CN117295756A - Preparation and application of recombinant multivalent novel coronavirus trimer protein vaccine capable of inducing broad-spectrum neutralization activity - Google Patents

Preparation and application of recombinant multivalent novel coronavirus trimer protein vaccine capable of inducing broad-spectrum neutralization activity Download PDF

Info

Publication number
CN117295756A
CN117295756A CN202280035290.6A CN202280035290A CN117295756A CN 117295756 A CN117295756 A CN 117295756A CN 202280035290 A CN202280035290 A CN 202280035290A CN 117295756 A CN117295756 A CN 117295756A
Authority
CN
China
Prior art keywords
strain
immunogenic
seq
adjuvants
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202280035290.6A
Other languages
Chinese (zh)
Inventor
谢良志
孙春昀
张延静
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sinocelltech Ltd
Original Assignee
Sinocelltech Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sinocelltech Ltd filed Critical Sinocelltech Ltd
Publication of CN117295756A publication Critical patent/CN117295756A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/215—Coronaviridae, e.g. avian infectious bronchitis virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08—RNA viruses
    • C07K14/165—Coronaviridae, e.g. avian infectious bronchitis virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Pulmonology (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Cell Biology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

A recombinant multivalent novel coronavirus trimeric protein vaccine which induces broad spectrum neutralization activity. Recombinant protein components include, but are not limited to, the b.1.617.1 strain and the b.1.617.2 strain spike protein (S protein) extracellular domain (ECD) homotrimeric proteins formed by introducing mutation sites and trimerization assistance. The multivalent vaccine comprises ECD trimeric proteins of the above variants, either alone or in any combination, and pharmaceutically acceptable adjuvants. The vaccine combination shows excellent immunogenicity in mice and can maintain humoral immunity and cellular immune response for a long time. The multivalent novel coronavirus trimeric protein vaccine can be used for preventing infection-related diseases caused by infection of novel coronaviruses and variants thereof.

Description

Preparation and application of recombinant multivalent novel coronavirus trimer protein vaccine capable of inducing broad-spectrum neutralization activity
Cross Reference to Related Applications
The present application claims the benefit of chinese patent application 202110838359.6 filed on month 07 and 23 of 2021, the contents of which are incorporated herein by reference.
Technical Field
The invention relates to the field of molecular vaccinology, and relates to preparation and application of a recombinant multivalent novel coronavirus trimer protein vaccine capable of inducing broad-spectrum neutralization activity.
Background
The novel coronavirus (SARS-CoV-2) has strong transmission capability, and the safe and effective vaccine is the most powerful technical means for controlling epidemic situation. Vaccines can be classified into the following categories, depending on the target and technology: inactivated vaccines, recombinant protein vaccines, viral vector vaccines, RNA vaccines, live attenuated vaccines, and virus-like particle vaccines. Since the pandemic of SARS-CoV-2, new crown vaccines developed in various countries have reached more than 200. By day 18 of 7 of 2021, 16 vaccines have been approved or conditionally used, and 92 more vaccines have entered the clinical study (https:// www.covid-19vaccinetracker. Org/# protein-subset).
SARS-CoV-2 and SARS-CoV share a common host cell receptor protein, angiotensin converting enzyme 2 (ACE 2) (Zhou, P., et al, discovery of a novel coronavirus associated with the recent pneumonia outbreak in humans and its potential bat origin. BioRxiv, 2020.). The trimeric Spike protein (Spike) of the virus binds to the ACE2 receptor and is cleaved by host proteases into an S1 polypeptide comprising a receptor binding domain (Receptor binding domain, RBD) and an S2 polypeptide responsible for mediating fusion of the virus to cell membranes (Hoffmann, m., et al, SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor.Cell,2020.). The S protein is the main component of the viral envelope and plays an important role in receptor binding, fusion, viral entry and host immune defenses. The RBD region of the S protein contains a major neutralizing antibody epitope that stimulates B cells to produce high titer neutralizing antibodies against RBD. In addition, the S protein also contains abundant T cell epitopes, and can induce T cells to generate specific CTL responses and clear virus infected cells. Thus, the S protein is the most critical antigen for new coronal vaccine design. Most vaccines currently designed select either the S protein or the RBD domain protein as the core immunogen.
SARS-CoV-2 is an RNA single-stranded virus, which is subject to deletion mutations and such mutations occur in repeated deletion regions of the S protein (Recurrent deletion regions, RDRs). Deletions or mutations may alter the conformation of the S protein such that antibodies induced by previous vaccine immunization reduce binding and neutralization of the mutant S protein resulting in reduced vaccine immunization effects and viral immune escape. Early D614G mutations (B.1) enhanced the affinity of the S protein for the ACE2 receptor and became a rapidly prevalent strain, but did not reduce the sensitivity to neutralizing antibodies (Korber, B., et al, spike mutation pipeline reveals the emergence of a more transmissible form of SARS-CoV-2.BioRxiv,2020: p.2020.04.29.069054; korber, B., et al, tracking Changes in SARS-CoV-2 Spike:Evidence that D614G Increases Infectivity of the COVID-19 viruses.cell, 2020.182 (4): p.812-827.e19.). However, with the pandemic of SARS-CoV-2, 4 variants of high concern (Variants of Concern, VOC) appear worldwide: alpha (B.1.1.7), beta (B.1.351), gamma (P.1) and Delta (B.1.617.2) and various attention variants (Variants of Interest, VOI): eta (B.1.525), iota (B.1.526), kappa (B.1.617.1) and Lambda (C.37). Studies have shown that these high risk strains can increase transmissibility, exacerbate disease progression (increase hospitalization or mortality), severely reduce antibody neutralization by past infections or immunizations, reduce therapeutic or vaccine efficacy, or disable diagnostic assays (https:/www.cdc.gov/coronavirus/2019-ncov/cases-updates/variant-surveillance/variant-info.h tml). Alpha (b.1.1.7) spreads rapidly and increases the risk of 61% related death (Davies, n.g., et al Increased mortality in community-tested cases of SARS-CoV-2 lineage B.1.1.7.Nature,2021). The neutralization effect study results show that the neutralization ability of the convalescent plasma or vaccine immunized serum to Alpha (B.1.1.7) strain remains substantially unchanged, while the neutralization ability to Beta (B.1.351) strain is greatly reduced (Cele, S., et al, escape of SARS-CoV-2 501Y.V2 from neutralization by convalescent plasma.2021.; zhou, D., et al, evidence of Escape of SARS-CoV-2 variant B.1.351 from natural and vaccine-reduced sera.cell,2021.; tada, T., 2021).https://doi.org/10.1101/2021.02.05.430003The method comprises the steps of carrying out a first treatment on the surface of the Wang, p., et al, increased Resistance of SARS-CoV-2 Variants B.1.351 and B.1.1.7 to Antibody Neutralization.bioRxiv,2021; wadman, M.and J.Cohen,2021.https:// doi.org/10.1136/bmj.n296; wu, k., et al, mRNA-1273 vaccine induces neutralizing antibodies against spike mutants from global SARS-CoV-2 derivatives.2021. Clinical results also show that Alpha (B.1.1.7) strain has little effect on the protective effect of the vaccine, while Beta (B.1.351) strain significantly reduces the protective effect against light diseases (Madhi, S.A., et al, efficacy of the ChAdOx nCoV-19 Covid-19Vaccine against the B.1.351 Variant.2021, shinde, V, et al, efficiency of NVX-CoV2373 Covid-19Vaccine against the B.1.351 Variant.New England Journal of Medicine,2021, abu-Raddad, L.J., H.Chemaitelly, and A.A. button, effectiveness of the BNT b2 Covid-19Vaccine against the B.1.1.7 and B.1.351 Variants.2021, karim, S.S.A., vaccines and SARS-CoV-2 variants:the urgent need for a correlate of protection.Lancet,2021.397 (10281): p.1263-1264. Compared with original virus and early variant strain, delta (B.1.617.2) strain has stronger transmission capacity of variation, short latency period and fast disease development, is transmitted to more than 90 countries or regions at present, and becomes a global epidemic strain. A preliminary study by the Israel health department shows that Delta is strong in transmission capacity and can seriously impair the effect of vaccine, bioNTech&psimRNThe effectiveness of the full vaccinators of the A vaccine against Delta variant strains was reduced from 94% to 64%. The current vaccines are designed based on the sequence of early epidemic strains (genome sequence: genBank Accession No. NC_ 045512), and in view of the high transmissibility of variant strains and adverse effects on the protective effect of the existing vaccines, there is an urgent need for second-generation vaccines with broad-spectrum properties and high protective effect on high-risk variant strains.
Disclosure of Invention
Based on the above need for a vaccine with high protective effect against the novel coronavirus SARS-CoV-2 variant, the present invention provides a method for improving the immunogenicity/antigen trimer stability of the ECD antigen of a SARS-CoV-2 mutant strain by constructing the ECD antigen comprising the amino acid sequence as shown in SEQ ID No. 8 or SEQ ID No. 12 or an immunogenic fragment and/or immunogenic variant thereof, thereby making the ECD in a stable trimeric form in a prefusion conformation.
In one embodiment, the mutant strain is a high risk mutant strain comprising at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, P681R.
In one embodiment, the strain comprises at least one of a b.1 strain, a b.1.351 strain, a b.1.1.7 strain, a p.1 strain, a b.1.427 strain, a b.1.429 strain, a b.1.617.1 strain, and a b.1.617.2 strain.
In one embodiment, wherein the ECD antigen is co-administered to the subject with one or more adjuvants selected from the group consisting of: aluminum adjuvants, oil emulsion adjuvants, toll-like receptor (TLR) agonists, combinations of immunopotentiators, microbial adjuvants, propolis adjuvants, levamisole adjuvants, liposomal adjuvants, chinese herbal adjuvants, and small peptide adjuvants; preferably, the oil emulsion adjuvant comprises a squalene component; toll-like receptor (TLR) agonists comprise CpG or monophosphoryl lipid a (MPL) adsorbed on an aluminium salt; and a combination of immunopotentiators comprising QS-21 and/or MPL.
The invention also provides a method for improving the immunogenicity/antigen trimer stability of SARS-CoV-2 high risk mutant strain ECD antigen by constructing a polynucleotide encoding at least any one of the amino acid sequences shown as SEQ ID No. 8 or SEQ ID No. 12 or an immunogenic fragment and/or immunogenic variant thereof, thereby expressing the stable prefusion conformational trimer form ECD.
In one embodiment, the mutant strain is a high risk mutant strain comprising at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, P681R.
In one embodiment, the mutant strain comprises at least one of a b.1 strain, a b.1.351 strain, a b.1.1.7 strain, a p.1 strain, a b.1.427 strain, a b.1.429 strain, a b.1.617.1 strain, and a b.1.617.2 strain.
The present invention provides an ECD immunogenic protein/peptide of SARS-CoV-2 mutant strain with improved stability of immunogenicity/antigen trimer, said immunogenic protein/peptide comprising at least any one of the amino acid sequences shown as SEQ ID No. 8 or SEQ ID No. 12, or an immunogenic fragment and/or immunogenic variant thereof, said ECD immunogenic protein/peptide being in the form of a trimer in stable precision conformation.
In one embodiment, the mutant strain is a high risk mutant strain comprising at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, P681R.
In one embodiment, the strain comprises at least one of a b.1 strain, a b.1.351 strain, a b.1.1.7 strain, a p.1 strain, a b.1.427 strain, a b.1.429 strain, a b.1.617.1 strain, and a b.1.617.2 strain.
The invention also provides polynucleotides encoding SARS-CoV-2 mutant strain ECD immunogenic proteins/peptides having improved immunogenicity/antigen trimer stability as described above; preferably, the polynucleotide comprises the nucleotide sequence shown as SEQ ID No. 7 or SEQ ID No. 11.
The present invention provides an immunogenic composition comprising a. At least one immunogenic protein/peptide as described above or an immunogenic fragment and/or immunogenic variant thereof, or at least one polynucleotide encoding an immunogenic protein/peptide with improved stability of the immunogenic/antigen trimer as described above, and
b. any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent;
optionally, the immunogenic composition comprises a c.
Further, the present invention provides an immunogenic composition comprising an immunogenic protein/peptide or an immunogenic fragment and/or immunogenic variant thereof selected from any one of the groups a), b) or c),
an immunogenic protein/peptide of the amino acid sequences shown in SEQ ID No. 16, SEQ ID No. 20 and SEQ ID No. 8 or an immune fragment and/or an immunogenic variant thereof;
an immunogenic protein/peptide of the amino acid sequences shown in SEQ ID No. 16, SEQ ID No. 20 and SEQ ID No. 12 or an immune fragment and/or an immunogenic variant thereof; or (b)
An immunogenic protein/peptide of the amino acid sequences shown in SEQ ID No. 16, SEQ ID No. 20, SEQ ID No. 8 and SEQ ID No. 12 or an immunogenic fragment and/or immunogenic variant thereof.
Still further, the adjuvant is one or more selected from the group consisting of: aluminum adjuvants, oil emulsion adjuvants, toll-like receptor (TLR) agonists, combinations of immunopotentiators, microbial adjuvants, propolis adjuvants, levamisole adjuvants, liposomal adjuvants, chinese herbal adjuvants, and small peptide adjuvants;
preferably, the oil emulsion adjuvant comprises a squalene component; toll-like receptor (TLR) agonists comprise CpG or monophosphoryl lipid a (MPL) adsorbed on an aluminium salt; and the immune enhancer comprises QS-21 and/or MPL.
The invention also provides the use of an immunogenic protein/peptide as described above, a polynucleotide encoding an immunogenic protein/peptide as described above and/or an immunogenic composition comprising an immunogenic protein/peptide as described above or a polynucleotide encoding said immunogenic protein/peptide for the prevention or treatment of a disease caused by a SARS-CoV-2 mutant strain.
The invention also provides the use of an immunogenic protein/peptide as described above, a polynucleotide encoding an immunogenic protein/peptide as described above and/or an immunogenic composition comprising an immunogenic protein/peptide as described above or a polynucleotide encoding said immunogenic protein/peptide for the preparation of a vaccine or medicament for the prevention or treatment of a disease caused by a mutant strain of SARS-CoV-2.
Drawings
FIG. 1 is a schematic representation of the primary structure (A) and the higher structure (B, reference PDB:6 XLR) of the engineered S-ECD.
FIG. 2 is a diagram showing analysis of purity of SCTV01C-TM28 trimer, wherein (A) is a representative map of non-reducing SDS-PAGE; (B) SEC-HPLC representative profile.
FIG. 3 shows serum antibody titer assays (GeoMean+ -SD) after SCTV01C-TM27, SCTV01C-TM28 monovalent and multivalent vaccine immunization of C57BL/6 mice.
FIG. 4 shows serum neutralization titer assays (GeoMean+ -SD) after SCTV01C-TM27, SCTV01C-TM28 monovalent and multivalent vaccine immunization of C57BL/6 mice.
Detailed Description
Definition of the definition
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. For the purposes of the present invention, the following terms are further defined.
As used herein and in the appended claims, the singular forms "a," "an," "the," and "the" include plural referents unless the context clearly dictates otherwise.
The terms "comprising," "including," and "containing" are intended to include the specific components without excluding any other components. Such as "consisting essentially of … …" allows for the inclusion of other components or steps that do not detract from the novel or essential features of the invention, i.e., they exclude other non-recited components or steps that do. The term "consisting of … …" is meant to include a particular ingredient or ingredients and exclude all other ingredients.
The term "antigen" refers to a foreign substance recognized (specifically bound) by an antibody or T cell receptor, but which does not definitively induce an immune response. Foreign substances that induce specific immunity are called "immunogenic antigens" or "immunogens". "hapten" refers to an antigen that is not itself capable of eliciting an immune response (although a conjugate of several molecular haptens, or a conjugate of a hapten and a macromolecular carrier, may elicit an immune response).
A "humoral immune response" is an antibody-mediated immune response and involves the introduction and generation of antibodies that recognize and bind with some affinity to antigens in the immunogenic compositions of the invention, a "cell-mediated immune response" being an immune response mediated by T cells and/or other leukocytes. A "cell-mediated immune response" is induced by providing an epitope associated with a class I or class II molecule of the Major Histocompatibility Complex (MHC), CD1 or other atypical MHC-like molecule.
The term "immunogenic composition" refers to any pharmaceutical composition containing an antigen, such as a microorganism or component thereof, which composition can be used to elicit an immune response in an individual.
"immunogenicity" as used herein means the ability of an antigen (or epitope of an antigen), such as a coronavirus spinous process protein receptor binding region or an immunogenic composition, to elicit a humoral or cell-mediated immune response or both in a host (e.g., a mammal).
"protective" immune response refers to the ability of an immunogenic composition to elicit a humoral or cell-mediated immune response, or both, for protecting an individual from infection. The protection provided need not be absolute, i.e., it need not completely prevent or eradicate the infection, so long as there is a statistically significant improvement over a control population of individuals (e.g., infected animals that are not administered a vaccine or immunogenic composition). Protection may be limited to alleviating the severity of symptoms of infection or rapidity of onset.
"immunogenic amount" and "immunologically effective amount" are used interchangeably herein to refer to an amount of antigen or immunogenic composition sufficient to elicit an immune response (cellular (T cell) or humoral (B cell or antibody) response or both, as measured by standard assays known to those of skill in the art).
The effectiveness of an antigen as an immunogen may be measured, for example, by a proliferation assay, by a cytolytic assay, or by measuring the level of B cell activity.
The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of consecutive amino acid residues.
The terms "nucleic acid", "nucleotide" and "polynucleotide" are used interchangeably to refer to RNA, DNA, cDNA or cRNA and derivatives thereof, such as those containing a modified backbone. It is to be understood that the present invention provides polynucleotides comprising sequences complementary to the sequences described herein. "Polynucleotide" as contemplated in the present invention includes forward strands (5 'to 3') and reverse complementary strands (3 'to 5'). Polynucleotides according to the invention may be prepared in different ways (e.g., by chemical synthesis, by gene cloning, etc.), and may take various forms (e.g., linear or branched, single-or double-stranded, or hybrids thereof, primers, probes, etc.).
The term "immunogenic protein/peptide" includes polypeptides having immunological activity in the sense that upon administration to a host they are capable of eliciting an immune response against the humoral and/or cellular type of the protein. Thus, a protein fragment according to the invention comprises or essentially consists of at least one epitope or antigenic determinant. As used herein, an "immunogenic" protein or polypeptide includes the full-length sequence of a protein, an analog thereof, or an immunogenic fragment thereof. An "immunogenic fragment" refers to a fragment of a protein that contains one or more epitopes, thereby eliciting an immune response as described above.
The term "immunogenic protein/peptide" also encompasses deletions, additions and substitutions to the sequence, provided that the polypeptide functions to produce an immune response as defined herein, i.e. "immunogenic variants".
The SCTV01C recombinant protein vaccine provided by the invention is modified based on an extracellular domain (ECD, containing S1 and S2 parts) of SARS-CoV-2 spike protein. The known natural spike protein of SARS-CoV-2 is a trimeric structure, and during its production and infection function, the membrane fusion process is completed by cleavage by proteases in the Golgi apparatus and on the cell surface through the RRAR site present between S1 and S2, followed by S1 shedding, and further the S2 structure is converted from the precision conformation to the postfusion conformation, thus completing the membrane fusion (Cai, Y., J.Zhang, and T.Xaao, distinct conformational states of SARS-CoV-2 spike protein.2020.369 (6511): p.1586-1592.).
In order to obtain ECD trimers in stable precision conformation, the present invention was modified based on S protein of different strain variants in three parts (see Table 1):
1) It has now been found that antibodies with higher neutralizing activity bind to both the S1 region (specifically to the NTD and RBD regions in S1). The S1 part is kept intact, and is important for the generation of neutralizing antibodies induced by the novel crown vaccine. The Furin site is removed by modification in the SCTV01C recombinant protein vaccine, namely, the amino acid sequence from 679 to 688 is fixed to NSPGSASSVA, so that the possibility of S1 fracture and shedding is reduced.
2) Because of the allosteric propensity of S2 itself, the precision conformation of spike protein is unstable, while effective induction of neutralizing antibodies requires maintenance of the precision conformation stable, which has been demonstrated in RSV and HIV-1 vaccine studies (McLellan, J.S., et al, structure-based design of a fusion glycoprotein vaccine for respiratory syncytial virus.science,2013.342 (6158): p.592-8.; frey, G., et al Distinct conformational states of HIV-1 gp41 are recognized by neutralizing and non-nesting anti-ibodies Nat Struct Mol Biol,2010.17 (12): p.1486-91.). In current marketed vaccines, modifications of S-2P (i.e., mutation of amino acids 986 and 987 to proline) are commonly employed (Tian, J.H., et al, SARS-CoV-2 spike glycoprotein vaccine candidate NVX-CoV 2373-immunogenicity in baboons and protection in mice.2021.12 (1): p.372.; mercoado, N.B., et al, single-shot Ad26 vaccine protects against SARS-CoV-2 in rhesus macaques.2020.586 (7830): p.583-588.; corbett, K.S., et al, SARS-CoV-2 mRNA Vaccine Development Enabled by Prototype Pathogen Preparedness.bioRxiv,2020). In addition, hexaPro mutation (namely mutation of 817, 892, 899 and 942 amino acids into proline besides S-2P mutation) which can effectively improve stability and does not influence three-dimensional Structure is introduced (Hsieh, C.L., et al, structure-based Design of Prefusion-stabilized SARS-CoV-2 Spikes.bioRxiv,2020). These mutation sites are all located at the N-terminal or Loop region of the α -helix in S2, and after mutation to the proline (P) type with this secondary structure propensity, the allosteric propensity of S2 can be effectively reduced to stabilize the presupposition conformation of S2.
3) Finally, in order to further stabilize the S-ECD trimer structure, the invention adds a trimerization module T4foldon at the C-terminal of the vaccine molecule. This module is derived from the C-terminal domain of the fibrin of the T4 bacteriophage, with 27 amino acids. T4foldon has been used in RSV vaccine candidates and proved to be safe in clinical phase I studies (Crank, M.C., A proof of concept for structure-based vaccine design targeting RSV in humans.2019.365 (6452): p.505-509.).
After the recombinant S-ECD trimeric protein antigen modified by the method is recombined into an expression vector and the expressed recombinant S-ECD trimeric protein is subjected to conventional purity and stability analysis, corresponding vaccines, namely Kappa (B.1.617.1) strain SCTV01C-TM27 vaccine and Delta (B.1.617.2) strain SCTV01C-TM28 vaccine, are prepared.
TABLE 1 molecular structural design engineering of SCTVC 01C-TM27 and SCTV01C-TM28 vaccines
TABLE 2S protein mutations of SARS-CoV-2 variant of the invention
Pango pedigree WHO label S protein mutations of interest
B.1 D614G
B.1.351* Beta K417N、E484K、N501Y
B.1.1.7* Alpha N501Y
P.1* Gamma K417T、E484K、N501Y
B.1.617.2* Delta L452R、T478K、P681R**
B.1.427/B.1.429* Epsilon L452R
B.1.617.1* Kappa L452R、E484Q
*https://www.who.int/en/activities/tracking-SARS-CoV-2-variants
**https://doi.org/10.1016/j.celrep.2022.110829
The ECD trimeric immunogenic proteins/peptides of the invention exhibit excellent immunogenicity in mice and maintain long-term humoral and cellular immune responses.
Immunization tests of mice immunized with prepared Kappa strain SCTV01C-TM27, delta strain SCTV01C-TM28, alpha strain SCTV01C-TM22 and Beta strain SCTV01C-TM23 show that the two vaccines prepared by the invention can induce high-titer antibody immune reaction in experimental animals; the bivalent vaccine SCTV 01C-TM22+SCT01C-TM 23 can induce dose-related immune response, and the trivalent vaccine or tetravalent vaccine formed by adding TM27 or TM28 based on the bivalent vaccine TM22+TM23 has similar or slightly higher neutralization titer compared with the monovalent or bivalent vaccine with the same dose, which indicates that each component in the trivalent or tetravalent vaccine has immunogenicity. The trivalent TM22+TM23+TM28 vaccine and the trivalent TM22+TM23+TM27+TM28 have higher and similar neutralization titers on different strains, so that the two multivalent vaccines have more excellent capability of inducing broad-spectrum neutralizing antibodies.
Examples
Example 1: new coronavirus recombinant spike protein extracellular region (S-ECD) trimer protein antigen design, construction of expression vector and protein production
1.1 construction of an S-ECD trimeric protein (SCTV 01C-TM 27) expression vector based on the Kappa Strain (B.1.617.1) sequence (EPI_ISL_ 1704611)
The SCTV01C-TM27 gene fragment contained 3708bp and was obtained from the template pD2535nt-CoV2-S-ECDTM 8-T4F-primer amplification by PCR splicing. The pXC-CoV2-S-ECDTM27-T4F-trimer expression vector is obtained by constructing the pXC-17.5 stable strain expression vector which is cut by HindIII+EcoRI through an In-fusion method.
Amplification primers
1.2 construction of an expression vector for the S-ECD trimeric protein (SCTV 01C-TM 28) based on the Delta Strain (B.1.617.2) sequence (EPI_ISL_ 1999775)
The SCTV01C-TM28 comprises a 3702bp gene fragment, and the SCTV01C-TM28 gene fragment is obtained by PCR splicing from the templates pCMV3-CoV2-B.1.617.2, pD2535nt-CoV2-S-ECDTM 8-T4F-primer, pD2535nt-CoV2-S-ECDTM 28-T4F-primer. The pXC-CoV2-S-ECDTM28-T4F-trimer expression vector is obtained by constructing the pXC-17.5 stable strain expression vector which is cut by HindIII+EcoRI through an In-fusion method.
Amplification primers
F8(SEQ ID NO:35) ACTAAAAGCCAAAGCCGCCACCATGTTTGTGTTCCTGGTGCTGCTG
R8(SEQ ID NO:36) GTTGGTCTGGGTCTGGTAGGAGG
F9(SEQ ID NO:37) CCTCCTACCAGACCCAGACCAAC
R9(SEQ ID NO:38) GTCAGAGCCCTGTTAAGTTGGGTACA
F10(SEQ ID NO:39) TGTACCCAACTTAACAGGGCTCTGAC
R6(SEQ ID NO:32) GATGTCTAGTGGAGGCGCGCC TTTACAGGAAGGTGCTCAGCAGC
F7(SEQ ID NO:33) GTCACCGTCCTTGACACGAAGCTTGCCGCCACCATGTTTGTGTTCCTGGTGCTGCTG
R7(SEQ ID NO:34) TGGCTGATTATGATCAATGAATTCTTTACAGGAAGGTGCTCAGCAGC
1.3 Expression and purification of S-ECD trimeric proteins
The objective gene constructed above was chemically transferred into HEK-293 cells (source: invitrogen), cultured and expressed for 7 days, and the culture supernatant was obtained by centrifugation and filtration. The culture supernatant was first captured by cation exchange chromatography (POROS XS, thermo) and eluted with high salt buffer; then, further purification is carried out by adopting an anion chromatography (NanoGel-50Q, nano Micro) combination mode and a mixed anion chromatography (Diamond MIX-A, boguron) flow-through mode, and impurities related to products and processes are removed. S-ECD trimer expression levels >60mg/L.
Example 2: analysis of purity and stability of recombinant spike protein extracellular region (S-ECD) trimer protein of novel coronavirus
2.1 analysis of recombinant S-ECD trimer protein purity
The purified recombinant S-ECD trimer protein stock solution is placed in a buffer solution containing 20mM Tris,35mM NaCl,pH7.0-7.5 with the concentration of about 1.0mg/mL, and the analysis of primary structure purity and size exclusion high performance liquid chromatography (size-exclusion high performance liquid chromatograph, SEC-HPLC) is carried out by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS polyacrylamide gel electrophoresis, SDS-PAGE) to analyze the trimer content, and dynamic light scattering (dynamic light scattering, DLS) is used for detecting morphological characteristics.
Specific operation steps of SDS-PAGE: (1) preparation of SDS-PAGE gel: 3.9% of concentrated gum and 7.5% of separation gum; (2) boiling the sample at 100 ℃ for 2min, centrifuging and loading 8 mug; (3) Coomassie brilliant blue staining followed by bleaching. The SEC-HPLC operation steps are: (1) apparatus: a liquid chromatography system (Agilent company, model: agilent 1260), a water-soluble size exclusion chromatography column (Sepax company, model: SRT-C SEC-500 chromatography column); (2) mobile phase: 200mM NaH 2 PO 4 100mM Arginine,pH 6.5,0.01% isopropyl alcohol (IPA); (3) the loading amount is 80 mug; (3) The detection wavelength was 280nM, the analysis time was 35min and the flow rate was 0.15mL/min.
The specific operation steps of DLS are as follows: (1) apparatus: dynamic light scattering instrument (Wyatt Technology Co., model: dynaPro nanoStar); (2) a loading amount of 50. Mu.L; (3) After data collection, data was analyzed using Dynamics 7.1.8 software.
Recombinant SCTV01C-TM27 and SCTV01C-TM28 proteins are homotrimeric structures due to their non-covalent hydrophobic interactions. The non-reducing SDS-PAGE treatment resulted in a monomer molecule of about 148kDa (FIG. 2) with purities of 89.3% and 91.0%, respectively; SEC-HPLC showed a main peak purity of 94.9% and 96.7%, respectively, with an aggregate to fragment ratio content of less than 5% and a main peak molecular weight average of 530kDa, and FIG. 2 is a representative detection result of SCTV01C-TM 28. Dynamic light scattering results showed that the average radii of recombinant SCTV01C-TM27 and SCTV01C-TM28 trimeric protein molecules were 10.2nm and 9.2nm, respectively (Table 3).
TABLE 3 recombinant S-ECD trimer purity analysis
2.2 evaluation of recombinant S-ECD trimer protein stability
Taking recombinant SCTV01C-TM28 trimeric protein as an example, the heat acceleration stability and the freeze thawing stability of the recombinant SCTV01C-TM28 trimeric protein are evaluated. Recombinant SCTV01C-TM28 trimeric protein was stored at 37℃for 2 weeks (37T 2W), at 80℃for 8 hours, and then transferred to 25℃for thawing for 0.5h (F/T-5C), and repeated freeze thawing was performed 5 times, and the change in the trimer content was analyzed by SDS-PAGE and SEC-HPLC, and the data are shown in Table 4.
The results are shown in Table 4, the recombinant SCTV01C-TM28 trimer protein has no obvious increase of aggregate and fragment, and shows good heat acceleration stability and freeze thawing stability after accelerating for 2 weeks at 37 ℃ and after repeating freeze thawing for 5 times, and the SEC-HPLC trimer content change is within 1.5%.
TABLE 4 evaluation of recombinant S-ECD trimer protein stability
Example 3: evaluation of monovalent and multivalent SCTV01C-TM27 and SCTV01C-TM28 vaccines in mice
3.1 vaccine preparation and immune grouping
Expression and purification of the trimeric proteins of SCTV01C-TM22 (B.1.1.7 strain EPI_ISL_ 764238) and SCTV01C-TM23 (B.1.351 strain EPI_ISL_ 736940) are described in "a method for improving the immunogenicity of the ECD antigen/the stability of the antigen trimer of the SARS-CoV-2 mutant strain" (International patent application PCT/CN2022/095609, incorporated herein by reference in its entirety). Applicants have elaborated in this patent that bivalent vaccine compositions of TM22+ TM23 have a more excellent broad spectrum neutralization capacity than TM22 and TM23 monovalent vaccines. To further broaden the broad spectrum neutralization of the vaccine, especially against Kappa (B.1.617.1) and Delta (B.1.617.2) variants, the applicant has added TM27 or TM28 components on the basis of the TM22+TM23 bivalent vaccine to constitute a trivalent or tetravalent vaccine.
Monovalent or multivalent vaccine samples were prepared by pre-diluting purified SCTV01C-TM22, SCTV01C-TM23, SCTV01C-TM27 and SCTV01C-TM28 trimeric proteins with PBS according to the final immunization dose (Table 5) and mixing with equal volumes of MF59 (2X, source: china cell engineering Co., ltd., hereinafter).
Table 5 summary of immune packet information
3.2 immunization of mice
6-8 weeks C57BL/6 mice (source: beijing Vitre Liwa laboratory animal technologies Co., ltd.) were intramuscular injected with 0.1mL of vaccine sample containing MF59 adjuvant. A total of 2 immunizations were performed with an immunization interval of 14 days. The orbit was collected for 14 days after the first immunization (14 days 1 and 7 days after 2 immunization (7 days 2) and serum was collected by centrifugation at 4500rpm for 15 minutes for subsequent serological immunoassay.
3.3 determination of mouse immune serum antibody titers and neutralization titers
SCTV01C-TM22, SCTV01C-TM23, SCTV01C-TM27 or SCTV01C-TM28 trimeric protein 100. Mu.L/Kong Baobei at a concentration of 5. Mu.g/mL was coated overnight in 96-well plates at 2-8deg.C. After the ELISA plate is cleaned and dried, 320 mu L/hole of blocking solution containing 2% BSA is added, and the plate is blocked for more than 1h at room temperature. Monovalent or multivalent vaccine mouse immune serum was subjected to gradient dilution (e.g., 8000×, 16000×, 32000×, 64000×, 128000 ×, 256000 ×, 512000 ×, etc.) using TBST sample diluent containing 0.1% bsa, and the same gradient diluted non-immunized mouse serum was used as negative control serum. The 96-well ELISA plate is added with 100 mu L/well serum after gradient dilution, and incubated for 1-2 h at room temperature. The plate was washed 3 times and 80ng/mL of rabbit anti-mouse IgG F (ab) was added 2 HRP detection Secondary antibody (source: jackson ImmunoResearch, hereinafter the same) 100. Mu.L/well, incubated at room temperature for 1h. Washing the plate for 5 times, adding a substrate color development liquid for color development for 10-15 min, and 2M H 2 SO 4 After termination, reading OD by ELISA 450 Immune antibody titers were calculated. Antibody titer = greater than negative serum OD 450 X 2.1 maximum dilution factor.
50 mu L/well of 2 immune serum free of 7 days with different dilution times are added into a 96-well plate, and then 100-200 TCID is added into 50 mu L/well 50 Alpha strain (B.1.1.7), beta strain (B.1.351), kappa strain (B.1.617.1) and Delta strain (B.1.617.2) pseudoviruses (pseudoviruses are replication-defective in which the VSV-G protein gene in the viral genome is replaced by a luciferase reporter gene)Vesicular stomatitis virus (VSV delta G-Luc-G) as carrier is prepared by amplifying in cell line expressing Spike and its mutant protein, and is prepared by China cell engineering Co., ltd., hereinafter the same), mixing, and placing at 37deg.C and 5% CO 2 Incubate for 1h. The wells without immune serum added with pseudoviruses were used as positive control, and the wells without immune serum and pseudoviruses were used as negative control. After incubation, 100. Mu.L/well was inoculated with 2X 10 4 Huh-7 cells were mixed and placed at 37℃in 5% CO 2 And (5) standing and culturing for about 20 hours in an incubator. After the completion of the culture, the culture supernatant was removed, and 1X Passive lysis buffer was added to 50. Mu.L/well, followed by mixing and cell lysis. The neutralization rate was calculated by taking 40. Mu.L/Kong Zhuairu of 96-well full-whitening chemiluminescent plate, adding luciferase substrate to 40. Mu.L/well using LB960 microplate type luminometer and measuring the luminescence value (RLU). Neutralization% = (positive control RLUs-sample RLUs)/(positive control RLUs-negative control RLUs) ×100%, IC was calculated according to the Reed-Muench formula 50 I.e. the neutralization potency NAT 50 。
The results of antibody titers after immunization are shown in FIG. 3A, the TM27 and TM28 monovalent vaccines induced high titers of antibody immune responses in C57BL/6 mice, and the 1 μg immunization dose was similar to the 3 μg immunization dose antibody titers. The tm22+tm23 bivalent vaccine induced a dose-dependent immune response (fig. 3B). The addition of a trivalent or tetravalent vaccine composed of TM27 or TM28 on the basis of a TM22+tm23 bivalent vaccine has a similar or slightly higher neutralization potency than the same dose of the monovalent or bivalent vaccine, indicating that each component of the trivalent or tetravalent vaccine is immunogenic (fig. 3C, fig. 3D, table 6).
TABLE 6 monovalent and multivalent vaccine against SCTVC 01C-TM27, SCTV01C-TM28 serum antibody titers log10 values after immunization of C57BL/6 mice
The results of various pseudovirus neutralization titers are shown in FIG. 4, where the TM27 monovalent vaccine immune serum has a higher neutralizing titer against the pseudovirus of the Kappa strain, while the neutralizing capacity against Alpha, beta and Delta strains is reduced by a factor of about 5.7-16.4 times (1. Mu.g/titer) and 8.7-18.4 times (3. Mu.g/titer) the neutralizing titer of the Kappa strain (FIG. 4A). The TM28 monovalent vaccine immune serum had a higher neutralizing potency against the Delta strain pseudovirus, while the neutralizing ability against Alpha, beta and Kappa strains was reduced by about 2.9-12.7 times (1. Mu.g/valence) and 2.3-15.1 times (3. Mu.g/valence) the neutralizing potency of the Delta strain (FIG. 4A). The TM22+TM23 bivalent vaccine had similar neutralization capacity for Alpha, beta and Kappa strains, while the neutralization potency for Delta strain was reduced by about 2.6-fold (FIG. 4B). The TM22+TM23+TM27 trivalent vaccine is similar to the TM22+TM23 divalent vaccine, has similar neutralization ability to Alpha strain, beta strain and Kappa strain, and has 2-3 times lower neutralization potency to Delta strain (FIG. 4C). In contrast, the trivalent tm22+tm23+tm28 vaccine and tm22+tm23+tm27+tm28 have higher and similar neutralization titers for different strains, demonstrating that these two multivalent vaccines have more excellent ability to induce broad-spectrum neutralizing antibodies (fig. 4C, fig. 4D, table 7).
TABLE 7 neutralization of NAT50 by SCTVC-01C-TM 27, SCTV01C-TM28 monovalent and multivalent vaccine serum multiple variants after immunization of C57BL/6 mice
In summary, bivalent vaccines have broad-spectrum neutralizing ability against different variant strains, and are hopeful to generate cross-protective ability against various variant strains, and improve the protection rate against variant infection compared with monovalent vaccines.
While the invention has been described in detail in the foregoing description and with reference to the embodiments, it is for an understanding of the nature and character of the invention to be considered as obvious and obvious to those skilled in the art, without departing from the spirit or scope of the appended claims.
Sequence listing

Claims (16)

  1. A method of increasing the immunogenicity/antigen trimer stability of an ECD antigen of a mutant strain of SARS-CoV-2 by constructing an ECD antigen comprising the amino acid sequence set forth in SEQ ID No. 8 or SEQ ID No. 12, or an immunogenic fragment and/or immunogenic variant thereof, whereby the ECD is in the form of a trimer in a stable prefusion conformation.
  2. The method of claim 1, wherein the mutant strain is a high risk mutant strain comprising at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, P681R.
  3. The method of claim 1 or 2, wherein the strain comprises at least one of a b.1 strain, a b.1.351 strain, a b.1.1.7 strain, a p.1 strain, a b.1.427 strain, a b.1.429 strain, a b.1.617.1 strain, and a b.1.617.2 strain.
  4. The method of claim 1, wherein the ECD antigen is co-administered to the subject with one or more adjuvants selected from the group consisting of:
    aluminum adjuvants, oil emulsion adjuvants, toll-like receptor (TLR) agonists, combinations of immunopotentiators, microbial adjuvants, propolis adjuvants, levamisole adjuvants, liposomal adjuvants, chinese herbal adjuvants, and small peptide adjuvants;
    preferably, the oil emulsion adjuvant comprises a squalene component;
    toll-like receptor (TLR) agonists comprise CpG or monophosphoryl lipid a (MPL) adsorbed on an aluminium salt; and
    the combination of immunopotentiators comprises QS-21 and/or MPL.
  5. A method for improving the immunogenicity// antigen trimer stability of an ECD antigen of a SARS-CoV-2 mutant strain by constructing a polynucleotide encoding a polypeptide comprising at least any one of the amino acid sequences set forth in SEQ ID No. 8 or SEQ ID No. 12, or an immunogenic fragment and/or immunogenic variant thereof,
    thereby expressing a stable fusion conformational trimeric form of the ECD.
  6. The method of claim 5, wherein the mutant strain is a high risk mutant strain comprising at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, P681R.
  7. The method of claim 5 or 6, wherein the strain comprises at least one of a b.1 strain, a b.1.351 strain, a b.1.1.7 strain, a p.1 strain, a b.1.427 strain, a b.1.429 strain, a b.1.617.1 strain, and a b.1.617.2 strain.
  8. An immunogenic protein/peptide of SARS-CoV-2 mutant strain ECD with improved stability of immunogenicity/antigen trimer, characterized in that the immunogenic protein/peptide comprises at least any one of the amino acid sequences shown in SEQ ID No. 8 or SEQ ID No. 12, or an immunogenic fragment and/or immunogenic variant thereof,
    the ECD immunogenic protein/peptide is in the form of a trimer in a stable precision conformation.
  9. The immunogenic protein/peptide of claim 8, wherein the mutant strain is a high risk mutant strain comprising at least any one of K417N, K417T, L452R, T478K, E484K, E484Q, N501Y, D614G, P681R.
  10. The immunogenic protein/peptide of claim 8 or 9, wherein the strain comprises at least one of a b.1 strain, a b.1.351 strain, a b.1.1.7 strain, a p.1 strain, a b.1.427 strain, a b.1.429 strain, a b.1.617.1 strain, and a b.1.617.2 strain.
  11. A polynucleotide encoding the immunogenic protein/peptide of claim 8,
    preferably, the nucleotide sequence comprising at least either one of SEQ ID No. 7 or SEQ ID No. 11.
  12. An immunogenic composition comprising
    a. At least one immunogenic protein/peptide or immunogenic fragment and/or immunogenic variant thereof according to claim 8, or
    At least one polynucleotide according to claim 11, and
    b. any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent;
    optionally, c.comprises an adjuvant.
  13. The immunogenic composition according to claim 12, characterized in that it comprises an immunogenic protein/peptide selected from any one of the groups a), b) or c) or an immunogenic fragment and/or immunogenic variant thereof,
    an immunogenic protein/peptide of the amino acid sequences shown in SEQ ID No. 16, SEQ ID No. 20 and SEQ ID No. 8 or an immune fragment and/or an immunogenic variant thereof;
    an immunogenic protein/peptide of the amino acid sequences shown in SEQ ID No. 16, SEQ ID No. 20 and SEQ ID No. 12 or an immune fragment and/or an immunogenic variant thereof; or (b)
    An immunogenic protein/peptide of the amino acid sequences shown in SEQ ID No. 16, SEQ ID No. 20, SEQ ID No. 8 and SEQ ID No. 12 or an immunogenic fragment and/or immunogenic variant thereof.
  14. The immunogenic composition of claim 12 or 13, wherein the adjuvant is selected from one or more of the following:
    aluminum adjuvants, oil emulsion adjuvants, toll-like receptor (TLR) agonists, combinations of immunopotentiators, microbial adjuvants, propolis adjuvants, levamisole adjuvants, liposomal adjuvants, chinese herbal adjuvants, and small peptide adjuvants;
    preferably, the oil emulsion adjuvant comprises a squalene component;
    toll-like receptor (TLR) agonists comprise CpG or monophosphoryl lipid a (MPL) adsorbed on an aluminium salt; and
    the combination of immunopotentiators comprises QS-21 and/or MPL.
  15. Use of the immunogenic protein/peptide of claim 8, the polynucleotide of claim 11 and the immunogenic complex of any one of claims 12-14 for the prevention or treatment of a disease caused by a SARS-CoV-2 mutant strain.
  16. Use of the immunogenic protein/peptide of claim 8, the polynucleotide of claim 11 and the immune complex of any one of claims 12-14 in the manufacture of a vaccine or medicament for preventing or treating a disease caused by a SARS-CoV-2 mutant strain.
CN202280035290.6A 2021-07-23 2022-07-22 Preparation and application of recombinant multivalent novel coronavirus trimer protein vaccine capable of inducing broad-spectrum neutralization activity Pending CN117295756A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN2021108383596 2021-07-23
CN202110838359 2021-07-23
PCT/CN2022/107213 WO2023001259A1 (en) 2021-07-23 2022-07-22 Preparation and application of recombinant multivalent novel coronavirus trimer protein vaccine capable of inducing broad-spectrum and neutralizing activity

Publications (1)

Publication Number Publication Date
CN117295756A true CN117295756A (en) 2023-12-26

Family

ID=84979749

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202280035290.6A Pending CN117295756A (en) 2021-07-23 2022-07-22 Preparation and application of recombinant multivalent novel coronavirus trimer protein vaccine capable of inducing broad-spectrum neutralization activity

Country Status (2)

Country Link
CN (1) CN117295756A (en)
WO (1) WO2023001259A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024086575A1 (en) 2022-10-17 2024-04-25 BioNTech SE Combination vaccines against coronavirus infection, influenza infection, and/or rsv infection

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2828405B1 (en) * 2001-08-09 2005-06-24 Virbac Sa ANTI-CORONAVIRUS VACCINE
WO2018115527A2 (en) * 2016-12-23 2018-06-28 Curevac Ag Mers coronavirus vaccine
US10906944B2 (en) * 2020-06-29 2021-02-02 The Scripps Research Institute Stabilized coronavirus spike (S) protein immunogens and related vaccines
CN112358533B (en) * 2020-10-30 2023-07-14 上海泽润生物科技有限公司 Recombinant spike protein and preparation method and application thereof
CN112552380B (en) * 2020-12-10 2021-12-24 武汉博沃生物科技有限公司 Immunogen of SARS-CoV-2 virus and its application

Also Published As

Publication number Publication date
WO2023001259A1 (en) 2023-01-26

Similar Documents

Publication Publication Date Title
Li et al. SARS-CoV-2 spike produced in insect cells elicits high neutralization titres in non-human primates
ES2858315T3 (en) Stabilized soluble RSV prefusion protein F for use in the prophylaxis of RSV infection
US9731006B2 (en) Attenuated recombinant vesicular stomatitis virus vaccine vectors comprising modified matrix proteins
Zhou et al. Development of variant‐proof severe acute respiratory syndrome coronavirus 2, pan‐sarbecovirus, and pan‐β‐coronavirus vaccines
WO2022090679A1 (en) Coronavirus polypeptide
TW202332685A (en) Coronavirus vaccine formulations
WO2023160654A1 (en) Preparation and use of recombinant multicomponent sars-cov-2 trimeric protein vaccine capable of inducing broad-spectrum neutralizing activity
Pecetta et al. Immunology and technology of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) vaccines
WO2023001259A1 (en) Preparation and application of recombinant multivalent novel coronavirus trimer protein vaccine capable of inducing broad-spectrum and neutralizing activity
Chang et al. Subunit vaccines with a saponin-based adjuvant boost humoral and cellular immunity to MERS coronavirus
Hua et al. Enhanced humoral and CD8+ T cell immunity in mice vaccinated by DNA vaccine against human respiratory syncytial virus through targeting the encoded F protein to dendritic cells
US20190231866A1 (en) Methods for safe induction of cross-clade immunity against hiv infection in humans
WO2024032468A1 (en) Preparation and use of recombinant five-component sars-cov-2 trimer protein vaccine capable of inducing broad-spectrum neutralization activity
WO2022253134A1 (en) Method for improving immunogenicity/antigenic trimer stability of ecd antigen of sars-cov-2 mutant strain
JP2023538667A (en) Vaccine against SARS-COV-2 infection
CN115477703A (en) Method for improving SARS-CoV-2 mutant strain ECD antigen immunogenicity/antigen trimer stability
JP2023519837A (en) Vaccine composition for treating coronavirus
JP2013545733A (en) Recombinant envelope protein of human immunodeficiency virus (HIV) and vaccine containing the same
US20240092840A1 (en) Vaccine formulation comprising recombinant overlapping peptides and native proteins
US20220370604A1 (en) Peptide vaccine for virus infection
Shen et al. DNA vaccine prime and replicating vaccinia vaccine boost induce robust humoral and cellular immune responses against MERS-CoV in mice
US20230174586A1 (en) Strain dis-derived recombinant vaccinia virus having novel influenza virus-derived hemagglutinin protein gene
JP2024503482A (en) Replication-competent adenovirus type 4 SARS-COV-2 vaccines and their use
EP4341275A1 (en) Amino acids, nucleotides and vectors expressing the same and uses thereof in preventing sarbecovirus infection
WO2021173965A1 (en) Identification of variable influenza residues and uses thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination