  • a muscle tissue sample as disclosed herein can be taken of about one gram.
  • the creation of the incision as disclosed herein and /or the obtaining of the muscle tissue sample as disclosed herein may for example routinely be made using a scalpel.
  • Said muscle tissue sample can be maintained on ice.
  • Exemplary procedures for wound closure comprise the use of skin sutures (PGA 6/0), covering the wound closure using aluminum spray, providing analgesic subcutaneously, for example Novem 20 at 0.025 mL/kg.
  • the muscle tissue sample as disclosed herein is cleaned by the removal of excess fat and fibrous tissue if present.
  • the muscle tissue sample as disclosed herein is subjected to enzymatic digestion, for instance by using a matrix metalloproteinase such as a collagenase.
  • a matrix metalloproteinase such as a collagenase.
  • collagenase AFC A Worthington, CLS-1, 2000 U/ml
  • Exemplary conditions for dissociation using collagenase are an incubation time of 45 minutes and an incubation temperature of 37 ⁇ C.
  • the muscle tissue sample as disclosed herein is incubated with erythrocyte lysis buffer.
  • 1x ACK erythrocyte lysis buffer may be used.
  • Exemplary incubation conditions for erythrocyte lysis buffer are an incubation time of 1 minute and an incubation temperature of 37 ⁇ C.
  • cells obtained from the muscle tissue sample as disclosed herein after said enzymatic digestion and/or said incubation with erythrocyte lysis buffer are precultured by resuspending and incubating said cells in serum-free proliferation medium as disclosed herein (and in PCT/NL2021/050066), and e.g. seeded into bovine collagen type I coated tissue plates.
  • the collagen type I used for coating said tissue plates is for example C2124 from Sigma, and can be applied at 2.5 ⁇ g/cm 2 .
  • incubation in said serum-free proliferation medium is done at 37 ⁇ C.
  • a method of the invention comprises a step of – purifying a progenitor cell that is a FAP cell from an optionally preprocessed (i.e. removed excess fat and/or fibrous tissue, enzymatically digested and/or erythrocyte-lysed) muscle tissue sample as disclosed herein.
  • the step of purifying a progenitor cell as disclosed herein from a sample as disclosed herein is performed by antigen-based cell sorting such as fluorescence activated cell sorting (FACS). Sorting may for example be done using a MACSQuant Tyto sorter from Miltenyi. In FAPs, several cell surface markers are differentially expressed compared to muscle progenitor cells such as satellite cells.
  • FACS fluorescence activated cell sorting
  • Examples are APBB1IP, NID2, LYN, MLKL, CD14, SH3D21, PRKCH, KCNK6, LHFPL2, HAPLN3, CD248, ADGRG2, GPI, FABP5, THY1, FBP2, COL16A1, TBC1D2, CDH2, LASP1, FLT1, ENG, ITGA5, ITGB3, XYLT1, ETS2, SCIN, ROBO3, PTK2B, GPRC5A, SMAGP, GUCA1A, SLC38A5, SUSD2, TMEM254, KCNK17, NT5E, TNFSF13B, NCKAP5, BASP1, COX6B2, SLC4A8, FZD1, RIPK1, HMGCS1, EDNRA, GPAT3, ATP1B3, TES, GMIP, DCHS1, PITPNM3, CSF1R, PTPRM, DPYSL2, IL16, NME2, FNBP1, NME1, MYLK, ARAP1, CASP4, ADAMTSL
  • any one, or any combination, of the examples listed above may be used as a marker for the identification and/or purification of FAP cells.
  • This list of cell surface markers is also provided in Table 1.
  • muscle progenitor cells such as satellite cells
  • several cell surface markers are differentially expressed (upregulated) compared to FAP cells.
  • a list of these upregulated genes is provided in Table 2.
  • FAPs are characterized by the presence of cell surface markers CD9, CD14, CD49e, CD61, CD140a and/or ITGA9, and/or the absence of cell surface markers CD45, CD321, CD56 and/or ITGA7, or a selection of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 of said cell surface markers. More preferably, FAPs are characterized by the presence of cell surface marker CD140a. FAPs may also be characterized by the presence of cell surface marker ITGA5, and/or the presence of cell surface marker CD140a, and the absence of cell surface marker ITGA7. Preferably, satellite cells are characterized by the presence of cell surface marker ITGA7.
  • satellite cells are characterized by the absence of cell surface marker ITGA5, and/or the absence of cell surface marker CD140a and the presence of cell surface marker ITGA7.
  • said step of purifying a FAP cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of: the presence of a cell surface marker CD140a and the presence of a cell surface marker CD9, the presence of a cell surface marker CD140a and the presence of a cell surface marker CD14, the presence of a cell surface marker CD140a and the presence of a cell surface marker CD49e, the presence of a cell surface marker CD140a and the presence of a cell surface marker CD61, the presence of a cell surface marker CD140a and the presence of a cell surface marker ITGA9, the presence of a cell surface marker CD140a and the absence of a cell surface marker ITGA7, the presence of a cell surface marker CD140a and the absence of a cell surface marker CD45, the presence of a cell surface marker CD140
  • said step of purifying a FAP cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of: the absence of a cell surface marker ITGA7 and the presence of a cell surface marker CD9, the absence of a cell surface marker ITGA7 and the presence of a cell surface marker CD14, the absence of a cell surface marker ITGA7 and the presence of a cell surface marker CD49e, the absence of a cell surface marker ITGA7 and the presence of a cell surface marker CD61, the absence of a cell surface marker ITGA7 and the presence of a cell surface marker ITGA9, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321, and/or the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD56.
  • said step of purifying a FAP cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of: the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the presence of a cell surface marker CD14; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the presence of a cell surface marker CD49e; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the presence of a cell surface marker CD61; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD140a
  • said step of purifying a FAP cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of i) the presence of a cell surface marker selected from the group consisting of CD140a, CD14, CD49e, CD61 and ITGA9 and/or (ii) the absence of cell surface marker selected from the group consisting of ITGA7 and CD56.
  • a combination of 2, 3, 4, 5, 6, or 7 of said cell surface markers may be used as a basis for performing antigen-based cell sorting as disclosed herein for the purification of muscle progenitor cells.
  • said purifying a FAP cell from said sample by performing antigen-based cell sorting is based on the presence of CD140a and the absence of ITGA7
  • said purifying a FAP cell from said sample by performing antigen-based cell sorting is based on the presence of CD140a and CD49e and the absence of CD321, CD45 and ITGA7.
  • antigen-based cell sorting as disclosed herein is performed on the basis of (i) the presence of at least one cell surface marker selected from the group consisting of CD140a, CD9, CD14, CD49e, CD61 and ITGA9 and/or (ii) the absence of at least one cell surface marker selected from the group consisting of ITGA7, CD45, CD321 and CD56.
  • antigen-based cell sorting as disclosed herein is performed on the basis of (i) the presence of at least one cell surface marker selected from the group consisting of CD140a, CD9, CD14, CD49e, CD61 and ITGA9 and/or (ii) the absence of cell surface markers ITGA7, CD45, CD321 and CD56.
  • said step of purifying a muscle progenitor cell, preferably a satellite cell, from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of: the absence of a cell surface marker CD140a and the presence of a cell surface marker CD9, the absence of a cell surface marker CD140a and the absence of a cell surface marker CD14, the absence of a cell surface marker CD140a and the absence of a cell surface marker CD49e, the absence of a cell surface marker CD140a and the absence of a cell surface marker CD61, the absence of a cell surface marker CD140a and the absence of a cell surface marker ITGA9, the absence of a cell surface marker CD140a and the presence of a cell surface marker ITGA7, the absence of a cell surface marker CD140a and the absence of a cell surface marker CD45, the absence of a cell surface marker CD140a and the absence of a cell surface marker CD321, the absence of a cell surface marker CD140a and the presence of a cell surface marker
  • any one, or any combination, of the cell surface markers listed above may be used as a marker for the identification and/or purification of muscle progenitor cells.
  • the antigen-based cell sorting procedure for purifying a progenitor cell that is a muscle progenitor cell as disclosed herein is preferably based on i) the absence of a cell surface marker selected from the group consisting of CD140a, CD14, CD49e, CD61, CD321, CD45 and ITGA9 and/or (ii) the presence of cell surface marker selected from the group consisting of ITGA7, CD56 and optionally CD9.
  • a combination of 2, 3, 4, 5, 6,7, 8, 9 or 10 of said cell surface markers may be used as a basis for performing FACS as disclosed herein for the purification of muscle progenitor cells.
  • said step of purifying a muscle progenitor cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of: the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the absence of a cell surface marker CD49e; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the absence of a cell surface marker CD61; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the absence of a cell surface marker ITGA9; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the absence of
  • said step of purifying a muscle progenitor cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is done on the basis of i) the absence of a cell surface marker selected from the group consisting of CD140a, CD14, CD49e, CD61 and ITGA9, e.g. the absence of CD140a, and/or (ii) the presence of cell surface marker selected from the group consisting of ITGA7 and CD56, e.g. the presence of ITGA7.
  • a combination of 2, 3, 4, 5, 6 or 7 of said cell surface markers may be used as a basis for performing antigen-based cell sorting as disclosed herein for the purification of muscle progenitor cells.
  • the FAP cell and the muscle progenitor cell as disclosed herein are purified by, for FAP cells, performing antigen-based cell sorting on the basis of (i) the presence of a cell surface marker selected from the group consisting of CD140a (PDGFRa), CD9, CD14, CD49e, CD61 and ITGA9 and/or (ii) the absence of a cell surface marker selected from the group consisting of ITGA7, CD45, CD321 (F11R) and CD65, and, for muscle progenitor cells by performing antigen-based cell sorting on the basis of (i) the presence of a cell surface marker that is ITGA7 and/or (ii) the absence of cell surface marker CD140a (PDGFRa).
  • FAP cells and SC cells originate from the same muscle tissue sample, and are purified and separated in the same antigen-based cell sorting procedure by employing cell surface markers that allow for these cell types to be distinguished.
  • cell surface markers that allow for these cell types to be distinguished.
  • the skilled person is able to routinely separate FAP cells from SC cells on the basis of mutually exclusive cell surface markers.
  • the invention provides a method for producing cultured fat cells for animal consumption, comprising the steps of: - providing a fibro-adipogenic progenitor (FAP) cell; - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells; and - culturing said expanded population of FAP cells in a culture medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells.
  • the step of culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells can be performed by any suitable culture medium that allows for expansion (proliferation) of progenitor cells such as FAP cells.
  • such a medium is a serum-free media and does not comprise animal-derived components.
  • such a medium, and the methods of the invention are entirely animal component-free.
  • An exemplary, and non-limiting, culture medium for expanding FAP cells is a serum-free medium comprising - an albumin; and - a fibroblast growth factor (FGF) such as FGF2.
  • FGF fibroblast growth factor
  • said serum-free medium for expanding a FAP cell as disclosed herein may further comprise one or more vitamins and/or hormones selected from the group consisting of ascorbic acid or a derivative thereof, an insulin, a somatotropin and a hydrocortisone, and one or more cytokines and/or growth factors selected from the group consisting of a platelet-derived growth factor (PDGF), an insulin-like growth factor (IGF), a vascular endothelial growth factor (VEGF), an hepatocyte growth factor (HGF) and an interleukin 6 (IL-6).
  • PDGF platelet-derived growth factor
  • IGF insulin-like growth factor
  • VEGF vascular endothelial growth factor
  • HGF hepatocyte growth factor
  • IL-6 interleukin 6
  • said one or more cytokines and/or growth factors are selected from the group of combinations comprising i) an IL-6; ii) an IL- 6 and an IGF; iii) an IL-6, an IGF and an HGF; iv) an IL-6, an IGF, an HGF and a PDGF; v) an IL-6, an IGF, and a VEGF; vi) an IL-6, an IGF and a PDGF; vii) an IL- 6, a PDGF and a VEGF; viii) an IL-6, an IGF, a PDGF and a VEGF; and ix) an IL- 6, an IGF, an HGF, a PDGF and a VEGF.
  • said serum-free medium for proliferating an adipogenic progenitor cells comprises a PDGF, a VEGF, an HGF, an IGF and an IL-6.
  • the serum-free medium for expanding progenitor cells such as FAP cells comprises: wherein said serum-free medium comprises: - an albumin; - a fibroblast growth factor (FGF); - one or more vitamins and/or hormones selected from the group consisting of ascorbic acid or a derivative thereof, an insulin, a somatotropin and a hydrocortisone; - one or more cytokines and/or growth factors selected from the group consisting of a platelet-derived growth factor (PDGF), an insulin-like growth factor (IGF), a vascular endothelial growth factor (VEGF), an hepatocyte growth factor (HGF) and an interleukin 6 (IL- 6); - a basal medium; - a source of glucose; - a source of glutamine;
  • Exemplary, but non-limiting, serum-free proliferation media, and expansion culture conditions are for instance disclosed in PCT/NL2021/050066, such as the medium referred to as SFM1 in PCT/NL2021/050066.
  • SFM1 in PCT/NL2021/050066.
  • the contents of PCT/NL2021/050066 are incorporated herein by reference.
  • Culturing resulting in the expansion of FAP cells may be performed two- dimensionally or three-dimensionally.
  • FAP cells as disclosed herein may be propagated in tissue culture flasks in a culture medium for expanding FAP cells as disclosed herein.
  • For three-dimensional culturing e.g.
  • FAP cells as disclosed herein may be propagated in any suitable vessel such as spinner flasks or bioreactors which may comprise microcarriers.
  • Any suitable vessel such as spinner flasks or bioreactors which may comprise microcarriers.
  • Three-dimensional culturing is advantageous compared to two-dimensional culturing when aiming to achieve expansion on a large scale.
  • culturing of FAP cells is performed in a way that leads to three-dimensional expansion.
  • the step of culturing a FAP cell as disclosed herein in a culture medium for expanding FAP cells as disclosed herein to thereby provide an expanded population of FAP cells is performed in the form of a microcarrier-based cell culture.
  • the serum-free proliferation (expansion) medium as disclosed herein can also be used to expand muscle progenitor cells.
  • Differentiation of FAP cells A method of the invention involves the step of - culturing an expanded population of FAP cells in a culture medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells.
  • said culture medium for differentiating FAP cells can be any suitable culture medium that allows for differentiation of FAP cells into adipocytes.
  • a medium is a serum-free media and does not comprise animal- derived components.
  • such a medium, and the methods of the invention are entirely animal component-free.
  • An exemplary, and expressly non-limiting, culture medium for differentiating FAP cells into adipocytes is a serum-free medium comprising: - at least one peroxisome proliferator-activated receptor gamma (PPARy) agonist; - at least one hormone selected from the group consisting of insulin and hydrocortisone; - at least one cytokine and/or growth factor selected from the group consisting of bone morphogenetic protein 4 (BMP4) and epidermal growth factor (EGF); and - ascorbic acid or a derivative thereof.
  • PPARy peroxisome proliferator-activated receptor gamma
  • BMP4 bone morphogenetic protein 4
  • EGF epidermal growth factor
  • said serum-free medium comprises bone morphogenetic protein 4 (BMP4) and epidermal growth factor (EGF) as said at least one cytokine and/or growth factor; and wherein said serum- free medium optionally further comprises fibroblast growth factor (FGF) such as FGF2.
  • BMP4 bone morphogenetic protein 4
  • EGF epidermal growth factor
  • said serum- free medium optionally further comprises fibroblast growth factor (FGF) such as FGF2.
  • FGF fibroblast growth factor
  • said medium comprises both insulin and hydrocortisone as said at least one hormone.
  • said serum-free medium does not comprise a differentiation inducer selected from the group consisting of isobutyl-methyl- xantane (IBMX), dexamethasone and/or a thiazolidinedione such as rosiglitazone, pioglitazone, lobeglitazone, cigilitazone, darglitazone, englitazone, netoglitazone, rivoglitazone, troglitazone and/or balaglitazone.
  • IBMX isobutyl-methyl- xantane
  • dexamethasone dexamethasone
  • a thiazolidinedione such as rosiglitazone, pioglitazone, lobeglitazone, cigilitazone, darglitazone, englitazone, netoglitazone, rivoglitazone, troglitazone and/or balaglitazone.
  • said at least one PPARy agonist is selected from the group consisting of indomethacin, amorfrutin B, magnolol and honokiol, preferably indomethacin or magnolol.
  • said serum-free medium comprises a source of energy that allows for differentiation of said adipogenic progenitor cell.
  • said serum-free medium for differentiating a FAP cell comprises: - at least one peroxisome proliferator- activated receptor gamma (PPARy) agonist, preferably indomethacin or magnolol; - hydrocortisone; - insulin; - bone morphogenetic protein 4 (BMP4); - epidermal growth factor (EGF); - ascorbic acid or a derivative thereof; and - a basal medium, preferably DMEM/F12; and wherein said serum-free medium for differentiating optionally further comprises - at least one biogenic amine such as putrescine, - a fibroblast growth factor (FGF) such as FGF2, - a source of lipids, preferably wherein said source of lipids is a source of saturated and unsaturated fatty acids, - progesterone; and/or - HEPES.
  • PPARy peroxisome proliferator- activated receptor gamma
  • the at least one hormone that is a hydrocortisone can be present in the medium in a concentration of 0.01 – 1000 nM, preferably 1 - 500 nM, more preferably about 100 nM.
  • insulin can be present in the medium in a concentration of 0.01-200 ⁇ M, preferably 0.1-20 ⁇ M, more preferably 1-2 ⁇ M.
  • the BMP4 as disclosed herein is animal BMP4, more preferably mammalian BMP4, such as E. coli derived recombinant human BMP4 (e.g.120-05ET from Peprotech).
  • the BMP4 can be present in the medium in a concentration of 0.03-60000 nM, preferably 0.3-6000 nM, more preferably 3-600 nM or 30-60 nM.
  • the EGF as disclosed herein is animal EGF, more preferably mammalian EGF, such as recombinant human EGF (e.g. AF-100-15 from Peprotech).
  • the EGF can be present in the medium in a concentration of 3- 30000 pM, preferably 30-3000 pM, more preferably about 322 pM.
  • the FGF as disclosed herein in relation to an adipogenic differentiation medium can be an FGF2 (e.g.
  • 100-18B from Peprotech can be present in the medium in a concentration of 1-10000 pM, preferably 10-1000 pM, more preferably 20-800 pM, more preferably 50-500 pM, more preferably 75-250 pM, more preferably 100-150 pM, more preferably about 115 pM.
  • ascorbic acid or a derivative thereof such as L-ascorbic acid 2-phosphate can be present in the medium in a concentration of 0.01 – 10000 ⁇ M, preferably 1- 500 ⁇ M, more preferably about 227 ⁇ M.
  • the biogenic amine can be present in the medium in a concentration of 0.01 - 1000 ⁇ M, more preferably 0.1 to 500 ⁇ M or 1-100 ⁇ M or 20- 80 ⁇ M or 50-60 ⁇ M, most preferably about 56 ⁇ M.
  • a medium for differentiating FAP cells as disclosed herein further comprises one or more basal media. More preferably, a serum-free medium of the invention further comprises one or more basal media selected from the group comprising DMEM and Ham’s F-12; even more preferably a combination of DMEM and Ham’s F-12.
  • a medium for differentiating FAP cells as disclosed herein may further comprise one or more additional vitamins and/or hormones, such as progesterone.
  • Progesterone can be present in the medium in a concentration of 0.01 – 400 nM, preferably 0.1 - 40 nM, more preferably about 18 nM.
  • a medium for differentiating FAP cells as disclosed herein may further comprise one or more buffering agent, such as one or more of sodium bicarbonate (e.g. S5761 from Sigma Aldrich) and HEPES (e.g.
  • a medium for differentiating FAP cells as disclosed herein may further comprises one or more source of glutamine, preferably one or more of L-glutamine (e.g. G8540 from Sigma Aldrich) and L-alanyl-L-glutamine (e.g. GlutaMAXTM from Gibco).
  • L-glutamine e.g. G8540 from Sigma Aldrich
  • L-alanyl-L-glutamine e.g. GlutaMAXTM from Gibco.
  • the one or more source of glutamine can be present in the medium in a concentration of 0.04-400 mM, preferably 0.4-40 mM, more preferably about 4 mM.
  • the skilled person can routinely calculate and adjust the osmolality of a solution in general and of a medium in particular if needed.
  • Osmolality is typically expressed in milliosmoles per kilogram of water (mOsm/kg). Osmolality may be measured using an osmometer.
  • the osmolality of a medium for differentiation as disclosed herein is within the range of 180-380 mOsm/kg, preferably within the range of 275-299 mOsm/kg.
  • the serum-free medium for differentiating a FAP cells is as disclosed in Example 1.
  • the adipogenic differentiation can occur in the form of a two-dimensional or three- dimensional cell culture.
  • Three-dimensional differentiation of adipogenic progenitor cells may result in a structure comprising adipocytes that from a macroscopic perspective mimics subcutaneous fat in texture and appearance. This is a desirable effect, as it may be used to create meat products that mimic non- cultured meat products in terms of texture and appearance.
  • a three-dimensional system can be provided that is preferably edible and scalable.
  • a non-limiting example of a three- dimensional cell culture system is a hydrogel.
  • said hydrogel is a hydrogel comprising alginate.
  • adipogenic differentiation is performed as a three-dimensional cell culture, for instance in a protein matrix, scaffold or cell aggregate.
  • Exemplary, but expressly non-limiting, culturing conditions for FAP cells that lead to differentiation are as follows: expanded FAP cells are suspended in alginate solution, e.g.0.5% high viscosity alginate solution (such as Sigma W201502), at a concentration of e.g. 3x10 7 cells/mL.
  • the resulting cell-alginate suspension can be injected into a CaCl 2 solution (e.g. at 66 mM) with 10 mM HEPES.
  • Resultant microfibers can be washed and transferred to a tissue culture plate, such as a 12-well tissue culture plate, containing serum-free adipogenic differentiation medium as disclosed herein. Fibres are then incubated on a shaking platform, e.g. at 75 RPM at 37 ⁇ C and e.g. at 5% CO 2 , and culture media is replaced when needed, e.g. every 3-4 days for e.g.28 days.
  • the step of culturing said expanded population of FAP cells in a medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells is carried out in and/or on microfibres. These microfibres may for example be made using alginate (i.e.
  • the expanded population of FAP cells is provided in the form of a three-dimensional cell culture (e.g. a microfiber, such as an alginate-based microfiber) for subsequent adipogenic differentiation.
  • a culture medium for differentiating muscle progenitor cells to thereby differentiate muscle progenitor cells into (partially or terminally differentiated) muscle cells is used.
  • a medium for differentiating muscle progenitor cells as disclosed herein is a serum-free medium.
  • said culture medium for differentiating muscle progenitor cells can be any suitable culture medium that allows for differentiation of muscle progenitor cells into partially or terminally differentiated muscle cells such as a myocyte, myotube and/or myofiber.
  • a medium is a serum-free media and does not comprise animal-derived components.
  • such a medium, and the methods of the invention are entirely animal component-free.
  • An exemplary, and expressly non-limiting, example of a culture medium for differentiating muscle progenitor cells comprises: - at least one (myogenic) differentiation inducer selected from the group consisting of a lysophosphatidic acid receptor 1 (LPAR1) agonist, a lysophosphatidic acid receptor 3 (LPAR3) agonist, an oxytocin receptor (OXTR) agonist, a glucagon receptor (GCGR) agonist and a lactate.
  • the LPAR1 is preferably a bovine LPAR1 such as identified by UniProtKB - Q28031.
  • the LPAR3 as disclosed herein can be a bovine LPAR3 such as identified by UniProtKB - F1MX11.
  • the OXTR as disclosed herein can be a bovine OXTR such as identified by UniProtKB - P56449.
  • the GCGR as disclosed herein can be a bovine GCGR such as identified by UniProtKB - E1BKB6.
  • at least one of the differentiation inducers as disclosed herein can be employed in a medium for differentiating muscle progenitor cells as disclosed herein in combination with one or more further differentiation inducer as disclosed herein.
  • combinations of (i) an LPAR1 agonist or an LPAR3 agonist, and an OXTR agonist, (ii) an LPAR1 agonist or an LPAR3 agonist, and a GCGR agonist, (iii) an LPAR1 agonist or an LPAR3 agonist, and a lactate, (iv) an OXTR agonist and a GCGR agonist, (v) an OXTR agonist and a lactate, (vi) a GCGR agonist and a lactate, and (vii) an LPAR1 agonist and an LPAR3 agonist, are envisaged.
  • At least three, at least four or at least five of the differentiation inducers as disclosed herein can be employed in a medium for differentiating muscle progenitor cells as disclosed herein.
  • an example of at least three differentiation inducers is a combination of at least LPAR1 (or an LPAR3) agonist, an OXTR agonist and a GCGR agonist.
  • the LPAR1 agonist can be present in a medium for differentiating muscle progenitor cells as disclosed herein in a concentration of 0.01 – 500 ⁇ M, preferably 0.5 - 50 ⁇ M, more preferably about 5 ⁇ M.
  • Lysophosphatidic acid can already be comprised in a basal medium, or can be supplemented to a basal medium.
  • lysophosphatidic acid as used herein in relation to a differentiation inducer, includes reference to all its forms such as its free acid (protonated) form, conjugate base (non-protonated) form, and salt form (such as lysophosphatidic acid (sodium) salt.
  • the LPAR3 can be present in a medium for differentiating muscle progenitor cells as disclosed herein in a concentration of 0.01 – 500 ⁇ M, preferably 0.5 - 50 ⁇ M, more preferably about 5 ⁇ M. Lysophosphatidic acid can already be comprised in a basal medium, or can be supplemented to a basal medium.
  • the OXTR agonist can be present in a medium for differentiating muscle progenitor cells as disclosed herein in a concentration of 0.01 – 1000 nM, preferably 5 - 500 nM, more preferably 50 nM.
  • Oxytocin can already be comprised in a basal medium, or can be supplemented to a basal medium.
  • the glucagon receptor agonist can be present in a medium for differentiating muscle progenitor cells as disclosed herein in a concentration of 0.01- 100 ⁇ M, preferably 0.1 - 10 ⁇ M, preferably about 1 ⁇ M.
  • Glucagon can already be comprised in a basal medium, or can be supplemented to a basal medium.
  • the lactate can be present in a medium for differentiating muscle progenitor cells as disclosed herein in a concentration of 0.1 – 1000 mM, preferably 2-200 mM, more preferably about 10-20 mM. Lactate can already be comprised in a basal medium, or can be supplemented to a basal medium.
  • the serum-free medium for differentiating muscle progenitor cells may comprises: - at least one differentiation inducer selected from the group consisting of a lysophosphatidic acid receptor 1 (LPAR1) agonist, a lysophosphatidic acid receptor 3 (LPAR3) agonist, an oxytocin receptor (OXTR) agonist, a glucagon receptor (GCGR) agonist and a lactate; - an epidermal growth factor (EGF); - optionally an albumin or a replacement thereof; - a source of glucose and a source of glutamine; - a source of iron or an iron transporter; - ascorbic acid or a derivative thereof; - sodium selenite; - ethanolamine; - insulin; and/or - sodium bicarbonate.
  • LPAR1 lysophosphatidic acid receptor 1
  • LPAR3 lysophosphatidic acid receptor 3
  • OXTR oxytocin receptor
  • GCGR glucagon receptor
  • the culture medium for differentiating muscle progenitor cells is a serum-free medium for differentiating a muscle progenitor cell as disclosed in PCT/NL2021/050718, the contents of which are expressly incorporated by reference herein.
  • a myogenic differentiation inducer as disclosed in PCT/NL2021/050718 is a Notch signaling pathway inhibitor, preferably a gamma-secretase inhibitor such as a compound selected from the group consisting of DAPT, E2012, L685458, RO4929097 and LY-411575.
  • a Notch signaling pathway inhibitor can be used alternatively to, or in combination with, one or more of the other myogenic differentiation inducers listed herein.
  • the serum-free medium comprises (i) at least one differentiation inducer selected from the group consisting of a lysophosphatidic acid receptor 1 (LPAR1) agonist, a lysophosphatidic acid receptor 3 (LPAR3) agonist, an oxytocin receptor (OXTR) agonist, a glucagon receptor (GCGR) agonist and a lactate, and (ii) a Notch signaling pathway inhibitor.
  • at least one differentiation inducer selected from the group consisting of a lysophosphatidic acid receptor 1 (LPAR1) agonist, a lysophosphatidic acid receptor 3 (LPAR3) agonist, an oxytocin receptor (OXTR) agonist, a glucagon receptor (GCGR) agonist and a lactate
  • LPAR1 lysophosphatidic acid receptor 1
  • LPAR3 lysophosphatidic acid receptor 3
  • OXTR oxytocin receptor
  • GCGR glucagon receptor
  • the invention provides a method for incorporating expanded and differentiated FAP cells in a food product for animal, preferably human, consumption, and a food product for animal, preferably human, consumption comprising a cultured fat cell obtainable by a method of the invention and optionally a cultured muscle cell obtainable by a method as disclosed herein.
  • said expanded and differentiated FAP cells are (bovine) fat cells.
  • said cells are incorporated into a food product together with expanded and differentiated muscle progenitor cells.
  • said expanded and differentiated muscle progenitor cells are (bovine) muscle cells.
  • a food product of the invention can be a meat product or a fat product such as a fat product not including (cultured) muscle cells.
  • Non-limiting examples of a food product of the invention are a hamburger, a sausage, a steak, minced meat, a meatball, corned beef, a charcuterie product, jerky or stewed meat. Meat products also covers the combination of several types of meat products.
  • the cultured fat cells as disclosed herein and optionally the muscle cells as disclosed herein may be processed prior to or following incorporation into a meat product.
  • Non-limiting examples of processing are boiling, grilling, freezing, pressing, salting, curing, fermenting, smoking, drying, canning, cutting, grinding, mixing, seasoning, tubing in casing and marinating.
  • the cultured fat cells and optional cultured muscle cells of the invention may be arranged in a specific manner in the meat product, for example in order to create optical similarity with traditionally produced meat products and/or to improve texture.
  • a food product of the invention contains between 0.01% and 70% cultured fat cells, such as between 1% and 30% fat cells or between 5% and 20% fat cells.
  • meat products may comprise water, one or more salt, one or more fiber, one or more carbohydrate, one or more protein, one or more starch, one or more spice, one or more herb, one or more yeast extract, one or more casing ingredient, one or more vitamin, one or more oil, one or more hydrocolloid, one or more thickening agent, one or more preservative, one or more colorant, one or more antioxidant, one or more acidity regulator, one or more stabilizer, one or more emulsifier, one or more flavor enhancer and/or one or more sweetener.
  • all constituents of the meat product are animal-free.
  • the food product of the invention is optically, structurally, in terms of flavor and/or in terms of composition identical or similar or corresponds to existing traditional meat products wherein animals are slaughtered in order to obtain said meat product.
  • the food product of the invention has a composition that has beneficial characteristics in terms of human health and/or consumer preference when compared to existing traditional meat products wherein animals are slaughtered in order to obtain said meat product.
  • the food product of the invention comprises more unsaturated fatty acids compared to bovine(-derived) subcutaneous fat tissue. Unsaturated fatty acids are generally more beneficial to animal health, more preferably human health, compared to saturated fatty acids.
  • the food product of the invention comprises no inflammatory cells.
  • the food product of the invention comprises fewer, preferably no, antibiotics and/or antibiotics residues.
  • Antibiotics in food products are a burden to animal health, including human health, when consumed, as they may kill part of the animal gut microbiome.
  • the presence of antibiotics in food may allow for the promotion of antibiotic resistance.
  • antibiotics may lead to tissue damage, for example in the animal gut.
  • the food product of the invention comprises no blood residues such as red blood cells. Blood components may lead to lipid oxidation and may decrease the shelf life of the food products.
  • Existing traditional meat products generally contain blood components such as red blood cells.
  • the food product of the invention comprises lower levels of microbial contamination compared to traditional meat products.
  • the food product of the invention is preferably produced in controlled environments that aim to prevent contamination with microbials.
  • potential microbials present in or on animal tissue are incorporated in a food product in much lower levels compared to traditional meat products.
  • the food product of the invention comprises no cartilage.
  • Cartilage may have a negative effect on the consumption experience of the consumer, as it is much tougher than (artificial) muscle tissue or (artificial) fat tissue. Absence of cartilage in a food product is generally associated with a higher quality.
  • the food product of the invention comprises lower levels of fibrous tissue compared to traditional meat or fat products.
  • Fibrous tissue otherwise referred to as connective tissue, comprises proteins such as collagen and elastin that render meat tough and therefore less beneficial for consumption. Fibrous tissue may be associated with lower quality food products. Lower levels of fibrous tissue are also beneficial in the preparation of food products, as it generally takes less time to cook food products with low levels if fibrous tissue.
  • Post-biopsy health checks were performed daily by the farmer for 10 days post-procedure. Isolation of bovine muscle-derived cells Excess visible fat and fibrous tissue was removed prior to dissociation, and muscle fibers were dissociated using collagenase AFC A (Worthington, CLS-1, 2000 U/ml) for 45 minutes at 37 °C. Muscle isolates were incubated in 1x ACK erythrocyte lysis buffer for 1 minute at room temperature. Cells were resuspended in a serum- free proliferation medium and immediately seeded into bovine collagen type I (Sigma, C2124; 2.5 ⁇ g/cm 2 ) coated tissue culture plates, and pre-cultured at 37 °C for 72 hours.
  • bovine collagen type I Sigma, C2124; 2.5 ⁇ g/cm 2
  • the serum-free proliferation medium that was used is as disclosed in PCT/NL2021/050066, the contents of which are incorporated herein by reference, and is referred to therein as “SFM1” and contains: albumin (5 mg/ml), somatotropin (2 ng/ml), L-Ascorbic acid 2-phosphate (50 ⁇ g/ml), hydrocortisone (36 ng/ml), ⁇ -linolenic acid (1 ⁇ g/ml), insulin (10 ⁇ g/ml), transferrin (5.5 ⁇ g/ml), sodium selenite (0.0067 ⁇ g/ml), ethanolamine (2 ⁇ g/ml), L-alanyl-L-glutamine or glutamine (2mM), IL-6 (5 ng/ml), FGF2 also referred to as bFGF (10 ng/ml), IGF1 (100 ng/ml), VEGF (10 ng/ml), HGF (5 ng/ml), PDGF-BB (10 ng/m
  • FACS purification of FAP cells and SC cells After 72 hours of pre-culture, cells were sorted using a MACSQuant Tyto sorter (Miltenyi) based on absence of expression of JAM1, CD45, and integrin alpha 7 (ITGA7), and the positive expression of integrin alpha 5 (ITGA5) or platelet derived growth factor alpha (PDGFR ⁇ ; also known as CD140a). Unstained cells were used routinely to define gating parameters. Proliferation and differentiation of FAP and SC cells After FACS sorting, FAP cells and SC cells were cultured on collagen Type I coated tissue culture flasks at 37°C and 5% CO 2 in a serum-free proliferation medium (SFM1).
  • SFM1 serum-free proliferation medium
  • Myogenic differentiation assay was performed by culturing said cells at 37°C and 5% CO 2 on Matrigel-coated vessel at a seeding density of 50k cells per cm 2 in SFM1 for 24h and then switching to a serum-free medium for differentiating myogenic progenitor cells, which medium contained: DMEM/F121:1 supplemented with albumin (recombinant human albumin from Richcore) at 0.5 mg/ml, insulin (recombinant human insulin, 10-365 from Peprotech) at 19.4 ug/ml, transferrin (recombinant human transferrin, 10-366 from Peprotech) at 10.7 ug/ml, sodium selenite (S5261 from SigmaAldrich) at 0.014 ug/ml, Ethanolamine from Sigma Aldrich cat nr E9508 at 4 ug/ml, ascorbic acid (L-DMEM/F121:1 supplemented with albumin (recombinant human albumin from Richcore) at
  • Adipogenic differentiation assay was performed by seeding said cells in SFM1 at a density of 30k cells per cm 2 at 37°C and 5% CO 2 on a type I bovine collagen coated vessel. The next day medium was changed to a serum-free medium for differentiating adipogenic progenitor cells, which medium contained: DMEM/F12 medium was supplemented with PSA (17-745E from Lonza) at 1%, HEPES (H3375 from Sigma Aldrich) at 4.9mM, hydrocortisone (H0135 from Sigma Aldrich) at 0.1 ⁇ M, insulin (recombinant human insulin, 10-365 from Peprotech) at 1-2 ⁇ M, lipid concentrate (chemically defined lipid concentrate, 11548846 from Thermo Fisher) at 0.001% (v/v), putrescine (51799 from Sigma Aldrich) at 56 ⁇ M, EGF (recombinant human EGF, AF-100-15 from Peprotech) at 322 pM, FGF2 (recomb
  • the adherent cells consisted of two major populations, ITGA5+ or PDGFR ⁇ + / ITGA7- cells, which we subsequently refer to as fibro-adipogenic progenitor (FAP) cells, and ITGA5- or PDGFR ⁇ - / ITGA7+ cells, known as satellite cells (SCs; Fig. 1B).
  • FAP fibro-adipogenic progenitor
  • SCs satellite cells
  • JAM1 and CD45 post- sorting, there were distinct morphological differences between the two cell types, with FAPs generally larger and more stretched when compared to SCs, and with increased numbers of cellular protrusions (Fig.1C). To confirm these cells were FAPs, we assessed their differentiation potential.
  • Example 2 Bioinformatic characterization of FAP cells Material & Methods Single-cell RNA sequencing For single-cell RNAseq, sequencing libraries were prepared using 25,000 cells derived from 10 bovine muscle biopsies by using the Chromium Next GEM Single Cell 3 ⁇ GEM, Library & Gel Bead Kit v3.1 (10X Genmoics). The single-cell libraries were sequenced on a NovaSeq 6000 (Illumina) using genotype-based multiplexing and resulting reads were aligned to bovine reference genome bosTau9 (ARS UCD1.2.98) with Cell Ranger version 3.1. After doublet exclusion, this yielded approximately 8000 single-cell transcriptomes with > 5000 genes per cell.
  • NovaSeq 6000 Illumina
  • ARS UCD1.2.98 bovine reference genome bosTau9
  • RNA sequencing For bulk RNAseq, FAPs and SCs from two donor animals were sorted into TRK Lysis buffer. RNA was isolated using the Omega MicroElute Total RNA Kit (Omega Bio-tek), and sequenced on a NextSeq 500 after library preparation using the TruSeq stranded mRNA kit (Illumina). Resulting reads were aligned to the bosTau9 (ARS UCD1.2.98) reference genome and counted using the Rsubread package.
  • Notable upregulated genes in SCs are NCAM1 and ITGA7, whereas notable upregulated genes in FAPs are PDGFRA, ITGA9, ITGB3, ITGA5, CD14 and CD9.
  • the most differentially expressed surface markers between bovine FAPs and bovine SCs are presented in Table 1 and Table 2, respectively. Tables 1 and 2 are provided hereinbelow. Table 1. The highest differentially expressed surface markers (upregulated) in bovine FAPs as compared to bovine SCs.
  • Example 3 Characterization of FAP cell surface expression profiles Material & Methods Flow cytometry Unsorted bovine muscle-derived cells were stained with ITGA7-PE, in conjunction with the indicated APC-conjugated antibodies (PDGFRA-APC, ITGA5-APC, CD14- APC, CD9-APC, CD61-APC, ITGA9-APC, NCAM1-APC, CD45-APC, CD321-APC). Subsequently, cells were washed and analysed on a MACSQuant 10 flow analyzer (Miltenyi). Unstained cells were used as a negative control, and to define gating parameters. Bulk RNA sequencing was performed as described (see Example 2).
  • Example 4 Expansion of FAP cells Material & Methods Two dimensional (2D) cell culture FAPs, isolated according to Example 1 and purified according to Example 2 (ITGA7- and ITGA5+ as the cell surface markers), were propagated on collagen Type I coated tissue culture flasks in a serum-free proliferation medium as defined in Example 1 (SFM1). Cells were regularly passaged when approaching confluency, and reseeded at a density of 5000 cells/cm 2 . Microcarrier cell culture Cytodex 1 microcarriers (GE Healthcare) were hydrated in PBS in a siliconized (Sigmacote, Sigma Aldrich) spinner flask (Corning) at a final concentration of 10 cm 2 /mL.
  • FAPs proliferated with 1.3 PDs per day, whilst over the course of the culture the growth rate steadily decreased to approximately 0.8 PDs per day (Fig. 4A). There were little to no clear and observable morphological changes over the multiple passages (Fig. 4B). Similarly, in a setting more appropriate to large scale cell production, FAPs were able to grow on the surface of microcarriers in suspension cultures, as evidenced by the increasing cell density on the microcarriers and the cell counts (Fig. 5A; Fig.5B). During exponential growth, FAPs had a doubling time of 22.6 +/- 2 hrs (n 4) for all spinners, with no lag-phase observed.
  • Example 5 Adipogenic differentiation of FAPs in 3-dimensional hydrogels Material & Methods Three-dimensional adipogenic microfiber culture FAPs, isolated according to Example 1 and purified according to Example 2 (ITGA7- and ITGA5+ as the cell surface markers), were resuspended in 0.5% high viscosity alginate solution (Sigma, W201502) at a concentration of 3x10 7 cells/mL. Cell-alginate suspension was injected into 66 mM CaCl2, 10 mM HEPES.
  • Resultant microfibres were washed and transferred to a 12-well tissue culture plate containing an exemplary serum-free adipogenic differentiation medium which contained: DMEM/F12 medium supplemented with PSA (17-745E from Lonza) at 1%, HEPES (H3375 from Sigma Aldrich) at 4.9mM, hydrocortisone (H0135 from Sigma Aldrich) at 0.1 ⁇ M, insulin (recombinant human insulin, 10-365 from Peprotech) at 1-2 ⁇ M, lipid concentrate (chemically defined lipid concentrate, 11548846 from Thermo Fisher) at 0.001% (v/v), putrescine (51799 from Sigma Aldrich) at 56 ⁇ M, EGF (recombinant human EGF, AF-100-15 from Peprotech) at 322 pM, FGF (recombinant human FGF, 100-18B from Peprotech) at 115 pM, progesterone (P8783 from Sigma Aldrich) at 17.8nM, as
  • Fibres were incubated on a shaking platform at 75 RPM at 37°C and 5% CO 2 , and culture media was replaced every 3-4 days for 28 days.
  • the control medium constituted of the above- mentioned exemplary serum-free adipogenic differentiation medium with the exception that indomethacin was omitted.
  • Immunofluorescence for microfibers Microfibres were fixed using 4% formaldehyde in 66 mM CaCl 2 , 10 mM HEPES for 1 hr at room temperature. Once fixed, microfibres were blocked/permeabilized in blocking solution (66 mM CaCl 2 , 10 mM HEPES, 10% goat serum, 0.1% Triton X) at room temperature for 1 hr.
  • Microfibers were incubated overnight at 4 °C in 1:125 BODIPY 493/503 and 1:1000 Hoechst. Where used, primary antibodies for Acetyl-CoA carboxylase (ACC; 1:200; Cell Signalling, #3676) or perilipin-1 (PLIN1; 1:400; Abcam, ab61682) were added to the blocking solution. Subsequent to washing, fibers were incubated with 1:250 or 1:500 donkey anti-rabbit Alexa 594 (Thermo Fisher, A21207) in blocking solution for 2 hours at room temperature. Microfibres were imaged by confocal microscopy (TCS SP8, Leica Microsystems) using a 25 ⁇ /1.00 objective lens.
  • RT-qPCR was performed using the iQ SYBR Green Supermix (Bio-Rad) with primer pairs for the following genes: fatty acid binding protein 4 (FABP4; GTAGGTACCTGGAAACTTGTCT; ACTTTCCTGGTAGCAAAGCC), adiponectin (ADIPOQ; GGCTCTGATTCCACACCTGA; TGTTGTCCTCGCCATGACTG), trafficking regulator of GLUT41 (TRARG1;CTCATCCTTGCCATCGCCTC; TGTTGCACGCTACTTCGAGA) and cell death inducing DFFA like effector C (CIDEC; TGCAGAGTAACCACTGCTGA; ACGCCAGCATCAGGGTATC).
  • FABP4 fatty acid binding protein 4
  • GTAGGTACCTGGAAACTTGTCT ACTTTCCTGGTAGCAAAGCC
  • adiponectin ADIPOQ
  • TGTTGTCCTCGCCATGACTG trafficking regulator of GLUT41
  • the 2 ⁇ Ct - values of genes of interest were normalized to three averaged housekeeping genes (Ubiquitously Expressed Prefoldin (GAGCAGTCTCCTCACAGAGCTC; AGCAACATGTGGATATGGGCCT), 60S Ribosomal Protein L19 (TCGAATGCCCGAGAAGGTAAC; CTGTGATACATGTGGCGGTC) and 60S acidic ribosomal protein P0 (GGCAGCATCTACAACCCTGA; CAGATGCGACGGTTGGGTAA ). Results We aimed to achieve adipogenic differentiation of FAPs into mature fat tissue in a scalable, edible three-dimensional system.
  • FAPs showed strong upregulation of genes related to adipogenic differentiation, including FABP4, ADIPOQ, TRARG1 and CIDEC, as measured by RT-qPCR (Fig. 6D).
  • Example 6 Adipose Tissue Analysis Material & Methods Mass spectrometry-based lipidomics For lipidomics analysis, 10-30 mg samples of bovine subcutaneous fat tissue, bovine muscle tissue, undifferentiated (day 0) and differentiated (28 days) bovine FAP samples from three different donors were collected. Lipids were extracted using a modified Bligh-Dyer protocol, and were analysed by hydrophilic interaction liquid chromatography mass spectrometry (HILIC LC-MS/MS). Lipid quantities were normalized to the amount of protein present within the respective sample.
  • HILIC LC-MS/MS hydrophilic interaction liquid chromatography mass spectrometry

Abstract

The invention provides inter alia a method for producing cultured fat cells for animal consumption, comprising the steps of: - providing a fibro-adipogenic progenitor (FAP) cell; - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells; - culturing said expanded population of FAP cells in a culture medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells.

Description

Title: Method for producing cultured fat for animal consumption. FIELD OF THE INVENTION The invention is in the field of cell culturing, and relates to methods for production of cultured fat cells. In particular, the present invention relates to methods for production of cultured fat cells from fibro-adipogenic progenitor (FAP) cells for human consumption, and to food products such as cultured fat products comprising those cells. The invention is also in the field of the production of cultured meat products that include cultured fat cells obtained in accordance with the present invention and cultured muscle cells. BACKGROUND TO THE INVENTION There is a growing demand for alternatives to traditionally sourced meat products. Environmental impact and ethical considerations are driving forces towards the development and production of products that overcome these drawbacks. One solution would be the introduction of cultured meat products that are made of cells grown in vitro. Meat comprises muscle cells and fat cells. For example, a hamburger contains around 87.5% muscle tissue and 12.5% fat tissue. Cultured meat products ideally mimic traditional meat products in order to be most appealing for human consumption, and should therefore also comprise both muscle and fat cells. One important parameter is the composition of cultured fat, which should preferably closely resemble fat from traditional meat products, as it greatly contributes to flavor and texture. It was hitherto unknown whether cultured fat could be produced that closely resembles fat from traditional meat products and whether it therefore could provide for an acceptable substitute. The choice of progenitor fat cell type might be a relevant parameter, potentially together with progenitor cell purification methodology. Different fat cells may produce different lipid profiles and may also vary in terms of lipid accumulation and distribution. The field of cultured fat and/or meat production is a relatively new field and practical guidance in relation to these aspects is currently absent. Although some general suggestions are provided in relation to cultured meat production, such as, amongst others, that there are multiple potential starting cell types for fat tissue production (Melzener et al., J Sci Food Agric.2020; 101: 7-14), it was hitherto unknown how these suggestions could be practically implemented in advantageous and reproducible cultured fat and/or meat production methods. There is a need for methods that lead to the advantageous production of cultured fat that can be incorporated into cultured meat products or that can be used as a stand-alone cultured fat product. Currently, such advantageous production methods are not available. SUMMARY OF THE INVENTION The present inventors discovered that fibro-adipogenic progenitor (FAP) cells can be advantageously used in cell culture-based fat production as they provide for different advantages. For the first time, the inventors have identified, characterized, purified and differentiated skeletal muscle tissue-derived bovine FAP cells into mature fat tissue by the use of cell culturing. Differentially expressed (upregulated) genes between bovine FAP cells and bovine satellite cells (SC), encoding for cell surface markers, were identified and were implemented in antigen-based cell sorting procedures to distinguish and separate FAPs and SCs which allows for subsequent advantageous expansion, and adipogenic and myogenic differentiation, respectively. Upregulated cell surface markers on FAP cells are listed in Table 1. Upregulated cell surface markers on SC cells are listed in Table 2. It was found that the generated cultured fat tissue mimicked the properties of cow-derived subcutaneous fat tissue in terms of lipid accumulation, profile, texture and appearance. In addition, it was observed that cultured fat produced in accordance with methods of the invention showed a higher relative percentage of unsaturated triglycerides compared to (uncultured) bovine subcutaneous fat tissue and muscle tissue and is therefore distinguishable from (uncultured) bovine subcutaneous fat tissue and muscle tissue. It is generally known that unsaturated triglycerides are healthier than saturated triglycerides. Another advantage of FAPs is the high level of lipid accumulation that is observed for these cells upon adipogenic differentiation. Therefore, the invention provides a method for producing cultured fat cells for animal consumption, comprising the steps of: - providing a fibro-adipogenic progenitor (FAP) cell; - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells; - culturing said expanded population of FAP cells in a culture medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells. In a preferred embodiment of a method for producing cultured fat cells of the invention, the FAP cell is a bovine FAP cell. In another preferred embodiment of a method for producing cultured fat cells of the invention, the method is a method for producing cultured fat cells for human consumption. In another preferred embodiment of a method for producing cultured fat cells of the invention, the FAP cell that is provided is obtainable by a method comprising the steps of: - providing a muscle tissue sample, preferably a bovine muscle tissue sample, comprising a progenitor cell; - optionally, removing excess fat and/or fibrous tissue from said sample if present; - optionally, subjecting said sample to enzymatic digestion, preferably using a matrix metalloproteinase such as a collagenase; - optionally, subjecting said optionally digested sample to an erythrocyte lysis buffer; - optionally, (pre)culturing said optionally digested and optionally erythrocyte-lysed sample in a culture medium for expanding FAP cells; - purifying a progenitor cell that is a FAP cell from said sample so as to provide a FAP cell. Alternatively, in a preferred embodiment of a method for producing cultured fat cells of the invention, the method comprises the following steps, preceding said step of providing a fibro-adipogenic progenitor (FAP) cell: - providing a muscle tissue sample, preferably a bovine muscle tissue sample, comprising a progenitor cell; - optionally, removing excess fat and/or fibrous tissue from said sample if present; - optionally, subjecting said sample to enzymatic digestion, preferably using a matrix metalloproteinase such as a collagenase; - optionally, subjecting said optionally digested sample to an erythrocyte lysis buffer; - optionally, (pre)culturing said optionally digested and optionally erythrocyte-lysed sample in a culture medium for expanding FAP cells; and - purifying a progenitor cell that is a FAP cell from said sample so as to provide a FAP cell. In another preferred embodiment of a method for producing cultured fat cells of the invention, the step of purifying a progenitor cell that is a FAP cell from said muscle tissue sample is performed by antigen-based cell sorting, e.g. fluorescence activated cell sorting (FACS). In another preferred embodiment of a method for producing cultured fat cells of the invention, the antigen-based cell sorting, such as fluorescence activated cell sorting (FACS), is performed on the basis of (i) the presence of at least one cell surface marker selected from Table 1, optionally in combination with the absence of at least one cell surface marker selected from Table 2. In another preferred embodiment of a method for producing cultured fat cells of the invention, the antigen-based cell sorting, such as fluorescence activated cell sorting (FACS), is performed on the basis of (i) the presence of at least one cell surface marker selected from the group consisting of CD140a (PDGFRa), CD14, CD49e (ITGA5), CD61 (ITGB3), CD9 and ITGA9 and/or (ii) the absence of at least one cell surface marker selected from the group consisting of ITGA7, CD45, CD321 (F11R) and CD56 (NCAM1). In another preferred embodiment of a method for producing cultured fat cells of the invention, the antigen-based cell sorting, such as fluorescence activated cell sorting (FACS), is performed on the basis of (i) the presence of at least one cell surface marker selected from the group consisting of CD140a (PDGFRa), CD14, CD49e (ITGA5), CD61 (ITGB3) and ITGA9 and/or (ii) the absence of cell surface markers ITGA7 and CD56 (NCAM1). In another preferred embodiment of a method for producing cultured fat cells of the invention, the method further comprises the step of: - purifying differentiated fat cells. In another preferred embodiment of a method for producing cultured fat cells of the invention, the method further comprises the step of: - incorporating said optionally purified cultured fat cells in a food product, preferably a cultured fat product or cultured meat product, for animal consumption. In another preferred embodiment of a method for producing cultured fat cells of the invention, the culture medium for expanding FAP cells and/or said culture medium for differentiating FAP cells is a serum-free medium, preferably a serum-free medium entirely free of animal components. In another preferred embodiment of a method for producing cultured fat cells of the invention, said culture medium for expanding FAP cells is a serum-free medium, and wherein said serum-free medium comprises: - an albumin; and - a fibroblast growth factor (FGF) such as FGF2. In another preferred embodiment of a method for producing cultured fat cells of the invention, said culture medium for differentiating FAP cells is a serum- free medium, and wherein said serum-free medium comprises: - at least one peroxisome proliferator-activated receptor gamma (PPARy) agonist; - at least one hormone selected from the group consisting of insulin and hydrocortisone; - at least one cytokine and/or growth factor selected from the group consisting of bone morphogenetic protein 4 (BMP4) and epidermal growth factor (EGF); and - ascorbic acid or a derivative thereof. In another preferred embodiment of a method for producing cultured fat cells of the invention, said method is a method for producing cultured fat cells and cultured muscle cells for animal consumption, and wherein said method further comprises the steps of: - providing a muscle progenitor cell, preferably a satellite cell; - culturing said muscle progenitor cell in a culture medium for expanding muscle progenitor cells to thereby provide an expanded population of muscle progenitor cells; - culturing said expanded population of muscle progenitor cells in a culture medium for differentiating muscle progenitor cells to thereby differentiate muscle progenitor cells into muscle cells; - optionally, purifying differentiated muscle cells; - optionally, incorporating said differentiated muscle cells together with said differentiated fat cells in a food product, preferably a cultured meat product, for animal consumption. In another preferred embodiment of a method for producing cultured fat cells of the invention, said method is a method for producing cultured fat cells and cultured muscle cells for human consumption. In another preferred embodiment of a method for producing cultured fat cells and muscle cells of the invention, said muscle progenitor cell is a bovine muscle progenitor cell, preferably a bovine satellite cell (SC). In another preferred embodiment of a method for producing cultured fat cells and muscle cells of the invention, said FAP cell and said muscle progenitor cell are obtainable by a method comprising the steps of: - providing a muscle tissue sample, preferably a bovine muscle tissue sample, comprising a FAP cell and a muscle progenitor cell; - optionally, removing excess fat and/or fibrous tissue from said sample if present; - optionally, subjecting said sample to enzymatic digestion, preferably using a matrix metalloproteinase such as a collagenase; - optionally, subjecting said optionally digested sample to an erythrocyte lysis buffer; - optionally, (pre)culturing said optionally digested and optionally erythrocyte-lysed sample in a culture medium for expanding FAP cells and muscle progenitor cells; - purifying a progenitor cell that is a FAP cell and a muscle progenitor cell from said sample so as to provide a FAP cell and a myogenic progenitor cell. In another preferred embodiment of a method for producing cultured fat cells and muscle cells of the invention, said step of purifying a progenitor cell that is a FAP cell and said step of purifying a progenitor cell that is a muscle progenitor cell are performed by antigen-based cell sorting such as fluorescence activated cell sorting (FACS). In another preferred embodiment of a method for producing cultured fat cells and muscle cells of the invention, said antigen-based cell sorting, such as fluorescence activated cell sorting (FACS), in order to purify said FAP cell is performed as defined in any one of the previous embodiments; and wherein the antigen-based cell sorting, such as fluorescence activated cell sorting (FACS), in order to purify said muscle progenitor cell is performed on the basis of (i) the presence of a cell surface marker selected from Table 2, optionally in combination with the absence of a cell surface member selected from Table 1. In another preferred embodiment of a method for producing cultured fat cells and muscle cells of the invention, said antigen-based cell sorting, such as fluorescence activated cell sorting (FACS), in order to purify said muscle progenitor cell is performed on the basis of the presence of a cell surface marker selected from the group consisting of ITGA7 and CD56 (NCAM1) and/or (ii) the absence of a cell surface marker selected from the group consisting of CD140a (PDGFRa), CD14, CD49e (ITGA5), CD61 (ITGB3) and ITGA9. In another preferred embodiment of a method for producing cultured fat cells and muscle cells of the invention, said FAP cell and said muscle progenitor cell are purified from the same muscle tissue sample and/or are separated from each other during the same antigen-based cell sorting procedure, such as FACS procedure, followed by separate expansion and differentiation into fat cells and muscle cells, respectively. In another preferred embodiment of a method for producing cultured fat cells and muscle cells of the invention, said culture medium for expanding muscle progenitor cells is a serum-free medium, and wherein said serum-free medium comprises: - an albumin; and - a fibroblast growth factor (FGF) such as FGF2. In another preferred embodiment of a method for producing cultured fat cells and muscle cells of the invention, said medium for differentiating muscle progenitor cells is a serum-free medium, and wherein said serum-free medium comprises: - at least one differentiation inducer selected from the group consisting of a lysophosphatidic acid receptor 1 (LPAR1) agonist, a lysophosphatidic acid receptor 3 (LPAR3) agonist, an oxytocin receptor (OXTR) agonist, a glucagon receptor (GCGR) agonist and a lactate. In another preferred embodiment of a method for producing cultured fat cells and/or muscle cells of the invention, said step of - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells, and/or the step of – culturing said muscle progenitor cell in a medium for expanding muscle progenitor cells to thereby provide an expanded population of muscle progenitor cells, is two-dimensional or three-dimensional cell culturing, such as microcarrier-based cell culturing. In another preferred embodiment of a method for producing cultured fat cells and/or muscle cells of the invention, said step of: - culturing said expanded population of FAP cells in a medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells, and/or the step of: - culturing said expanded population of muscle cell progenitor cells in a medium for differentiating muscle progenitor cells to thereby differentiate muscle progenitor cells into muscle cells, is two-dimensional or three-dimensional cell culturing, such as culturing in a hydrogel, preferably a hydrogel comprising alginate. In another aspect, the invention provides a food product for animal consumption, comprising: - a cultured fat cell obtainable by a method according to any one of the previous aspects and/or embodiments; and - optionally, a cultured muscle cell obtainable by a method according to any one of the previous aspects and/or embodiments. In a preferred embodiment of a food product of the invention, said food product is a cell culture-based food product. In another preferred embodiment of a food product of the invention, said food product is a cultured fat product or cultured meat product. In another preferred embodiment of a food product of the invention, said food product: - comprises cultured fat with a different triglyceride composition compared to the triglyceride composition of a (preferably bovine) subcutaneous fat tissue, preferably (i) wherein the relative contribution of unsaturated triglycerides, preferably triglycerides with a single unsaturation, to the total amount of triglycerides is higher in cultured fat as compared to the relative contribution of unsaturated triglycerides, preferably triglycerides with a single unsaturation, to the total amount of triglycerides in said (preferably bovine) subcutaneous fat tissue or (ii) wherein the relative contribution of saturated triglycerides to the total amount of triglycerides is lower in said cultured fat as compared to the relative contribution of saturated triglycerides to the total amount of triglycerides in said (preferably bovine) subcutaneous fat tissue; - does not comprise inflammatory cells such as immune cells; - does not comprise antibiotics and/or antibiotic residues; - does not comprise red blood cells; - comprises lower levels of microbial contamination as compared to meat products obtained by animal slaughter; - does not comprise cartilage tissue; and/or - comprises lower levels of fibrous tissue as compared to meat products obtained by animal slaughter. In another embodiment of a food product of the invention, said food product: - comprises cultured fat with a different triglyceride composition compared to the triglyceride composition of a (preferably bovine) subcutaneous fat tissue, preferably (i) wherein the relative contribution of unsaturated triglycerides, preferably triglycerides with a single unsaturation, to the total amount of triglycerides is higher in cultured fat as compared to the relative contribution of unsaturated triglycerides, preferably triglycerides with a single unsaturation, to the total amount of triglycerides in said (preferably bovine) subcutaneous fat tissue or (ii) wherein the relative contribution of saturated triglycerides to the total amount of triglycerides is lower in said cultured fat as compared to the relative contribution of saturated triglycerides to the total amount of triglycerides in said (preferably bovine) subcutaneous fat tissue; - does not comprise antibiotics and/or antibiotic residues; does not comprise red blood cells; - comprises lower levels of microbial contamination as compared to meat products obtained by animal slaughter; and/or - does not comprise cartilage tissue. In another aspect, the invention provides a use of a fibro-adipogenic progenitor (FAP) cell in the production of cultured fat for animal, preferably human, consumption. DESCRIPTION OF THE DRAWINGS Fig. 1: Isolation and purification of fibro-adipogenic progenitor (FAP) cells. A) Schematic overview of the isolation and purification process, including biopsy taking, cell isolation from muscle tissue, enzymatic digestion, preculture prior to cell sorting, and fluorescence-activated cell sorting (FACS) into satellite cells (SCs) and/or Fibro-adipogenic progenitors (FAPs). B) FACS plot of major cell populations within bovine muscle fractions after 72 hours of pre-culture in a serum-free proliferation medium identified hereinbelow as “SFM1” in Example 1. PDGFRA+ or ITGA5+/ITGA7- FAPs and PDGFRA- or ITGA5-/ITGA7+ satellite cells (SCs) are indicated. C) Brightfield microscopic images of unsorted cells after 72 hours of pre-culture (left panel), FAPs (middle) SCs (right) cells at confluence. Scale bars: 250 µm. D) Representative High Content Analyzer (HCA) brightfield and immunofluorescence images of myogenic and adipogenic differentiation of FAPs and SCs after 96 hours. Nuclei were stained with Hoechst, cells were stained with desmin (myogenic assay) or BODIPY (adipogenic assay). Scale bars: 200 µm. Fig. 2: Bioinformatic characterisation of FAP cells. A) Uniform Manifold Approximation and Projection (UMAP) plot of the 72 hours pre-cultured muscle tissue-derived cells. Each point indicates a cell that was clustered into one of the depicted cell types. B) Violin plots showing the expression of ITGA7 (left) and PDGFRa (right) for each identified cell type. C) PCA plot of sorted SCs and FAPs from two different donor animals (shape). D) Volcano plot highlighting differentially expressed genes significantly upregulated in SCs (triangle down, left-hand side grey) and FAPs (triangle up, right-hand side grey). Fig. 3: Characterisation of FAP cell surface expression profiles. A) FAP cell surface markers. Representative flow cytometry plots of unsorted cells stained with ITGA7-PE, and PDGFRA-, ITGA5-, CD14-, CD9-, CD61- and ITGA9- APC-antibodies. B) Bioinformatic analyses of the same markers shown in A, from bulk RNAseq. C) Cell surface markers for which FAPs are negative. Representative flow cytometry plots of unsorted cells analyzing expression of ITGA7, combined with NCAM1, CD45 and CD321. D) Bioinformatic analyses of the same markers shown in C, from bulk RNAseq. Fig. 42D proliferation of bovine FAPs. A) Growth curve (left panel), and the growth rate (right) of bovine FAPs from three individual donor animals. Data is plotted as the mean of all three individuals, with 95% CI indicated. B) Brightfield microscopy images of bovine FAPs at passages three, six and nine. All scale bars: 200 µm. Fig. 5: Spinner flask culture (proliferation) of bovine FAPs. A) Representative images of bovine FAPs on Cytodex 1 microcarriers at 18, 66 and 110 hours of culture. Scale bars: 190 µm. B) Growth curve of FAPs from two individual donors on microcarriers in spinner flasks. Data is shown as the mean of the two donors, with 95% CI indicated. Fig. 6: Adipogenic differentiation of FAPs in 3-dimensional hydrogels. A) Maximum intensity projection confocal microscopy images of control (top panels) and adipogenic differentiation induced (bottom) FAP microfibers stained with BODIPY and Hoechst on days 0, 14 and 28 of differentiation. Scale bar = 100 μm. B) Quantification of the lipid droplet volume in A. **** P =< 0.0001. C) Maximum intensity projection confocal microscopy images of 28 days differentiated FAP microfibers stained with Hoechst, BODIPY and perilipin 1 (PLIN1; top row) or acetyl carboxylase (ACC; bottom row) visualized via Alexa Fluor 594, and the composite of the three channels. Scale bar = 40 μm. D) RT-qPCR analysis of FABP4, ADIPOQ, TRARG1 and CIDEC in FAP microfibers at day 7, 14 and 28 of adipogenic differentiation, bars were normalized against the control (day 0 of differentiation). Respective P-values were *P=<0.0477, **P=0.0024, ***P=0.0004-0.0001, ****P=<0.0001. Data is represented as the mean ± sd (n=3). Fig. 7: Adipose Tissue Analysis. A) Absolute quantification of all lipid species (normalized to the amount of protein) present within differentiated hydrogels from days 7, 14 and 28. B) Breakdown of relative percentages of key fatty acids in fat, muscle, undifferentiated (day 0) and differentiated (day 28) hydrogel. C) Plot of relative percentage of acyl chains containing 16, 18, 20 or 22 carbon atoms. D) As C, but with relative percentage of acyl chains containing 0-6 saturations. Data is shown as mean ± sd (n=3). E) Macroscopic images of empty alginate hydrogel, differentiated cultured fat, and control animal subcutaneous fat. DETAILED DESCRIPTION OF THE INVENTION Definitions The term ‘cultured’, as used herein, includes reference to the cell cultures of the cells disclosed herein and may refer, depending on the method and type of medium used, to propagation and/or proliferation (expansion) of adipogenic progenitor cells and/or muscle progenitor cells such as bovine fibro-adipogenic progenitor cells and bovine muscle progenitor cells, or to differentiation of bovine adipogenic progenitor cells and/or bovine muscle progenitor cells into adipocytes and muscle cells, respectively. It should however be understood that a method of the invention may also be employed to differentiate other non-human, mammalian progenitor cells such as ovine, porcine or murine fibro-adipogenic progenitor cells and/or muscle progenitor cells such as satellite cells (SCs). Therefore, any embodiment described herein in relation to bovine fibro-adipogenic progenitor cells and/or bovine muscle progenitor cells, is also applicable to ovine (such as sheep), porcine (such as pig) and murine (such as mice) progenitor cells, i.e. progenitor cells of ovine, porcine or murine origin. Thus, in aspects and/or embodiments of a method for producing cultured fat cells and optionally muscle cells of the invention or a food product of the invention, instead of a bovine progenitor cell, an ovine progenitor or a porcine progenitor cell can be employed. Preferably, the fibro-adipogenic progenitor cell is a muscle-derived fibro-adipogenic progenitor cell. Preferably the adipogenic progenitor cell as disclosed herein is derived from a muscle tissue sample, preferably a skeletal muscle tissue sample, for instance by taking a biopsy. The term ‘fat cell’, as used herein, can be used interchangeably with the term ‘adipocyte’. These terms include reference to cells in which fat is stored and/or produced, including cultured and/or artificial fat cells or adipocytes or cultured and/or artificial fat tissue. Adipocytes may be categorized as forming white adipose tissue or brown adipose tissue. Adipocytes are found throughout the body. Adipocytes synthesize and store fat, including but not limited to lipids and triglycerides. The phrase ‘for animal consumption’, as used herein, includes reference to products and components that are not harmful to healthy, non-allergic animals when consumed under normal circumstances and normal use. The phrase ‘for human consumption’, as used herein, includes reference to products and components that are not harmful to healthy, non-allergic humans when consumed under normal circumstances and normal use. Components (or ingredients) that are acceptable for human consumption can for instance be found in the Food Chemicals Codex, ISO 22000, and/or are approved by the European Food Safety Authority and/or United States Food and Drug Administration. The term ‘bovine’, as used herein, includes reference to any member of the subfamily Bovinae. The subfamily Bovinae includes the tribes Bovini, Tragelaphini and Boselaphini. Preferably, bovine as disclosed herein refers to the members of the subfamily Bovinae that are used for human consumption. Non- limiting examples of such members include domestic cattle (Bos taurus and subspecies Bos taurus taurus; Bos taurus indicus), gaur (Bos gaurus), gayal or mithun (Bos frontalis), yak (Bos grunniens; Bos mutus), banteng (Bos javanicus), water buffalo (Bubalus arnee; Bubalus bubalis), American bison (Bison bison), giant eland (Taurotragus derbianus), common eland (Taurotragus oryx), kudu (Tragelaphus strepsiceros; Tragelaphus imberbis), and nilgai (Boselaphus tragocamelus). Especially preferred bovine species as disclosed herein are Bos taurus and its subspecies. The terms ‘fibro-adipogenic progenitor cell’ and ‘FAP cell’, as used herein, include reference to progenitor cells that are able to differentiate into fibroblasts, adipocytes, osteoblasts, and chondrocytes. FAP cells generally reside in skeletal muscle and play a role in the production of new myofibers by muscle satellite cells. FAP cells can be purified from muscle tissue samples by methods involving antigen-based cell sorting such as FACS based e.g. on upregulated cell surface markers as listed in Table 1 and optionally the absence of cell surface markers listed in Table 2. Cell surface marker analysis as described herein demonstrated that bovine FAPs expressed CD9, CD14, CD49e (ITGA5), CD61 (ITGB3), CD140a (PDGFRA), and ITGA9 (Fig. 3A). FAPs lacked expression of hematopoietic marker CD45, endothelial marker CD321 (F11R), and the myogenic progenitor markers CD56 (NCAM1) and ITGA7 (Fig. 3C). FAP cells are inter alia characterized by CD31-, CD45- and integrinα7-. Preferably, the FAP cell is a bovine FAP cell. The terms ‘expansion’ and ‘proliferation’, as used herein, can be used interchangeably. These terms include reference to increasing the population size of progenitor cells, such as bovine progenitor cells, in cell culture, i.e. progenitor cells are generating other progenitor cells by cell proliferation. Such an expanded progenitor cell population can subsequently be cultured in a differentiation media for differentiating said progenitor cells into muscle cells or fat cells that can subsequently be incorporated into a cell-culture based fat or meat product for human consumption. However, first, before differentiation, sufficient amounts of progenitor cells, such as bovine progenitor cells, need to be produced by expansion / proliferation. The term ‘expanded population’, as used herein, includes reference to an unspecified number of cells that have previously been subjected to a step of expansion / proliferation. The term ‘medium’, also referred to herein as ‘culture medium’, includes reference to a preferably liquid composition that supports cellular proliferation and/or expansion and/or differentiation by providing the components needed. A medium may be provided in liquid or powdered format. Supplementation may be required for proliferation and/or expansion depending on the cell type. A medium may contain or be supplemented with one or more components selected from the non-limiting group consisting of amino acids, lipids, sugars, carbohydrates, anions, cations, buffering agents, colorants, vitamins, antioxidants, hormones, enzymes, proteins and trace elements. The terms ‘differentiating’ and ‘differentiation’, as used herein, include reference to the process of specialization of cells. During this process, progenitor cells (which may also be referred to as precursor cells or stem cells, which are terms used interchangeably herein) change from one cell type to another. Differentiation may be activated and regulated by hormones, growth factors or other signaling molecules. The term ‘muscle tissue sample’, as used herein, includes reference to an ex vivo biopsy of the muscle of an animal. The muscle tissue sample may be obtained via needle biopsy or incision biopsy. A muscle tissue sample may either be freshly obtained or pre-digested, i.e. subjected to incubation with proteinases such as matrix metalloproteinases such as a collagenase so as to breakdown ECM and release cells; thus, a muscle tissue sample may have gone through different stages of processing. Preferably, a muscle tissue sample as disclosed herein is a skeletal muscle tissue sample, i.e. a tissue sample of the skeletal muscle of an animal. Skeletal muscle is typically striated and is activated by the central nervous system. One non-limiting example of a muscle tissue sample is a semitendinosus muscle tissue sample. In embodiments, the adipogenic progenitor cell is obtained from a (skeletal) muscle tissue sample that is derived from a cadaver, or from a living non- human animal e.g. by taking a biopsy. The term ‘progenitor cell’, as used herein, includes reference to a cell that is able to differentiate into a more specialized cell. The term ‘progenitor cell’ can be used interchangeably with the term ‘precursor cell’. Progenitor cells may for example be stem cells, satellite cells, intermediate progenitor cells, radial glial cells, bone marrow stromal cells, periosteum, pancreatic progenitor cells, angioblasts, blast cells or fibro-adipogenic progenitor cells. No limitation to the stage of development is intended. Progenitor cells as disclosed herein may have any potency, such as pluripotent, multipotent or oligopotent progenitor cells, and can be induced pluripotent stem cells (iPSC). Non-limiting examples of progenitor cells are FAP cells, which may for example differentiate into fat cells, and satellite cells, which may for example differentiate into muscle cells. The term ‘purifying’, as used herein, includes reference to the purification or sorting of a specified cell type or a group of cells from specified cell types, or the exclusion of one or more cell types from a sample. Purification or sorting of cells may be done using antigen-based cell sorting, such as FACS. The term ‘isolating’, as used herein, includes reference to the processing of a muscle tissue sample, wherein the cells that are part of the tissue sample are to become detached from other cells and other components of the tissue sample. Typically, isolating involves digestion with one or more enzyme that is able to break down the extracellular matrix, such as collagenase, and may also involve erythrocyte lysis. The term ‘antigen-based cell sorting’, as used herein, includes reference to any protocol that allows for sorting of cell types on the basis of the presence or absence of cell surface markers. Non-limiting examples of antigen-based cell sorting protocols are protocols that employ fluorescently labelled antibodies, such as FACS, or protocols that are based on magnetic labelling or isotope labelling of the cell surface marker-binding antibodies. Preferably, the antigen-based cell sorting is fluorescence-activated cell sorting. The terms ‘fluorescence activated cell sorting’ and ‘FACS’, as used herein, include reference to an antigen-based cell sorting protocol in which cells or cell populations are analyzed using a fluorescent signal of one or more reporter and involves flow cytometry. In FACS, cellular components, preferably cell surface markers, attach to labeled reporters. Preferably, the reporters are antibodies that are labeled with fluorophores or quantum dots. Although the acronym FACS includes reference to sorting, cells do not necessarily have to be sorted in order for the procedure to be called FACS. Preferably, the cells are sorted based on their attachment to fluorescent reporter(s), which is also referred to as cell purification. Preferably, cells are alive during and directly following FACS. The term ‘FACS procedure’, as used herein, may include reference to the process of cell analysis and optionally cell sorting using FACS. The term ‘cell surface marker’, as used herein, includes reference to proteins that are present on the surface of a cell and that are used to identify cell types. Cell surface markers have a variety of functionalities. Cell surface markers are often indicated by a CD number in the cluster of differentiation (CD) protocol. Antigen-based cell sorting, such as FACS, can be used for the identification of cells by employing cell surface markers. Examples of cell surface markers present on FAP cells are CD140a (also referred to as PDGFRα, PDGFRa or PDGFRA), CD9, CD14, CD49e (also referred to as ITGA5), CD61 (also referred to as ITGB3) and ITGA9. FAPs lack (or have a reduced) expression of ITGA7, CD45 (also referred to as PTPRC), CD321 (also referred to as F11R, JAM-1 and JAM-A) and CD56 (also referred to as NCAM1). The term ‘presence’ or ‘absence’, as used herein in relation to antigen- based cell sorting such as FACS, includes reference to the discrimination between cell types on the basis of differential expression of cell surface marker proteins (antigens). The skilled person directly understands that the term ‘absence’ does not mean that protein expression of a cell surface marker protein needs to be fully absent (i.e. zero), but that its expression is lower as compared to another cell type and is lower to such an extent that it allows for a negative selection criterion in cell sorting. Thus, antigen-based cell sorting such as FACS allows for discrimination between cell types on the basis of (i) cell surface markers that are expressed on a cell to such an extent that they can be used as a positive selection criterion (i.e. presence; “+”) or (ii) cell surface markers that have a lower or reduced expression on a cell to such an extent that they can be used as a negative selection criterion (i.e. absence, “-”). Preferably, antigen-based cell sorting, e.g. FACS, of a cell type is performed on the basis of both the presence of a cell surface marker and the absence of a cell surface marker. The terms ‘CD140a’ and ‘PDGFRa’, as used herein, also referred to as platelet-derived growth factor receptor A, include reference to a cell surface marker and receptor. CD140a is known to be expressed in for example Leydig cells (testicle), Peritubular cells (testicle), fibroblasts (connective tissue), Ito cells (liver), melanocytes (skin) The term ‘ITGA7’, as used herein, also referred to as integrin subunit alpha 7, includes reference to a cell surface marker and receptor. ITGA7 is known to be expressed in for example Sertoli cells (testicle), cardiomyocytes, smooth muscle cells and skeletal muscle cells. The term ‘CD9’, as used herein, includes reference to a cell surface marker and glycoprotein that is a member of the transmembrane 4 superfamily, also referred to as the tetraspanin family. The term ‘CD14’, as used herein, include reference to a cell surface marker and protein that plays a role as a receptor in the innate immune system. The term ‘CD49e’, as used herein, also referred to as ITGA5, includes reference to a cell surface marker and membrane protein. The term ‘CD61’, as used herein, also referred to as integrin beta-3 and ITGB3, includes reference to a cell surface marker and protein that is a member of the integrin protein family. The term ‘ITGA9’, as used herein, includes reference to a cell surface marker and protein that is a member of the integrin protein family. The term ‘CD45’, as used herein, also referred to as protein tyrosine phosphatase receptor type C or PTPRC, includes reference to a cell surface marker and enzyme belonging to the protein tyrosine phosphatase family. The term ‘CD321’, also referred to as F11R and junction adhesion molecule A, includes reference to a cell surface marker and protein related to assembly of tight junctions. The term ‘CD56’, as used herein, also referred to as neural cell adhesion molecule and NCAM, includes reference to a cell surface marker and glycoprotein of the immunoglobulin superfamily. The term ‘incorporating’, as used herein, includes reference to the production of a fat or meat product using cultured fat cells optionally in combination with cultured muscle cells. The term ‘food product’, as used herein, includes reference to products that are suitable for human consumption. The term ‘cell-culture based food product’, as used herein, includes reference to food products that are manufactured by incorporating cells grown ex vivo or in vitro into a food product, optionally in combination with other cell-culture based components and/or other components. Preferably, the food product of the invention comprises cultured fat cells, cultured fat tissue, or fat produced by cultured fat cells or cultured fat tissue. Particularly preferred food products of the invention are meat products, which also include (cultured) muscle cells. The term ‘meat product’, as used herein, includes reference to cultured meat that is suitable for human consumption. A meat product generally comprises muscle tissue and fat tissue. Non-limiting examples of a meat product of the invention are a hamburger, a sausage, a steak, minced meat, a meatball, corned beef, a charcuterie product, jerky or stewed meat. Meat products also covers the combination of several types of meat products. The term ‘suspension culture’, as used herein, includes reference to different types of suspension culture such as microcarrier-based cell culture. Preferably, the expansion or proliferation of progenitor cells as described herein is performed using a microcarrier-based cell culture. A microcarrier-based cell culture preferably involves growing progenitor cells on the surface of microcarriers in suspension cultures. Alternatively, suspension culture refers to suspension cell culture, where cells are cultured in suspensions or aggregates and are not attached to a surface such as a microcarrier surface. In embodiments, expansion or proliferation of progenitor cells as described herein is performed by suspension cell culture. The term ‘hydrogel’, as used herein, includes reference to polymers with hydrophilic properties. Hydrogels may be formed by a variety of compounds, such as alginate, agarose, methylcellulose, hyaluronan, elastin-like polypeptides, collagen, chitosan, gelatin and starch. Hydrogels may be advantageously employed in the three-dimensional culturing and differentiation of cells, for example for the achievement of cultured fat. Preferably, the hydrogel as disclosed herein comprises alginate. The term ‘serum-free’, as used herein, includes reference to the absence of animal serum such as fetal bovine serum (FBS). The term ‘animal-derived’, as used herein, includes reference to components that are produced by an animal. Non-limiting examples of animal- derived components are fetal bovine serum, and components isolated from fetal bovine serum. Not animal-derived are for instance recombinantly produced animal proteins or peptides and any other component not produced by an animal but synthesized e.g. in the laboratory. If a medium as disclosed herein does not comprise any components or ingredients that are animal-derived, then the medium is animal component-free. Preferably, a serum-free medium as disclosed herein does not comprise components that are derived (obtained) from an animal. The terms ‘fibroblast growth factor’ and ‘FGF’, as used herein, include reference to proteins that can stimulate growth and differentiation of animal cells, amongst other functions. FGFs bind to a fibroblast growth factor receptor (FGFR). FGFs are preferably recombinantly produced. Preferably, the FGF as disclosed herein is a recombinant FGF. Preferably, the FGF as disclosed herein is FGF2. It is to be understood that the terms ‘fibroblast growth factor’ and ‘FGF, as used herein, may also include reference to fragments of FGF that retain the biological function of FGF, such as FGF replacement peptides. The term ‘cytokine’, as used herein, includes reference to proteins that are involved in cell signaling, more specifically cell signaling related to or associated with the immune system and/or morphogenic pathways. Cytokines may be constituents of media, for example for the induction of expansion and/or differentiation. The term ‘growth factor’, as used herein, includes reference to members of a class of signal molecules that generally have an effect on cell proliferation, growth and/or death. Growth factors may be constituents of media, for example for the induction of expansion and/or differentiation. The terms ‘peroxisome proliferator-activated receptor gamma’, ‘PPARG and ‘PPARγ’, as used herein, include reference to a nuclear receptor that is present in cells of different tissue types such as adipose tissue, colon, rumen and placenta, and in macrophages. Alternative names of PPARγ include NR1C3 and glitazone receptor. The term ‘PPARγ agonist’, as used herein, includes reference to any chemical that binds to or interacts with PPARγ, which results or may under certain circumstances result in a biological response. ‘PPARγ agonist’, as used herein, includes reference to endogenous agonists, co-agonists, full agonists, partial agonists, selective agonists, superagonists, inverse agonists, irreversible agonists and biased agonists. Examples of PPARγ agonists include indomethacin, magnolol, amorfrutins (comprising, for example, amorfrutin 1, amorfrutin 2, amorfrutin A, amorfrutin B, amorfrutin C and amorfrutin D), honokiol, lecithine (such as L-α- lecithine from soy beans), formononetin, bixin, norbixin, catechin, Δ9- tetrahydrocannabinol, (9S, 13R)-12-oxo-phytodienoic acid, odoratin, hydroxy unsaturated fatty acids from Coix lacrymajobi, commipheric acid, glabrone, kaempferol-3-O-β-glucopyranoside, deoxyelephantopin, acetylated flavonol glycosides, kampferol, citral, alkamides from Echinacae purpera, quercetin, genistein, 5’-formulglabridin, (2R,3R)-3,4’,7-trihydroxy-3’-prenylflavane, echinatin, (3R)-2’,3’,7-trihydroxy-4’-methoxyisoflavan, kanzonol X, kanzonol W, shinpterocarpin, glabrol, tocotrienols, shinflavanone, amorphastilbol, gancaonin L, licochalcone E, flavonoids from Glycyrrhiza uralensis, 3-arylcoumarins from Glycyrrhiza uralensis, fatty acids from Lycium chinense, magnolol, honokiol, lunularin, fatty acids from Melampyrum pratense, licoflavanone A, cucurbitane- type triterpene glycosides, polyacetylenes from Notopterygium incisum, biochanin A, ginsenoside 20(S)-protopanaxatriol, ginsenoside Rb1, fatty acids from Pinellia ternata, meranzin, oleaninic acid, pseudolaric acid B, daidzein, carnosic acid, carnosol, 12-O-methul carnosic acid, α-linolenic acid, linoleic acid, naringenin, saurufuran A, isosilybin A, gallotannins, carvacrol, isoflavones from Trifolium pratense, ellagic acid, epicatechin gallate, flavonoids from Vitis vinifera, dehydrotrametenolic acid and 6-shogaol. The term ‘biogenic amine’, as used herein, includes reference to a substance that can be produced by life forms and that comprises one or more amine groups. Included in the group of biogenic amines are monoamines and polyamines. Examples of the group of monoamines are ethanolamine and phenylethanolamine. Examples of the group of polyamines are putrescine, agmatine, cadaverine, spermine and spermidine. The term ‘putrescine’, as used herein, includes reference to a compound represented by the formula NH2(CH2)4NH2. Putrescine is otherwise referred to as tetramethylenediamine, butane-1,4-diamine and 1,4-diaminobutane. Putrescine may be produced chemically or biochemically. The terms “hydrocortisone” and “cortisol” as used herein, include reference to a steroid hormone with chemical formula C21H30O5, that is involved in the fat metabolism of animals, amongst other functions. Hydrocortisone may be obtained from animals, plants or microorganisms or may be chemically synthesized. Preferably, hydrocortisone as disclosed herein is not derived from animals or animal material. The term ‘insulin’, as used herein, includes reference to peptide hormones that promote the uptake of glucose by cells, amongst other functions. Insulin is preferably recombinantly produced. Preferably, insulin as disclosed herein is a recombinant protein. The terms ‘epidermal growth factor’ and ‘EGF’, as used herein, include reference to proteins that can stimulate cell growth and differentiation of animal cells, amongst other functions. The proteins belong to an epidermal growth factor family. EGFs bind to epidermal growth factor receptor (EGFR). EGFs are preferably recombinantly produced. Preferably, the EGF as disclosed herein is a recombinantly produced EGF. It is to be understood that the terms ‘epidermal growth factor’ and ‘EGF’, as used herein, may also include reference to fragments of EGF that retain the biological function of EGF, such as EGF replacement peptides. The term ‘ascorbic acid’, as used herein, includes reference to a compound represented by the formula C6H8O6. Ascorbic acid is otherwise referred to as vitamin C. Ascorbic acid may be produced chemically or biochemically. The terms ‘bone morphogenetic protein’ and ‘BMP’, as used herein, include reference to a group of growth factors that can be found in the animal body. This group comprises the BMP proteins BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8a, BMP8b, BMP10, BMP11 and BMP15. Preferably, the BMP as disclosed herein is BMP4. Preferably, the BMP4 as disclosed herein is recombinantly produced, and can be a human BMP4. It is to be understood that the terms ‘bone morphogenetic protein 4’ and ‘BMP4’, as used herein, may also include reference to fragments of BMP4 that retain the biological function of BMP4, such as BMP4 replacement peptides. The term ‘lipid’, as used herein in relation to a source of lipids, includes reference to hydrophobic or partially hydrophobic hydrocarbon molecules such as fatty acids, glycerolipids, glycerophospholipids, sphingolipids, sterols, prenols, saccharolipids and polyketides. In embodiments, a source of lipids is provided as a (chemically defined) lipid concentrate, which can be a mixture of lipids in emulsion. Without wishing to be exhaustive, a chemically defined lipid concentrate as disclosed herein may comprise one or more of arachidonic acid, cholesterol, dl- alpha-tocopherol acetate, ethyl alcohol, linoleic acid, linolenic acid, myristic acid, oleic acid, palmitic acid, palmitoleic acid, stearic acid and/or Tween 80. In embodiments, a chemically defined lipid concentrate as disclosed herein comprises a combination of some or all the above-listed compounds. The term ‘basal medium’, as used herein, includes reference to a preferably liquid medium that supports cellular growth by providing essential components for growth. A basal medium may be provided in liquid or powdered format. A basal medium that is not supplemented with any compound may enable cellular growth, but supplementation may be required for growth depending on the cell type. A basal medium may be supplemented with one or more components selected from the non-limiting group consisting of amino acids, lipids, sugars, carbohydrates, anions, cations, buffering agents, colorants, vitamins, antioxidants, hormones, enzymes, proteins and trace elements. Preferably, the basal medium as disclosed herein is a commercially available basal medium. The term ‘muscle progenitor cell’, as used herein, includes reference to a cell that is capable of giving rise to a muscle cell or to form muscle tissue. The term “muscle progenitor cell” may include reference to multipotent or pluripotent stem cells such as multipotent stromal cells (mesenchymal stem cells) with the capacity for self-renewal and multipotential differentiation into inter alia fat cells (adipocytes) and muscle cells (myocytes). A preferred muscle progenitor cell is a bovine muscle progenitor cell such as satellite cell. The terms ‘satellite cell’ (abbreviated SC) and ‘myosatellite cell’, as used herein, include reference to a small multipotent cell and can be found in mature muscle tissue. Myosatellite cells are precursors to skeletal muscle cells, able to give rise to satellite cells or differentiated skeletal muscle cells. They are precursor cells that can be obtained from muscle tissue. They have the potential to provide additional myonuclei to their parent muscle fiber, or return to a quiescent state. More specifically, upon activation, satellite cells can re-enter the cell cycle to proliferate or differentiate into myoblasts. Myosatellite cells are generally located between the basement membrane and the sarcolemma of a muscle fibers. Myosatellite cells generally express a number of distinctive genetic markers. Most satellite cells express PAX7 and PAX3. Preferably, the satellite cell as disclosed herein is a bovine satellite cell. The term ‘differentiation inducer’, as used herein, also referred to as differentiation-inducing factors, includes reference to a compound that by itself or in combination with other compounds leads to the differentiation of cells. Differentiation inducers may additionally lead to changes in cell chemistry and/or growth inhibition. The term “agonist”, as used herein, includes reference to a substance that binds to a receptor and activates the signaling pathway modulated by said receptor to thereby produce a response in a cell such as a progenitor cell. An agonist mimics the action of an endogenous ligand (and an agonist as used herein can be said endogenous ligand) that has an activating, stimulating or inductive effect on said receptor and/or said signaling pathway modulated by said receptor. Preferably, in relation to myogenic differentiation, the agonist of a receptor is a lysophosphatidic acid receptor (LPAR) agonist, more preferably a lysophosphatidic acid receptor 1 (LPAR1) agonist or a lysophosphatidic acid receptor 3 (LPAR3) agonist; an oxytocin receptor (OXTR) agonist; or a glucagon receptor (GCGR) agonist. Another myogenic differentiation inducer is a lactate. Examples of known lysophosphatidic acid receptor 1 (LPAR1) agonist are N-palmitoyl serine phosphoric acid, sn-2-aminooxy analogue 12b, 1-oleoyl-2-O- methyl-rac-glycerophospho-thionate isomers 2, 13 and 15, dialkyl thiophosphatidic acid, lysophosphatidic acid (e.g. an oleoyl-L-α-lysophosphatidic acid, for instance in (sodium) salt form), N-acyl ethanolamide phosphate, alpha-fluoromethylene phosphonate, thiophosphate lipid analogue and oleoyl-thiophosphate. In embodiments, the lysophosphatidic acid receptor 1 (LPAR1) agonist as disclosed herein is one or more of the aforementioned lysophosphatidic acid receptor 1 (LPAR1) agonists, preferably said lysophosphatidic acid receptor 1 (LPAR1) agonist is a lysophosphatidic acid. Routine assays are available that allow a skilled person to assess whether an agent is a lysophosphatidic acid receptor 1 (LPAR1) agonist. Surface plasmon resonance (SPR) is an example of a widely used technique to measure association and dissociation rates for the binding kinetics between two species of chemicals, e.g., cell receptors and ligands. Examples of known lysophosphatidic acid receptor 3 (LPAR3) agonists are lysophosphatidic acid (e.g. an oleoyl-L-α-lysophosphatidic acid, for instance in (sodium) salt form), thiophosphate lipid analogue, N-palmitoyl serine phosphoric acid, N-acyl ethanolamide phosphate, alpha-hydroxymethylene phosphonate, 1- oleoyl-2-O-methyl-rac-glycerophospho-thionate and its isomers 2, 13 and 15, alpha- fluoromethylene phosphonate, dialkyl thiophosphatidic acid, dodecyl phosphate and oleoyl-thiophosphate. In embodiments, the lysophosphatidic acid receptor 3 (LPAR3) agonist as disclosed herein is one or more of the aforementioned lysophosphatidic acid receptor 3 (LPAR3) agonists, preferably said lysophosphatidic acid receptor 3 (LPAR3) agonist is a lysophosphatidic acid. Routine assays are available that allow a skilled person to assess whether an agent is a lysophosphatidic acid receptor 3 (LPAR3) agonist. Surface plasmon resonance (SPR) is an example of a widely used technique to measure association and dissociation rates for the binding kinetics between two species of chemicals, e.g., cell receptors and ligands. Examples of known oxytocin receptor (OXTR) agonists are peptide agonists such as oxytocin, lipo-oxytocin-1, demoxytocin, vasopressin, carbetocin, desmopressin, and merotocin, and non-peptide agonists such as WAY-267464, WAY 267464 dihydrochloride and TC OT 39. In embodiments, the oxytocin receptor (OXTR) agonist as disclosed herein is one or more of the aforementioned oxytocin receptor (OXTR) agonists, preferably said oxytocin receptor (OXTR) agonist is oxytocin. Routine assays are available that allow a skilled person to assess whether an agent is an oxytocin receptor (OXTR) agonist. Surface plasmon resonance (SPR) is an example of a widely used technique to measure association and dissociation rates for the binding kinetics between two species of chemicals, e.g., cell receptors and ligands. Examples of known glucagon receptor (GCGR) agonists are glucagon and peptide derivatives thereof such as glucagon 1-6 and glucagon 1-21, and also NNC1702 and oxyntomodulin. In embodiments, the glucagon receptor (GCGR) agonist as disclosed herein is one or more of the aforementioned glucagon receptor (GCGR) agonists, preferably said glucagon receptor (GCGR) agonist is glucagon. Routine assays are available that allow a skilled person to assess whether an agent is a glucagon receptor (GCGR) agonist. Surface plasmon resonance (SPR) is an example of a widely used technique to measure association and dissociation rates for the binding kinetics between two species of chemicals, e.g., cell receptors and ligands. The term ’lactate‘, as used herein, includes references to lactate as a free acid (lactic acid), lactate in salt form such as sodium lactate and potassium lactate, or lactate in ionic form or in any other form. The terms ‘preculturing’ or ‘preculture’, as used herein, include reference to the maintenance of one or more cell in a medium, with the main objective to keep the cells alive and furthermore to rid the cells from non-adherent cells and other components that may be disadvantageous or non-beneficial to purification of cells, cell culturing, expansion and/or differentiation. Preculturing is done before the step that has the objective to result in the expansion of a cell or cell population, and is preferably performed in serum-free medium for expanding progenitor cells as disclosed herein, and also as disclosed in PCT/NL2021/050066, the contents of which are incorporated herein by reference. Preferably, preculturing precedes the step of purification of a FAP cell or muscle progenitor cell, as non-adherent cells and other components may thereby be removed prior to purification in for example an antigen-based cell sorting protocol such as FACS. The term ‘triglyceride’, as used herein, includes reference to a lipid that is derived from glycerol and three fatty acids. As a consequence, a triglyceride is an ester with three covalently linked fatty acids. These fatty acids may be saturated, characterized by one or more C=C double bond, or unsaturated, characterized by no C=C double bonds. The term ‘unsaturated fatty acid’, as used herein, includes reference to fatty acids with at least one C=C double bond. Unsaturated fatty acids in animal fat and cultured fat may for example comprise 16, 18, 20 or 22 carbon atoms, and may for example comprise 1, 2, 3, 4, 5, or 6 C=C double bonds. Saturated fatty acids are fatty acids with no C=C double bond. Unsaturated and/or saturated fatty acids may be constituents of lipids, such as triglycerides. In general, unsaturated fatty acids are more beneficial to animal health than saturated fatty acids. The term ‘inflammatory cells’, as used herein, includes reference to cells that are part of the immune system of animals. Examples include macrophages, neutrophils, dendritic cells, innate lymphoid cells, mast cells, eosinophils, basophils, natural killer cells, B cells, T cells and/or granulocytes. The term ‘antibiotics’, as used herein, includes reference to antimicrobial substances that are active against bacteria, for example by killing bacteria or by inhibiting growth of bacteria. Antibiotics may be used in livestock, such as cattle. Antibiotics, or residues thereof, may be passed on to meat products after slaughtering of the animal. Examples of antibiotics used in cattle include bacitracin, bambermycin, laidlomycin, lasalocid, monensin, neomycin, and virginiamycin. The term ‘blood residues’, as used herein, includes reference to components typically found in blood, such as serum, serum proteins, erythrocytes, leukocytes and thrombocytes. The term ‘microbial contamination’, as used herein, includes reference to undesired presence of one or more microbe, such as bacteria, viruses, fungi and archaea. It also includes reference to pathogenic contamination of food products in general. The term ‘cartilage’, as used herein, includes reference to elastic animal tissue that is for example found at the end of bones at joints, in the rib cage, in the ear and in the nose. The term ‘cartilage’ includes reference to the three types of cartilage, i.e. elastic cartilage, hyaline cartilage and fibrocartilage. Cartilage in meat products is not desirable for consumption. The term ‘fibrous tissue’, as used herein, also referred to as fibrous connective tissue, includes reference to a tissue type with a high amount of fibers, such as elastic and collagenous fibers. In meat products, fibrous tissue may render the meat product tough and therefore less desirable for consumption. Methods for producing cultured fat cells The invention provides a method for producing cultured fat cells for animal consumption, and in some embodiments a method for producing cultured fat cells and cultured muscle cells for animal consumption. The invention further comprises a food product for animal consumption comprising a cultured fat cell obtained by a method of the invention, and optionally a cultured muscle cell obtained by a method as disclosed herein. Provision and isolation of fibro-adipogenic progenitor (FAP) cells The invention provides a method for producing cultured fat cells for animal consumption, comprising the steps of: - providing a fibro-adipogenic progenitor (FAP) cell, preferably a bovine FAP cell; - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells; and - culturing said expanded population of FAP cells in a culture medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells. In some embodiments, said FAP cell is provided by a method comprising the step of - providing a muscle tissue sample, preferably a bovine muscle tissue sample, comprising a progenitor cell; - optionally, removing excess fat and/or fibrous tissue from said sample if present; - optionally, subjecting said sample to enzymatic digestion, preferably using a matrix metalloproteinase such as a collagenase; - optionally, subjecting said optionally digested sample to an erythrocyte lysis buffer; - optionally, (pre)culturing said optionally digested and optionally erythrocyte-lysed sample in a culture medium for expanding FAP cells; - purifying a progenitor cell that is a FAP cell from said sample so as to provide a FAP cell. Preferably, said muscle tissue sample comprising at least one progenitor cell comprises a FAP cell and in embodiments also a muscle progenitor cell. More preferably, said muscle tissue sample comprising at least one progenitor cell comprises both FAP cells and muscle progenitor cells. Preferably, the muscle tissue sample as disclosed herein is obtained via biopsy on an animal. Prior to said biopsy, animals may be sedated. Sedation may for example be done by injecting Xyla-Ject 2% at 0.15 ml/100 kg in the tail vain. Preferably, the animal is given local anesthetic at the biopsy site. Local anesthetic may for example be applied via subcutaneous injection, and may be done using procamidor. Preferably, the biopsy is taken via skin incision in order to expose muscle. From said muscle, a muscle tissue sample as disclosed herein can be taken of about one gram. The creation of the incision as disclosed herein and /or the obtaining of the muscle tissue sample as disclosed herein may for example routinely be made using a scalpel. Said muscle tissue sample can be maintained on ice. Exemplary procedures for wound closure comprise the use of skin sutures (PGA 6/0), covering the wound closure using aluminum spray, providing analgesic subcutaneously, for example Novem 20 at 0.025 mL/kg. In embodiments, the muscle tissue sample as disclosed herein is cleaned by the removal of excess fat and fibrous tissue if present. In embodiments, the muscle tissue sample as disclosed herein is subjected to enzymatic digestion, for instance by using a matrix metalloproteinase such as a collagenase. This allows for dissociation of muscle fibers. For example, collagenase AFC A (Worthington, CLS-1, 2000 U/ml) may be used. Exemplary conditions for dissociation using collagenase are an incubation time of 45 minutes and an incubation temperature of 37˚C. In embodiments, the muscle tissue sample as disclosed herein is incubated with erythrocyte lysis buffer. For example, 1x ACK erythrocyte lysis buffer may be used. Exemplary incubation conditions for erythrocyte lysis buffer are an incubation time of 1 minute and an incubation temperature of 37˚C. Preferably, cells obtained from the muscle tissue sample as disclosed herein after said enzymatic digestion and/or said incubation with erythrocyte lysis buffer are precultured by resuspending and incubating said cells in serum-free proliferation medium as disclosed herein (and in PCT/NL2021/050066), and e.g. seeded into bovine collagen type I coated tissue plates. The collagen type I used for coating said tissue plates is for example C2124 from Sigma, and can be applied at 2.5 µg/cm2. Preferably, incubation in said serum-free proliferation medium is done at 37˚C. Preferably, cells obtained from the muscle tissue sample as disclosed herein after said optional preprocessing steps are cultured for e.g. 72 hours and subsequently sorted. Said step of culturing may be called preculturing. Purification of FAP cells In embodiments, a method of the invention comprises a step of – purifying a progenitor cell that is a FAP cell from an optionally preprocessed (i.e. removed excess fat and/or fibrous tissue, enzymatically digested and/or erythrocyte-lysed) muscle tissue sample as disclosed herein. Preferably, the step of purifying a progenitor cell as disclosed herein from a sample as disclosed herein is performed by antigen-based cell sorting such as fluorescence activated cell sorting (FACS). Sorting may for example be done using a MACSQuant Tyto sorter from Miltenyi. In FAPs, several cell surface markers are differentially expressed compared to muscle progenitor cells such as satellite cells. Examples are APBB1IP, NID2, LYN, MLKL, CD14, SH3D21, PRKCH, KCNK6, LHFPL2, HAPLN3, CD248, ADGRG2, GPI, FABP5, THY1, FBP2, COL16A1, TBC1D2, CDH2, LASP1, FLT1, ENG, ITGA5, ITGB3, XYLT1, ETS2, SCIN, ROBO3, PTK2B, GPRC5A, SMAGP, GUCA1A, SLC38A5, SUSD2, TMEM254, KCNK17, NT5E, TNFSF13B, NCKAP5, BASP1, COX6B2, SLC4A8, FZD1, RIPK1, HMGCS1, EDNRA, GPAT3, ATP1B3, TES, GMIP, DCHS1, PITPNM3, CSF1R, PTPRM, DPYSL2, IL16, NME2, FNBP1, NME1, MYLK, ARAP1, CASP4, ADAMTSL4, EMP3, DDIAS, FABP3, STAC, KCNJ15, DIAPH3, EPB41L3, BLVRB, STIL, IL1RL1, F2RL1, THBS2, TRPM4, PALM3, STOM, FAM72A, ADA, LRRFIP2, UAP1, ITGA9, RAB23, CEP55, POLE, IFRD1, FYN, ITPKA, BZW2, IL7R, CPZ, TMEM258, SC5D, MSN, NTNG2, ATG7, JAK3, PEBP1, PAQR8, ASPM, CD38, ATP2B4, FILIP1L, PDE3A, TRPV2, SLC16A3, NPTXR, SLC16A1, SRD5A3, ITGB4, KNTC1, CDIPT, IL10RA, CRYBG3, IL21R, DAW1, PRC1, APOLD1, PRKCE, POU2F3, SLC13A5, LRRC15, ERAP1, IL1R1, HAUS7, NCS1, RTN4RL1, SOCS5, GNB4, XPO6, SUMF2, KDR, PLAUR, PTPN22, RAB8A, SLC1A5, JAK2, SRPRB, CRIP1, CLIC2, SEC16B, KIF21B, TNFRSF8, TRAIP, BEND6, NGEF, ARHGEF40, PIGB, SLC5A6, LPAR3, TCIM, ANO10, EIF2B2, SIGLEC10, MYO10, HAUS4, SLC19A1, FMNL2, SUCLG2, UBE2K, CENPJ, EPB41L2, ICAM1, TTLL5, RAB3GAP2, SLC39A14, BANK1, CSF1, CREB5, CYP20A1, CCDC136, DHDDS, FAM126A, FBLN5, UBASH3B, CIP2A, IQGAP2, ATP8B1, RGS7BP, ASGR2, SCN8A, CORO2A, KLHL7, HERPUD1, ACTN1, RASD1, UTP20, TBXA2R, DDAH1, PACSIN2, TDP1, DAB2, SLC7A5, CAVIN3, LINGO1, TMEM268, GPRIN2, SWAP70, UBE2QL1, NLGN1, TLR4, PI3, NDC1, DBN1, PPP2R1B, DBN1, PPP2R1B, GTSE1, SLC9A1, CRIP2, UBE2C, EHD1, EPHA3, ATP23, GNAI2, PDGFRA, CRLF3, CFAP157, IYD, TM2D2, P3H3, AMACR, TRAF7, BAIAP2, AXIN2, STEAP4, SNAP23, TWF2, HYLS1, ARHGAP18, GLO1, ARHGEF5, PFDN1, COL6A2, RPIA, TICAM1, TULP3, MKRN3, CALCRL, TBC1D10A, CD274, TM4SF20, BOC, PDZD2, ADGRD1, SLC39A6, NEO1, OLR1, SDC4, FCGR1A, PTX3, NHSL2, DNAJC9, PSD, CTNNB1, NMT2, FRMD8, FKBP2, PHGDH, GPX8, PDE4A, RIC8A, B2M, ACOT9, EIF5B, NCKAP1L, PDAP1, CAVIN1 and TRIM4. Any one, or any combination, of the examples listed above may be used as a marker for the identification and/or purification of FAP cells. This list of cell surface markers is also provided in Table 1. In muscle progenitor cells such as satellite cells, several cell surface markers are differentially expressed (upregulated) compared to FAP cells. A list of these upregulated genes is provided in Table 2. Preferably, FAPs are characterized by the presence of cell surface markers CD9, CD14, CD49e, CD61, CD140a and/or ITGA9, and/or the absence of cell surface markers CD45, CD321, CD56 and/or ITGA7, or a selection of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 of said cell surface markers. More preferably, FAPs are characterized by the presence of cell surface marker CD140a. FAPs may also be characterized by the presence of cell surface marker ITGA5, and/or the presence of cell surface marker CD140a, and the absence of cell surface marker ITGA7. Preferably, satellite cells are characterized by the presence of cell surface marker ITGA7. Alternatively, satellite cells are characterized by the absence of cell surface marker ITGA5, and/or the absence of cell surface marker CD140a and the presence of cell surface marker ITGA7. In embodiments, said step of purifying a FAP cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of: the presence of a cell surface marker CD140a and the presence of a cell surface marker CD9, the presence of a cell surface marker CD140a and the presence of a cell surface marker CD14, the presence of a cell surface marker CD140a and the presence of a cell surface marker CD49e, the presence of a cell surface marker CD140a and the presence of a cell surface marker CD61, the presence of a cell surface marker CD140a and the presence of a cell surface marker ITGA9, the presence of a cell surface marker CD140a and the absence of a cell surface marker ITGA7, the presence of a cell surface marker CD140a and the absence of a cell surface marker CD45, the presence of a cell surface marker CD140a and the absence of a cell surface marker CD321, the presence of a cell surface marker CD140a and the absence of a cell surface marker CD56. In embodiments, said step of purifying a FAP cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of: the absence of a cell surface marker ITGA7 and the presence of a cell surface marker CD9, the absence of a cell surface marker ITGA7 and the presence of a cell surface marker CD14, the absence of a cell surface marker ITGA7 and the presence of a cell surface marker CD49e, the absence of a cell surface marker ITGA7 and the presence of a cell surface marker CD61, the absence of a cell surface marker ITGA7 and the presence of a cell surface marker ITGA9, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321, and/or the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD56. In embodiments, said step of purifying a FAP cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of: the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the presence of a cell surface marker CD14; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the presence of a cell surface marker CD49e; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the presence of a cell surface marker CD61; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD9 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD14 and the presence of a cell surface marker CD49e; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD14 and the presence of a cell surface marker CD61; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD14 and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD14 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD14 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD14 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD14 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD49e and the presence of a cell surface marker CD61; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD49e and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD49e and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD49e and the absence of a cell surface marker CD45; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD49e and the absence of a cell surface marker CD321; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD49e and the absence of a cell surface marker CD56; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD61 and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD61 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD140a, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD140a, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD140a, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD140a, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD140a, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD140a, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD140a, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD140a, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD140a, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD140a, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD140a, the absence of a cell surface marker CD321 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD9, the presence of a cell surface marker CD14 and the presence of a cell surface marker CD49e; the presence of a cell surface marker CD9, the presence of a cell surface marker CD14 and the presence of a cell surface marker CD61; the presence of a cell surface marker CD9, the presence of a cell surface marker CD14 and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD9, the presence of a cell surface marker CD14 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD9, the presence of a cell surface marker CD14 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD9, the presence of a cell surface marker CD14 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD9, the presence of a cell surface marker CD14 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD9, the presence of a cell surface marker CD49e and the presence of a cell surface marker CD61; the presence of a cell surface marker CD9, the presence of a cell surface marker CD49e and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD9, the presence of a cell surface marker CD49e and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD9, the presence of a cell surface marker CD49e and the absence of a cell surface marker CD45; the presence of a cell surface marker CD9, the presence of a cell surface marker CD49e and the absence of a cell surface marker CD321; the presence of a cell surface marker CD9, the presence of a cell surface marker CD49e and the absence of a cell surface marker CD56; the presence of a cell surface marker CD9, the presence of a cell surface marker CD61 and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD9, the presence of a cell surface marker CD61 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD9, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD9, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD9, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD9, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD9, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD9, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD9, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD9, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD9, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD9, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD9, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD9, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD9, the absence of a cell surface marker CD321 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD14, the presence of a cell surface marker CD49e and the presence of a cell surface marker CD61; the presence of a cell surface marker CD14, the presence of a cell surface marker CD49e and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD14, the presence of a cell surface marker CD49e and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD14, the presence of a cell surface marker CD49e and the absence of a cell surface marker CD45; the presence of a cell surface marker CD14, the presence of a cell surface marker CD49e and the absence of a cell surface marker CD321; the presence of a cell surface marker CD14, the presence of a cell surface marker CD49e and the absence of a cell surface marker CD56; the presence of a cell surface marker CD14, the presence of a cell surface marker CD61 and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD14, the presence of a cell surface marker CD61 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD14, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD14, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD14, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD14, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD14, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD14, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD14, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD14, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD14, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD14, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD14, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD14, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD14, the absence of a cell surface marker CD321 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD49e, the presence of a cell surface marker CD61 and the presence of a cell surface marker ITGA9; the presence of a cell surface marker CD49e, the presence of a cell surface marker CD61 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD49e, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD49e, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD49e, the presence of a cell surface marker CD61 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD49e, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD49e, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD49e, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD49e, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD49e, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD49e, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD49e, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD49e, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD49e, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD49e, the absence of a cell surface marker CD321 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD61, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker ITGA7; the presence of a cell surface marker CD61, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD61, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD61, the presence of a cell surface marker ITGA9 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD61, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the presence of a cell surface marker CD61, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD61, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD61, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the presence of a cell surface marker CD61, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD56; the presence of a cell surface marker CD61, the absence of a cell surface marker CD321 and the absence of a cell surface marker CD56; the presence of a cell surface marker ITGA9, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the presence of a cell surface marker ITGA9, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the presence of a cell surface marker ITGA9, the absence of a cell surface marker ITGA7 and the absence of a cell surface marker CD56; the presence of a cell surface marker ITGA9, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the presence of a cell surface marker ITGA9, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD56; the presence of a cell surface marker ITGA9, the absence of a cell surface marker CD321 and the absence of a cell surface marker CD56; the absence of a cell surface marker ITGA7, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the absence of a cell surface marker ITGA7, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD56; the absence of a cell surface marker ITGA7, the absence of a cell surface marker CD321 and the absence of a cell surface marker CD56; and/or the absence of a cell surface marker CD45, the absence of a cell surface marker CD321 and the absence of a cell surface marker CD56. In embodiments, said step of purifying a FAP cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of i) the presence of a cell surface marker selected from the group consisting of CD140a, CD14, CD49e, CD61 and ITGA9 and/or (ii) the absence of cell surface marker selected from the group consisting of ITGA7 and CD56. A combination of 2, 3, 4, 5, 6, or 7 of said cell surface markers may be used as a basis for performing antigen-based cell sorting as disclosed herein for the purification of muscle progenitor cells. In embodiments, said purifying a FAP cell from said sample by performing antigen-based cell sorting is based on the presence of CD140a and the absence of ITGA7 Preferably, said purifying a FAP cell from said sample by performing antigen-based cell sorting is based on the presence of CD140a and CD49e and the absence of CD321, CD45 and ITGA7. In an embodiment to purify FAP cells, antigen-based cell sorting as disclosed herein is performed on the basis of (i) the presence of at least one cell surface marker selected from the group consisting of CD140a, CD9, CD14, CD49e, CD61 and ITGA9 and/or (ii) the absence of at least one cell surface marker selected from the group consisting of ITGA7, CD45, CD321 and CD56. In an embodiment to purify FAP cells, antigen-based cell sorting as disclosed herein is performed on the basis of (i) the presence of at least one cell surface marker selected from the group consisting of CD140a, CD9, CD14, CD49e, CD61 and ITGA9 and/or (ii) the absence of cell surface markers ITGA7, CD45, CD321 and CD56. In embodiments, said step of purifying a muscle progenitor cell, preferably a satellite cell, from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is performed on the basis of: the absence of a cell surface marker CD140a and the presence of a cell surface marker CD9, the absence of a cell surface marker CD140a and the absence of a cell surface marker CD14, the absence of a cell surface marker CD140a and the absence of a cell surface marker CD49e, the absence of a cell surface marker CD140a and the absence of a cell surface marker CD61, the absence of a cell surface marker CD140a and the absence of a cell surface marker ITGA9, the absence of a cell surface marker CD140a and the presence of a cell surface marker ITGA7, the absence of a cell surface marker CD140a and the absence of a cell surface marker CD45, the absence of a cell surface marker CD140a and the absence of a cell surface marker CD321, the absence of a cell surface marker CD140a and the presence of a cell surface marker CD56, the presence of a cell surface marker ITGA7 and the presence of a cell surface marker CD9, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD14, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD49e, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD61, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker ITGA9, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321, and/or the presence of a cell surface marker ITGA7 and the presence of a cell surface marker CD56. In muscle progenitor cells, several cell surface markers are differentially expressed (upregulated) as compared to FAP cells. These are listed in Table 2. Examples are SMOC1, KLHL41, CHRNA1, CDH1, NCAM1, COBL, ADORA1, BCAR3, ITGA7, PLXNA4, LOXHD1, ENO3, CDH13, CD93, HTRA1, ASB5, ERBB3, MET, FRMD7, CHRND, SORBS1, CAVIN4, PARD6G, CAP2, SYNC, MCAM, SCN1A, ARHGAP24, SERINC2, AFAP1L2, CAVIN2, SYPL2, EFR3B, BAIAP2L1, PCDH17, XIRP1, FLNC, KANK1, ROM1, MYL4, RGS10, PCDHGA3, TACC2, MAMDC2, NEXN, AMIGO2, CAV3, MARCKS, SEMA6D, SMPX, KCNB2, NCOA1, SOX11, MCF2L2, B3GALT2, DLG2, OSR2, PHACTR1, ANXA13, PTPN4, PCDH7, DYSF, CDH15, PTPRK, PRTG, SLC40A1, RHOJ, EPB41L4B, ADGRL2, ECSCR, RNF149, MTSS1, FAIM, RAPSN, TMEM63B, TRIM54, ABCC5, GRIK5, CNKSR2, TXNIP, ARHGDIG, BVES, PIP4K2C, LMOD2, CRYAB, ITGA3, PSTPIP2, EPHB1, CACNG4, S100A16, ARHGEF26, ANK3, BFSP2, RGS14, MBP, GNAS, SCN9A, APBB1, STK17A, PRR32, WIPF1, MYO5B, COL17A1, CD37, PDE4D, PPIP5K1, SH3BGR, NRP2, TMEM108, ABCA7, TMEM266, PPP1R9A, ATG13, FBLN7, TNNI2, ITGB7, VAMP5, KIF21A, GYPC, ARRB2, MMP15, CCDC69, SCEL, DAG1, ANKRD35, RNF165, PTPRR, RALGAPA2, SORT1, GCLM, TSPAN15, CX3CL1, PDE9A, PTPN21, PTPRS, PRKCA, PRDX6, ARHGEF28, TMEM245, CNP, HIP1R, PAWR, CYFIP2, ANKRD45, RELL1, BLNK, NRCAM, KIAA1522, MYH11, OCA2, SLC12A2, INSR, ARHGEF12, FUT2, TMEM107, SLC9A5, TEK, EPB41L4A, SYNGR3, DCUN1D2, NOTCH2, KIAA1958, ANXA3, CTNND1, LRRC9, NECTIN4, ST8SIA5, ARVCF, ENC1, SEMA6C, PTPRB, CAMK2B, CORO2B, HTR1B, OCLN, GRAMD1B, ZNF706, TMTC2, ITGB8, DDIT4L, EXOC3L1, LMTK2, CDH26, ADRA1B, CTSV, HIF3A, EPOR, MADD, DDX58, UNC5A, BMX, SLC39A2, PSD2, KCNAB1, STK17B, ZNF839, LAT2, S100A2, VWA7, ATP2B1, ARMC12, CAMK2A, CA9, APOD, CLCN5, CDV3, GALNT10, ROBO1, JUP, AVPI1, CTSF, DNAJB4, ITGA2B, TEX9, PAK1, PACSIN3, SLIT1, CCDC8, MTCP1, LPAR4, CDH3, TRIM44, CLIC5, OGT, TBC1D24, ELN, SYCP2, TEX14, EPHA2, S100A13, CGN, IFIT5, FAM210B, USP2, NF2, CD163, LYST, GAB2, KLF9, FZD6, OSBPL6, MYO1B, TNFRSF25, RASGRP1, ABCG2, CAMK2D, SHANK1, PALMD, CMTM7, HYI, CCDC24, TASP1, DCAF16, DCBLD2, UTRN, KIF17, CTNNBIP1, ABCC6, CCDC28A, TSG101, PCMTD1, FRMD3, ANKRA2, MAPT, SPINT2, UBQLN2, ITGA4, LONRF3, RNF146, SMAP1, PKN1, LGALS4, METAP2, HARBI1, MACF1, SLC38A6, PPM1A, PPP1R27, GLUL, AGER, SEMA3C, CST6, ARHGAP23, ABCC3, SPPL3, C17orf58, MAP3K21, CD99L2, PURG, DLGAP3, FOXN3, DIO2, UBE2D1, TTC7B, ARHGAP29, TCAF2, SLC31A2, UBE2B, PPP1R16B, LZTS1, TBC1D30, ZNF646, APLP1, RASSF2, DNAJC6, DAAM1, CPPED1, GPBP1L1, FBXO41, MAT2B, CCDC112, ZSWIM8, CYTH2, PNISR, LRP12, RSPH3, SLCO4C1, ZNF599, BFSP1, SSH1, ZNF10, TSHZ3, ARID2, ARRDC4, OSBPL10, MMP25, PARD3 and SLC9A3R1. Any one, or any combination, of the cell surface markers listed above may be used as a marker for the identification and/or purification of muscle progenitor cells. The antigen-based cell sorting procedure for purifying a progenitor cell that is a muscle progenitor cell as disclosed herein is preferably based on i) the absence of a cell surface marker selected from the group consisting of CD140a, CD14, CD49e, CD61, CD321, CD45 and ITGA9 and/or (ii) the presence of cell surface marker selected from the group consisting of ITGA7, CD56 and optionally CD9. A combination of 2, 3, 4, 5, 6,7, 8, 9 or 10 of said cell surface markers may be used as a basis for performing FACS as disclosed herein for the purification of muscle progenitor cells. In embodiments, said step of purifying a muscle progenitor cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting) is performed on the basis of: the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the absence of a cell surface marker CD49e; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the absence of a cell surface marker CD61; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the absence of a cell surface marker ITGA9; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD14 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD49e and the absence of a cell surface marker CD61; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD49e and the absence of a cell surface marker ITGA9; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD49e and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD49e and the absence of a cell surface marker CD45; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD49e and the absence of a cell surface marker CD321; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD49e and the presence of a cell surface marker CD56; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD61 and the absence of a cell surface marker ITGA9; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD61 and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD61 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD61 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD61 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD140a, the absence of a cell surface marker ITGA9 and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD140a, the absence of a cell surface marker ITGA9 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD140a, the absence of a cell surface marker ITGA9 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD140a, the absence of a cell surface marker ITGA9 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD140a, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD140a, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD140a, the presence of a cell surface marker ITGA7 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD45 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD140a, the absence of a cell surface marker CD321 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD321 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD14, the absence of a cell surface marker CD49e and the absence of a cell surface marker CD61; the absence of a cell surface marker CD14, the absence of a cell surface marker CD49e and the absence of a cell surface marker ITGA9; the absence of a cell surface marker CD14, the absence of a cell surface marker CD49e and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD14, the absence of a cell surface marker CD49e and the absence of a cell surface marker CD45; the absence of a cell surface marker CD14, the absence of a cell surface marker CD49e and the absence of a cell surface marker CD321; the absence of a cell surface marker CD14, the absence of a cell surface marker CD49e and the presence of a cell surface marker CD56; the absence of a cell surface marker CD14, the absence of a cell surface marker CD61 and the absence of a cell surface marker ITGA9; the absence of a cell surface marker CD14, the absence of a cell surface marker CD61 and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD14, the absence of a cell surface marker CD61 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD14, the absence of a cell surface marker CD61 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD14, the absence of a cell surface marker CD61 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD14, the absence of a cell surface marker ITGA9 and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD14, the absence of a cell surface marker ITGA9 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD14, the absence of a cell surface marker ITGA9 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD14, the absence of a cell surface marker ITGA9 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD14, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD14, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD14, the presence of a cell surface marker ITGA7 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD14, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD14, the absence of a cell surface marker CD45 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD14, the absence of a cell surface marker CD321 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD49e, the absence of a cell surface marker CD61 and the absence of a cell surface marker ITGA9; the absence of a cell surface marker CD49e, the absence of a cell surface marker CD61 and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD49e, the absence of a cell surface marker CD61 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD49e, the absence of a cell surface marker CD61 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD49e, the absence of a cell surface marker CD61 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD49e, the absence of a cell surface marker ITGA9 and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD49e, the absence of a cell surface marker ITGA9 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD49e, the absence of a cell surface marker ITGA9 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD49e, the absence of a cell surface marker ITGA9 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD49e, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD49e, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD49e, the presence of a cell surface marker ITGA7 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD49e, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD49e, the absence of a cell surface marker CD45 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD49e, the absence of a cell surface marker CD321 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD61, the absence of a cell surface marker ITGA9 and the presence of a cell surface marker ITGA7; the absence of a cell surface marker CD61, the absence of a cell surface marker ITGA9 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD61, the absence of a cell surface marker ITGA9 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD61, the absence of a cell surface marker ITGA9 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD61, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the absence of a cell surface marker CD61, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD61, the presence of a cell surface marker ITGA7 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD61, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the absence of a cell surface marker CD61, the absence of a cell surface marker CD45 and the presence of a cell surface marker CD56; the absence of a cell surface marker CD61, the absence of a cell surface marker CD321 and the presence of a cell surface marker CD56; the absence of a cell surface marker ITGA9, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD45; the absence of a cell surface marker ITGA9, the presence of a cell surface marker ITGA7 and the absence of a cell surface marker CD321; the absence of a cell surface marker ITGA9, the presence of a cell surface marker ITGA7 and the presence of a cell surface marker CD56; the absence of a cell surface marker ITGA9, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the absence of a cell surface marker ITGA9, the absence of a cell surface marker CD45 and the presence of a cell surface marker CD56; the absence of a cell surface marker ITGA9, the absence of a cell surface marker CD321 and the presence of a cell surface marker CD56; the presence of a cell surface marker ITGA7, the absence of a cell surface marker CD45 and the absence of a cell surface marker CD321; the presence of a cell surface marker ITGA7, the absence of a cell surface marker CD45 and the presence of a cell surface marker CD56; the presence of a cell surface marker ITGA7, the absence of a cell surface marker CD321 and the presence of a cell surface marker CD56; and/or the absence of a cell surface marker CD45, the absence of a cell surface marker CD321 and the presence of a cell surface marker CD56. Preferably, said step of purifying a muscle progenitor cell from a muscle tissue sample as disclosed herein by performing antigen-based cell sorting is done on the basis of i) the absence of a cell surface marker selected from the group consisting of CD140a, CD14, CD49e, CD61 and ITGA9, e.g. the absence of CD140a, and/or (ii) the presence of cell surface marker selected from the group consisting of ITGA7 and CD56, e.g. the presence of ITGA7. A combination of 2, 3, 4, 5, 6 or 7 of said cell surface markers may be used as a basis for performing antigen-based cell sorting as disclosed herein for the purification of muscle progenitor cells. In embodiments, the FAP cell and the muscle progenitor cell as disclosed herein are purified by, for FAP cells, performing antigen-based cell sorting on the basis of (i) the presence of a cell surface marker selected from the group consisting of CD140a (PDGFRa), CD9, CD14, CD49e, CD61 and ITGA9 and/or (ii) the absence of a cell surface marker selected from the group consisting of ITGA7, CD45, CD321 (F11R) and CD65, and, for muscle progenitor cells by performing antigen-based cell sorting on the basis of (i) the presence of a cell surface marker that is ITGA7 and/or (ii) the absence of cell surface marker CD140a (PDGFRa). Preferably, FAP cells and SC cells originate from the same muscle tissue sample, and are purified and separated in the same antigen-based cell sorting procedure by employing cell surface markers that allow for these cell types to be distinguished. On the basis of the present disclosure, the skilled person is able to routinely separate FAP cells from SC cells on the basis of mutually exclusive cell surface markers. Expansion of FAP cells The invention provides a method for producing cultured fat cells for animal consumption, comprising the steps of: - providing a fibro-adipogenic progenitor (FAP) cell; - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells; and - culturing said expanded population of FAP cells in a culture medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells. Preferably, the step of culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells can be performed by any suitable culture medium that allows for expansion (proliferation) of progenitor cells such as FAP cells. Preferably, such a medium is a serum-free media and does not comprise animal-derived components. Preferably, such a medium, and the methods of the invention, are entirely animal component-free. An exemplary, and non-limiting, culture medium for expanding FAP cells is a serum-free medium comprising - an albumin; and - a fibroblast growth factor (FGF) such as FGF2. In embodiments, said serum-free medium for expanding a FAP cell as disclosed herein may further comprise one or more vitamins and/or hormones selected from the group consisting of ascorbic acid or a derivative thereof, an insulin, a somatotropin and a hydrocortisone, and one or more cytokines and/or growth factors selected from the group consisting of a platelet-derived growth factor (PDGF), an insulin-like growth factor (IGF), a vascular endothelial growth factor (VEGF), an hepatocyte growth factor (HGF) and an interleukin 6 (IL-6). In embodiments, said one or more cytokines and/or growth factors are selected from the group of combinations comprising i) an IL-6; ii) an IL- 6 and an IGF; iii) an IL-6, an IGF and an HGF; iv) an IL-6, an IGF, an HGF and a PDGF; v) an IL-6, an IGF, and a VEGF; vi) an IL-6, an IGF and a PDGF; vii) an IL- 6, a PDGF and a VEGF; viii) an IL-6, an IGF, a PDGF and a VEGF; and ix) an IL- 6, an IGF, an HGF, a PDGF and a VEGF. In embodiments, said serum-free medium for proliferating an adipogenic progenitor cells comprises a PDGF, a VEGF, an HGF, an IGF and an IL-6. In embodiments, the serum-free medium for expanding progenitor cells such as FAP cells comprises: wherein said serum-free medium comprises: - an albumin; - a fibroblast growth factor (FGF); - one or more vitamins and/or hormones selected from the group consisting of ascorbic acid or a derivative thereof, an insulin, a somatotropin and a hydrocortisone; - one or more cytokines and/or growth factors selected from the group consisting of a platelet-derived growth factor (PDGF), an insulin-like growth factor (IGF), a vascular endothelial growth factor (VEGF), an hepatocyte growth factor (HGF) and an interleukin 6 (IL- 6); - a basal medium; - a source of glucose; - a source of glutamine; - a source of fatty acids; - a source of iron or an iron transporter; and - sodium selenite; and optionally a protein hydrolysate, a biogenic amine and/or an attachment factor. Exemplary, but non-limiting, serum-free proliferation media, and expansion culture conditions, are for instance disclosed in PCT/NL2021/050066, such as the medium referred to as SFM1 in PCT/NL2021/050066. The contents of PCT/NL2021/050066 are incorporated herein by reference. Culturing resulting in the expansion of FAP cells may be performed two- dimensionally or three-dimensionally. For two-dimensional culturing, FAP cells as disclosed herein may be propagated in tissue culture flasks in a culture medium for expanding FAP cells as disclosed herein. For three-dimensional culturing, e.g. microcarrier-based cell culturing (in suspension culture) , FAP cells as disclosed herein may be propagated in any suitable vessel such as spinner flasks or bioreactors which may comprise microcarriers. Three-dimensional culturing is advantageous compared to two-dimensional culturing when aiming to achieve expansion on a large scale. Preferably, in a method of the invention, culturing of FAP cells is performed in a way that leads to three-dimensional expansion. In some embodiments, the step of culturing a FAP cell as disclosed herein in a culture medium for expanding FAP cells as disclosed herein to thereby provide an expanded population of FAP cells is performed in the form of a microcarrier-based cell culture. The serum-free proliferation (expansion) medium as disclosed herein can also be used to expand muscle progenitor cells. Differentiation of FAP cells A method of the invention involves the step of - culturing an expanded population of FAP cells in a culture medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells. Preferably, said culture medium for differentiating FAP cells can be any suitable culture medium that allows for differentiation of FAP cells into adipocytes. Preferably, such a medium is a serum-free media and does not comprise animal- derived components. Preferably, such a medium, and the methods of the invention, are entirely animal component-free. An exemplary, and expressly non-limiting, culture medium for differentiating FAP cells into adipocytes is a serum-free medium comprising: - at least one peroxisome proliferator-activated receptor gamma (PPARy) agonist; - at least one hormone selected from the group consisting of insulin and hydrocortisone; - at least one cytokine and/or growth factor selected from the group consisting of bone morphogenetic protein 4 (BMP4) and epidermal growth factor (EGF); and - ascorbic acid or a derivative thereof. In embodiments, said serum-free medium comprises bone morphogenetic protein 4 (BMP4) and epidermal growth factor (EGF) as said at least one cytokine and/or growth factor; and wherein said serum- free medium optionally further comprises fibroblast growth factor (FGF) such as FGF2. Preferably, said medium comprises both insulin and hydrocortisone as said at least one hormone. Preferably, said serum-free medium does not comprise a differentiation inducer selected from the group consisting of isobutyl-methyl- xantane (IBMX), dexamethasone and/or a thiazolidinedione such as rosiglitazone, pioglitazone, lobeglitazone, cigilitazone, darglitazone, englitazone, netoglitazone, rivoglitazone, troglitazone and/or balaglitazone. Preferably, said at least one PPARy agonist is selected from the group consisting of indomethacin, amorfrutin B, magnolol and honokiol, preferably indomethacin or magnolol. Preferably, said serum-free medium comprises a source of energy that allows for differentiation of said adipogenic progenitor cell. In an embodiment, said serum-free medium for differentiating a FAP cell comprises: - at least one peroxisome proliferator- activated receptor gamma (PPARy) agonist, preferably indomethacin or magnolol; - hydrocortisone; - insulin; - bone morphogenetic protein 4 (BMP4); - epidermal growth factor (EGF); - ascorbic acid or a derivative thereof; and - a basal medium, preferably DMEM/F12; and wherein said serum-free medium for differentiating optionally further comprises - at least one biogenic amine such as putrescine, - a fibroblast growth factor (FGF) such as FGF2, - a source of lipids, preferably wherein said source of lipids is a source of saturated and unsaturated fatty acids, - progesterone; and/or - HEPES. In embodiments, the at least one hormone that is a hydrocortisone can be present in the medium in a concentration of 0.01 – 1000 nM, preferably 1 - 500 nM, more preferably about 100 nM. In embodiments, insulin can be present in the medium in a concentration of 0.01-200 µM, preferably 0.1-20 µM, more preferably 1-2 µM. In embodiments, the BMP4 as disclosed herein is animal BMP4, more preferably mammalian BMP4, such as E. coli derived recombinant human BMP4 (e.g.120-05ET from Peprotech). The BMP4 can be present in the medium in a concentration of 0.03-60000 nM, preferably 0.3-6000 nM, more preferably 3-600 nM or 30-60 nM. In embodiments, the EGF as disclosed herein is animal EGF, more preferably mammalian EGF, such as recombinant human EGF (e.g. AF-100-15 from Peprotech). The EGF can be present in the medium in a concentration of 3- 30000 pM, preferably 30-3000 pM, more preferably about 322 pM. The FGF as disclosed herein in relation to an adipogenic differentiation medium can be an FGF2 (e.g. 100-18B from Peprotech) and can be present in the medium in a concentration of 1-10000 pM, preferably 10-1000 pM, more preferably 20-800 pM, more preferably 50-500 pM, more preferably 75-250 pM, more preferably 100-150 pM, more preferably about 115 pM. In embodiments, ascorbic acid or a derivative thereof such as L-ascorbic acid 2-phosphate can be present in the medium in a concentration of 0.01 – 10000 µM, preferably 1- 500 µM, more preferably about 227 µM. In embodiments, the biogenic amine can be present in the medium in a concentration of 0.01 - 1000 µM, more preferably 0.1 to 500 µM or 1-100 µM or 20- 80 µM or 50-60 µM, most preferably about 56 µM. In embodiments, a medium for differentiating FAP cells as disclosed herein further comprises one or more basal media. More preferably, a serum-free medium of the invention further comprises one or more basal media selected from the group comprising DMEM and Ham’s F-12; even more preferably a combination of DMEM and Ham’s F-12. In embodiments, the combination of DMEM and Ham’s F-12 is in a ratio of 1:10 to 10:1 v/v, more preferably in a ratio of 1:1 v/v. In embodiments, a medium for differentiating FAP cells as disclosed herein may further comprise one or more additional vitamins and/or hormones, such as progesterone. Progesterone can be present in the medium in a concentration of 0.01 – 400 nM, preferably 0.1 - 40 nM, more preferably about 18 nM. In embodiments, a medium for differentiating FAP cells as disclosed herein may further comprise one or more buffering agent, such as one or more of sodium bicarbonate (e.g. S5761 from Sigma Aldrich) and HEPES (e.g. H3375 from Sigma Aldrich). The sodium bicarbonate can be present in the medium in a concentration of 0.2-2000 mM, preferably 2-200 mM, more preferably about 20 mM. The HEPES can be present in the medium in a concentration of 0.05-500 mM, preferably 0.5-50 mM, more preferably about 5 mM. A medium for differentiating FAP cells as disclosed herein may further comprises one or more source of glutamine, preferably one or more of L-glutamine (e.g. G8540 from Sigma Aldrich) and L-alanyl-L-glutamine (e.g. GlutaMAX™ from Gibco). The one or more source of glutamine can be present in the medium in a concentration of 0.04-400 mM, preferably 0.4-40 mM, more preferably about 4 mM. The skilled person can routinely calculate and adjust the osmolality of a solution in general and of a medium in particular if needed. Osmolality is typically expressed in milliosmoles per kilogram of water (mOsm/kg). Osmolality may be measured using an osmometer. In embodiments, the osmolality of a medium for differentiation as disclosed herein is within the range of 180-380 mOsm/kg, preferably within the range of 275-299 mOsm/kg. In another embodiments, the serum-free medium for differentiating a FAP cells is as disclosed in Example 1. The adipogenic differentiation can occur in the form of a two-dimensional or three- dimensional cell culture. Three-dimensional differentiation of adipogenic progenitor cells may result in a structure comprising adipocytes that from a macroscopic perspective mimics subcutaneous fat in texture and appearance. This is a desirable effect, as it may be used to create meat products that mimic non- cultured meat products in terms of texture and appearance. In order to achieve three-dimensional differentiation of adipogenic progenitor cells as disclosed herein, a three-dimensional system can be provided that is preferably edible and scalable. A non-limiting example of a three- dimensional cell culture system is a hydrogel. In embodiments, said hydrogel is a hydrogel comprising alginate. Preferably, adipogenic differentiation is performed as a three-dimensional cell culture, for instance in a protein matrix, scaffold or cell aggregate. Exemplary, but expressly non-limiting, culturing conditions for FAP cells that lead to differentiation are as follows: expanded FAP cells are suspended in alginate solution, e.g.0.5% high viscosity alginate solution (such as Sigma W201502), at a concentration of e.g. 3x107 cells/mL. The resulting cell-alginate suspension can be injected into a CaCl2 solution (e.g. at 66 mM) with 10 mM HEPES. Resultant microfibers can be washed and transferred to a tissue culture plate, such as a 12-well tissue culture plate, containing serum-free adipogenic differentiation medium as disclosed herein. Fibres are then incubated on a shaking platform, e.g. at 75 RPM at 37˚C and e.g. at 5% CO2, and culture media is replaced when needed, e.g. every 3-4 days for e.g.28 days. In embodiments, the step of culturing said expanded population of FAP cells in a medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells is carried out in and/or on microfibres. These microfibres may for example be made using alginate (i.e. alginate-based microfibers). Thus, in embodiments, the expanded population of FAP cells is provided in the form of a three-dimensional cell culture (e.g. a microfiber, such as an alginate-based microfiber) for subsequent adipogenic differentiation. Differentiating muscle progenitor cells In a method for producing cultured fat cells and cultured muscle cells of the invention, a culture medium for differentiating muscle progenitor cells to thereby differentiate muscle progenitor cells into (partially or terminally differentiated) muscle cells is used. Preferably, a medium for differentiating muscle progenitor cells as disclosed herein is a serum-free medium. Preferably, said culture medium for differentiating muscle progenitor cells can be any suitable culture medium that allows for differentiation of muscle progenitor cells into partially or terminally differentiated muscle cells such as a myocyte, myotube and/or myofiber. Preferably, such a medium is a serum-free media and does not comprise animal-derived components. Preferably, such a medium, and the methods of the invention, are entirely animal component-free. An exemplary, and expressly non-limiting, example of a culture medium for differentiating muscle progenitor cells comprises: - at least one (myogenic) differentiation inducer selected from the group consisting of a lysophosphatidic acid receptor 1 (LPAR1) agonist, a lysophosphatidic acid receptor 3 (LPAR3) agonist, an oxytocin receptor (OXTR) agonist, a glucagon receptor (GCGR) agonist and a lactate. In embodiments, the LPAR1 is preferably a bovine LPAR1 such as identified by UniProtKB - Q28031. The LPAR3 as disclosed herein can be a bovine LPAR3 such as identified by UniProtKB - F1MX11. The OXTR as disclosed herein can be a bovine OXTR such as identified by UniProtKB - P56449. The GCGR as disclosed herein can be a bovine GCGR such as identified by UniProtKB - E1BKB6. In embodiments, at least one of the differentiation inducers as disclosed herein can be employed in a medium for differentiating muscle progenitor cells as disclosed herein in combination with one or more further differentiation inducer as disclosed herein. For instance, combinations of (i) an LPAR1 agonist or an LPAR3 agonist, and an OXTR agonist, (ii) an LPAR1 agonist or an LPAR3 agonist, and a GCGR agonist, (iii) an LPAR1 agonist or an LPAR3 agonist, and a lactate, (iv) an OXTR agonist and a GCGR agonist, (v) an OXTR agonist and a lactate, (vi) a GCGR agonist and a lactate, and (vii) an LPAR1 agonist and an LPAR3 agonist, are envisaged. In other embodiments, at least three, at least four or at least five of the differentiation inducers as disclosed herein can be employed in a medium for differentiating muscle progenitor cells as disclosed herein. For instance, an example of at least three differentiation inducers is a combination of at least LPAR1 (or an LPAR3) agonist, an OXTR agonist and a GCGR agonist. The LPAR1 agonist can be present in a medium for differentiating muscle progenitor cells as disclosed herein in a concentration of 0.01 – 500 μM, preferably 0.5 - 50 μM, more preferably about 5 μM. Lysophosphatidic acid can already be comprised in a basal medium, or can be supplemented to a basal medium. The term “lysophosphatidic acid”, as used herein in relation to a differentiation inducer, includes reference to all its forms such as its free acid (protonated) form, conjugate base (non-protonated) form, and salt form (such as lysophosphatidic acid (sodium) salt. The LPAR3 can be present in a medium for differentiating muscle progenitor cells as disclosed herein in a concentration of 0.01 – 500 μM, preferably 0.5 - 50 μM, more preferably about 5 μM. Lysophosphatidic acid can already be comprised in a basal medium, or can be supplemented to a basal medium. The OXTR agonist can be present in a medium for differentiating muscle progenitor cells as disclosed herein in a concentration of 0.01 – 1000 nM, preferably 5 - 500 nM, more preferably 50 nM. Oxytocin can already be comprised in a basal medium, or can be supplemented to a basal medium. The glucagon receptor agonist can be present in a medium for differentiating muscle progenitor cells as disclosed herein in a concentration of 0.01- 100 μM, preferably 0.1 - 10 μM, preferably about 1 μM. Glucagon can already be comprised in a basal medium, or can be supplemented to a basal medium. The lactate can be present in a medium for differentiating muscle progenitor cells as disclosed herein in a concentration of 0.1 – 1000 mM, preferably 2-200 mM, more preferably about 10-20 mM. Lactate can already be comprised in a basal medium, or can be supplemented to a basal medium. In embodiments, the serum-free medium for differentiating muscle progenitor cells may comprises: - at least one differentiation inducer selected from the group consisting of a lysophosphatidic acid receptor 1 (LPAR1) agonist, a lysophosphatidic acid receptor 3 (LPAR3) agonist, an oxytocin receptor (OXTR) agonist, a glucagon receptor (GCGR) agonist and a lactate; - an epidermal growth factor (EGF); - optionally an albumin or a replacement thereof; - a source of glucose and a source of glutamine; - a source of iron or an iron transporter; - ascorbic acid or a derivative thereof; - sodium selenite; - ethanolamine; - insulin; and/or - sodium bicarbonate. Preferably, the culture medium for differentiating muscle progenitor cells is a serum-free medium for differentiating a muscle progenitor cell as disclosed in PCT/NL2021/050718, the contents of which are expressly incorporated by reference herein. One option for a myogenic differentiation inducer as disclosed in PCT/NL2021/050718 is a Notch signaling pathway inhibitor, preferably a gamma-secretase inhibitor such as a compound selected from the group consisting of DAPT, E2012, L685458, RO4929097 and LY-411575. A Notch signaling pathway inhibitor can be used alternatively to, or in combination with, one or more of the other myogenic differentiation inducers listed herein. As an example, in embodiments, the serum-free medium comprises (i) at least one differentiation inducer selected from the group consisting of a lysophosphatidic acid receptor 1 (LPAR1) agonist, a lysophosphatidic acid receptor 3 (LPAR3) agonist, an oxytocin receptor (OXTR) agonist, a glucagon receptor (GCGR) agonist and a lactate, and (ii) a Notch signaling pathway inhibitor. Food products for animal consumption The invention provides a method for incorporating expanded and differentiated FAP cells in a food product for animal, preferably human, consumption, and a food product for animal, preferably human, consumption comprising a cultured fat cell obtainable by a method of the invention and optionally a cultured muscle cell obtainable by a method as disclosed herein. Preferably, said expanded and differentiated FAP cells are (bovine) fat cells. Preferably, said cells are incorporated into a food product together with expanded and differentiated muscle progenitor cells. Preferably, said expanded and differentiated muscle progenitor cells are (bovine) muscle cells. A food product of the invention can be a meat product or a fat product such as a fat product not including (cultured) muscle cells. Non-limiting examples of a food product of the invention are a hamburger, a sausage, a steak, minced meat, a meatball, corned beef, a charcuterie product, jerky or stewed meat. Meat products also covers the combination of several types of meat products. The cultured fat cells as disclosed herein and optionally the muscle cells as disclosed herein may be processed prior to or following incorporation into a meat product. Non-limiting examples of processing are boiling, grilling, freezing, pressing, salting, curing, fermenting, smoking, drying, canning, cutting, grinding, mixing, seasoning, tubing in casing and marinating. The cultured fat cells and optional cultured muscle cells of the invention may be arranged in a specific manner in the meat product, for example in order to create optical similarity with traditionally produced meat products and/or to improve texture. In embodiments, a food product of the invention contains between 0.01% and 70% cultured fat cells, such as between 1% and 30% fat cells or between 5% and 20% fat cells. Additionally to fat cells and optionally muscle cells, meat products may comprise water, one or more salt, one or more fiber, one or more carbohydrate, one or more protein, one or more starch, one or more spice, one or more herb, one or more yeast extract, one or more casing ingredient, one or more vitamin, one or more oil, one or more hydrocolloid, one or more thickening agent, one or more preservative, one or more colorant, one or more antioxidant, one or more acidity regulator, one or more stabilizer, one or more emulsifier, one or more flavor enhancer and/or one or more sweetener. Preferably, all constituents of the meat product are animal-free. In embodiments, the food product of the invention is optically, structurally, in terms of flavor and/or in terms of composition identical or similar or corresponds to existing traditional meat products wherein animals are slaughtered in order to obtain said meat product. In embodiments, the food product of the invention has a composition that has beneficial characteristics in terms of human health and/or consumer preference when compared to existing traditional meat products wherein animals are slaughtered in order to obtain said meat product. Preferably, the food product of the invention comprises more unsaturated fatty acids compared to bovine(-derived) subcutaneous fat tissue. Unsaturated fatty acids are generally more beneficial to animal health, more preferably human health, compared to saturated fatty acids. In embodiments, the food product of the invention comprises no inflammatory cells. Existing traditional meat products are made from fat tissue and muscle tissue from the animal body, and therefore comprise inflammatory cells. Preferably, the food product of the invention comprises fewer, preferably no, antibiotics and/or antibiotics residues. Antibiotics in food products are a burden to animal health, including human health, when consumed, as they may kill part of the animal gut microbiome. Also, the presence of antibiotics in food may allow for the promotion of antibiotic resistance. Furthermore, antibiotics may lead to tissue damage, for example in the animal gut. Preferably, the food product of the invention comprises no blood residues such as red blood cells. Blood components may lead to lipid oxidation and may decrease the shelf life of the food products. Existing traditional meat products generally contain blood components such as red blood cells. Preferably, the food product of the invention comprises lower levels of microbial contamination compared to traditional meat products. The food product of the invention is preferably produced in controlled environments that aim to prevent contamination with microbials. Also, since significantly less animal tissue is used in the production of the food product of the invention compared to traditional food products, potential microbials present in or on animal tissue are incorporated in a food product in much lower levels compared to traditional meat products. Preferably, the food product of the invention comprises no cartilage. Cartilage may have a negative effect on the consumption experience of the consumer, as it is much tougher than (artificial) muscle tissue or (artificial) fat tissue. Absence of cartilage in a food product is generally associated with a higher quality. In embodiments, the food product of the invention comprises lower levels of fibrous tissue compared to traditional meat or fat products. Fibrous tissue, otherwise referred to as connective tissue, comprises proteins such as collagen and elastin that render meat tough and therefore less beneficial for consumption. Fibrous tissue may be associated with lower quality food products. Lower levels of fibrous tissue are also beneficial in the preparation of food products, as it generally takes less time to cook food products with low levels if fibrous tissue. For the purpose of clarity and a concise description, features are described herein as part of the same or separate embodiments, however, it will be appreciated that the disclosure includes embodiments having combinations of all or some of the features described. The content of the documents referred to herein is incorporated by reference.
EXAMPLES Example 1. Isolation and Purification of FAP cells Material & Methods Bovine muscle biopsy Animal health check was performed by a veterinarian prior to biopsy. Animals were sedated (Xyla-Ject 2%, 0.15 ml/100kg) via the tail vein. Local anesthetic (Procamidor, 20 mg/mL) was applied to the biopsy site via subcutaneous injection. Muscle was exposed by creating an incision in the skin using a scalpel, and approximately one gram of skeletal muscle tissue collected on ice. Wound was closed using skin sutures (PGA 6/0) and covered with aluminum spray. Analgesic (Novem 20, 0.025 mL/kg) was applied subcutaneously. Post-biopsy health checks were performed daily by the farmer for 10 days post-procedure. Isolation of bovine muscle-derived cells Excess visible fat and fibrous tissue was removed prior to dissociation, and muscle fibers were dissociated using collagenase AFC A (Worthington, CLS-1, 2000 U/ml) for 45 minutes at 37 °C. Muscle isolates were incubated in 1x ACK erythrocyte lysis buffer for 1 minute at room temperature. Cells were resuspended in a serum- free proliferation medium and immediately seeded into bovine collagen type I (Sigma, C2124; 2.5μg/cm2) coated tissue culture plates, and pre-cultured at 37 °C for 72 hours. The serum-free proliferation medium that was used is as disclosed in PCT/NL2021/050066, the contents of which are incorporated herein by reference, and is referred to therein as “SFM1” and contains: albumin (5 mg/ml), somatotropin (2 ng/ml), L-Ascorbic acid 2-phosphate (50 μg/ml), hydrocortisone (36 ng/ml), α-linolenic acid (1 μg/ml), insulin (10 μg/ml), transferrin (5.5 μg/ml), sodium selenite (0.0067 μg/ml), ethanolamine (2 μg/ml), L-alanyl-L-glutamine or glutamine (2mM), IL-6 (5 ng/ml), FGF2 also referred to as bFGF (10 ng/ml), IGF1 (100 ng/ml), VEGF (10 ng/ml), HGF (5 ng/ml), PDGF-BB (10 ng/ml) and DMEM / F12 basal medium. FACS purification of FAP cells and SC cells After 72 hours of pre-culture, cells were sorted using a MACSQuant Tyto sorter (Miltenyi) based on absence of expression of JAM1, CD45, and integrin alpha 7 (ITGA7), and the positive expression of integrin alpha 5 (ITGA5) or platelet derived growth factor alpha (PDGFRα; also known as CD140a). Unstained cells were used routinely to define gating parameters. Proliferation and differentiation of FAP and SC cells After FACS sorting, FAP cells and SC cells were cultured on collagen Type I coated tissue culture flasks at 37°C and 5% CO2 in a serum-free proliferation medium (SFM1). Subsequently, myogenic and adipogenic differentiation potential were independently assessed for both FAP cells and SC cells. Myogenic differentiation assay was performed by culturing said cells at 37°C and 5% CO2 on Matrigel-coated vessel at a seeding density of 50k cells per cm2 in SFM1 for 24h and then switching to a serum-free medium for differentiating myogenic progenitor cells, which medium contained: DMEM/F121:1 supplemented with albumin (recombinant human albumin from Richcore) at 0.5 mg/ml, insulin (recombinant human insulin, 10-365 from Peprotech) at 19.4 ug/ml, transferrin (recombinant human transferrin, 10-366 from Peprotech) at 10.7 ug/ml, sodium selenite (S5261 from SigmaAldrich) at 0.014 ug/ml, Ethanolamine from Sigma Aldrich cat nr E9508 at 4 ug/ml, ascorbic acid (L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, A8960 from SigmaAldrich) at 115.22 ug/ml, EGF (recombinant human EGF, AF-100-15 from Peprotech) at 10 ng/ml and one of the following inducers: lactate (Sodium L-lactate, 71718 from SigmaAldrich) at 10 mM, LPA (Oleoyl-L-α-lysophosphatidic acid sodium salt, L7260 from SigmaAldrich) at 5 uM, oxytocin (O6379 from SigmaAldrich) at 50 nM, or glucagon (G2044 from SigmaAldrich) at 1 uM. Adipogenic differentiation assay was performed by seeding said cells in SFM1 at a density of 30k cells per cm2 at 37°C and 5% CO2 on a type I bovine collagen coated vessel. The next day medium was changed to a serum-free medium for differentiating adipogenic progenitor cells, which medium contained: DMEM/F12 medium was supplemented with PSA (17-745E from Lonza) at 1%, HEPES (H3375 from Sigma Aldrich) at 4.9mM, hydrocortisone (H0135 from Sigma Aldrich) at 0.1 µM, insulin (recombinant human insulin, 10-365 from Peprotech) at 1-2 µM, lipid concentrate (chemically defined lipid concentrate, 11548846 from Thermo Fisher) at 0.001% (v/v), putrescine (51799 from Sigma Aldrich) at 56 µM, EGF (recombinant human EGF, AF-100-15 from Peprotech) at 322 pM, FGF2 (recombinant human FGF2, 100-18B from Peprotech) at 115 pM, progesterone (P8783 from Sigma Aldrich) at 17.8nM, ascorbic acid (L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate, A8960-5G from Sigma Aldrich) at 227 µM and indomethacin (I7378 from Sigma Aldrich) at 50 µM. Immunofluorescence analysis Adipogenic and myogenic differentiation was quantified using the ImageXPress Pico High Content Analyser (HCA; molecular devices). Cells in both assays were fixed in 2% FA. To assess myogenic differentiation, cells were permeabilized, blocked and next stained with primary antibody (mouse anti-desmin (Sigma- Aldrich) in blocking solution. Following incubation, cells were stained with Donkey anti-mouse Alexa Fluor 488 secondary antibody (Thermo Fisher) and Hoechst (Sigma-Aldrich). Fusion index was calculated as the percentage of nuclei present in Desmin expressing myotubes divided by the total number of nuclei per well, multiplied by 100. To assess 2D adipogenic differentiation, cells were stained with Hoechst and BODIPY 493/503 (Thermo Fisher). HCA software assigned BODIPY IR to the nearest nuclei, i.e. a positive cell. Percentage of positive cells was determined by dividing the number of BODIPY+ nuclei by the total number of nuclei. Results Cells were allowed to adhere and proliferate for 72 hours post-isolation in serum- free proliferation medium “SFM1” as described above (Fig.1C, left panel). The adherent cells consisted of two major populations, ITGA5+ or PDGFRα+ / ITGA7- cells, which we subsequently refer to as fibro-adipogenic progenitor (FAP) cells, and ITGA5- or PDGFRα- / ITGA7+ cells, known as satellite cells (SCs; Fig. 1B). The majority of muscle-derived cells were negative for the endothelial and hematopoietic markers JAM1 and CD45, respectively (data not shown). Post- sorting, there were distinct morphological differences between the two cell types, with FAPs generally larger and more stretched when compared to SCs, and with increased numbers of cellular protrusions (Fig.1C). To confirm these cells were FAPs, we assessed their differentiation potential. First, we exposed FAPs and SCs to the above-indicated myogenic differentiation assay. After 96 hours, the SCs formed multinucleated myotubes, whereas the FAPs generated none to a few (Fig. 1D, top row). Next, we submitted FAPs and SCs to the adipogenic differentiation assay indicated above. Over the course of 14 days, only the FAPs differentiated into adipocytes and accumulated lipid droplets (Fig.1D, bottom row). Example 2: Bioinformatic characterization of FAP cells Material & Methods Single-cell RNA sequencing For single-cell RNAseq, sequencing libraries were prepared using 25,000 cells derived from 10 bovine muscle biopsies by using the Chromium Next GEM Single Cell 3ʹ GEM, Library & Gel Bead Kit v3.1 (10X Genmoics). The single-cell libraries were sequenced on a NovaSeq 6000 (Illumina) using genotype-based multiplexing and resulting reads were aligned to bovine reference genome bosTau9 (ARS UCD1.2.98) with Cell Ranger version 3.1. After doublet exclusion, this yielded approximately 8000 single-cell transcriptomes with > 5000 genes per cell. The data analysis including quality control filtering, normalisation by SCTransform, dimensionality reduction clustering was performed using the Seurat package version 4.0. Finally, differentially expressed genes were computed for each cluster to identify population-specific makers for cluster-annotation. Bulk RNA sequencing For bulk RNAseq, FAPs and SCs from two donor animals were sorted into TRK Lysis buffer. RNA was isolated using the Omega MicroElute Total RNA Kit (Omega Bio-tek), and sequenced on a NextSeq 500 after library preparation using the TruSeq stranded mRNA kit (Illumina). Resulting reads were aligned to the bosTau9 (ARS UCD1.2.98) reference genome and counted using the Rsubread package. Gene counts were normalized by normalisation factors computed through the trimmed-mean of M-values. Samples were clustered using principal component analysis based on the 500 most variable genes, and differentially expressed genes between FAPs and SCs were computed using empirical Bayes moderation of the standard error with the R-package limma. Results SNN clustering of the dimensionality-reduced transcriptomes of single cells from multiple muscle biopsies indicated six clusters of cells with distinct expression profiles (Fig. 2A). The respective clusters showed increased gene expression specific for satellite cells (SCs), fibro-adipogenic progenitors (FAPs), endothelial cells, smooth muscle mesenchymal cells (SMMC), hematopoietic cells (monocytes), and glial cells. SCs were exclusively marked by expression of ITGA7, whereas FAPs showed increased expression of PDGFRa (Fig.2B). To further investigate the distinct transcriptomic differences between SCs and FAPs, both cell types were sorted by FACS and analysed using bulk RNAseq. Upon dimensionality reduction by PCA, the cell types clustered closely together on both the first and second principal component independent of the donor animal, indicating that the most pronounced transcriptomic features are conserved across animals (Fig. 2C). When comparing the two populations using differential expression analysis, in order to identify uniquely expressed surface markers for each population, 1555 genes were found to be significantly upregulated in SCs, while 753 genes were significantly upregulated in FAPs (FDR < 0.05, log2-FC > 1.5, Fig. 2D). Notable upregulated genes in SCs are NCAM1 and ITGA7, whereas notable upregulated genes in FAPs are PDGFRA, ITGA9, ITGB3, ITGA5, CD14 and CD9. The most differentially expressed surface markers between bovine FAPs and bovine SCs are presented in Table 1 and Table 2, respectively. Tables 1 and 2 are provided hereinbelow. Table 1. The highest differentially expressed surface markers (upregulated) in bovine FAPs as compared to bovine SCs.
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
Figure imgf000070_0001
Figure imgf000071_0001
Figure imgf000072_0001
Figure imgf000073_0001
Table 2. The highest differentially expressed surface markers (upregulated) in bovine SCs as compared to bovine FAPs.
Figure imgf000074_0001
Figure imgf000075_0001
Figure imgf000076_0001
Figure imgf000077_0001
Figure imgf000078_0001
Figure imgf000079_0001
Figure imgf000080_0001
Figure imgf000081_0001
Figure imgf000082_0001
Figure imgf000083_0001
Figure imgf000084_0001
Figure imgf000085_0001
Figure imgf000086_0001
Example 3: Characterization of FAP cell surface expression profiles Material & Methods Flow cytometry Unsorted bovine muscle-derived cells were stained with ITGA7-PE, in conjunction with the indicated APC-conjugated antibodies (PDGFRA-APC, ITGA5-APC, CD14- APC, CD9-APC, CD61-APC, ITGA9-APC, NCAM1-APC, CD45-APC, CD321-APC). Subsequently, cells were washed and analysed on a MACSQuant 10 flow analyzer (Miltenyi). Unstained cells were used as a negative control, and to define gating parameters. Bulk RNA sequencing was performed as described (see Example 2). Results To characterize FAP cell surface epitopes, we used flow cytometry to investigate the expression of surface markers identified by RNAseq in unsorted cells after 72 hours of pre-culture. Cell surface marker analysis demonstrated that the FAPs expressed CD9, CD14, CD49e (ITGA5), CD61 (ITGB3), CD140a (PDGFRA), and ITGA9 (Fig.3A). FAPs lacked expression of hematopoietic marker CD45, endothelial marker CD321 (F11R), and the myogenic progenitor markers CD56 (NCAM1) and ITGA7 (Fig.3C). The identity of the SCs within the unsorted population was confirmed using ITGA7. We corroborated the flow cytometry results by transcriptomic analysis using the RNAseq data of sorted FAPs and SCs, which showed significantly upregulated expression of CD9, CD14, CD49e, CD61, CD140a (PDGFRA), and ITGA9 in FAPs compared to SCs (Fig. 3B) and significantly downregulated expression of ITGA7 and NCAM1 (Fig.3D). Expectedly, expression of CD321 (F11R) was low in both populations. Example 4: Expansion of FAP cells Material & Methods Two dimensional (2D) cell culture FAPs, isolated according to Example 1 and purified according to Example 2 (ITGA7- and ITGA5+ as the cell surface markers), were propagated on collagen Type I coated tissue culture flasks in a serum-free proliferation medium as defined in Example 1 (SFM1). Cells were regularly passaged when approaching confluency, and reseeded at a density of 5000 cells/cm2. Microcarrier cell culture Cytodex 1 microcarriers (GE Healthcare) were hydrated in PBS in a siliconized (Sigmacote, Sigma Aldrich) spinner flask (Corning) at a final concentration of 10 cm2/mL. Spinner flasks were sterilised and prior to inoculation, microcarriers were conditioned with serum-free proliferation medium SFM1 for 1 h at 37 °C and 5% CO2. FAPs were seeded at 1.3-1.8 x103 cells/cm2. Spinner flasks were positioned on a magnetic stirrer platform in the incubator and agitated at 60 rpm. Every two days half-medium exchanges were performed. Cell counts were performed on an automated cell counter (NucleoCounter NC-200, Chemometec). Results On coated 2D surfaces, FAPs proliferated efficiently and were able to reach 33 population doublings (PDs) at an overall rate of approximately one PD per day. Initially, FAPs proliferated with 1.3 PDs per day, whilst over the course of the culture the growth rate steadily decreased to approximately 0.8 PDs per day (Fig. 4A). There were little to no clear and observable morphological changes over the multiple passages (Fig. 4B). Similarly, in a setting more appropriate to large scale cell production, FAPs were able to grow on the surface of microcarriers in suspension cultures, as evidenced by the increasing cell density on the microcarriers and the cell counts (Fig. 5A; Fig.5B). During exponential growth, FAPs had a doubling time of 22.6 +/- 2 hrs (n=4) for all spinners, with no lag-phase observed. Example 5: Adipogenic differentiation of FAPs in 3-dimensional hydrogels Material & Methods Three-dimensional adipogenic microfiber culture FAPs, isolated according to Example 1 and purified according to Example 2 (ITGA7- and ITGA5+ as the cell surface markers), were resuspended in 0.5% high viscosity alginate solution (Sigma, W201502) at a concentration of 3x107 cells/mL. Cell-alginate suspension was injected into 66 mM CaCl2, 10 mM HEPES. Resultant microfibres were washed and transferred to a 12-well tissue culture plate containing an exemplary serum-free adipogenic differentiation medium which contained: DMEM/F12 medium supplemented with PSA (17-745E from Lonza) at 1%, HEPES (H3375 from Sigma Aldrich) at 4.9mM, hydrocortisone (H0135 from Sigma Aldrich) at 0.1 µM, insulin (recombinant human insulin, 10-365 from Peprotech) at 1-2 µM, lipid concentrate (chemically defined lipid concentrate, 11548846 from Thermo Fisher) at 0.001% (v/v), putrescine (51799 from Sigma Aldrich) at 56 µM, EGF (recombinant human EGF, AF-100-15 from Peprotech) at 322 pM, FGF (recombinant human FGF, 100-18B from Peprotech) at 115 pM, progesterone (P8783 from Sigma Aldrich) at 17.8nM, ascorbic acid (L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate, A8960-5G from Sigma Aldrich) at 227 µM and indomethacin (I7378 from Sigma Aldrich) at 50 µM. Fibres were incubated on a shaking platform at 75 RPM at 37°C and 5% CO2, and culture media was replaced every 3-4 days for 28 days. The control medium constituted of the above- mentioned exemplary serum-free adipogenic differentiation medium with the exception that indomethacin was omitted. Immunofluorescence for microfibers Microfibres were fixed using 4% formaldehyde in 66 mM CaCl2, 10 mM HEPES for 1 hr at room temperature. Once fixed, microfibres were blocked/permeabilized in blocking solution (66 mM CaCl2, 10 mM HEPES, 10% goat serum, 0.1% Triton X) at room temperature for 1 hr. Microfibers were incubated overnight at 4 °C in 1:125 BODIPY 493/503 and 1:1000 Hoechst. Where used, primary antibodies for Acetyl-CoA carboxylase (ACC; 1:200; Cell Signalling, #3676) or perilipin-1 (PLIN1; 1:400; Abcam, ab61682) were added to the blocking solution. Subsequent to washing, fibers were incubated with 1:250 or 1:500 donkey anti-rabbit Alexa 594 (Thermo Fisher, A21207) in blocking solution for 2 hours at room temperature. Microfibres were imaged by confocal microscopy (TCS SP8, Leica Microsystems) using a 25×/1.00 objective lens. For all confocal images, stacks were acquired using 5 µm Z steps. Lipid droplet volume was quantified using FIJI software, objects (nuclei or lipid droplets) were counted using the 3D Object Counter. The total quantified lipid volume within one image was divided by the number of nuclei to obtain lipid volume per cell. Real Time-quantitative Polymerase Chain Reaction RNA was isolated from FAP microfibers using the EZNA Total RNA kit II (Omega, R6934) and reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad, 1708891), according to the manufacturer's instruction. RT-qPCR was performed using the iQ SYBR Green Supermix (Bio-Rad) with primer pairs for the following genes: fatty acid binding protein 4 (FABP4; GTAGGTACCTGGAAACTTGTCT; ACTTTCCTGGTAGCAAAGCC), adiponectin (ADIPOQ; GGCTCTGATTCCACACCTGA; TGTTGTCCTCGCCATGACTG), trafficking regulator of GLUT41 (TRARG1;CTCATCCTTGCCATCGCCTC; TGTTGCACGCTACTTCGAGA) and cell death inducing DFFA like effector C (CIDEC; TGCAGAGTAACCACTGCTGA; ACGCCAGCATCAGGGTATC). The 2ΔCt- values of genes of interest were normalized to three averaged housekeeping genes (Ubiquitously Expressed Prefoldin (GAGCAGTCTCCTCACAGAGCTC; AGCAACATGTGGATATGGGCCT), 60S Ribosomal Protein L19 (TCGAATGCCCGAGAAGGTAAC; CTGTGATACATGTGGCGGTC) and 60S acidic ribosomal protein P0 (GGCAGCATCTACAACCCTGA; CAGATGCGACGGTTGGGTAA ). Results We aimed to achieve adipogenic differentiation of FAPs into mature fat tissue in a scalable, edible three-dimensional system. We encapsulated FAPs within an alginate hydrogel, and subjected the resultant microfibers to adipogenic differentiation conditions. Over the course of 28 days, FAPs differentiated, accumulating large multilocular and unilocular lipid droplets (Fig. 6A). Lipid droplet volume per cell increased significantly over 28 days of differentiation, and compared to control (Fig. 6B). Expression of perilipin-1 (PLIN1) and acetyl-CoA carboxylase (ACC), mature adipocyte markers involved in lipid droplet metabolism, adjacent to lipid droplets indicate a high maturity of adipogenic differentiation (Fig.6C). Furthermore, FAPs showed strong upregulation of genes related to adipogenic differentiation, including FABP4, ADIPOQ, TRARG1 and CIDEC, as measured by RT-qPCR (Fig. 6D). Example 6: Adipose Tissue Analysis Material & Methods Mass spectrometry-based lipidomics For lipidomics analysis, 10-30 mg samples of bovine subcutaneous fat tissue, bovine muscle tissue, undifferentiated (day 0) and differentiated (28 days) bovine FAP samples from three different donors were collected. Lipids were extracted using a modified Bligh-Dyer protocol, and were analysed by hydrophilic interaction liquid chromatography mass spectrometry (HILIC LC-MS/MS). Lipid quantities were normalized to the amount of protein present within the respective sample. Results Total lipid content in differentiated samples from three donors increased significantly over the course of 28 days of differentiation (Fig. 7A). Of the different lipid classes, triglycerides (TG) have previously been shown to be most important for both taste and texture. Breakdown of all TG lipid species revealed large differences between TG species in the undifferentiated and differentiated samples (Fig.7B), with differentiated samples more closely mimicking the control samples (Fig.7B). Comparing saturation and chain length within the TGs between all conditions, differentiated FAPs closely mimicked both subcutaneous fat and muscle sample controls (Fig.7C, Fig.7D). Cultured fat showed a higher relative percentage of unsaturated TG (Fig. 7D) compared to subcutaneous fat tissue and muscle tissue. From a macroscopic perspective, the differentiated samples mimicked subcutaneous fat in texture and appearance (Fig. 7E).

Claims

Claims 1. A method for producing cultured fat cells for animal consumption, comprising the steps of: - providing a fibro-adipogenic progenitor (FAP) cell; - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells; and - culturing said expanded population of FAP cells in a culture medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells.
2. The method according to claim 1, wherein the FAP cell is a bovine FAP cell.
3. The method according to claim 1 or claim 2, wherein the method is a method for producing cultured fat cells for human consumption.
4. The method according to any one of the preceding claims, wherein said FAP cell that is provided is obtainable by a method comprising the steps of: - providing a muscle tissue sample, preferably a bovine muscle tissue sample, comprising a progenitor cell; - optionally, removing excess fat and/or fibrous tissue from said sample if present; - optionally, subjecting said sample to enzymatic digestion, preferably using a matrix metalloproteinase such as a collagenase; - optionally, subjecting said optionally digested sample to an erythrocyte lysis buffer; - optionally, (pre)culturing said optionally digested and optionally erythrocyte-lysed sample in a culture medium for expanding FAP cells; - purifying a progenitor cell that is a FAP cell from said sample so as to provide a FAP cell.
5. The method according to claim 4, wherein said step of purifying a progenitor cell that is a FAP cell from said sample is performed by antigen-based cell sorting, preferably fluorescence activated cell sorting (FACS).
6. The method according to claim 5, wherein the antigen-based cell sorting is performed on the basis of (i) the presence of at least one cell surface marker selected from Table 1, optionally in combination with the absence of at least one cell surface marker selected from Table 2.
7. The method according to claim 5 or claim 6, wherein the antigen-based cell sorting is performed on the basis of (i) the presence of at least one cell surface marker selected from the group consisting of CD140a (PDGFRa), CD14, CD49e (ITGA5), CD61 (ITGB3), CD9 and ITGA9 and/or (ii) the absence of at least one cell surface marker selected from the group consisting of ITGA7, CD45, CD321 (F11R) and CD56 (NCAM1).
8. The method according to any one of claims 5-7, wherein the antigen- based cell sorting is performed on the basis of (i) the presence of at least one cell surface marker selected from the group consisting of CD140a (PDGFRa), CD14, CD49e (ITGA5), CD61 (ITGB3) and ITGA9 and/or (ii) the absence of cell surface markers ITGA7 and CD56 (NCAM1).
9. The method according to any one of the preceding claims, further comprising the step of: - purifying differentiated fat cells.
10. The method according to any one of the preceding claims, further comprising the step of: - incorporating said optionally purified cultured fat cells in a food product, preferably a cultured fat product or cultured meat product, for animal consumption.
11. The method according to any one of the preceding claims, wherein said culture medium for expanding FAP cells and/or said culture medium for differentiating FAP cells is a serum-free medium, preferably a serum-free medium entirely free of animal components.
12. The method according to any one of the preceding claims, wherein said culture medium for expanding FAP cells is a serum-free medium, and wherein said serum-free medium comprises: - an albumin; and - a fibroblast growth factor (FGF).
13. The method according to any one of the preceding claims, wherein said culture medium for differentiating FAP cells is a serum-free medium, and wherein said serum-free medium comprises: - at least one peroxisome proliferator-activated receptor gamma (PPARy) agonist; - at least one hormone selected from the group consisting of insulin and hydrocortisone; - at least one cytokine and/or growth factor selected from the group consisting of bone morphogenetic protein 4 (BMP4) and epidermal growth factor (EGF); and - ascorbic acid or a derivative thereof.
14. The method according to any one of the preceding claims, wherein said method is a method for producing cultured fat cells and cultured muscle cells for animal consumption, and wherein said method further comprises the steps of: - providing a muscle progenitor cell, preferably a satellite cell; - culturing said muscle progenitor cell in a culture medium for expanding muscle progenitor cells to thereby provide an expanded population of muscle progenitor cells; - culturing said expanded population of muscle progenitor cells in a culture medium for differentiating muscle progenitor cells to thereby differentiate muscle progenitor cells into muscle cells; - optionally, purifying differentiated muscle cells; - optionally, incorporating said differentiated muscle cells together with said differentiated fat cells in a food product, preferably a cultured meat product, for animal consumption.
15. The method according to claim 14, wherein said method is a method for producing cultured fat cells and cultured muscle cells for human consumption.
16. The method according to claim 14 or claim 15, wherein said muscle progenitor cell is a bovine muscle progenitor cell, preferably a bovine satellite cell (SC).
17. The method according to any one of claims 14-16, wherein said FAP cell and said muscle progenitor cell are obtainable by a method comprising the steps of: - providing a muscle tissue sample, preferably a bovine muscle tissue sample, comprising a FAP cell and a muscle progenitor cell; - optionally, removing excess fat and/or fibrous tissue from said sample if present; - optionally, subjecting said sample to enzymatic digestion, preferably using a matrix metalloproteinase such as a collagenase; - optionally, subjecting said optionally digested sample to an erythrocyte lysis buffer; - optionally, (pre)culturing said optionally digested and optionally erythrocyte-lysed sample in a culture medium for expanding FAP cells and muscle progenitor cells; - purifying a progenitor cell that is a FAP cell and a muscle progenitor cell from said sample so as to provide a FAP cell and a myogenic progenitor cell.
18. The method according to claim 17, wherein said step of purifying a progenitor cell that is a FAP cell and said step of purifying a progenitor cell that is a muscle progenitor cell are performed by antigen-based cell sorting, preferably fluorescence activated cell sorting (FACS).
19. The method according to claim 18, wherein the antigen-based cell sorting in order to purify said FAP cell is performed as defined in any one of claims 6-8; and wherein the antigen-based cell sorting in order to purify said muscle progenitor cell is performed on the basis of (i) the presence of a cell surface marker selected from Table 2, optionally in combination with the absence of a cell surface member selected from Table 1.
20. The method according to claim 18 or claim 19, wherein the antigen- based cell sorting in order to purify said muscle progenitor cell is performed on the basis of the presence of a cell surface marker selected from the group consisting of ITGA7 and CD56 (NCAM1) and/or (ii) the absence of a cell surface marker selected from the group consisting of CD140a (PDGFRa), CD14, CD49e (ITGA5), CD61 (ITGB3) and ITGA9.
21. The method according to any one of claims 14-20, wherein said FAP cell and said muscle progenitor cell are purified from the same muscle tissue sample and/or are separated from each other during the same antigen-based cell sorting procedure followed by separate expansion and differentiation into fat cells and muscle cells, respectively.
22. The method according to any one of claims 14-21, wherein said culture medium for expanding muscle progenitor cells is a serum-free medium, and wherein said serum-free medium comprises: - an albumin; and - a fibroblast growth factor (FGF).
23. The method according to any one of claims 14-22, wherein said medium for differentiating muscle progenitor cells is a serum-free medium, and wherein said serum-free medium comprises: - at least one differentiation inducer selected from the group consisting of a lysophosphatidic acid receptor 1 (LPAR1) agonist, a lysophosphatidic acid receptor 3 (LPAR3) agonist, an oxytocin receptor (OXTR) agonist, a glucagon receptor (GCGR) agonist, a lactate, and a Notch signaling pathway inhibitor.
24. The method according to any one of the preceding claims, wherein the step of - culturing said FAP cell in a culture medium for expanding FAP cells to thereby provide an expanded population of FAP cells, and/or the step of – culturing said muscle progenitor cell in a medium for expanding muscle progenitor cells to thereby provide an expanded population of muscle progenitor cells, is performed by two-dimensional or three-dimensional cell culturing, preferably by microcarrier- based cell culturing.
25. The method according to any one of the preceding claims, wherein the step of: - culturing said expanded population of FAP cells in a medium for differentiating FAP cells to thereby differentiate FAP cells into fat cells, and/or the step of: - culturing said expanded population of muscle cell progenitor cells in a medium for differentiating muscle progenitor cells to thereby differentiate muscle progenitor cells into muscle cells, is performed by two-dimensional or three- dimensional cell culturing, preferably in a hydrogel, preferably a hydrogel comprising alginate.
26. A food product for animal consumption, comprising: - a cultured fat cell obtainable by a method according to any one of claims 1-25; and - optionally, a cultured muscle cell obtainable by a method according to any one of claims 14-25.
27. The food product according to claim 26, wherein said food product is a cell culture-based food product.
28. The food product according to claim 26 or claim 27, wherein said food product is a cultured fat product or cultured meat product.
29. The food product according to any one of claims 26-28, wherein said food product: - comprises cultured fat with a different triglyceride composition compared to the triglyceride composition of a (preferably bovine) subcutaneous fat tissue, wherein the relative contribution of unsaturated triglycerides to the total amount of triglycerides is higher in cultured fat as compared to the relative contribution of unsaturated triglycerides to the total amount of triglycerides in said (preferably bovine) subcutaneous fat tissue; - does not comprise antibiotics and/or antibiotic residues; - does not comprise red blood cells; - comprises lower levels of microbial contamination as compared to meat products obtained by animal slaughter; and/or - does not comprise cartilage tissue.
30. Use of a fibro-adipogenic progenitor (FAP) cell in the production of cultured fat for animal, preferably human, consumption.
PCT/NL2022/050432 2021-07-22 2022-07-22 Method for producing cultured fat for animal consumption. WO2023003471A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
NL2028814 2021-07-22
NL2028814A NL2028814B1 (en) 2021-07-22 2021-07-22 Method for producing cultured fat for animal consumption.

Publications (1)

Publication Number Publication Date
WO2023003471A1 true WO2023003471A1 (en) 2023-01-26

Family

ID=77999325

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2022/050432 WO2023003471A1 (en) 2021-07-22 2022-07-22 Method for producing cultured fat for animal consumption.

Country Status (2)

Country Link
NL (1) NL2028814B1 (en)
WO (1) WO2023003471A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116590225A (en) * 2023-05-12 2023-08-15 浙江大学 Application of phosphatidylcholine in preparation of polyester preparation for promoting pig FAPs cell differentiation

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DOHMEN RICHARD G. J. ET AL: "Muscle-derived fibro-adipogenic progenitor cells for production of cultured bovine adipose tissue", vol. 6, no. 1, 24 January 2022 (2022-01-24), XP055905325, Retrieved from the Internet <URL:https://www.nature.com/articles/s41538-021-00122-2.pdf> DOI: 10.1038/s41538-021-00122-2 *
JUDSON ROBERT N. ET AL: "Isolation, Culture, and Differentiation of Fibro/Adipogenic Progenitors (FAPs) from Skeletal Muscle", 26 August 2017 (2017-08-26), XP055905520, Retrieved from the Internet <URL:https://link.springer.com/protocol/10.1007/978-1-4939-7283-8_7> *
MELZENER ET AL., J SCI FOOD AGRIC, vol. 101, 2020, pages 7 - 14
MELZENER LEA ET AL: "Cultured beef: from small biopsy to substantial quantity", vol. 101, no. 1, 27 July 2020 (2020-07-27), GB, pages 7 - 14, XP055905514, ISSN: 0022-5142, Retrieved from the Internet <URL:https://onlinelibrary.wiley.com/doi/full-xml/10.1002/jsfa.10663> DOI: 10.1002/jsfa.10663 *
N ARRIGHI ET AL: "Characterization of adipocytes derived from fibro/adipogenic progenitors resident in human skeletal muscle", CELL DEATH & DISEASE, vol. 6, no. 4, 1 April 2015 (2015-04-01), pages e1733 - e1733, XP055497799, DOI: 10.1038/cddis.2015.79 *
REISS JACOB ET AL: "Cell Sources for Cultivated Meat: Applications and Considerations throughout the Production Workflow", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 22, no. 14, 13 July 2021 (2021-07-13), pages 7513, XP055905513, DOI: 10.3390/ijms22147513 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116590225A (en) * 2023-05-12 2023-08-15 浙江大学 Application of phosphatidylcholine in preparation of polyester preparation for promoting pig FAPs cell differentiation
CN116590225B (en) * 2023-05-12 2023-10-20 浙江大学 Application of phosphatidylcholine in preparation of preparation for promoting pig FAPs cell differentiation polyester

Also Published As

Publication number Publication date
NL2028814B1 (en) 2023-01-27

Similar Documents

Publication Publication Date Title
US20240076630A1 (en) Methods for generating neural tissue and uses thereof
EP4159277A1 (en) Method for producing organoid from lung epithelial cells or lung cancer cells
WO2011069121A1 (en) Mesenchymal stem cells (mscs) isolated from mobilized peripheral blood
US20150307846A1 (en) Growth factor cocktail to enhance osteogenic differentiation of mesenchymal cells
NL2028814B1 (en) Method for producing cultured fat for animal consumption.
Al Hosni et al. Mapping human serum–induced gene networks as a basis for the creation of biomimetic periosteum for bone repair
CN115109740A (en) Hepatocyte regulating preparation and preparation method and application thereof
Ogorevc et al. Development of an in vitro goat mammary gland model: Establishment, characterization, and applications of primary goat mammary cell cultures
CN105797154B (en) Isolation of cells of the soft shaft and uses thereof
JP2007267672A (en) Differentiation inducting method in stem cell of mammal
AU2017296175B2 (en) Cell compositions for tissue regeneration
US20240124845A1 (en) Skeletal stem cell isolation and uses thereof
AU2018310000A1 (en) Composition for cryopreservation, method for producing cryopreserved material, cell preparation, method for producing cell preparation, and kit for cryopreservation
KR20190141137A (en) How to Obtain Differentiated Cells from Muscle Derived Precursor Cells
JP2023551820A (en) Serum-free medium for progenitor cell differentiation
CN107603949B (en) Stem cell culture medium and application thereof
NL2028813B1 (en) Serum-free media for producing adipocytes for animal consumption.
Tassey et al. A single-cell culture system for dissecting microenvironmental signaling in development and disease of cartilage tissue
NL2032514B1 (en) Method of generating a homocellular progenitor cell culture from a heterocellular tissue sample
JPWO2018164133A1 (en) Cell sorting method
US20180325960A1 (en) Enhanced postnatal adherent cell, and use for same
WO2018156903A1 (en) Methods for identifying and isolating cardiac stem cells and methods for making and using them
WO2013130196A1 (en) Neurogenesis screening method and system using adipose tissue derived stem cells
Albiero Novel intracellular signalling regulators of cartilage progenitor cell populations
Mamachan et al. Mesenchymal stem cells for cartilage regeneration: Insights into molecular mechanism and therapeutic strategies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22747145

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE