WO2023001259A1 - Preparation and application of recombinant multivalent novel coronavirus trimer protein vaccine capable of inducing broad-spectrum and neutralizing activity - Google Patents

Abstract

A recombinant multivalent novel coronavirus trimer protein vaccine capable of inducing broad-spectrum and neutralizing activity. The recombinant protein component comprises, but is not limited to, a homotrimer protein formed by introducing, into an extracellular domain (ECD) of B.1.617.1 strain and B.1.617.2 strain spike (S) proteins, a mutation site and a trimerization assistance structure. The multivalent vaccine comprises an ECD trimer protein of a single component or any combination of components of the variant strains above, and a pharmaceutically acceptable adjuvant. The vaccine combination shows excellent immunogenicity in mice, and can maintain long-term humoral immunity and cellular immunity. The multivalent novel coronavirus trimer protein vaccine can be used for preventing infection-related diseases caused by infection of novel coronavirus and variant strains thereof.

Description

Preparation and application of a recombinant polyvalent new coronavirus trimeric protein vaccine capable of inducing broad-spectrum neutralization activity

Cross References to Related Applications

This application claims the benefit of Chinese patent application 202110838359.6 filed on July 23, 2021, the contents of which are incorporated herein by reference.

technical field

The invention relates to the field of molecular vaccinology, and relates to the preparation and application of a recombinant polyvalent new coronavirus trimer protein vaccine capable of inducing broad-spectrum neutralization activity.

Background technique

The new coronavirus (SARS-CoV-2) has a strong ability to spread, and a safe and effective vaccine is the most powerful technical means to control the epidemic. According to different targets and technologies, vaccines can be divided into the following categories: inactivated vaccines, recombinant protein vaccines, viral vector vaccines, RNA vaccines, live attenuated vaccines, and virus-like particle vaccines. Since the SARS-CoV-2 pandemic, countries have developed more than 200 new crown vaccines. As of July 18, 2021, 16 vaccines have been approved for use or conditional use, and another 92 vaccines have entered clinical research (https://www.covid-19vaccinetracker.org/#protein-subunit).

SARS-CoV-2 and SARS-CoV share a common host cell receptor protein, angiotensin-converting enzyme 2 (ACE2) (Zhou,P.,et al.,Discovery of a novel coronavirus associated with the recent pneumonia outbreak in humans and its potential bat origin. BioRxiv, 2020.). The trimeric spike protein (Spike) of the virus binds to the ACE2 receptor and is cleaved by the host protease into the S1 polypeptide containing the receptor binding domain (RBD) and the S2 polypeptide (Hoffmann , M., et al., SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell, 2020.). The S protein is the main component of the viral envelope and plays an important role in receptor binding, fusion, virus entry and host immune defense. The RBD region of the S protein contains major neutralizing antibody epitopes, which can stimulate B cells to produce high-titer neutralizing antibodies against RBD. In addition, the S protein also contains abundant T cell epitopes, which can induce specific CTL responses in T cells and clear virus-infected cells. Therefore, the S protein is the most critical antigen for the design of the new crown vaccine. The vast majority of vaccines currently designed have selected S protein or RBD domain protein as the core immunogen.

SARS-CoV-2 is an RNA single-stranded virus, which is prone to deletion mutations, and such mutations mostly occur in the recurrent deletion regions (RDRs) of the S protein. Deletion or mutation may change the conformation of the S protein, so that the antibodies induced by the previous vaccine immunization reduce the binding and neutralization of the mutant S protein, resulting in the decline of the immune effect of the vaccine and the immune escape of the virus. The early D614G mutation (B.1) enhanced the affinity of the S protein to the ACE2 receptor and quickly became a popular strain, but the mutation did not reduce the sensitivity to neutralizing antibodies (Korber, B., et al., Spike Mutation pipeline reveals the emergence of a more transmissible form of SARS-CoV-2.bioRxiv,2020:p.2020.04.29.069054; Korber,B.,et al.,Tracking Changes in SARS-CoV-2 Spike:Evidence that D614G Increases Infectivity of the COVID-19 Virus. Cell, 2020.182(4): p.812-827.e19.). However, with the pandemic of SARS-CoV-2, four high-concern variants (Variants of Concern, VOC) have emerged in the world: Alpha (B.1.1.7), Beta (B.1.351), Gamma (P. 1) and Delta (B.1.617.2) and a variety of Variants of Interest (VOI): Eta (B.1.525), Iota (B.1.526), Kappa (B.1.617.1) and Lambda (C.37). Studies have shown that these high-risk strains can increase transmissibility, exacerbate disease progression (increased hospitalization or mortality), severely reduce antibody neutralization from prior infection or immunization, reduce efficacy of treatment or vaccines, or render diagnostic testing ineffective ( https://www.cdc.gov/coronavirus/2019-ncov/cases-updates/variant-surveillance/variant-info.html ) . Alpha (B.1.1.7) spreads rapidly and can increase the risk of death by 61% (Davies, NG, et al., Increased mortality in community-tested cases of SARS-CoV-2 lineage B.1.1.7. Nature, 2021.). The results of the neutralization effect study showed that the neutralization ability of the plasma of convalescents or the serum of vaccine immunized persons to the Alpha (B.1.1.7) strain remained basically unchanged, but the neutralization ability to the Beta (B.1.351) strain was greatly reduced (Cele, S., et al., Escape of SARS-CoV-2 501Y.V2 from neutralization by convalescent plasma. 2021.; Zhou, D., et al., Evidence of escape of SARS-CoV-2 variant B. 1.351 from natural and vaccine-induced sera. Cell, 2021.; Tada, T., 2021. https://doi.org/10.1101/2021.02.05.430003 ; Wang, P., et al., Increased Resistance of SARS-CoV -2 Variants B.1.351 and B.1.1.7 to Antibody Neutralization. bioRxiv, 2021.; Wadman, M. and J. Cohen, 2021. https://doi.org/10.1136/bmj.n296; Wu, K. , et al., mRNA-1273 vaccine induces neutralizing antibodies against spike mutants from global SARS-CoV-2 variants. 2021.). Clinical results also show that the Alpha (B.1.1.7) strain has little effect on the protective effect of the vaccine, while the Beta (B.1.351) strain will greatly reduce the protective effect on mild disease (Madhi, SA, et al., Efficacy of the ChAdOx1 nCoV-19 Covid-19 Vaccine against the B.1.351 Variant. 2021.; Shinde, V., et al., Efficacy of NVX-CoV2373 Covid-19 Vaccine against the B.1.351 Variant. New England Journal of Medicine, 2021.; Abu-Raddad, LJ, H. Chemaitelly, and AA Butt, Effectiveness of the BNT162b2 Covid-19 Vaccine against the B.1.1.7 and B.1.351 Variants. 2021.; Karim, SSA, Vaccines and SARS- CoV-2 variants: the urgent need for a correlate of protection. Lancet, 2021.397(10281): p.1263-1264.). Compared with the original virus and early mutant strains, the Delta (B.1.617.2) strain mutation has stronger transmission power, shorter incubation period, and rapid disease progression. It has spread to more than 90 countries or regions and has become a global epidemic strain. . A preliminary study by the Israeli Ministry of Health showed that Delta not only has strong transmissibility, but also seriously weakens the vaccine's effect. The effective rate of preventing the Delta variant strain from 94% to 64% for fully vaccinated BioNTech & Pfizer mRNA vaccines. The current vaccines are all designed based on the sequence of early epidemic strains (genome sequence: GenBank Accession No.NC_045512). In view of the high transmissibility of mutant strains and the adverse impact on the protective effect of existing vaccines, there is an urgent need for high-risk mutant strains. A second-generation vaccine with broad-spectrum and high protective effect.

Contents of the invention

Based on the above requirements for vaccines with high protective effect on novel coronavirus SARS-CoV-2 mutant strains, the present invention provides a method for improving the ECD antigen immunogenicity/antigen trimer stability of SARS-CoV-2 mutant strains , the method is by constructing an ECD antigen comprising the amino acid sequence shown in SEQ ID No: 8 or SEQ ID No: 12 or its immunogenic fragment and/or immunogenic variant, so that the ECD is a three-dimensional stable prefusion conformation aggregate form.

In one embodiment, the mutant strain is a high-risk mutant strain containing at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, and P681R.

In one embodiment, the strains include B.1 strain, B.1.351 strain, B.1.1.7 strain, P.1 strain, B.1.427 strain, B.1.429 strain, B. . At least one of the 1.617.1 strain and the B.1.617.2 strain.

In one embodiment, wherein the ECD antigen and one or more adjuvants selected from the following are co-administered to the subject: aluminum adjuvant, oil-emulsion adjuvant, Toll-like receptor (TLR) agonist, immune enhancer Combination of microbial adjuvant, propolis adjuvant, levamisole adjuvant, liposome adjuvant, traditional Chinese medicine adjuvant and small peptide adjuvant; preferably, the oil emulsion adjuvant contains squalene; Toll-like receptor A (TLR) agonist comprising CpG or monophosphoryl lipid A (MPL) adsorbed on an aluminum salt; and a combination of immunopotentiators comprising QS-21 and/or MPL.

The present invention also provides a method for improving the immunogenicity/antigen trimer stability of the ECD antigen of the high-risk mutant strain of SARS-CoV-2, the method comprising SEQ ID No:8 or SEQ ID No:12 by constructing the method Polynucleotides of at least any one of the amino acid sequences or immunogenic fragments and/or immunogenic variants thereof, so as to express the trimer form ECD in a stable prefusion conformation.

In one embodiment, the mutant strain is a high-risk mutant strain containing at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, and P681R.

In one embodiment, the mutant strains include B.1 strain, B.1.351 strain, B.1.1.7 strain, P.1 strain, B.1.427 strain, B.1.429 strain, At least one of the B.1.617.1 strain and the B.1.617.2 strain.

The present invention provides a SARS-CoV-2 mutant strain ECD immunogenic protein/peptide with improved immunogenicity/antigen trimer stability, said immunogenic protein/peptide comprising SEQ ID No: 8 or SEQ ID No: At least any amino acid sequence shown in No. 12, or its immunogenic fragment and/or immunogenic variant, the ECD immunogenic protein/peptide is in the form of a trimer in a stable prefusion conformation.

In one embodiment, the mutant strain is a high-risk mutant strain containing at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, and P681R.

In one embodiment, the strains include B.1 strain, B.1.351 strain, B.1.1.7 strain, P.1 strain, B.1.427 strain, B.1.429 strain, B. . At least one of the 1.617.1 strain and the B.1.617.2 strain.

The present invention also provides a polynucleotide encoding the ECD immunogenic protein/peptide of the SARS-CoV-2 mutant strain with improved immunogenicity/antigen trimer stability as described above; preferably, the polynucleotide comprises The nucleotide sequence shown in SEQ ID No:7 or SEQ ID No:11.

The present invention provides an immunogenic composition comprising a. at least one immunogenic protein/peptide as described above or an immunogenic fragment and/or immunogenic variant thereof, or at least one polynucleotide encoding an immunogenic protein/peptide with increased immunogenicity/antigen trimer stability as described above, and

b. Any one or a combination of at least two of pharmaceutically acceptable carriers, excipients or diluents;

Optionally, the immunogenic composition comprises c. an adjuvant.

Further, the present invention provides an immunogenic composition comprising an immunogenic protein/peptide or an immune fragment thereof selected from any group of a), b) or c) and/or immunogenic variants,

a. Immunogenic proteins/peptides of the amino acid sequences shown in SEQ ID No:16, SEQ ID No:20 and SEQ ID No:8 or immune fragments and/or immunogenic variants thereof;

b. Immunogenic proteins/peptides of the amino acid sequences shown in SEQ ID No: 16, SEQ ID No: 20 and SEQ ID No: 12 or immune fragments and/or immunogenic variants thereof; or

c. Immunogenic proteins/peptides of the amino acid sequences shown in SEQ ID No: 16, SEQ ID No: 20, SEQ ID No: 8 and SEQ ID No: 12 or immune fragments and/or immunogenic variants thereof.

Further, the adjuvant is one or more selected from the following: aluminum adjuvant, oil emulsion adjuvant, Toll-like receptor (TLR) agonist, combination of immune enhancer, microbial adjuvant, propolis Adjuvants, levamisole adjuvants, liposome adjuvants, traditional Chinese medicine adjuvants and small peptide adjuvants;

Preferably, the oil-emulsion adjuvant comprises squalene; the Toll-like receptor (TLR) agonist comprises CpG or monophosphoryl lipid A (MPL) adsorbed on an aluminum salt; and the combination of immunopotentiators comprises QS- 21 and/or MPL.

The present invention also provides the immunogenic protein/peptide as described above, polynucleotides encoding the immunogenic protein/peptide as described above and/or comprising the immunogenic protein/peptide as described above or encoding the immunogenic protein/peptide as described above The application of the immunogenic composition of the polynucleotide of the original protein/peptide to the prevention or treatment of the disease caused by the mutant strain of SARS-CoV-2.

At the same time, the present invention also provides the above-mentioned immunogenic protein/peptide, polynucleotide encoding the above-mentioned immunogenic protein/peptide and/or comprising the above-mentioned immunogenic protein/peptide or encoding the polynucleotide The use of the immunogenic composition of the polynucleotide of the immunogenic protein/peptide in the preparation of vaccines or medicines for preventing or treating diseases caused by mutant strains of SARS-CoV-2.

Description of drawings

Figure 1 is a schematic diagram of the primary structure (A) and high-order structure (B, refer to PDB:6XLR) of the modified S-ECD.

Fig. 2 is the purity analysis of SCTV01C-TM28 trimer, wherein (A) non-reducing SDS-PAGE representative spectrum; (B) SEC-HPLC representative spectrum.

Figure 3 shows the detection of serum antibody titers (GeoMean±SD) after SCTV01C-TM27, SCTV01C-TM28 monovalent and multivalent vaccines immunized C57BL/6 mice.

Figure 4 shows the serum neutralization titer detection (GeoMean±SD) after SCTV01C-TM27, SCTV01C-TM28 monovalent and multivalent vaccines immunized C57BL/6 mice.

detailed description

definition

Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this invention belongs. For the purposes of the present invention, the following terms are further defined.

As used herein and in the appended claims, the singular forms "a," "an," "another," and "the" include plural referents unless the context clearly dictates otherwise.

The term "comprising", "comprising" refers to the inclusion of specific components without excluding any other components. Terms such as "consisting essentially of" allow for the inclusion of other ingredients or steps that do not impair the novel or essential characteristics of the invention, ie they exclude other unrecited ingredients or steps that impair the novel or essential characteristics of the invention. The term "consisting of" means the inclusion of a specific ingredient or group of ingredients and the exclusion of all other ingredients.

The term "antigen" refers to a foreign substance that is recognized (specifically bound) by antibodies or T cell receptors, but which does not definitively induce an immune response. Exogenous substances that induce specific immunity are called "immunizing antigens" or "immunogens". By "hapten" is meant an antigen that by itself does not elicit an immune response (although a combination of several molecules of the hapten, or a combination of a hapten and a macromolecular carrier may elicit an immune response).

A "humoral immune response" is an antibody-mediated immune response and involves the introduction and production of antibodies that recognize and bind with affinity to the antigen in the immunogenic composition of the invention, a "cell-mediated immune response" is composed of T cells and and/or other white blood cell-mediated immune responses. A "cell-mediated immune response" is induced by presenting an antigenic epitope associated with a major histocompatibility complex (MHC) class I or class II molecule, CD1 or other atypical MHC-like molecule.

The term "immunogenic composition" refers to any pharmaceutical composition containing an antigen, such as a microorganism or a component thereof, which is useful for eliciting an immune response in an individual.

As used herein, "immunogenicity" means that an antigen (or an epitope of an antigen) such as the coronavirus spike protein receptor binding region or an immunogenic composition induces humoral or cell-mediated immune response, or both.

A "protective" immune response refers to the ability of an immunogenic composition to elicit a humoral or cell-mediated immune response, or both, to protect an individual from infection. The protection conferred need not be absolute, i.e., the infection need not be completely prevented or eradicated, so long as there is a statistically significant improvement relative to a control population of individuals (e.g., infected animals not administered the vaccine or immunogenic composition) . Protection may be limited to moderation of severity or rapidity of onset of symptoms of infection.

Both "immunogenic amount" and "immunologically effective amount" are used interchangeably herein to refer to an antigen or immunogenic composition sufficient to elicit an immune response (cellular (T cell) or humoral (B cell or antibody) response or both. or, as measured by standard assays known to those skilled in the art).

The effectiveness of an antigen as an immunogen can be measured, for example, by a proliferation assay, by a cell lysis assay, or by measuring the level of B cell activity.

The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of contiguous amino acid residues.

The terms "nucleic acid", "nucleotide" and "polynucleotide" are used interchangeably to refer to RNA, DNA, cDNA or cRNA and derivatives thereof, such as those containing modified backbones. It is to be understood that the invention provides polynucleotides comprising sequences that are complementary to the sequences described herein. A "polynucleotide" contemplated in the present invention includes the forward strand (5' to 3') and the reverse complementary strand (3' to 5'). The polynucleotides according to the invention can be prepared in different ways (e.g. by chemical synthesis, by gene cloning, etc.) and can take various forms (e.g. linear or branched, single or double stranded, or hybrids thereof , primers, probes, etc.).

The term "immunogenic protein/peptide" includes a polypeptide that is immunologically active in the sense that it is capable of eliciting a humoral and/or cell-type immune response against the protein once administered to a host. Thus, a protein fragment according to the invention comprises or consists essentially of or consists of at least one epitope or antigenic determinant. As used herein, an "immunogenic" protein or polypeptide includes the full-length sequence of the protein, an analog thereof, or an immunogenic fragment thereof. "Immunogenic fragment" refers to a fragment of a protein that contains one or more epitopes that elicit an immune response as described above.

The term "immunogenic protein/peptide" also covers deletions, additions and substitutions to sequences so long as the polypeptide functions to generate an immune response as defined herein, ie "immunogenic variants".

The SCTV01C recombinant protein vaccine provided by the present invention is transformed based on the extracellular domain (ECD, including S1 and S2 parts) of the SARS-CoV-2 spike protein. The known natural spike protein of SARS-CoV-2 has a trimeric structure. During its production and infection function, the completion of the membrane fusion process is easily detected by the RRAR site between S1 and S2. Proteases in the Golgi apparatus and on the cell surface cut open, and then S1 falls off, and the S2 structure changes from a prefusion conformation to a postfusion conformation, thereby completing membrane fusion (Cai, Y., J. Zhang, and T. Xiao, Distinct conformational states of SARS-CoV-2 spike protein. 2020.369(6511): p.1586-1592.).

In order to obtain the ECD trimer of stable prefusion conformation, the present invention carried out the following three-part transformation on the basis of the S protein of different strain variants (see Table 1):

1) It has been found that antibodies with higher neutralizing activity all bind to the S1 region (specifically, bind to the NTD and RBD regions in S1). Keeping the integrity of the S1 part is crucial for the production of neutralizing antibodies induced by the new crown vaccine. In the present invention, the Furin site is modified and removed in the SCTV01C recombinant protein vaccine, that is, the amino acid sequence at positions 679 to 688 is fixed as NSPGSASSVA, so as to reduce the possibility of S1 breaking and falling off.

2) Due to the allosteric tendency of S2 itself, the prefusion conformation of the spike protein is unstable, and the effective induction of neutralizing antibodies requires a stable prefusion conformation, which has been confirmed in RSV and HIV-1 vaccine studies (McLellan, J.S. , et al., Structure-based design of a fusion glycoprotein vaccine for respiratory syncytial virus. Science, 2013.342(6158): p.592-8.; Frey, G., et al., Distinct conformational states of HIV-1 gp41 are recognized by neutralizing and non-neutralizing antibodies. Nat Struct Mol Biol, 2010.17(12): p.1486-91.). Among the currently marketed vaccines, the S-2P (i.e. mutating amino acids at positions 986 and 987 to proline) is commonly used (Tian, J.H., et al., SARS-CoV-2 spike glycoprotein vaccine candidate NVX-CoV2373 immunogenicity in baboons and protection in mice.2021.12(1):p.372.; Mercado,N.B.,et al.,Single-shot Ad26 vaccine protects against SARS-CoV-2 in rhesus macaques.2020.586(7830):p.583-588 .; Corbett, K.S., et al., SARS-CoV-2 mRNA Vaccine Development Enabled by Prototype Pathogen Preparedness. bioRxiv, 2020.). In addition, the present invention also introduces a HexaPro mutation that can effectively improve the stability without affecting its three-dimensional structure (that is, in addition to the S-2P mutation, the amino acids at positions 817, 892, 899 and 942 are mutated into proline) (Hsieh, C.L., et al., Structure-based Design of Prefusion-stabilized SARS-CoV-2 Spikes. bioRxiv, 2020.). These mutation sites are all located at the N-terminus or Loop region of the α-helix in S2. After mutation to the proline (P) type with this secondary structure tendency, it can effectively reduce the allosteric tendency of S2 and stabilize the prefusion of S2 Conformation.

3) Finally, in order to further stabilize the S-ECD trimer structure, the present invention added a trimerization module T4foldon to the C-terminus of the vaccine molecule. This module is derived from the C-terminal domain of fibrin of T4 phage and has 27 amino acids. T4foldon has been used in RSV candidate vaccines, and has been shown to be safe in Phase I clinical studies (Crank, M.C., A proof of concept for structure-based vaccine design targeting RSV in humans. 2019.365(6452): p. 505-509.).

After using the recombinant S-ECD trimer protein antigen recombined into the expression vector after the above modification, and performing routine purity and stability analysis on the expressed recombinant S-ECD trimer protein, a corresponding vaccine is prepared, namely Kappa (B.1.617.1) strain SCTV01C-TM27 vaccine and Delta (B.1.617.2) strain SCTV01C-TM28 vaccine.

Table 1 Molecular structure design and transformation of SCTV01C-TM27 and SCTV01C-TM28 vaccines

Table 2 S protein mutations of SARS-CoV-2 variant strains related to the present invention

Pango pedigree	WHO label	S protein mutations of interest
B.1	the	D614G
B.1.351*	Beta	K417N, E484K, N501Y
B.1.1.7*	Alpha	N501Y
P.1*	Gamma	K417T, E484K, N501Y
B.1.617.2*	Delta	L452R, T478K, P681R**

B.1.427/B.1.429*	Epsilon	L452R
B.1.617.1*	Kappa	L452R, E484Q

*https://www.who.int/en/activities/tracking-SARS-CoV-2-variants

**https://doi.org/10.1016/j.celrep.2022.110829

The ECD trimer immunogenic protein/peptide of the present invention shows excellent immunogenicity in mice, and can maintain long-term humoral immunity and cellular immune response.

Use prepared Kappa virus strain SCTV01C-TM27, Delta virus strain SCTV01C-TM28, Alpha virus strain SCTV01C-TM22 and Beta virus strain SCTV01C-TM23 vaccines to immunize mice and carry out immunological assay all show these two kinds of vaccines prepared by the present invention Can induce high-titer antibody immune response in experimental animals; SCTV01C-TM22+SCTV01C-TM23 bivalent vaccine can induce dose-related immune response, add TM27 or TM28 trivalent vaccine on the basis of TM22+TM23 bivalent vaccine or Quadrivalent vaccines have similar or slightly higher neutralizing titers than monovalent or bivalent vaccines at the same dose, indicating that all components in trivalent or quadrivalent vaccines are immunogenic. The TM22+TM23+TM28 trivalent vaccine and TM22+TM23+TM27+TM28 of the present invention have higher and similar neutralizing titers to different strains, indicating that these two multivalent vaccines have better inducing broad-spectrum and antibody capacity.

Example

Example 1: Design of Trimeric Protein Antigen, Construction of Expression Vector and Protein Production of New Coronavirus Recombinant Spike Protein Extracellular Domain (S-ECD)

1.1 Construction of S-ECD trimer protein (SCTV01C-TM27) expression vector based on Kappa strain (B.1.617.1) sequence (EPI_ISL_1704611)

SCTV01C-TM27 contains a 3708bp gene fragment, and the SCTV01C-TM27 gene fragment was obtained from the amplification of the template pD2535nt-CoV2-S-ECDTM8-T4F-trimer by PCR splicing. The expression vector of pXC-CoV2-S-ECDTM27-T4F-trimer was constructed by the In-fusion method into the pXC-17.5 stable strain expression vector digested with Hind III+EcoR I.

Amplification primer

1.2 Construction of S-ECD trimer protein (SCTV01C-TM28) expression vector based on Delta strain (B.1.617.2) sequence (EPI_ISL_1999775)

SCTV01C-TM28 contains a 3702bp gene fragment, amplified from templates pCMV3-CoV2-B.1.617.2, pD2535nt-CoV2-S-ECDTM8-T4F-trimer, pD2535nt-CoV2-S-ECDTM28-T4F-trimer by PCR splicing The SCTV01C-TM28 gene fragment was obtained. The expression vector of pXC-CoV2-S-ECDTM28-T4F-trimer was constructed by the In-fusion method into the pXC-17.5 stable strain expression vector digested with Hind III+EcoR I.

Amplification primer

F8 (SEQ ID NO: 35)	ACTAAAAGCCAAAGCCGCCACCATGTTTGTGTTCCTGGTGCTGCTG
R8 (SEQ ID NO: 36)	GTTGGTCTGGGTCTGGTAGGAGG
F9 (SEQ ID NO: 37)	CCTCCTACCAGACCCAGACCAAC
R9 (SEQ ID NO: 38)	GTCAGAGCCCTGTTAAGTTGGGTACA
F10 (SEQ ID NO: 39)	TGTACCCAACTTAACAGGGCTCTGAC
R6 (SEQ ID NO: 32)	GATGTCTAGTGGAGGCGCGCCTTTACAGGAAGGTGCTCAGCAGC
F7 (SEQ ID NO: 33)	GTCACCGTCCTTGACACGAAGCTTGCCGCCACCATGTTTGTGTTCCTGGTGCTGCTG
R7 (SEQ ID NO: 34)	TGGCTGATTATGATCAATGAATTCTTTACAGGAAGGTGCTCAGCAGC

1.3 Expression and purification of S-ECD trimeric protein

The target gene constructed above was chemically transferred into HEK-293 cells (source: Invitrogen), cultured and expressed for 7 days, and the culture supernatant was obtained by centrifugation and filtration. The culture supernatant was first captured by cation exchange chromatography (POROS XS, Thermo) and eluted with high-salt buffer; then anion chromatography (NanoGel-50Q, Nano Micro) combined mode and mixed anion chromatography (Diamond MIX -A, Burgeron) flow-through mode for further purification to remove impurities related to products and processes. S-ECD trimer expression level >60mg/L.

Example 2: Analysis of the purity and stability of the trimer protein of the new coronavirus recombinant spike protein extracellular domain (S-ECD)

2.1 Purity analysis of recombinant S-ECD trimer protein

Put the above purified recombinant S-ECD trimer protein stock solution in buffer containing 20mM Tris, 35mM NaCl, pH7.0-7.5, the concentration is about 1.0mg/mL, and use sodium dodecylsulfonate-polyacrylamide Gel electrophoresis (SDS polyacrylamide gel electrophoresis, SDS-PAGE) analysis of primary structure purity and size-exclusion high performance liquid chromatography (size-exclusion high performance liquid chromatography, SEC-HPLC) analysis of its trimer content, application of dynamic light scattering (dynamic light scattering, DLS) to detect its morphological characteristics.

SDS-PAGE specific operation steps: (1) Preparation of SDS-PAGE gel: 3.9% stacking gel, 7.5% separating gel; (2) Boil the sample at 100°C for 2 minutes, load 8 μg of sample after centrifugation; (3) Decolorize after Coomassie brilliant blue staining . SEC-HPLC operation step is: (1) instrument: liquid chromatography system (Agilent company, model: Agilent1260), water-soluble size exclusion chromatographic column (Sepax company, model: SRT-C SEC-500 chromatographic column); (2 ) Mobile phase: 200mM NaH ₂ PO ₄ , 100mM Arginine, pH 6.5, 0.01% isopropanol (IPA); (3) Loading amount is 80μg; (3) Detection wavelength is 280nM, analysis time is 35min, flow rate is 0.15mL /min.

The specific operation steps of DLS: (1) Instrument: Dynamic Light Scattering Instrument (Wyatt Technology Company, model: DynaPro NanoStar); (2) The sample volume is 50 μL; (3) After collecting the data, use Dynamics 7.1.8 software to analyze the data.

The recombinant SCTV01C-TM27 and SCTV01C-TM28 proteins are homotrimeric structures due to their non-covalent hydrophobic interactions. After non-reducing SDS-PAGE treatment, it becomes a monomer molecule with a molecular weight of about 148KDa (Figure 2), with a purity of 89.3% and 91.0%; The proportion content is all lower than 5%, and the average molecular weight of the main peak is 530KDa. Figure 2 is a representative test result of SCTV01C-TM28. The dynamic light scattering results showed that the average molecular radii of the recombinant SCTV01C-TM27 and SCTV01C-TM28 trimer proteins were 10.2 nm and 9.2 nm, respectively (Table 3).

Table 3 Recombinant S-ECD trimer purity analysis

2.2 Stability evaluation of recombinant S-ECD trimer protein

Taking the recombinant SCTV01C-TM28 trimeric protein as an example, its heat-accelerated stability and freeze-thaw stability were evaluated. The recombinant SCTV01C-TM28 trimer protein was stored at 37°C for 2 weeks (37T2W), stored at -80°C for 8 hours, then transferred to 25°C for 0.5h (F/T-5C), and repeated 5 times. After freezing and thawing, SDS-PAGE and SEC-HPLC were used to analyze the change of trimer content, and the data are shown in Table 4.

The results are shown in Table 4. After the recombinant SCTV01C-TM28 trimer protein was accelerated at 37°C for 2 weeks and after 5 repeated freeze-thaw cycles, the SEC-HPLC trimer content was within 1.5%, and there was no significant increase in aggregates and fragments. , showing good thermal acceleration stability and freeze-thaw stability.

Table 4 Recombinant S-ECD trimer protein stability evaluation

Example 3: Immunological Evaluation of SCTV01C-TM27, SCTV01C-TM28 Monovalent Vaccines and Multivalent Vaccines in Mice

3.1 Vaccine preparation and immunization grouping

For the expression and purification of trimeric proteins of SCTV01C-TM22 (B.1.1.7 strain EPI_ISL_764238) and SCTV01C-TM23 (B.1.351 strain EPI_ISL_736940), please refer to "An ECD Antigen Immunogen to Improve SARS-CoV-2 Mutant Strain Method for Stability of Sex/Antigen Trimer" (International Patent Application PCT/CN2022/095609, which is hereby incorporated by reference in its entirety). In this patent, the applicant elaborated that the bivalent vaccine composed of TM22+TM23 has better broad-spectrum neutralization ability than the monovalent vaccine of TM22 and TM23. In order to further broaden the broad-spectrum neutralizing effect of the vaccine, especially for the neutralizing effect of Kappa (B.1.617.1) and Delta (B.1.617.2) mutant strains, the applicant based on the TM22+TM23 bivalent vaccine TM27 or TM28 components are added to form a trivalent or quadrivalent vaccine.

According to the final immunization dose (Table 5), the purified SCTV01C-TM22, SCTV01C-TM23, SCTV01C-TM27 and SCTV01C-TM28 trimeric proteins were pre-diluted with PBS and mixed with MF59 (2×, source: Shenzhou Cell Engineering Co., Ltd. , hereinafter the same) equal volumes were mixed to prepare monovalent or multivalent vaccine samples.

Table 5 Summary of immunization grouping information

3.2 Immunization of mice

C57BL/6 mice (source: Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.) at 6-8 weeks were intramuscularly injected with 0.1 mL of vaccine samples containing MF59 adjuvant. A total of 2 immunizations were carried out, and the immunization interval was 14 days. Orbital blood was collected 14 days after the first immunization (14 days after the first immunization) and 7 days after the second immunization (7 days after the second immunization), and the serum was collected by centrifugation at 4500rpm for 15 minutes for subsequent serological immune analysis.

3.3 Determination of antibody titer and neutralizing titer of mouse immune serum

Coat 100 μL/well of SCTV01C-TM22, SCTV01C-TM23, SCTV01C-TM27 or SCTV01C-TM28 trimer protein at a concentration of 5 μg/mL on a 96-well plate, and coat overnight at 2-8°C. After the enzyme plate was washed and patted dry, 320 μL/well of blocking solution containing 2% BSA was added, and blocked at room temperature for more than 1 h. Use the TBST sample diluent containing 0.1% BSA to serially dilute the immune serum of monovalent or multivalent vaccine mice (such as 8000×, 16000×, 32000×, 64000×, 128000×, 256000×, 512000×, etc.) Serum from unimmunized mice was serially diluted as negative control serum. Add 100 μL/well of serially diluted serum to the 96-well ELISA plate, and incubate at room temperature for 1-2 hours. The plate was washed 3 times, 100 μL/well of 80 ng/mL rabbit anti-mouse IgG F(ab) ₂ /HRP detection secondary antibody (source: Jackson ImmunoResearch, the same below) was added, and incubated at room temperature for 1 h. Wash the plate 5 times, add the substrate chromogenic solution to develop the color for 10-15 minutes, and read the OD ₄₅₀ with a microplate reader after the termination of 2M H ₂ SO ₄ to calculate the immune antibody titer. Antibody titer = greater than the maximum dilution factor of negative serum OD ₄₅₀ ×2.1.

Add 50 μL/well of 2-immune 7-day immune serum with different dilutions to a 96-well plate, and then add 100-200 TCID ₅₀ of Alpha strain (B.1.1.7), Beta strain (B.1.351), Kappa virus strain (B.1.351), and 50 μL/well Strain (B.1.617.1) and Delta strain (B.1.617.2) pseudovirus (pseudovirus is a replication-deficient vesicular stomatitis that replaces the VSV-G protein gene in the viral genome with the luciferase reporter gene The virus (i.e. VSV△G-Luc-G) was used as the carrier, amplified and prepared in a cell line expressing Spike and its mutant protein, prepared by Shenzhou Cell Engineering Co., Ltd., the same below), mixed well and placed at 37°C , 5% CO ₂ incubator for 1 h. The cell wells containing pseudovirus and no immune serum were used as positive controls, and the cell wells without immune serum and pseudoviruses were used as negative controls. After the incubation, 100 μL/well was inoculated with 2×10 ⁴ Huh-7 cells, mixed evenly, and placed in a 37° C., 5% CO ₂ incubator for static culture for about 20 h. After the culture, remove the culture supernatant, add 50 μL/well of 1×Passive lysis buffer, and mix well to lyse the cells. 40 μL/well was transferred to a 96-well all-white chemiluminescent plate, and 40 μL/well of luciferase substrate was added using a LB960 microplate luminescence detector to detect the luminescence value (RLU) and calculate the neutralization rate. Neutralization rate%=(positive control RLUs-sample RLUs)/(positive control RLUs-negative control RLUs)×100%, IC ₅₀ was calculated according to the Reed-Muench formula, which was the neutralization titer NAT ₅₀ .

The results of antibody titers after immunization are shown in Figure 3A, TM27 and TM28 monovalent vaccines can induce high-titer antibody immune responses in C57BL/6 mice, and the antibody titer of 1 μg immunization dose is similar to that of 3 μg immunization dose. The TM22+TM23 bivalent vaccine induced a dose-related immune response (Fig. 3B). The trivalent vaccine or quadrivalent vaccine composed of TM27 or TM28 on the basis of TM22+TM23 bivalent vaccine has similar or slightly higher neutralizing titer than the same dose of monovalent or bivalent vaccine, indicating trivalent or quadrivalent All components in the vaccine were immunogenic (Fig. 3C, Fig. 3D, Table 6).

Table 6 SCTV01C-TM27, SCTV01C-TM28 monovalent and polyvalent vaccine immunization C57BL/6 mice serum antibody titer log10 value

The results of the neutralization titer of various pseudoviruses are shown in Figure 4. The neutralization titer of the TM27 monovalent vaccine immune serum to the Kappa strain pseudovirus is higher, but the neutralization ability to the Alpha strain, Beta strain and Delta strain is lower , the reduction factor includes about 5.7-16.4 times (1 μg/valent) and 8.7-18.4 times (3 μg/valent) of the Kappa strain neutralizing titer ( FIG. 4A ). The neutralizing titer of the TM28 monovalent vaccine immune serum to the Delta strain pseudovirus was higher, but the neutralizing ability to the Alpha strain, Beta strain and Kappa strain was reduced, and the reduction factor was about 2.9- 12.7 times (1 μg/valent) and 2.3-15.1 times (3 μg/valent) (Fig. 4A). The TM22+TM23 bivalent vaccine has similar neutralizing ability to Alpha strain, Beta strain and Kappa strain, but the neutralizing titer to Delta strain is about 2.6 times lower (Fig. 4B). The TM22+TM23+TM27 trivalent vaccine is similar to the TM22+TM23 bivalent vaccine, and its neutralizing ability to Alpha, Beta and Kappa strains is similar, while the neutralizing potency to Delta strains is 2-3 times lower (Fig. 4C). In contrast, the TM22+TM23+TM28 trivalent vaccine and TM22+TM23+TM27+TM28 have higher and similar neutralizing titers against different strains, indicating that these two multivalent vaccines have better induction of broad-spectrum Ability of neutralizing antibodies (Fig. 4C, Fig. 4D, Table 7).

Table 7 SCTV01C-TM27, SCTV01C-TM28 monovalent and multivalent vaccines neutralize NAT50 after immunizing C57BL/6 mice with various mutant strains

In summary, compared with monovalent vaccines, bivalent vaccines have broad-spectrum neutralization capabilities against different mutant strains, and are expected to produce cross-protection capabilities against multiple mutant strains and improve the protection rate against mutant strain infection.

Although the foregoing has described the present invention in detail by means of illustrations and examples, the purpose is to facilitate understanding, and those skilled in the art can obviously make various modifications and improvements to the technical solutions of the present invention without departing from the additional the spirit or scope of the claims.

sequence listing

Claims (16)

1. A method for improving the immunogenicity/antigen trimer stability of SARS-CoV-2 mutant strain ECD antigen, the method comprises SEQ ID No:8 or SEQ ID No:12 by constructing the amino acid sequence shown, or its immune ECD antigens of the original fragments and/or immunogenic variants such that the ECD is in the trimeric form in a stable prefusion conformation.
2. The method of claim 1, wherein the mutant strain is a high-risk mutant strain containing at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, and P681R.
3. The method of claim 1 or 2, wherein the strain comprises B.1 strain, B.1.351 strain, B.1.1.7 strain, P.1 strain, B.1.427 strain, B.1.429 strain , B.1.617.1 strain and B.1.617.2 strain at least one.
4. The method of claim 1, wherein the ECD antigen is co-administered to the subject with one or more adjuvants selected from:

   Aluminum adjuvant, oil-emulsion adjuvant, Toll-like receptor (TLR) agonist, combination of immune enhancer, microbial adjuvant, propolis adjuvant, levamisole adjuvant, liposome adjuvant, traditional Chinese medicine adjuvant and small Peptide adjuvants;

   Preferably, the oil-emulsion adjuvant contains squalene;

   Toll-like receptor (TLR) agonists comprising CpG or monophosphoryl lipid A (MPL) adsorbed on aluminum salts; and

   Combinations of immune boosters include QS-21 and/or MPL.
5. A method for improving the immunogenicity of the SARS-CoV-2 mutant strain ECD antigen//antigen trimer stability, the method comprises at least any of the shown in SEQ ID No: 8 or SEQ ID No: 12 by constructing a code an amino acid sequence, or a polynucleotide of an immunogenic fragment and/or immunogenic variant thereof,

   Thus expressing the stable prefusion conformation of the trimeric form of ECD.
6. The method of claim 5, wherein the mutant strain is a high-risk mutant strain containing at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, and P681R.
7. The method of claim 5 or 6, wherein the strain comprises B.1 strain, B.1.351 strain, B.1.1.7 strain, P.1 strain, B.1.427 strain, B.1.429 strain , B.1.617.1 strain and B.1.617.2 strain at least one.
8. A kind of SARS-CoV-2 mutant strain ECD immunogenic protein/peptide that immunogenicity/antigen trimer stability improves, is characterized in that, this immunogenic protein/peptide comprises SEQ ID No:8 or SEQ ID At least any amino acid sequence shown in No:12, or its immunogenic fragment and/or immunogenic variant,

   The ECD immunogenic protein/peptide is in the form of a trimer in a stable prefusion conformation.
9. The immunogenic protein/peptide according to claim 8, wherein the mutant strain is a high-risk mutant strain containing at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, and P681R.
10. The immunogenic protein/peptide of claim 8 or 9, wherein the strain comprises B.1 strain, B.1.351 strain, B.1.1.7 strain, P.1 strain, B.1.427 strain, At least one of B.1.429 strain, B.1.617.1 strain and B.1.617.2 strain.
11. A polynucleotide encoding the immunogenic protein/peptide of claim 8,

    Preferably, it comprises at least any one of the nucleotide sequences shown in SEQ ID No: 7 or SEQ ID No: 11.
12. An immunogenic composition, characterized in that, comprising

    a. at least one immunogenic protein/peptide or immunogenic fragment and/or immunogenic variant thereof as claimed in claim 8, or

    at least one polynucleotide as claimed in claim 11, and

    b. Any one or a combination of at least two of pharmaceutically acceptable carriers, excipients or diluents;

    Optionally, c. comprises an adjuvant.
13. 12. The immunogenic composition of claim 12, characterized in that it comprises an immunogenic protein/peptide or immunogenic fragment and/or immunogenic variant thereof selected from any group of a), b) or c),

    a. Immunogenic proteins/peptides or immunogenic fragments and/or immunogenic variants thereof of the amino acid sequences shown in SEQ ID No:16, SEQ ID No:20 and SEQ ID No:8;

    b. Immunogenic proteins/peptides of the amino acid sequences shown in SEQ ID No: 16, SEQ ID No: 20 and SEQ ID No: 12 or immune fragments and/or immunogenic variants thereof; or

    c. Immunogenic proteins/peptides of the amino acid sequences shown in SEQ ID No: 16, SEQ ID No: 20, SEQ ID No: 8 and SEQ ID No: 12 or immune fragments and/or immunogenic variants thereof.
14. The immunogenic composition of claim 12 or 13, wherein the adjuvant is selected from one or more of the following:

    Aluminum adjuvant, oil-emulsion adjuvant, Toll-like receptor (TLR) agonist, combination of immune enhancer, microbial adjuvant, propolis adjuvant, levamisole adjuvant, liposome adjuvant, traditional Chinese medicine adjuvant and small Peptide adjuvants;

    Preferably, the oil-emulsion adjuvant contains squalene;

    Toll-like receptor (TLR) agonists comprising CpG or monophosphoryl lipid A (MPL) adsorbed on aluminum salts; and

    Combinations of immune boosters include QS-21 and/or MPL.
15. The immunogenic protein/peptide described in claim 8, the polynucleotide described in claim 11 and the immunogenic compound described in any one of claims 12-14 are effective in preventing or treating SARS-CoV-2 mutant virus use for diseases caused by strains.
16. The immunogenic protein/peptide according to claim 8, the polynucleotide according to claim 11 and the immune complex according to any one of claims 12-14 are used in the preparation of prevention or treatment of mutant strains of SARS-CoV-2 Use in vaccines or medicines to cause diseases.

Images