WO2023001736A1 - Anticorps igg3 anti-sars-cov-2 modifiés - Google Patents

Anticorps igg3 anti-sars-cov-2 modifiés Download PDF

Info

Publication number
WO2023001736A1
WO2023001736A1 PCT/EP2022/070005 EP2022070005W WO2023001736A1 WO 2023001736 A1 WO2023001736 A1 WO 2023001736A1 EP 2022070005 W EP2022070005 W EP 2022070005W WO 2023001736 A1 WO2023001736 A1 WO 2023001736A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
cov
sars
sars cov
glycans
Prior art date
Application number
PCT/EP2022/070005
Other languages
English (en)
Inventor
Herta Steinkellner
Somanath Kallolimath
Original Assignee
Universität Für Bodenkultur Wien
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universität Für Bodenkultur Wien filed Critical Universität Für Bodenkultur Wien
Publication of WO2023001736A1 publication Critical patent/WO2023001736A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1002—Coronaviridae
    • C07K16/1003—Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2 or Covid-19]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1002—Coronaviridae
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
    • C07K2317/13—Immunoglobulins specific features characterized by their source of isolation or production isolated from plants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
    • C07K2317/41—Glycosylation, sialylation, or fucosylation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52—Constant or Fc region; Isotype
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • the present invention refers to a recombinant anti-SARS CoV-2 antibody with enhanced viral neutralization potency comprising an lgG3 constant and hinge region with one or more engineered glycans.
  • the invention refers also to a nucleic acid encoding the anti-SARS CoV-2 antibody, plant cells expressing the anti-SARS CoV-2 antibodies, a method for production of anti-SARS CoV-2 antibody, and a pharmaceutical composition comprising anti-SARS CoV-2 antibody.
  • the invention also refers to the use of an anti-SARS CoV-2 antibody for detecting SARS CoV-2 in a sample, the use for the manufacture of a medicament, and the use for treating or preventing diseases associated with coronavirus infections.
  • SARS- CoV-2 severe acute respiratory syndrome coronavirus 2
  • COVID-19 pandemic Symptoms of COVID-19 include fever, dry cough, and fatigue.
  • SARS-CoV-2 can lead to respiratory failure resulting in death.
  • human-origin monoclonal antibodies capable of neutralizing SARS-CoV-2 have been isolated from convalescent patients by Wu Y., et al., 2020. Thereby, the antibodies H4 and B38 have been shown to be able to block the binding between the spike glycoprotein receptor binding domain (RBD) of the virus and the cellular receptor angiotensin-converting enzyme 2 (ACE2).
  • the spike (S) glycoprotein homotrimer on the surface of the COVID-19 virus plays an essential role in receptor binding and virus entry.
  • the S protein is a class I fusion protein, wherein each S protomer consists of S1 and S2 domains with the receptor binding domain (RBD) located within the S1 domain.
  • the developed mAbs are mainly directed against spike protein (SP) on the surface of coronaviruses and are predominantly of the lgG1 subtype. While the role of lgG1 is intensively investigated, data on the functional impact of the other IgG subclasses are rare.
  • SP spike protein
  • the different IgG subclasses i.e. lgG1, lgG2, lgG3, and lgG4, are homologous in the constant domains of the heavy chains.
  • lgG3 differs from the other IgG subclasses in the structure and amino acid composition of in the hinge region between CH1 and CH2.
  • the hinge region is extended, consists of up to 62 amino acids, and forms a polyproline double helix consisting of 11 disulfide bridges.
  • the role of the hinge region was discussed by Chu T.H., et al., (2020) and has been shown to have a significant impact on the functional activities of antibodies.
  • lgG3 shows greater molecular flexibility, extensive polymorphisms, and additional glycosylation which are not present in other IgG subclasses.
  • lgG3-associated limitations the extensive hinge region undergoes proteolysis in vitro, multiple allotypes exist including allo-immunity to foreign allotype polymorphisms, there is excessive proinflammatory activation, and specific lgG3 allotypes have a reduced half-life (Damelang T., etal., 2019).
  • human lgG3 activates complement and FcyR more effectively and has the strongest effector functions but has also a short half-life which can be attributed to a single amino acid at the CH3 domain (Stapleton N.M., et al., 2011 ).
  • EP 3872091 A1 discloses antibodies and antigen-binding fragments capable of binding the SARS-CoV-2 antigen and of neutralizing a SARS-CoV-2 infection.
  • CN112094340A discloses the use of plants as host for the expression of the CoV- 19 specific antibodies B38 and H4.
  • Kallolimath S., et al. (2021) describe the expression of SARS-CoV-2 spike protein binding mAb (H4) in the four IgG subclasses present in human serum (lgG1-4) using glyco-engineered Nicotiana benthamiana plants. Thereby, H4-lgG3 exhibited an up to 50-fold superior neutralization potency compared with the other subclasses.
  • bamlanivimab as monotherapy
  • bamlanivimab together with etesevimab or casirivimab with imdevimab as a combination therapy.
  • the present invention provides a recombinant anti-SARS CoV-2 antibody comprising an lgG3 constant and hinge region i. at least 80% homogenous N-glycans comprising a fucose-deficient GlcNAc2Man3GlcNAc2 core structure, optionally further comprising terminal galactose or sialic acid(s), ii. O-glycans comprising a HexNAc core structure, optionally further comprising b1, 3-galactose and/or terminal sialic acid(s), and a variable domain binding to a SARS CoV-2 antigen.
  • the recombinant anti-SARS CoV-2 antibody of the invention comprises O-glycans which are located in the hinge region.
  • the recombinant anti-SARS CoV-2 antibody of the invention at least 85%, more specifically 90% or more of the homogenous N-glycans are fucose deficient.
  • O- and/or N-glycans are in the CH2 domain and/or the hinge region and are oligo-sialylated or poly-sialylated glycans.
  • the recombinant anti-SARS CoV-2 antibody of the invention is of lgG3 K or lgG3 l isotype.
  • the recombinant anti-SARS CoV-2 antibody of the invention specifically binds to the glycoprotein receptor binding domain (RBD) of SARS-CoV-2.
  • the recombinant anti-SARS CoV-2 antibody of the invention comprises SEQ ID NO: 10 or 12, or a functional variant thereof with at least 90% sequence identity.
  • the recombinant anti-SARS CoV-2 antibody of the invention is of G3m allotype, selected from the group consisting of G3m5, G3m6, G3m15, G3m16, G3m21, and G3m24.
  • nucleic acid encoding the antibody of the invention, wherein said nucleic acid is encoding the antibody of SEQ ID NO: 10 or 12, or a functional variant thereof with at least 90% sequence identity.
  • composition comprising the recombinant anti-SARS CoV-2 antibody of the invention, optionally together with a pharmaceutically acceptable carrier.
  • the recombinant anti-SARS CoV-2 antibody of the invention, or the pharmaceutical preparation of the invention are provided for use in prophylactic or therapeutic treatment of a disease condition which is caused by or associated with an infection by a coronavirus.
  • the coronavirus is a b-coronavirus, preferably selected from the group consisting of SARS-CoV-2, MERS-CoV, SARS-CoV-1, HCoV-OC43, and HCoV- HKU1 , or mutants thereof.
  • a plant cell expressing the recombinant anti-SARS CoV- 2 antibody of the invention, wherein said plant cell is genetically modified to reduce expression of core a1,3-fucosyltransferase (FucT), to reduce expression of b1 ,2- xylosyltransferase (XylT), to reduce expression of prolyl-4-hydroxylase subfamily, to increase expression of GalNac-transferase 2 (GalNAcT2), to increase expression of b1,3-galactosyltransferase (C1GalT1), and optionally to generate or increase sialylated glycans, specifically the plant cell is a Nicotians benthamiana cell, specifically a glyco- engineered AXTFT N. benthamiana cell.
  • Nicotians benthamiana cell specifically a glyco- engineered AXTFT N. benthamiana cell.
  • transfecting plant cells with one or more expression cassettes comprising a nucleic acid encoding the anti-SARS CoV-2 antibody described herein, specifically in the absence or presence of enzyme sequences of the N-and/or O-glycosylation pathway; more specifically in the absence of core cd,3- fucosyltransferase (FucT) and b1,2-xylosyltransferase (XylT); more specifically in the presence of one or more enzyme sequences for the human O-glycosylation pathway selected from GalNAc-transferase 2 (GalNAcT2) and b1,3-galactosyltransferase (C1GalT1);
  • GalNAcT2 GalNAc-transferase 2
  • C1GalT1 b1,3-galactosyltransferase
  • the plant cell is a N. benthamiana cell and the nucleic acid of the invention is codon optimized for N. benthamiana.
  • Figure 1 Biochemical characterization and antigen-binding activities of recombinant H4-lgG1-4.
  • Figure 1A Purified H4-lgG1-4 separated by reducing and non reducing SDS-PAGE (Coomassie Brilliant Blue stained), 4 pg protein were loaded at each lane;
  • Figure 1B ELISA-binding activities (EC50 values) of purified H4-lgG1-4 to SP using antibodies against K-LC for detection.
  • Figure 2 Western blot demonstrating the presence of O-glycan oligo/poly sialylation and N-glycan oligo/polysialylation on H4lgG3
  • Figure 3 O-glycosylation status of B38-, H4-lgG3 (SEQ ID NO: 25, SCDTPPPCPR-hinge peptide, MS profiles): A and D: genes for O-glycosylation pathway; B, E: O-glycosylation pathway including genes for b1 ,3 galactosyltransferase; C, F: O-glycosylation pathway including genes for b1 ,3 galactosyltransferase and sialylation pathway.
  • Figure 4 Nucleotide and amino acid sequences.
  • Figure 5 Schematic presentation of lgG3 carrying engineered N-glycan structures.
  • amino acids refer to twenty naturally occurring amino acids encoded by sixty-one triplet codons. These 20 amino acids can be split into those that have neutral charges, positive charges, and 5 negative charges:
  • the “neutral” amino acids are shown below along with their respective three-letter and single-letter code and polarity: Alanine(Ala, A; nonpolar, neutral), Asparagine (Asn, N; polar, neutral), Cysteine (Cys, C; nonpolar, neutral), Glutamine (Gin, Q; polar, neutral), Glycine (Gly, G; nonpolar, neutral), Isoleucine (lie, I; nonpolar, neutral), Leucine (Leu, L; nonpolar, neutral), Methionine (Met, M; nonpolar, neutral), Phenylalanine (Phe, F; nonpolar, neutral), Proline (Pro, P; nonpolar, neutral), Serine (Ser, S; polar, neutral), Threonine (Thr, T; polar, neutral), Tryptophan (Trp, W; nonpolar, neutral), Tyrosine (Tyr, Y; polar, neutral), Valine (Val, V; nonpolar, neutral), and Histidine (His, H; polar
  • the “positively” charged amino acids are: Arginine (Arg, R; polar, positive), and Lysine (Lys, K; polar, positive).
  • the “negatively” charged amino acids are: Aspartic acid (Asp, D; polar, negative), and Glutamic acid (Glu, E; polar, negative).
  • N-terminus denotes the last amino acid of the N-terminus.
  • C-terminus denotes the last amino acid of the C-terminus.
  • the anti-SARS CoV-2 antibody according to the invention comprises an lgG3 constant and hinge region with one or more engineered glycans and exhibits enhanced viral neutralization potency compared to anti-SARS CoV-2 antibodies comprising an lgG1, lgG2 or lgG4 constant and hinge region.
  • the anti-SARS CoV-2 antibody of the invention has highly increased viral neutralization potency.
  • viral neutralization potency refers to the ability of antibodies to bind specifically to the surface of an antigen, e.g., on a virus, and prevent the virus from interacting with the host cell.
  • the antibody of the invention can target any SARS CoV-2 antigen appropriate for virus neutralization such as virus surface antigens or coronavirus proteins or peptides released before or during cellular infection.
  • the antibody of the present invention binds to the RBD of the spike protein and prevents the virus from interacting with ACE 2 of the host cell.
  • the anti-SARS CoV- 2 antibody provided herein has at least 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, or 50-fold enhanced virus neutralization potency compared to an anti-SARS CoV-2 antibody comprising an lgG1, lgG2, or lgG4 constant and hinge region.
  • Viral neutralization (NT) potency can be measured by a cellular-based SARS- CoV-2 neutralization test using Vero-E6 cells (ATCC, CRL-1586).
  • IC50 inhibitory concentration; 50% reduction of neutralization
  • IC90 90% reduction of neutralization
  • the term facedcoronavirus“ or seekingCoV“ refers to any virus of the coronavirus family.
  • the coronavirus is a b-coronavirus, preferably selected from the group consisting of SARS-CoV-2, MERS-CoV, SARS-CoV-1, HCoV-OC43, and HC0V-HKUI, coronavirus lineages such as Pango lineages A.1 - A.30, B.1, such as B.1.1.529, including BA.1, BA.2, BA.3, BA.4, BA.5 (WHO label: Omicron), C.1 - C.40, etc., or mutants thereof (cov-lineages.org, https://cov-lineages.org/lineage_list.html).
  • SARS- CoV-2 refers to the newly-emerged coronavirus which was identified as the cause of the serious outbreak starting in Wuhan, China, and which was spreading rapidly and evolved into a global pandemic.
  • the virus binds to the human host cell via the viral spike protein to receptor angiotensin-converting enzyme 2 (ACE2).
  • ACE2 receptor angiotensin-converting enzyme 2
  • the spike protein of the virus is also referred to as “S”, “SP”, or “S protein”.
  • SARS-CoV-2 spike protein has two essential functions, host receptor binding and membrane fusion, which are attributed to the N-terminal (S1) and C-terminal (S2) subunits of the S protein.
  • S1 and S2 subunits of the S protein.
  • the spike protein binds to its cognate receptor via a receptor binding domain (RBD) present in the S1 subunit (Ou X., et al., 2020).
  • RBD receptor binding domain
  • the virion of coronavirus is spherical and has a diameter of approximately 125 nm.
  • the spike proteins are the defining feature of the virion and give them the appearance of a solar corona.
  • Within the envelope of the coronavirus is the nucleocapsid.
  • the initial attachment of the virion to the host cell is initiated by interactions between the spike protein and its receptor.
  • the sites of receptor binding domains (RBD) within the S1 region of a coronavirus spike protein vary depending on the virus, with some having the RBD at the C-terminus of S1.
  • the spike-protein/receptor interaction is the primary determinant for a coronavirus to infect a host species and also governs the tissue tropism of the virus.
  • coronaviruses utilize peptidases as their cellular receptor. Following receptor binding, the virus must next gain access to the host cell cytosol. This is generally accomplished by acid-dependent proteolytic cleavage of spike protein by a cathepsin, TMPRRS2 or another protease, followed by fusion of the viral and cellular membranes.
  • the disease condition associated with an infection by a coronavirus refers to coronavirus respiratory tract infections, often in the lower respiratory tract.
  • a viral infection refers to the invasion and multiplication of a virus in a host, i.e., the body of a subject. Symptoms can include high fever, dry cough, shortness of breath, pneumonia, gastro-intestinal symptoms such as diarrhea, organ failure (kidney failure and renal dysfunction), septic shock, and death in severe cases.
  • antibody refers to polypeptides or proteins that consist of or comprise antibody domains, which are understood as constant and/or variable domains of the heavy and/or light chains of immunoglobulins, with or without a linker sequence.
  • antibody refers to immunoglobulin molecules comprising four polypeptide chains, two heavy chains (HCs) and two light chains (LCs) inter-connected by disulfide bonds.
  • Each heavy chain comprises a heavy chain variable region (“HCVR” or “VH”) and a heavy chain constant region (comprised of domains CH1 , CH2 and CH3).
  • Each light chain is comprised of a light chain variable region (“LCVR or “VL”) and a light chain constant region (CL).
  • VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity-determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDR complementarity-determining regions
  • FR framework regions
  • the term refers to various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies such as bispecific antibodies, trispecific antibodies, and antibody fragments as long as they exhibit the desired anti- SARS CoV-2 function.
  • Antibody domains may be of native structure or modified by mutagenesis or derivatization, e.g., to modify the antigen binding properties or any other property, such as stability or functional properties, such as binding to the Fc receptors, such as FcRn and/or Fc-gamma receptor.
  • Polypeptide sequences are considered to be antibody domains, if comprising a beta-barrel structure consisting of at least two beta-strands of an antibody domain structure connected by a loop sequence.
  • antibody includes antigen binding derivatives and fragments thereof.
  • a derivative is any combination of one or more antibody domains or antibodies of the invention and / or a fusion protein in which any domain of the antibody of the invention may be fused at any position of one or more other proteins, such as other antibodies or antibody formats, e.g., a binding structure comprising CDR loops, a receptor polypeptide, but also ligands, scaffold proteins, enzymes, labels, toxins and the like.
  • antibody fragment refers to a molecule other than an intact antibody that comprises an lgG3 constant and hinge region sequence and a portion of an intact antibody that binds the antigen to which the intact antibody binds.
  • antibody fragments include but are not limited to bispecific antibodies, scFv-Fc, (scFv)2-Fc, Fab- scFv-Fc, and Fab-(scFv)2-Fc diabodies, linear antibodies; and multispecific antibodies formed from antibody fragments.
  • antibody fragments comprise single chain polypeptides having the characteristics of a VH domain, namely being able to assemble together with a VL domain, or of a VL domain, namely being able to assemble together with a VH domain to a functional antigen binding site and thereby providing the antigen binding property of full-length antibodies.
  • chimeric antibody refers to an antibody in which a portion of the heavy and/or light chain is derived from a particular source or species, while the remainder of the heavy and/or light chain is derived from a different source or species, usually prepared by recombinant DNA techniques.
  • Chimeric antibodies may comprise a rabbit or murine variable region and a human constant region.
  • Chimeric antibodies are the product of expressed immunoglobulin genes comprising DNA segments encoding immunoglobulin variable regions and DNA segments encoding immunoglobulin constant regions. Methods for producing chimeric antibodies involve conventional recombinant DNA and gene transfection techniques are well known in the art (Morrison, S.L., et al.,1984).
  • the present invention comprises also anti-SARS CoV-2 hybrid antigen-binding proteins having the variable domain from a first antibody and the constant domain from a second antibody.
  • a variable domain can be taken from an antibody isolated from a human and expressed with a constant region not derived from that same antibody.
  • the antibody of the present invention comprises an lgG3 constant domain including the hinge region as described herein and a variable domain from antibodies H4 or B38.
  • immunoglobulin refers to a protein having the structure of a naturally occurring antibody.
  • immunoglobulins of the IgG class are heterotetrameric glycoproteins of about 150,000 daltons, composed of two light chains and two heavy chains that are disulfide-bonded. From N- to C-terminus, each heavy chain has a variable region (VH), also called a variable heavy domain or a heavy chain variable domain, followed by three constant domains (CH1 , CH2, and CH3), also called a heavy chain constant region.
  • VH variable region
  • CH2 constant domain
  • each light chain has a variable region (VL), also called a variable light domain or a light chain variable domain, followed by a constant light (CL) domain, also called a light chain constant region.
  • VL variable region
  • CL constant light
  • An immunoglobulin of the IgG class essentially consists of two Fab molecules and an Fc domain, linked via the immunoglobulin hinge region.
  • the heavy chain of an immunoglobulin may be assigned to one of five types, called a (IgA), d (IgD), e (IgE), y (IgG), or m (IgM), some of which may be further divided into subtypes, e.g.
  • the light chain of an immunoglobulin may be assigned to one of two types, called kappa (K) and lambda (l).
  • the feltFab“ is the antigen binding fragment and refers to the antibody domain that binds to antigens and is involved in neutralization.
  • the Fab region is formed by the VH and CH1 and the light chains.
  • Fc or "Fc region” (or fragment crystallizable region) as used herein refers to the polypeptide comprising the constant region of an antibody excluding the first constant region immunoglobulin domain.
  • the Fc region refers to the C- terminal region of an antibody.
  • the Fc region is composed of two identical protein fragments, derived from the second and third constant domains of the antibody's two heavy chains: Chain A and Chain B.
  • the second and third constant domains are known as the CH2 domain and the CH3 domain, respectively.
  • the CH2 domain comprises a CH2 domain sequence of Chain A and a CH2 domain sequence of Chain B.
  • the CH3 domain comprises a CH3 domain sequence of Chain A and a CH3 domain sequence of Chain B.
  • a “functional Fc region” possesses the "effector functions" of a native Fc region.
  • exemplary “effector functions” included q binding; complement dependent cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); etc.
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • Such effector functions generally require the Fc region to be combined with a binding domain (e.g., an antibody variable domain) and can be assessed using various assays known in the art and as herein disclosed.
  • a “native Fc region” comprises an amino acid sequence identical to the amino acid sequence of an Fc region found in nature.
  • Native sequence human Fc regions as described herein include native sequence human lgG3 Fc region; as well as naturally occurring variants thereof.
  • a “variant Fc region” comprises an amino acid sequence which differs from that of a native Fc region sequence by virtue of one or more amino acid substitutions or modifications of the glycosylation pattern.
  • the variant Fc region sequence has at least one amino acid substitution compared to a native Fc region sequence or to the Fc region sequence of a parent polypeptide, e.g., from about one or more amino acid substitutions in a native Fc region sequence or in the Fc region sequence of the parent polypeptide.
  • the variant Fc region sequence described herein possesses at least about 80% identity with a native Fc region sequence and/or with an Fc region sequence of a parent polypeptide, and most preferably at least about 90% identity therewith, more preferably at least about 95% identity therewith.
  • Variant Fc region also refers to the presence of engineered glycans or glycopeptides. Modifications of the glycosylation pattern can comprise modifications of native N- or O-glycosylation pattern and are described herein.
  • the term “whihinge region” refers to a flexible amino acid sequence in the central part of the heavy chains of antibodies and can be linked by disulfide bonds.
  • the hinge region links the Fc and Fab portion of an antibody.
  • the hinge region can be engineered by glycosylation engineering and/or amino acid substitutions, deletions and/or additions as described herein for optimized in vivo efficacy and/or enhanced neutralization potency.
  • anti-SARS CoV-2 antibody described herein can further be engineered for improved effector function by glycosylation engineering and/or amino acid substitutions, deletions and/or additions within the Fc region.
  • effector function as used herein is meant a biochemical event that results from the interaction of an antibody Fc region with an Fc receptor or ligand. Effector functions include but are not limited to ADCC, ADCP, and CDC.
  • the anti-SARS CoV-2 antibody described herein has improved effector function compared to lgG1, lgG2, and lgG4 anti-SARS CoV-2 antibodies described in the art.
  • the “improved” effector function as used herein may be an increase in effector function or a reduction of the effector function.
  • the reduction of effector function can be a silencing of the effector function.
  • Increased effector functions of the antibody due to enhanced complement- and FcyR-mediated activities can include enhanced complement dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC) and/or antibody dependent cellular phagocytosis (ADCP).
  • Fc receptor-mediated ADCC is an important mechanism of action by which antibodies target diseased cells for elimination. When the Fc effector portion of target-bound antibodies also binds to FcyRIIIA receptors on the cell surface of effector cells, multiple cross-linking of the two cell types occurs, leading to pathway activation of ADCC.
  • Antibodies with enhanced complement activities can be determined by cell-based CDC assays and improved binding to C1q.
  • Improved or increased CDC activity is determined to be at least 1.5-fold, specifically at least 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, more specifically at least 5-fold, more specifically at least 6-fold increase compared to a reference, i.e. , an lgG1, lgG2 or lgG4 subclass anti-SARS CoV-2 antibody.
  • Increased ADCC activity is determined to be at least 1.5-fold, specifically at least 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, more specifically at least 5-fold, more specifically at least 6-fold increased potency compared to a reference antibody, i.e., lgG1, lgG2 or lgG4 subclass anti-SARS CoV-2 antibody.
  • a reference antibody i.e., lgG1, lgG2 or lgG4 subclass anti-SARS CoV-2 antibody.
  • Increased ADCP activity is determined to be at least 1.5-fold, specifically at least 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, more specifically at least 5-fold, more specifically at least 6-fold increased potency compared to a reference antibody, i.e., lgG1, lgG2 or lgG4 subclass anti-SARS CoV-2 antibody.
  • a reference antibody i.e., lgG1, lgG2 or lgG4 subclass anti-SARS CoV-2 antibody.
  • Reduced effector functions of the antibody due to reduced complement- and FcyR-mediated activities can include reduced complement dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC) and/or antibody dependent cellular phagocytosis (ADCP).
  • CDC complement dependent cytotoxicity
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • ADCP antibody dependent cellular phagocytosis
  • the term “antigen” as used herein interchangeably with the terms “target” or “target antigen” shall refer to a whole target molecule or a fragment of such molecule recognized by an antibody binding site.
  • substructures of an antigen e.g., a polypeptide or carbohydrate structure, generally referred to as “epitopes”, e.g., B-cell epitopes or T-cell epitope, which are immunologically relevant, may be recognized by such binding site.
  • the antigen recognized by the antibody of the present invention is the glycoprotein receptor binding domain (RBD) of SARS-CoV-2.
  • epitope as used herein shall in particular refer to a molecular structure which may completely make up a specific binding partner or be part of a specific binding partner to a binding site of an antibody format of the present invention.
  • An epitope may either be composed of a carbohydrate, a peptidic structure, a fatty acid, an organic, biochemical or inorganic substance or derivatives thereof and any combinations thereof. If an epitope is comprised in a peptidic structure, such as a peptide, a polypeptide or a protein, it will usually include at least 3 amino acids, specifically about 5 to 40 amino acids. Epitopes can be either linear or conformational epitopes.
  • a linear epitope is comprised of a single segment of a primary sequence of a polypeptide or carbohydrate chain.
  • Linear epitopes can be contiguous or overlapping.
  • Conformational epitopes are comprised of amino acids or carbohydrates brought together by folding the polypeptide to form a tertiary structure and the amino acids are not necessarily adjacent to one another in the linear sequence.
  • the herein provided invention refers to the anti-SARS CoV-2 variable domains of antibodies B38 and H4 expressed in the lgG3 subclass and thus comprising the lgG3 constant and hinge region with one or more engineered glycans.
  • the binding activity of the anti-SARS CoV-2 antibody binding to RBD is about 3- fold, specifically about 4-fold, more specifically about 5-fold increased compared to an anti-SARS CoV-2 antibody binding to RBD such as H4 expressed in the subclasses lgG1, lgG2, and lgG4.
  • Major differences of lgG3 compared to other IgG subclasses are the long O- glycosylated hinge region and single point mutations in the Fc domain, that enable, e.g., high-affinity interaction with activating Fcy-receptors (FcyR).
  • the modified hinge region of the anti-SARS CoV-2 lgG3 antibody provided herein can contribute to altered activities, e.g., but not limited to crosslinking spike protein on the viral surface.
  • the improved crosslinking may lower also the concentration of the antibody described herein required for neutralization and low spike densities facilitate antibody evasion.
  • an antigen binding domain or “binding domain” or “binding-site” refers to the part of an antigen binding moiety that comprises the area which specifically binds to and is complementary to part or all of an antigen. Where an antigen is large, an antigen binding molecule may only bind to a particular part of the antigen, which part is termed an epitope.
  • An antigen binding domain may be provided by, for example, one or more antibody variable domains (also called antibody variable regions).
  • an antigen binding domain comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH).
  • binding site refers to a molecular structure capable of binding interaction with an antigen.
  • the binding site is located within the complementary determining region (CDR) of an antibody, herein also called “a CDR binding site”, which is a specific region with varying structures conferring binding function to various antigens.
  • CDR complementary determining region
  • the varying structures can be derived from natural repertoires of antibodies, e.g. murine or human repertoires, or may be recombinantly or synthetically produced, e.g. by mutagenesis and specifically by randomization techniques.
  • CDR regions include mutagenized CDR regions, loop regions of variable antibody domains, in particular CDR loops of antibodies, such as CDR1 , CDR2 and CDR3 loops of any of VL and/or VH antibody domains.
  • the antibody format as used according to the invention typically comprises one or more CDR binding sites, each specific to an antigen.
  • CDRs three complementarity determining regions (CDRs) on the heavy chain and two CDRs on the light chain are involved in the RBD-B38 interaction (Wu Y., et al., 2020).
  • the term “specific” as used herein shall refer to a binding reaction which is determinative of the cognate ligand of interest in a heterogeneous population of molecules.
  • the binding reaction is at least with an RBD antigen.
  • the antibody that specifically binds to its particular target does not bind in a significant amount to other molecules present in a sample.
  • a specific binding site is typically not cross-reactive with other targets. Still, the specific binding site may specifically bind to one or more epitopes, isoforms or variants of the target, or be cross-reactive to other related target antigens, e.g., homologs or analogs.
  • the specific binding means that binding is selective in terms of target identity, high, medium or low binding affinity or avidity, as selected.
  • Avidity refers to the overall sum of binding strength of multiple affinities and is often used to describe the accumulated strength of two antibody Fab arms with its antigens.
  • Selective binding is usually achieved if the binding constant or binding dynamics to a target antigen such as RBD is at least 10-fold different, preferably the difference is at least 100-fold, and more preferred a least 1000-fold compared to binding constant or binding dynamics to an antigen which is not the target antigen.
  • the level of effector function can be measured by cell-based CDC assays, by change in equilibrium constant.
  • human antibody as used herein, includes antibodies having variable and constant regions derived from human germline immunoglobulin sequences whether in a human cell or grafted into a non-human cell, e.g., a plant cell.
  • the term includes antibodies recombinantly produced in a non-human mammal or in cells of a non-human mammal.
  • a “humanized” antibody refers to a chimeric antibody comprising amino acid residues from non-human HVRs and amino acid residues from human framework regions (FRs) which has undergone humanization.
  • a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., CDRs) correspond to those of a non-human antibody, and all or substantially all of the FRs correspond to those of a human antibody.
  • a humanized antibody optionally may comprise at least a portion of an antibody constant region derived from a human antibody.
  • Other forms of humanized antibodies encompassed by the present invention are those in which the constant region has been additionally modified or changed from that of the original antibody to generate the new properties.
  • variable domain of the recombinant anti-SARS CoV-2 antibody provided herein is encoded by the nucleotide sequence of the H4 variable HC (SEQ ID NO: 1) and the H4 variable LC (SEQ ID NO: 3) and comprises the amino acid sequence of the H4 variable HC (SEQ ID NO: 2) and the H4 variable LC (SEQ ID NO: 4).
  • variable domain of the recombinant anti-SARS CoV- 2 antibody provided herein is encoded by the nucleotide sequence of the B38 variable HC (SEQ ID NO: 5) and the B38 variable LC (SEQ ID NO: 7) and comprises the amino acid sequence of the B38 variable HC (SEQ ID NO: 6) and the B38 variable LC (SEQ ID NO: 8).
  • sequence of the recombinant anti-SARS CoV-2 antibody comprising an lgG3 constant and hinge region comprising the variable region of H4 is given in SEQ ID NO: 9 (nucleotide sequence) and SEQ ID NO: 10 (amino acid sequence).
  • sequence of the recombinant anti-SARS CoV-2 antibody comprising an lgG3 constant and hinge region comprising the variable region of B38 is given in SEQ ID NO: 11 (nucleotide sequence) and SEQ ID NO: 12 (amino acid sequence).
  • sequence of the B38 IgG-kappa Lc is given in SEQ ID NO: 13 (nucleotide sequence) and in SEQ ID NO: 14 (amino acid sequence).
  • the sequence of the H4 IgG-kappa Lc is given in SEQ ID NO: 15 (nucleotide sequence) and in SEQ ID NO: 16 (amino acid sequence).
  • sequence of the B38 IgG-Lambda Lc is given in SEQ ID NO: 17 (nucleotide sequence) and in SEQ ID NO: 18 (amino acid sequence).
  • H4 IgG-Lambda Lc The sequence of the H4 IgG-Lambda Lc is given in SEQ ID NO: 19 (nucleotide sequence) and in SEQ ID NO: 20 (amino acid sequence).
  • Allotypes refer to polymorphisms in the constant regions of immunoglobulin heavy and light chains, wherein the term ..polymorphism" refers to the occurrence of different genetic forms among members of a population or colony, or in the lifecycle of and individual organism. Allotypes refer to amino acid differences in the constant region of either the heavy or light chains of an antibody within a subclass. lgG3 has 13 Gm allotypes termed G3m which are inherited in different combinations or G3 m alleles shared among individuals within populations. According to the present invention, the anti-SARS CoV-2 antibody is of G3m allotype, specifically selected from the group consisting of G3m5, G3m6, G3m15, G3m16, G3m21, and G3m24.
  • G3m5 is a combination of alleles G3m5, 10, 11, 13, 14, 26, 27; IGHG3 genes IGHG3 * 01 , * 05, * 06, * 07, * 09, * 10, * 11 , * 12; in the Ig heavy domain chain H-y3 CH3.
  • G3m6 is a combination of alleles G3m5, 6, 10, 11, 14, 26, 27; IGHG3 genes IGHG3*13; in the Ig heavy domain chain H-y3 CH3.
  • G3m15 is a combination of alleles G3m10, 11, 13, 15, 27; IGHG3 genes IGHG3*17; in the Ig heavy domain chain H-y3 CH3.
  • G3m16 is a combination of alleles G3m10, 11, 13, 15, 16, 27; IGHG3 genes IGHG3*18, *19; in the Ig heavy domain chain H-y3 CH2.
  • G3m21 is a combination of alleles G3m21, 26, 27, 28; IGHG3 genes IGHG3*14, *15, *16; in the Ig heavy domain chain H-y3 CH2.
  • G3m24 is a combination of alleles G3m5, 6, 11, 24, 26; IGHG3 genes IGHG3 * 03; in the Ig heavy domain chain H-y3 CH3.
  • Immunoglobulins are glycoproteins, i.e. , proteins that are glycosylated through a post-translational modification termed glycosylation which describes the attachment of carbohydrates to a protein with the help of certain enzymes.
  • glycosylation The glycosylation pattern of human lgG3 is described by Damelang T., et al. (2019).
  • a native lgG3 antibody can have three glycosylation sites. One single N-glycosylation site at the CH2 domain is found in all IgG subclasses. A second N-glycosylation site can be found in the heavy and light chain variable regions VH and VL.
  • the third glycosylation site is found only in lgG3 and is an O-glycosylation site in the hinge region, wherein each lgG3 can contain up to three O-glycans at threonine residues at triple repeat regions within the hinge.
  • the recombinant anti-SARS CoV-2 antibody of the invention comprises an lgG3 constant and hinge region with one or more engineered glycans at the glycosylation sites present in native lgG3.
  • glycocan refers to the term as known in the field of glycobiology. Thereby, a glycan refers to the carbohydrate portion of a glycoconjugate such as a glycoprotein.
  • a glycoprotein is a protein which carries one or more glycans covalently linked to the polypeptide backbone. Usually, these linkages are N- or O-linkages.
  • N-glycan a carbohydrate, commonly a GlcNAc residue, is covalently attached to a protein at an asparagine (Asn) residue by an N-glycosidic bond at an N- glycosylation site.
  • An N-glycosylation site is characterized by the amino acid sequence Asn-X-Ser/Thr, wherein “X” can be any amino acid except Pro.
  • Eukaryotic N-glycans share a common core sequence: Mane -3(M3ha1-6)M3hb1-46I ⁇ NA ⁇ b1-46I ⁇ NA ⁇ b1- Asn-X-Ser/Thr.
  • Eukaryotic N-glycans are classified into three types: oligomannose, in which only Man residues extend the core; complex, in which “antennae” initiated by GlcNAc extend the core; and hybrid, in which Man extends the Maned -6 arm of the core and one or two GlcNAcs extend the Mane -3 arm.
  • Each N-glycan contains the common core Man3GlcNAc2Asn.
  • Plants perform A/-glycosylation similar to mammalian cells as discussed by Strasser R. et al. (2008). Plants are able to synthesize an A/-glycan core structure identical to that of mammalian cells (GnGn) but plant complex A/-glycans lack terminal b1 , 4-galactose (and sialic acid) and core cd, 6-fucose which are present in mammals.
  • N-glycans synthesized by plants carry instead b1, 2-xylose and core cd,3-fucose, which are absent in mammals.
  • an A/-glycan profile from a plant-derived antibody consists mainly of complex A/-glycans carrying b1, 2-xylose and core cd,3-fucose residues.
  • fucose deficient antibodies provide the advantage of increased effector functions (such as increased ADCC, and ADCP)
  • O-glycans refer to a glycosylation wherein a carbohydrate, commonly a GalNAc residue, is attached to the hydroxyl group of serine or threonine residue in proteins. Thereby, O-glycans are less branched than most N-glycans and can result in the formation of mucin-type molecules. As described by Strasser R. (2016), mucin-type O- glycans have not been detected on native plant proteins. In plants, a single GalNAc sugar nucleotide can be transferred to Ser residues on specific proteins and arabinose chains as well as structurally complex arabinogalactans occur on hydroxyproline residues of cell wall proteins.
  • a “engineered glycan” refers to an engineered carbohydrate structure of the glycosylation pattern of the lgG3 presented herein.
  • the engineered glycans are N- glycans and/or O-glycans, wherein the carbohydrate structure is altered due to an engineered, i.e., altered glycosylation pathway of the host cell where the antibody comprising the targeted glycan structures is produced, as described herein.
  • the recombinant anti-SARS CoV-2 antibody provided herein has one or more engineered glycans.
  • the recombinant anti-SARS CoV-2 antibody provided herein has at least one, two, or three engineered glycans.
  • engineered glycans are engineered N-glycans present at the conserved Fc N-glycosylation site of lgG3 and/or engineered O-glycans present at the O-glycosylation site of lgG3.
  • engineered N-glycans can be present in Fab glycosylation sites.
  • the engineered O-glycans are O-glycan-structures comprising N-acetylgalactosamine (GalNAc) attached to serine/threonine residues (mucin-type O-glycosylation), wherein said structure may be extended by different monosaccharides, e.g., galactose, GlcNAc, and/or mono- or poly-sialic acid (see Figure 3 for examples of said structures).
  • GalNAc N-acetylgalactosamine
  • the engineered glycans are fucose-deficient N-glycans meaning that the N-glycans do not carry a core fucose residue selected from core a1,3- fucose residue and a1,6-fucose residue.
  • the engineered fucose-deficient N-glycans may terminate either with GlcNAc, galactose or sialic acid residues (see Table 3).
  • the anti-SARS CoV-2 antibody provided herein at least 80%, preferably at least 85%, 86%, 87%, 88%, 89%, more specifically 90% or more of the N-glycans are homogenous glycans, specifically 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%. More specifically, the anti-SARS CoV-2 antibody provided herein carries only N-glycans comprising the glycosylation profile GnGn, i.e., N-glycans lacking b1, 2-xylose and core a1,3-fucose. GnGn refers to GlcNAc terminating complex N-glycans, i.e., GlcNAc2Man3GlcNAc2.
  • the O- and/or N-glycans in the CH2 domain and/or the hinge region are oligo-sialylated or poly-sialylated glycans.
  • immunoglobulin IgA in glyco-engineered DCT/FT Nicotians benthamiana can result in complex biantennary N-glycans with terminal N- acetylglucosamine on the N-glycosylation site of the CH2 domain in the immunoglobulin. Further, specific modifications including hydroxyproline formation and attachment of pentoses at O-glycosylation in the hinge region can be provided. Also disialylated mucin- type core 1 O-glycans can be introduced.
  • sialic acids and polysialic acids can mediate diverse biological functions.
  • Sialic acids are abundant terminal modifications of protein-linked glycans. These terminal sialic acids form linear homo-oligomers or polymers, with its most complex form as polysialic acid.
  • Sialylated structures with different interlinkages and degree of polymerization may also be comprised as glycan modifications in the antibodies described herein.
  • Sialylated structures are regarded as polySia chains if the degree of polymerization (DP) exceeds 8 (DP >8).
  • PolySia structures range from 8-up to DP >400. Sialylation and polysialylation can enhance IgG serum persistence of the antibodies described herein. Further, sialylation can alter biodistribution.
  • the recombinant anti-SARS CoV-2 antibody of the invention comprises SEQ IDs NO: 10 or 12, or a functional variant thereof with at least 90% sequence identity, specifically comprising a heavy chain constant region with fucose-deficient N-glycans.
  • allelic variant or “functionally active variant” refer to naturally occurring allelic variants, as well as mutants or any other non-naturally occurring variants.
  • an allelic variant, or also referred to as homologue is an alternate form of a nucleic acid or peptide that is characterized as having a substitution, deletion, or addition of one or more nucleotides or amino acids that does essentially not alter the biological function of the nucleic acid or polypeptide.
  • a functional variant may comprise a substitution, deletion and/or addition of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or20 amino acid residues, ora combination thereof, which substitutions, deletions and/or additions are conservative modifications and do not alter the antigen binding properties.
  • a functional variant as described herein comprises no more than or up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acid substitutions, deletions and/or additions, which are conservative modifications and do not alter the antibody ' s function.
  • a functionally active variant as described herein comprises up to 15, preferably up to 10 or 5, amino acid substitutions, deletions and/or additions, which are conservative modifications and do not alter the antibody’s function.
  • Functional variants may be obtained by sequence alterations in the polypeptide or the nucleotide sequence, e.g., by one or more point mutations, wherein the sequence alterations retain or improve a function of the unaltered polypeptide or the nucleotide sequence, when used in combination of the invention.
  • sequence alterations can include, but are not limited to, (conservative) substitutions, additions, deletions, mutations and insertions.
  • Conservative substitutions are those that take place within a family of amino acids that are related in their side chains and chemical properties. Examples of such families are amino acids with basic side chains, with acidic side chains, with non-polar aliphatic side chains, with non-polar aromatic side chains, with uncharged polar side chains, with small side chains, with large side chains etc.
  • a point mutation is particularly understood as the engineering of a polynucleotide that results in the expression of an amino acid sequence that differs from the nonengineered amino acid sequence in the substitution or exchange, deletion or insertion of one or more single (non-consecutive) or doublets of amino acids for different amino acids.
  • Percent (%) sequence identity with respect to the polypeptide sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific polypeptide sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • sequence identity of a functional variant of an antibody provided herein comprising SEQ IDs NO: 10 or 12 is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% with the respective sequences described herein.
  • the antibody provided herein is an lgG3 antibody, wherein the hinge region of the antibody is engineered by protein engineering. Thereby, the amino acid sequence of the hinge region is altered and said alteration may be a shortening, elongation, or an exchange of amino acids.
  • a responsiblenucleic acid“ refers to a DNA or RNA sequence consisting of nucleotides as monomers, wherein in the present invention the nucleic acid is encoding the antibody of the present invention.
  • recombinant as used herein shall mean “being prepared by genetic engineering” or “the result of genetic engineering”, e.g., specifically employing heterologous sequences incorporated in a recombinant vector or recombinant host cell.
  • the term refers to antibodies recombinantly expressed in host cells, preferably in plant cells.
  • the recombinant production of the antibody of the invention preferably employs an expression system, e.g., including expression constructs or vectors comprising a nucleotide sequence encoding the antibody format.
  • expression system refers to nucleic acid molecules containing a desired coding sequence and control sequences in operable linkage, so that hosts transformed or transfected with these sequences are capable of producing the encoded proteins.
  • the expression system may be included on a vector; however, the relevant DNA may then also be integrated into the host chromosome.
  • an expression system can be used for in vitro transcription/translation.
  • Expression vectors used herein are defined as DNA sequences that are required for the transcription of cloned recombinant nucleotide sequences, i.e., of recombinant genes and the translation of their mRNA in a suitable host organism.
  • Expression vectors comprise the expression cassette and additionally usually comprise an origin for autonomous replication in the host cells or a genome integration site, one or more selectable markers (e.g., an amino acid synthesis gene or a gene conferring resistance to antibiotics such as zeocin, kanamycin, G418 or hygromycin), a number of restriction enzyme cleavage sites, a suitable promoter sequence and a transcription terminator, which components are operably linked together.
  • plasmid and “vector” as used herein include autonomously replicating nucleotide sequences as well as genome integrating nucleotide sequences. Specifically, the term refers to a vehicle by which a DNA or RNA sequence (e.g., a foreign gene), e.g., a nucleotide sequence encoding the antibody format of the present invention, can be introduced into a host cell, so as to transform the host and promote expression (e.g., transcription and translation) of the introduced sequence.
  • a DNA or RNA sequence e.g., a foreign gene
  • promote expression e.g., transcription and translation
  • Vectors typically comprise the DNA of a transmissible agent, into which foreign DNA is inserted.
  • a common way to insert one segment of DNA into another segment of DNA involves the use of enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites.
  • a “cassette” refers to a DNA coding sequence or segment of DNA that code for an expression product that can be inserted into a vector at defined restriction sites.
  • the cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame.
  • foreign DNA is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA.
  • a segment or sequence of DNA having inserted or added DNA, such as an expression vector can also be called a “DNA construct”.
  • a common type of vector is a “plasmid”, which generally is a self-contained molecule of double-stranded DNA that can readily accept additional (foreign) DNA and which can readily be introduced into a suitable host cell.
  • a vector of the invention often contains coding DNA and expression control sequences, e.g. promoter DNA, and has one or more restriction sites suitable for inserting foreign DNA.
  • Coding DNA is a DNA sequence that encodes a particular amino acid sequence for a particular polypeptide or protein such as an antibody format of the invention.
  • Promoter DNA is a DNA sequence which initiates, regulates, or otherwise mediates or controls the expression of the coding DNA.
  • Promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms.
  • Recombinant cloning vectors of the invention will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g. antibiotic resistance, and one or more expression cassettes.
  • DNA sequences e.g. providing or coding for the factors of the present invention and/or the protein of interest, a promoter, a terminator and further sequences, respectively, and to insert them into suitable vectors containing the information necessary for integration or host replication, are well known to persons skilled in the art, e.g. described by Sambrook et al, 2012.
  • a host cell is specifically understood as a cell, a recombinant cell or cell line transfected with an expression construct, such as a vector.
  • a recombinant antibody of the invention may be produced using any known and well-established expression system and recombinant cell culturing technology. More specifically, the recombinant antibody of the invention is expressed in plant cell hosts (eukaryotic systems). An antibody molecule of the present invention may be produced in transgenic organisms, more specifically in transgenic plants.
  • the antibody provided herein is produced in a plant cell and said plant cell is a Nicotians benthamiana cell, specifically a glyco-engineered AXTFT N. benthamiana cell.
  • glyco-engineered AXTFT N. benthamiana cell was described by Strasser R., et al., 2008 and is characterized by down-regulation of endogenous b1 ,2- xylosyltransferase (XylT) and core a1,3-fucosyltransferase (FucT) genes. Therefore, production of recombinant proteins in glyco-engineered AXTFT N. benthamiana cells lack plant-specific xylosylated and core fucosylated glycan structures.
  • the glyco- engineered AXTFT N. benthamiana cell may be further engineered for to enable sialylation of glycans and N-and O-glycan structures described herein.
  • the invention provides a method for production of the recombinant anti-SARS CoV-2 antibody provided herein in said plant cell.
  • the plant cells are transfected with one or more expression cassettes comprising the nucleic acid of the invention, specifically in the presence of one or more enzyme sequences for the human O-glycosylation pathway, more specifically in the presence of one or more of b1 ,4-galactosyltransferase, GalNAc-T2, GalNAc-T4, GalNAc-T14, C1GalT1, UDP-N- acetylglucosamine 2 epimerase / N-acetylmannosamine kinase, N-acetylneuraminic acid phosphate synthase and CMP-N-acetylneuraminic acid synthetase.
  • the plants are cultivated under conditions wherein the antibody is expressed in said plant cells.
  • the antibody is isolated from the plant cell.
  • GalNAc-T2, GalNAc-T4, GalNAc-T14 refer to polypeptide N- acetylgalactosaminyltransferase 2 and catalyze the initial reaction in O-linked oligosaccharide biosynthesis, namely the transfer of an N-acetyl-D-galactosamine reside to serine or threonine.
  • C1GalT1 refers to Glycoprotein-N-acetylgalactosamine 3-beta- galactosyltransferase 1 and catalyzes the reaction that generates the core 1 O-glycan Gal-beta1-3GalNAc-alpha1-Ser/Thr, which is a precursor for many extended O-glycans.
  • UDP-N-acetylglucosamine 2 epimerase is an enzyme which catalyzes the reversible epimerization atC-2 of UDP-N-acetylglucosamine (UDP-GIcNAc) and thereby provides bacteria with UDP-N-acetylmannosamine (UDP-ManNAc), the activated donor of ManNAc residues.
  • UDP-G-acetylmannosamine kinase refers to an enzyme which catalyzes the phosphorylation of N-acetylmannosamine (ManNAc) to ManNAc-6-P.
  • N-acetylneuraminic acid phosphate synthase produces N-acetylneuraminic acid (Neu5Ac) and 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid (KDN).
  • the enzyme can also use N-acetylmannosamine 6-phosphate and mannose 6-phosphate as substrates to generate phosphorylated forms of Neu5Ac and KDN, respectively.
  • CMP-N-acetylneuraminic acid synthetase refers to cytidine monopospho-N- acetylneuraminic acid synthetase and converts Neu5Ac to cytidine monophospho-A/- acetylneuraminic acid.
  • the plant cell is a N. benthamiana cell and nucleic acid of the invention is codon optimized for N. benthamiana.
  • Codon optimization refers to a method of adapting a sequence encoding a certain protein to the codon usage of the host cell used for expression of the protein. Thereby, codon bias between different host cells is accommodated in the sequence encoding the protein of interest. Codon optimization can be performed using specific tables describing the codon usage in a host cell, e.g., in N. benthamiana, or by using specific software or online tools specifically designed for codon optimization. Such methods and tools are well known to the skilled person.
  • the recombinant anti-SARS CoV-2 antibody provided herein is used in an in vitro method for detecting SARS-CoV-2 in a sample.
  • the method of detection can be applied to detect any virus surface antigens or coronavirus proteins or peptides released before or during cellular infection.
  • the recombinant anti-SARS CoV-2 antibody may be used to detect and/or measure coronavirus and/or coronaviral spike proteins.
  • Exemplary assays for such an in vitro method for detection of SARS-CoV-2 may include neutralization assays, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence-activated cell sorting (FACS).
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS fluorescence-activated cell sorting
  • the present invention includes a method for detecting the presence of spike protein polypeptide or a fragment thereof in a sample comprising contacting the sample with the anti-SARS CoV-2 antibody provided herein and detecting the presence of a coronaviral spike protein wherein the presence of the complex indicates the presence of a coronavirus and/or a coronaviral spike protein.
  • An anti-SARS CoV-2 antibody of the invention may be used in a Western blot or immune-protein blot procedure for detecting the presence of coronaviral spike protein or a fragment thereof in a sample.
  • the anti- SARS CoV-2 antibody provided herein may also be used for immunohistochemistry.
  • treatment refers to clinical intervention in an attempt to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
  • antibodies of the invention are used to delay development of a disease or to slow the progression of a disease.
  • the disease condition is caused or associated with an infection by a coronavirus.
  • compositions of this invention may be in a variety of forms, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories.
  • liquid solutions e.g., injectable and infusible solutions
  • dispersions or suspensions tablets, pills, powders, liposomes and suppositories.
  • the preferred form depends on the intended mode of administration and therapeutic application. Typical preferred compositions are in the form of injectable or infusible solutions, such as compositions similar to those used for passive immunization of humans.
  • the preferred mode of administration is parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular).
  • the antibody is administered by intravenous infusion or injection.
  • the antibody is administered by intramuscular or subcutaneous injection.
  • the route and/or mode of administration will vary depending upon the desired results.
  • the anti-SARS CoV-2 antibody of the invention may be administered once, but more preferably is administered multiple times.
  • the antibody may be administered from three times daily to once every six months or longer.
  • the administering may be on a schedule such as three times daily, twice daily, once daily, once every two days, once every three days, once weekly, once every two weeks, once every month, once every two months, once every three months and once every six months.
  • a subject is treated with the anti-SARS CoV-2 antibody described herein, who has been infected or is at risk of being infected with coronavirus.
  • a subject is treated who has been infected or is at risk of being infected with said virus, preferably a human being, or a non-human mammal, such as a dog, cat, horse, camelids, cattle or pig.
  • the subject is or has been exposed to a virus, or is otherwise at risk of being infected with the virus.
  • the subject has been determined or diagnosed of being infected with the virus.
  • a subject is treated which is a patient suffering from Coronaviridae virus-caused disease, such as gastroenteritis, respiratory tract disease, or severe acute respiratory syndrome (SARS).
  • Coronaviridae virus-caused disease such as gastroenteritis, respiratory tract disease, or severe acute respiratory syndrome (SARS).
  • the disease is a b- coronavirus-caused disease e.g., a SARS virus-caused disease, upon getting in contact with the pathogen, such as COVID19, or COVID19-associated pneumonia.
  • a pharmaceutical preparation comprising the anti-SARS CoV-2 antibody, in an effective amount.
  • the anti-SARS CoV-2 antibody of the invention and the pharmaceutical compositions comprising the anti-SARS CoV-2 antibody of the invention can also be administered in combination with one or more other therapeutic, diagnostic or prophylactic agents.
  • Additional therapeutic agents include other antiviral agents such as other immunoglobulins, e.g., lgG1, lgG2, lgG4, IgA; therapeutic molecules, e.g., anticoagulants, and corticosteroids; and/or agents interfering with virus replication, e.g., Remdesivir®.
  • the pharmaceutical composition comprising the recombinant anti-SARS CoV-2 antibody of the invention may optionally comprise a pharmaceutically acceptable carrier.
  • a "pharmaceutically acceptable carrier” refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject.
  • Some examples of pharmaceutically acceptable carriers are water, saline, phosphate buffered saline, amino acids such as glycine or histidine, dextrose, glycerol, ethanol and the like, as well as combinations thereof.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Additional examples of pharmaceutically acceptable substances are wetting agents or minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the antibody.
  • the invention further provides for methods of treating a subject being infected or at risk of being infected with a virus such as a coronavirus, comprising administering an effective amount of the anti-SARS CoV-2 antibody thereof, and respective medicinal products or pharmaceutical preparations as further described herein.
  • the example illustrates the cloning, expression, purification, and characterization of SARS-CoV-2 mAb (H4) in subclass lgG3. Further, the results are compared to SARS- CoV-2 mAb (H4) in lgG1, lgG2, and lgG4.
  • Codon-optimized IgG heavy chain variable fragment H4- HCFv (379-bp) and IgG light chain variable fragment H4-LCFv (339-bp) were grafted into the MagnICON® vectors (Marillonnet, S., et al.,2005) containing barley alfa amylase signal peptide with heavy chain constant domain of lgG1 (HC1) and kappa light chain constant domain (LC) using Bsal restriction sites, resulting in H4-lgG-HC1 (1371 -bp) and light chain H4-lgG-LC (663-bp).
  • Subsequent vectors were named as TMVaH4- IgGHCI and PVXaH4-lgGLC, respectively.
  • lgG2-4 subclasses containing the H4 variable regions were generated in two steps similarly as described in (Kallolimath S., et al., 2020):
  • H4-HCFv variable region and heavy chain constant region of lgG2-4 HC were amplified from RxlgG2-4HC with primer pairs H4HCF1: tatacgtctcaaggtcaggttcagcttgttcaa (SEQ ID NO:21)/
  • H4HCSOER1 ccttggtggaggcagaggacacag (SEQ ID NO:22) and H4HCSOEF1: tgactgtgtcctctgcctccacca (SEQ ID NO:23)/
  • 7B4lgGHCR1 gcacgtctcaagctcatttacccggagac (SEQ ID NO:24) respectively.
  • H4-lgG-HC2 1359- bp
  • H4-lgG-HC3 1512-bp
  • H4-lgG HC4 1362-bp
  • TMV-based vector containing barley alfa amylase signal peptide resulting in TMVaH4-lgGHC2-4 ( H4-lgGHC1-4 ).
  • the resulting vectors were transferred to Agrobacteria (strain GV3101 pMP90) for subsequent agroinfiltration experiments.
  • Glycoengineered Nicotiana benthamiana that lack plant-specific core xylose and fucose residues (Strasser R., et al., 2008) were grown in a plant growth chamber under controlled conditions at 24 °C, 60% humidity with a 16 h light/8 h dark photoperiod. Leaves of 4-5 weeks old plants were used for syringe-based agroinfiltration. Liquid cultures of agrobacteria transformed with H4-lgGHC1-4 and corresponding kappa light chain H4-lgGLC were grown at 29 °C for 24 h.
  • Cultures were centrifuged at 3000 g for 5 min and resuspended in infiltration buffer (10 mM MES pH 5.6; 10 mM MgS04) to a final optical density (OD600) of 0.1 and mixed in a 1:1 ratio for infiltration.
  • infiltration buffer 10 mM MES pH 5.6; 10 mM MgS04
  • plant leaves are infiltrated with antibody constructs along with DNA constructs carrying proteins required for mucine-type O-glycans, e.g., B1,4-galactosyltransferase, GalNAc-T2, GalNAc-T4, GalNAc-T 14, C1 GalT 1 , UDP-N-acetylglucosamine 2 epimerase / N-acetylmannosamine kinase, N-acetylneuraminic acid phosphate synthase and CMP-N-acetylneuraminic acid synthetase.
  • proteins required for mucine-type O-glycans e.g., B1,4-galactosyltransferase, GalNAc-T2, GalNAc-T4, GalNAc-T 14, C1 GalT 1 , UDP-N-acetylglucosamine 2 epimerase / N-acetylmannosamine kinase, N-acetyl
  • Infiltrated leaves were harvested four days post infiltration (dpi), flash-frozen in liquid nitrogen, and grounded to fine powder.
  • Total soluble proteins (TSPs) were extracted with extraction buffer (0.5 M NaCI, 45 mM Tris, 1 mM EDTA, and 40 mM ascorbic acid; pH 7.4) in a ratio of 1:2 w/v (fresh leaf weight/buffer) for 1.5 h at 4 °C on an orbital shaker. Subsequently, the extract was centrifuged twice at 14,000 g for 20 min at 4 °C and the supernatant was vacuum filtrated using 8-12 and 2-3 pm filter (ROTILABO® Typ 12A and 15A).
  • H4-lgG1, 2, and 4 were purified by affinity chromatography using protein A (rProA Amicogen, Cat no: 1080025), for H4-lgG3 purification protein G was used (Protein G SepharoseTM Fast Flow, GE Healthcare). TSP extracts were loaded at a flow rate of 1.5 mL/min on a column which was pre-equilibrated with 2 column volumes (CV) PBS (137 mM NaCI; 3 mM KCI; 10 mM Na2HP04; 1.8 mM KH2P04; pH 7.4). Washing was done with 2 CVs PBS (pH 7.4).
  • CV column volumes
  • Antibodies were eluted in 1 ml_ fractions with 0.1 M Glycine/HCI (pH 2.5), eluates were immediately neutralized with 1 M Tris (pH 9.0) and dialyzed overnight against PBS (pH 7.4). Monomeric forms of H4- IgG subclasses were separated by size exclusion chromatography using a HiLoad Sephadex 200/10/300 GL column (GE Healthcare). The column was equilibrated and eluted with each 1.5 CV elution buffer (PBS; 200 mM NaCI; pH 7.2) at a flow rate of 0.4 mL/min.
  • PBS 1.5 CV elution buffer
  • Glycosylation profile of the purified Abs are determined by mass spectrometry MS as described previously (Kallolimath S., et al., 2020; Loos A., et al., 2014). Briefly, respective heavy chains were excised from an SDS-PAGE, trypsin digested, and analyzed with an LC-ESI-QTOF system (Bruker maXis 4G). The possible glycans were identified as sets of peaks consisting of the peptide moiety and the attached N-glycan varying in the number of HexNAc units, hexose, deoxyhexose, and pentose residues. Manual glycan searches were made using DataAnalysis 4.0 (Bruker). The peak heights roughly reflect the molar ratios of the glycoforms. Nomenclature according to Consortium for Functional Glycomics (http://www.functionalglycomics.org) was used.
  • Microplates (Thermo fischer maxisorp, catlog No: M9410-1CS) were coated with PBS containing 2 pg/mL recombinant SARS-CoV-2 SP (soluble, trimeric SARS CoV-2 spike protein ectodomain carrying a C-terminal His-tag produced in CHO-K1 cells), and incubated overnight at 4 °C. After washing with PBS-T (PBS pH 7.4 with 0,05% Tween 20), the plates were blocked with 3% fat-free milk powder in PBS-T (blocking solution) for 1.5 h. The Abs were incubated for 2 h at room temperature in two-fold serial dilutions starting from 3200 ng/ml_.
  • SARS-CoV-2 SP soluble, trimeric SARS CoV-2 spike protein ectodomain carrying a C-terminal His-tag produced in CHO-K1 cells
  • the SARS-CoV-2 neutralization assay was performed as described recently (Koblischke M., et al., 2020), and recombinant H4 antibodies were tested in two independent experiments. Serial dilutions of purified H4-lgG1-4 subtypes were incubated with 50-100 TCID50 SARS-CoV-2 for 1 h at 37 °C before the mixture was added to Vero E6 cell monolayers. Incubation was continued for 3 days. The concentration of each Ab at which 100% protection against virus-induced cytopathic effects was achieved is given as NT100.
  • RBD receptor-binding domain
  • H4-lgGHC1-4 supporting information.
  • K-LC light chain constant
  • MS analyses demonstrate the generation of galactosylated and sialylated H4lgG3 (further described in example 2, Table 3). Pro and anti-inflammatory lgG3 activities might be modulated by galactosylation and sialylation.
  • the engineering of lgG3 O-glycosylation is shown in Figure 3.
  • the MS profiles exhibit three O-glycan profiles: A, D: initiation of O-GalNAc (HexNAc) formation by the overexpression of GalNAc-transferase 2 (GalNAcT2); B, C: elongation GalNAc (HexNAc) with b1 ,3-galactose by overexpressing b1 ,3-galactosyltransferase (C1 GalT 1 ); C,D: synthesis of sialylated O-glycans (by coexpression of C1GalT1 with the genes for the human sialylation pathway).
  • These glycans may confer increased Ab stability and impact on the conformation and the binding abilities of Abs.
  • the IgG subtypes shown in Table 2 have the glycosylation profile as shown in Figure 5.
  • the combination of glycosylation enzymes that have been used to produce the H4-lgG3 of Table 2 tested for antigen binding and neutralization are listed in Table 1.
  • the herein described antibody can be used in an in vitro method for detecting SARS CoV-2 and/or the spike protein of SARS-CoV-2 in a sample.
  • the technical effect of using the herein described antibody is that an up to 5-fold increased binding of lgG3 compared to the lowest binder was found and thus, the antibody of the invention provides the advantage of high sensitivity.
  • virus neutralization (NT) assays were performed, as described previously by Koblischke M., et al., 2020.
  • lgG1, 2 and 4 exhibited similar neutralization potencies (see Table 2).
  • lgG3 displayed an up to 50-fold increased activity (see Table 2) in comparison with the other subtypes.
  • Our results point to an important role of domains beyond antigen-binding to H4-Ab activities.
  • Table 2 ECso values and neutralization activities (NT100 values) of H4-lgG subclasses Impact of O-glycosylation
  • Engineered O-glycans may confer increased Ab stability and may alter the conformation and the binding abilities of SARS-CoV2 lgG3.
  • Table 3 shows 5 times increased lgG3 purification yield upon co expression of the O-glycosylation pathway.
  • This oligo/polysialylation of the Ab may increase Ab stability and biodistribution of Abs, e.g., the antibody may enter neural tissue by overriding the blood brain barrier.
  • Vero cells were used that do not carry FcyR in the studies, superior SARS- CoV-2 NT induced by Fc-mediated effector activities can be excluded.
  • An unusual hinge region of lgG3 can be a relevant factor that mediates altered activities.
  • Enhanced SARS- CoV-2 NT can be a consequence of crosslinking SP on the viral surface, induced by the structural features of the lgG3. Crosslinking might lower the concentration of Abs required for neutralization and low spike densities facilitate Ab evasion.
  • H4HcFv IgG heavy chain variable fragment
  • H4LcFv IgG light chain variable fragment
  • lgG2-4 subclass containing H4 variable region were generated in two steps similarly as described in (Kallolimath et al.,2020): (i) a H4HcFv variable region and heavy chain constant region of lgG2-4Hc was amplified from RxlgG2-4Hc with primer pairs (H4Hc F1 / H4HcSOE R1) and (H4HcSOE F1 / 7B4lgGHC R1) respectively (ii) Full-length HC fragments that carry variable domain of H4 with lgG2-4 constant domains were generated using overlap extension polymerase chain reaction with primer pair (H4Hc F1 /7B4lgGHC R1).
  • the primers also introduce BsmBI restriction site and flank the fragment with Bsal restriction site to facilitate cloning into MagnICON® vector (Marillonnet et al. 2005).
  • the full-length HC fragments H4lgG-HC2 (1359-bp); H4lgG-HC3 (1512-bp); H4lgG HC4 (1362bp) were cloned into TMV-based vector containing barley alfa amylase signal peptide resulting in TMVaH4lgGHC1-4 (H4lgGHc1-4).
  • the resulting vectors were transferred to Agrobacteria (strain GV3101 pMP90).
  • H4lgGHC1 -4 For in-planta expression of IgG subtypes, four plant-based expression vectors carrying identical variable region of H4HC, but differed in their HC constant domains, were generated (H4lgGHC1 -4).
  • H4lgGHC1 -4 For the expression of LC H4lgGLC was used which is a common light chain for all IgG subtypes. Nicotians benthamiana wild type (WT) and glycoengineered plants AXTFT (Strasser et al. 2008) were grown in a plant chamber at 24°C, 60% humidity with a 16 h light/ 8h dark photoperiod. Fully expanded 2-3 (middle) Leaves of 4-5 weeks old plants were used for syringe-based agroinfiltration.
  • Liquid cultures of agrobacteria transformed with H4lgGHC1-4 and corresponding light chain H4lgGLC were grown at 29°C for 24 h. Cultures were centrifuged for 5 min at 3000 g and resuspended in infiltration buffer (10 mM MES pH 5.6; 10 mM MgS04) to a final optical density (OD600) of 0.1 and mixed in a 1:1 ratio for infiltration as described (Castilho et al. 2010).
  • TSPs Total soluble proteins
  • H4-lgG1, 2, and 4 were purified by affinity chromatography using protein A (Protein A SepharoseTM Fast Flow, GE Healthcare), H4-lgG3 was purified using protein G (Protein G SepharoseTM Fast Flow, GE Healthcare).
  • Antibodies were eluted with 0.1 M Glycine/HCI (pH 2.5) and neutralized with 1 M Tris (pH 9). Purified antibodies were dialyzed overnight against PBS and yield was determined by spectrophotometer (NanoDropTM 2000, Thermo Scientific).
  • H4 IgG subtypes including H4lgG3 produced in N. benthamiana AXTFT and in N. benthamiana WT is given in Table 4.
  • the glycan analysis shows that H4lgG3 produced in N. benthamiana AXTFT show a homogenous glycosylation profile since 90% of the N-glycans are GnGn. No fucosylated N-glycans could be identified and only less than 10% of the N-glycans carry M8-9.
  • the H4lgG3 produced in N. benthamiana WT does not show GnGn N-glycans but MGnXF, M8-9, and GnGnXF.
  • H4lgG3 subjected to galactosylation and sialylation exhibited significant fraction of the respective N-glycans (Table 4).
  • Hinge length contributes to the phagocytic activity of HIV-specific lgG1 and lgG3 antibodies.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pulmonology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

La présente invention concerne un anticorps anti-SARS-CoV-2 recombinant ayant une puissance de neutralisation virale améliorée comprenant une région constante IgG3 et une région charnière avec un ou plusieurs glycanes modifiés. L'invention concerne également un acide nucléique codant pour l'anticorps anti-SARS-CoV-2, des cellules végétales exprimant les anticorps anti-SARS-CoV-2, un procédé de production d'anticorps anti-SARS-CoV-2, et une composition pharmaceutique comprenant un anticorps anti-SARS-CoV-2. L'invention concerne également l'utilisation d'un anticorps anti-SARS-CoV-2 pour détecter le SARS-CoV-2 dans un échantillon, l'utilisation pour la fabrication d'un médicament, et l'utilisation pour le traitement ou la prévention de maladies associées à des infections à coronavirus.
PCT/EP2022/070005 2021-07-19 2022-07-18 Anticorps igg3 anti-sars-cov-2 modifiés WO2023001736A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP21186354.3 2021-07-19
EP21186354 2021-07-19

Publications (1)

Publication Number Publication Date
WO2023001736A1 true WO2023001736A1 (fr) 2023-01-26

Family

ID=76971701

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2022/070005 WO2023001736A1 (fr) 2021-07-19 2022-07-18 Anticorps igg3 anti-sars-cov-2 modifiés

Country Status (1)

Country Link
WO (1) WO2023001736A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112094340A (zh) 2020-07-31 2020-12-18 王跃驹 植物作为宿主在表达新型冠状病毒肺炎中和抗体b38抗体和/或h4抗体中的应用
EP3872091A1 (fr) 2020-02-26 2021-09-01 VIR Biotechnology, Inc. Anticorps contre le sars-cov-2 et leurs procédés d'utilisation
WO2022162587A1 (fr) * 2021-01-27 2022-08-04 Centre Hospitalier Universitaire Vaudois (C.H.U.V.) Anticorps anti-sras-cov-2 et leur utilisation dans le traitement d'une infection par le sras-cov-2

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3872091A1 (fr) 2020-02-26 2021-09-01 VIR Biotechnology, Inc. Anticorps contre le sars-cov-2 et leurs procédés d'utilisation
CN112094340A (zh) 2020-07-31 2020-12-18 王跃驹 植物作为宿主在表达新型冠状病毒肺炎中和抗体b38抗体和/或h4抗体中的应用
WO2022162587A1 (fr) * 2021-01-27 2022-08-04 Centre Hospitalier Universitaire Vaudois (C.H.U.V.) Anticorps anti-sras-cov-2 et leur utilisation dans le traitement d'une infection par le sras-cov-2

Non-Patent Citations (37)

* Cited by examiner, † Cited by third party
Title
AMANAT F. ET AL.: "A serological assay to detect SARS-CoV-2 seroconversion in humans", NATURE MEDICINE, vol. 26, no. 7, 2020, pages 1033 - 1036, XP037191537, DOI: 10.1038/s41591-020-0913-5
ATYEO C. ET AL.: "Dissecting strategies to tune the therapeutic potential of SARS-CoV-2-specific monoclonal antibody CR3022", JCI INSIGHT, vol. 6, no. 1, 2021
CASTILHO A ET AL.: "In planta protein sialylation through overexpression of the respective mammalian pathway", J BIOL CHEM., vol. 285, no. 21, 2010, pages 15923 - 15930, XP055243683, DOI: 10.1074/jbc.M109.088401
CHU T. H. ET AL.: "Hinge length contributes to the phagocytic activity of HIV-specific IgG1 and IgG3 antibodies", PLOS PATHOGENS, vol. 16, no. 2, 2020, pages e1008083
DAMELANG, T. ET AL.: "Role of IgG3 in Infectious Diseases", TRENDS IN IMMUNOLOGY, vol. 40, no. 3, 2019, pages 197 - 211
DICKER M ET AL.: "Transient Glyco-Engineering to Produce Recombinant lgA1 with Defined N- and O-Glycans in Plants", FRONT PLANT SCI, vol. 7, 29 January 2016 (2016-01-29), pages 18
IIES JASON K ET AL: "Determination of IgG1 and IgG3 SARS-CoV-2 spike protein and nucleocapsid binding - Who is binding who and why?", MEDRXIV, 21 June 2021 (2021-06-21), XP055872959, Retrieved from the Internet <URL:https://www.medrxiv.org/content/10.1101/2021.06.17.21259077v2.full.pdf> [retrieved on 20211214], DOI: 10.1101/2021.06.17.21259077 *
KALLOLIMATH S. ET AL.: "Expression Profiling and Glycan Engineering of IgG Subclass 1-4 in Nicotiana benthamiana", FRONTIERS IN BIOENGINEERING AND BIOTECHNOLOGY, vol. 8, 2020, pages 825, XP055873686, DOI: 10.3389/fbioe.2020.00825
KALLOLIMATH S. ET AL.: "Highly active engineered IgG3 antibodies against SARS-CoV-2", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 118, 2021, pages 42
KALLOLIMATH SOMANATH ET AL: "Expression Profiling and Glycan Engineering of IgG Subclass 1-4 in Nicotiana benthamiana", FRONTIERS IN BIOENGINEERING AND BIOTECHNOLOGY, vol. 8, 24 July 2020 (2020-07-24), XP055873686, DOI: 10.3389/fbioe.2020.00825 *
KALLOLIMATH SOMANATH ET AL: "Highly active engineered IgG3 antibodies against SARS-CoV-2", vol. 118, no. 42, 1 October 2021 (2021-10-01), XP055872952, ISSN: 0027-8424, Retrieved from the Internet <URL:https://www.pnas.org/content/pnas/118/42/e2107249118.full.pdf> DOI: 10.1073/pnas.2107249118 *
KALLOLIMATH SOMANATH ET AL: "Supplementary Information for Highly active engineered IgG3 antibodies against SARS-CoV-2", 1 October 2021 (2021-10-01), XP055873611, Retrieved from the Internet <URL:https://www.pnas.org/content/pnas/suppl/2021/10/01/2107249118.DCSupplemental/pnas.2107249118.sapp.pdf> [retrieved on 20211216], DOI: 10.1073/pnas.2107249118 *
KALLOLIMATH SOMANATH ET AL: "Supplementary Material for Expression Profiling and Glycan Engineering of IgG Subclass 1-4 in Nicotiana benthamiana", FRONT. BIOENG. BIOTECHNOL., 24 July 2020 (2020-07-24), XP055873694, Retrieved from the Internet <URL:https://www.frontiersin.org/articles/10.3389/fbioe.2020.00825/full> [retrieved on 20211216], DOI: 10.3389/fbioe.2020.00825 *
KOBLISCHKE M. ET AL.: "Dynamics of CD4 T Cell and Antibody Responses in COVID-19 Patients With Different Disease Severity", FRONT MED (LAUSANNE), vol. 7, 2020, pages 592629
LARSEN M.D. ET AL.: "Afucosylated IgG characterizes enveloped viral responses and correlates with COVID-19 severity", SCIENCE, vol. 371, 2021, pages 6532
LARSEN MADS DELBO ET AL: "Afucosylated IgG characterizes enveloped viral responses and correlates with COVID-19 severity", vol. 371, no. 6532, 23 December 2020 (2020-12-23), US, XP055873640, ISSN: 0036-8075, Retrieved from the Internet <URL:https://www.science.org/doi/10.1126/science.abc8378> DOI: 10.1126/science.abc8378 *
LIU L. ET AL.: "Anti-spike IgG causes severe acute lung injury by skewing macrophage responses during acute SARS-CoV infection", JCI INSIGHT, vol. 4, 2019, pages 4
LLES J. K. ET AL.: "Determination of IgG1 and IgG3 SARS-CoV-2 spike protein and nucleocapsid binding - Who Is binding who and why?", MEDRXIV, 2021
LOOS A. ET AL.: "Expression and glycoengineering of functionally active heteromultimeric IgM in plants", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 111, no. 17, 2014, pages 6263 - 6268
MARILLONNET, S. ET AL.: "Systemic Agrobacterium tumefaciens-mediated transfection of viral replicons for efficient transient expression in plants", NATURE BIOTECHNOLOGY, vol. 23, no. 6, 2005, pages 718 - 723, XP002407902, DOI: 10.1038/nbt1094
MORRISON, S.L. ET AL.: "Chimeric human antibody molecules: mouse antigen-binding domains with human constant region domains", PROC. NATL. ACAD. SCI., vol. 81, 1984, pages 6851 - 6855, XP002014405, DOI: 10.1073/pnas.81.21.6851
MURPHYWEAVER: "Janeway's Immunobiology", 2017, JONES & BARTLETT LEARNING
OU, X.LIU, Y.LEI, X. ET AL.: "Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV", NAT COMMUN, vol. 11, 2020, pages 1620, Retrieved from the Internet <URL:https://doi.org/10.1038/s41467-020-15562-9>
PLOMP R. ET AL.: "Hinge-Region O-Glycosylation of Human Immunoglobulin G3 (lgG3", MOLECULAR & CELLULAR PROTEOMICS, vol. 14, no. 5, 2015, pages 1373 - 1384, XP055873438, DOI: 10.1074/mcp.M114.047381
PLOMP ROSINA ET AL: "Hinge-Region O-Glycosylation of Human Immunoglobulin G3 (IgG3)", MOLECULAR & CELLULAR PROTEOMICS, vol. 14, no. 5, 1 May 2015 (2015-05-01), US, pages 1373 - 1384, XP055873438, ISSN: 1535-9476, DOI: 10.1074/mcp.M114.047381 *
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", vol. 1 -3, 2012, COLD SPRING HARBOR LABORATORY PRESS
STAPLETON, N.ANDERSEN, J.STEMERDING, A. ET AL.: "Competition for FcRn-mediated transport gives rise to short half-life of human IgG3 and offers therapeutic potential", NAT COMMUN, vol. 2, 2011, pages 599, Retrieved from the Internet <URL:https://doi.org/10.1038/ncomms1608>
STAVENHAGEN KATHRIN ET AL: "Site-Specific Protein N- and O-Glycosylation Analysis by a C18-Porous Graphitized Carbon-Liquid Chromatography-Electrospray Ionization Mass Spectrometry Approach Using Pronase Treated Glycopeptides", ANALYTICAL CHEMISTRY, vol. 87, no. 23, 4 November 2015 (2015-11-04), US, pages 11691 - 11699, XP055975293, ISSN: 0003-2700, Retrieved from the Internet <URL:https://pubs.acs.org/doi/full/10.1021/acs.analchem.5b02366> DOI: 10.1021/acs.analchem.5b02366 *
STRASSER R. ET AL.: "Generation of glyco-engineered Nicotiana benthamiana for the production of monoclonal antibodies with a homogeneous human-like N-glycan structure", PLANT BIOTECHNOL J, vol. 6, no. 4, 2008, pages 392 - 402, XP009104007, DOI: 10.1111/j.1467-7652.2008.00330.x
STRASSER R.: "Plant protein glycosylation", GLYCOBIOLOGY., vol. 26, no. 9, 2016, pages 926 - 939
STRASSER R: "Biological significance of complex N-glycans in plants and their impact on plant physiology", FRONT PLANT SCI, vol. 5, 22 July 2014 (2014-07-22), pages 363
TAYLOR, P.C.ADAMS, A.C.HUFFORD, M.M. ET AL.: "Neutralizing monoclonal antibodies for treatment of COVID-19", NAT REV IMMUNOL, vol. 21, 2021, pages 382 - 393, XP037470979, Retrieved from the Internet <URL:https://doi.org/10.1038/s41577-021-00542-x> DOI: 10.1038/s41577-021-00542-x
WU Y. ET AL.: "A noncompeting pair of human neutralizing antibodies block COVID-19 virus binding to its receptor ACE2", SCIENCE, vol. 368, no. 6496, 2020, pages 1274 - 1278, XP055799109, DOI: 10.1126/science.abc2241
WU YAN ET AL: "Supplementary Material - A noncompeting pair of human neutralizing antibodies block COVID-19 virus binding to its receptor ACE2", SCIENCE, vol. 368, no. 6496, 13 May 2020 (2020-05-13), US, pages 1274 - 1278, XP055799109, ISSN: 0036-8075, Retrieved from the Internet <URL:https://science.sciencemag.org/highwire/filestream/744452/field_highwire_adjunct_files/1/abc2241_Wu_SM.pdf> DOI: 10.1126/science.abc2241 *
YAN WU ET AL: "A noncompeting pair of human neutralizing antibodies block COVID-19 virus binding to its receptor ACE2", SCIENCE (AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE), 13 May 2020 (2020-05-13), United States, pages 1274 - 1278, XP055758869, Retrieved from the Internet <URL:https://science.sciencemag.org/content/sci/368/6496/1274.full.pdf> DOI: 10.1126/science.abc2241 *
YATES JENNIFER L. ET AL: "Serological analysis reveals an imbalanced IgG subclass composition associated with COVID-19 disease severity", CELL REPORTS MEDICINE, vol. 2, no. 7, 14 June 2021 (2021-06-14), pages 100329, XP055872963, ISSN: 2666-3791, DOI: 10.1016/j.xcrm.2021.100329 *
YATES JL. ET AL.: "Serological Analysis Reveals an Imbalanced IgG Subclass Composition Associated with COVID-19 Disease Severity", MEDRXIV, Retrieved from the Internet <URL:https://doi.org/10.1101/2020.10.07.20208603>

Similar Documents

Publication Publication Date Title
US20210101961A1 (en) Polypeptides With Enhanced Anti-Inflammatory And Decreased Cytotoxic Properties And Relating Methods
US20220162290A1 (en) Polypeptides With Enhanced Anti-Inflammatory And Decreased Cytotoxic Properties And Relating Methods
KR101565949B1 (ko) 당­조작 항체
US20160215061A1 (en) Fc CONTAINING POLYPEPTIDES HAVING INCREASED BINDING TO FcGammaRIIB
AU2005289594B2 (en) Srage mimetibody, compositions, methods and uses
US20090004179A1 (en) Polypeptides with enhanced anti-inflammatory and decreased cytotoxic properties and relating methods
Stelter et al. Engineering the interactions between a plant‐produced HIV antibody and human Fc receptors
Vattepu et al. Sialylation as an important regulator of antibody function
JP2011506476A (ja) 抗炎症性が促進しかつ細胞毒性が低減したポリペプチドおよび関連する方法
JP2014532661A (ja) 改善された特性を有する抗体を調製するための方法
EP2768845B1 (fr) Procédé de séparation d&#39;anticorps fucosylés
EP2091969A2 (fr) Polypeptides ayant des proprietes antiinflammatoires accrues et cytotoxiques reduites et procedes associes
JP6965350B2 (ja) 糖タンパク質再構築のためのエンドグリコシダーゼ変異体及びその使用方法
US20200062861A1 (en) Glycosynthase variants for glycoprotein engineering and methods of use
WO2019234021A1 (fr) Anticorps monoclonal glycomodifié
US20170260254A1 (en) Method for producing variants having an fc with improved sialylation
CA2934656A1 (fr) Procede pour la production in vivo de proteines recombinantes deglycosylees utilisees en tant que substrat pour le glyco-remodelage de proteines en aval
Göritzer et al. Efficient N-glycosylation of the heavy chain tailpiece promotes the formation of plant-produced dimeric IgA
US11674125B2 (en) Glycoengineering
WO2015073307A2 (fr) Polypeptides contenant fc et présentant une liaison améliorée à dc-sign humaine
WO2023001736A1 (fr) Anticorps igg3 anti-sars-cov-2 modifiés
JP2010512306A (ja) 抗炎症特性が増強され、細胞毒性特性が減少したポリペプチドおよび関連する方法
US20240174988A1 (en) Glycoengineering
WO2023246691A1 (fr) Anticorps contre le virus de l&#39;hépatite b, sa préparation et son utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22751361

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE