WO2022255478A1

WO2022255478A1 - Pharmaceutical composition for prostate cancer treatment

Info

Publication number: WO2022255478A1
Application number: PCT/JP2022/022594
Authority: WO
Inventors: 聡井上; 賢一高山; 直樹木村
Original assignee: 地方独立行政法人東京都健康長寿医療センター
Priority date: 2021-06-04
Filing date: 2022-06-03
Publication date: 2022-12-08
Also published as: JP2022186461A

Abstract

The purpose of the present invention is to provide a drug for treating prostate cancer including castration-resistant prostate cancer.　The problem can be solved by using this pharmaceutical composition for prostate cancer treatment, said composition including an RNasa H2 inhibitor as an active ingredient.

Description

Pharmaceutical composition for treating prostate cancer

The present invention relates to a pharmaceutical composition for treating prostate cancer. According to the present invention, refractory prostate cancer can be treated.

In Japan, there were 91,215 cases of prostate cancer in 2017, which is the number one cancer among men and is said to affect one in ten men. Prostate cancer is a malignant tumor that grows in an androgen-dependent manner. Therefore, for localized prostate cancer where the cancer is confined to the prostate, surgery or radiation therapy is performed, but for advanced prostate cancer, androgen deprivation therapy (ADT) is used. conduct. ADT is very effective in the early stages, but it gradually loses its effectiveness, leading to castration-resistant prostate cancer (CRPC), which has become a very important clinical problem (patent References 1 and 2).

Japanese Patent Application Laid-Open No. 2019-172700 JP 2019-123671 A

Therefore, an object of the present invention is to provide therapeutic agents for prostate cancer, including castration-resistant prostate cancer.

As a result of intensive research on therapeutic agents for castration-resistant prostate cancer, the present inventor surprisingly found that RNase H2 inhibitors are effective in treating prostate cancer.
The present invention is based on these findings.
Accordingly, the present invention provides
[1] A pharmaceutical composition for treating prostate cancer containing an RNase H2 inhibitor as an active ingredient,
[2] The RNase H2 inhibitor is a double-stranded nucleic acid having an RNAi effect on the RNase H2 gene, a sense strand comprising a nucleotide sequence corresponding to the target sequence of SEQ ID NO: 13, and a complement to the sense strand The pharmaceutical composition for treating prostate cancer according to [1], which is a double-stranded nucleic acid comprising an antisense strand containing a specific nucleotide sequence,
[3] The double-stranded nucleic acid is an oligonucleotide siRNA consisting of the nucleotide sequences represented by SEQ ID NOs: 1 and 2, an oligonucleotide siRNA consisting of the nucleotide sequences represented by SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and Oligonucleotide siRNA consisting of the base sequence represented by 6, Oligonucleotide siRNA consisting of the base sequences represented by SEQ ID NOS: 7 and 8, Oligonucleotide siRNA consisting of the base sequences represented by SEQ ID NOS: 9 and 10, and an oligonucleotide siRNA consisting of the base sequences represented by SEQ ID NOs: 11 and 12.
[4] the RNase H2 inhibitor is
Formula (1) below:

(Wherein, X is a single bond, an alkylene group having 1 to 3 carbon atoms, or -NH-CO-C-, Y is a single bond or -C-S-, and R ¹ is a substituent a 5- to 6-membered aromatic heterocyclic group that may have a substituent, a phenyl group that may have a substituent, a cycloalkyl group that has 5 to 6 carbon atoms that may have a substituent, or an alkyl that has 3 to 8 carbon atoms is a group, R ² is a cycloalkyl group having 5 to 6 carbon atoms which may have a substituent, a 5- to 6-membered aromatic heterocyclic group which may have a substituent, A phenyl group or an alkyl group having 3 to 8 carbon atoms, the hydrogen atom (H) of —NH— is dissociated, and the nitrogen atom (N) is bonded to the sulfur atom (S) of the substituent of the R ² group and [5] the RNaseH2 inhibitory compound is represented by the following formula (2):

2-cyclopentanamide-4-ethyl-5-methylthiophene-3-carboxamide represented by or the following formula (3):

N-[(furan-2-yl)methyl]-2-{8-thia-4,6-diazatricyclo[7.4.0.02,7]trideca-1 (9), 2 (7 ),3,5-tetraen-3-ylsulfanyl}acetamide, the pharmaceutical composition for treating prostate cancer according to [4],
Regarding.
The emergence of androgen receptor (AR) variants (AR variants; AR-Vs) has been reported as one of the causes of castration-resistant prostate cancer. siRNA SEH2A and a ribonuclease (RNase) H2 inhibitor suppressed proliferation of prostate cancer cells by increasing the expression level of the tumor suppressor gene p53 and decreasing the expression level of AR in prostate cancer cells. Furthermore, in CRPC cells, the expression level of AR-Vs was suppressed.

The pharmaceutical composition for treating prostate cancer of the present invention can effectively treat prostate cancer, particularly castration-resistant prostate cancer.

Changes in RNASEH2A and AR mRNA (A, D) and protein expression levels (B, E) in AR-positive prostate cancer cells (LNCaP cells and 22Rv1 cells) by siRNA, and cell proliferation (C, F) It is the graph which showed the influence. Photographs of tumor suppressor gene p53 and Ac-p53 protein expression (A, C) in AR-positive prostate cancer cells (LNCaP cells and 22Rv1 cells) by siRNA, and p53 downstream signals (p53, p21, BAX) is a graph showing the mRNA expression (B, D) of Graph showing the effect of siRNA on AR and AR-V7 protein (A) and mRNA (B) expression, and the effect of androgen dihydrotestosterone (DHT) stimulation on prostate cancer cell proliferation (C). is. FIG. 4 shows the in vivo therapeutic effect of siRNA on castration-resistant prostate cancer cells. Fig. 3 is a graph showing the effect of RNase H2 inhibitory compounds (RNaseH2i#1 and RNaseH2i#2) on cell proliferation of AR-positive prostate cancer cells (LNCaP cells and 22Rv1 cells). Fig. 3 is a photograph of Western blotting showing the effect of RNase H2 inhibitory compounds (RNaseH2i#1 and RNaseH2i#2) on the expression of p53 and AR. 1 is a graph showing the effects of RNase H2 inhibitory compounds (RNaseH2i#1 and RNaseH2i#2) on DNA damage (γH2AX) and apoptosis (c-PARP). In this example, the effects of RNase H2 inhibitory compounds on DNA damage and apoptosis were examined. The effect on DNA damage was detected by γH2AX, and apoptosis was examined by the expression level of cleaved-Poly (ADP-ribose) polymerase (c-PARP) caused by the degradation of Poly (ADP-ribose) polymerase (PARP), and the TUNEL method. did. In 22Rv1, both RNase H2i#1 and #2 (1 and 5 μM) increased the expression of γH2AX and c-PARP (Fig. 7A). In LNCaP cells, RNaseH2i#1 (5 μM) and RNaseH2i#2 (5 μM) increased the expression of γH2AX, and RNaseH2i#1 (1 and 5 μM) and RNaseH2i#2 (5 μM) increased the expression of c-PARP. (Fig. 7B). In TUNEL assay, both RNase H2i#1 and #2 (1 and 5 μM) significantly increased the number of apoptotic cells (Fig. 8). Fig. 3 shows photographs and graphs showing the effect of RNase H2 inhibitory compounds (RNaseH2i#1 and RNaseH2i#2) on apoptosis measured by TUNEL assay. FIG. 4 shows in vivo therapeutic effects of RNase H2 inhibitory compounds on castration-resistant prostate cancer cells.

The pharmaceutical composition for treating prostate cancer of the present invention contains an RNase H2 inhibitor as an active ingredient.

《RNase H2》
RNase H is an enzyme that hydrolyzes the RNA strands of RNA/DNA hybrids. Eukaryotes have both RNase H1 and RNase H2, and in human cells, RNase H2 mainly has RNase H enzymatic activity. RNase H2 is composed of three subunits, A, B, and C. Each protein is composed of 299 amino acids for RNase H2A, 308 amino acids for H2B, and 164 amino acids for H2C. It is a huge protein. RNase H2 activity is exhibited by the formation of a complex of three proteins.

In some prostate cancers, especially CRPC, the expression of the RNase H2A gene is elevated. In the present invention, prostate cancer can be treated by suppressing RNase H2. In addition, by suppressing the expression or activity of RNase H2, an increase in the expression level of the tumor suppressor gene p53 and/or a decrease in the expression level of AR is observed. Without limitation, these phenomena have the potential to treat prostate cancer, particularly CRPC.

The RNase H2 inhibitor is not particularly limited as long as it suppresses and/or inhibits the activity of RNase H2. mentioned. Suppression or inhibition of RNase H2 activity specifically includes, for example, suppression of RNase H2 mRNA expression, suppression of RNase H2 protein expression, suppression or inhibition of RNase H2 protein function, and the like. , but not limited to these.

<<Double-stranded nucleic acid having RNAi effect>>
The double-stranded nucleic acid is a double-stranded nucleic acid having an RNAi effect on the RNase H2 gene, and is a sense strand comprising a base sequence corresponding to the target sequence of SEQ ID NO: 13, and a base complementary to the sense strand. and an antisense strand containing the sequence. As used herein, the term "double-stranded nucleic acid" means a nucleic acid molecule containing a double-stranded nucleic acid region formed by hybridizing a desired sense strand and an antisense strand, and siRNA (small interfering RNA) Preferably.

The double-stranded nucleic acid of the present invention comprises a sense strand containing a nucleotide sequence corresponding to the target sequence of SEQ ID NO: 13, and an antisense strand containing a complementary nucleotide sequence to the sense strand. Here, the "base sequence corresponding to the target sequence" is the same base sequence as the target sequence, or one or several (eg, 2 to 3) bases in the target sequence are substituted. means a base sequence. It is known that when the double-stranded nucleic acid is siRNA, RNAi effect can be obtained even if it contains one to several base mismatches. In the present invention, not only the base sequence identical to the target sequence, but also base sequences containing mismatches may be used as long as the RNAi effect can be obtained.

In addition, the "base sequence complementary to the sense strand" in the antisense strand may be a base sequence complementary to the extent that it can hybridize with the sense strand, and a base sequence completely complementary to the sense strand. Alternatively, it may be a base sequence in which one or several (eg, 2 to 3) bases are substituted in a base sequence completely complementary to the sense strand.

(Nucleic acid types and modifications)
The type of nucleic acid constituting the double-stranded nucleic acid is not particularly limited and can be appropriately selected. Examples thereof include double-stranded RNA and DNA-RNA chimeric double-stranded nucleic acid. The chimeric type is obtained by replacing part of the double-stranded RNA having an RNAi effect with DNA, and is known to have high stability in serum and low immune response induction.
In addition, double-stranded nucleic acids are modified, for example, by modification of the 2′-OH group, substitution of the backbone with phosphorothioate or modification with a boranophosphate group, introduction of LNA (locked nucleic acid) in which the 2-position and 4-position of ribose are bridged. For example, resistance to nucleases and stabilization can be enhanced. Alternatively, for the purpose of increasing the efficiency of introduction into cells, the 5'-end or 3'-end of the sense strand of the double-stranded nucleic acid can be modified with, for example, nanoparticles, cholesterol, cell membrane-transmitting peptides, or the like. .

(siRNA)
The double-stranded RNA of the present invention is preferably siRNA (including chimeric forms). Here, "siRNA" is a small double-stranded RNA of 18 bases to 29 bases in length (preferably 21 to 23 bases in length) having a sequence complementary to the antisense strand (guide strand) of the siRNA. It has the function of cleaving the mRNA of the target gene with and suppressing the expression of the target gene. That is, siRNA can destroy messenger RNA (mRNA) by RNA interference (RNAi) and suppress gene expression in a sequence-specific manner. The nucleotide sequence of siRNA can be appropriately designed from the nucleotide sequence of RNase H2A mRNA (SEQ ID NO: 13). The siRNA is not particularly limited in its terminal structure as long as it contains a sense strand and an antisense strand as described above and exhibits a desired RNAi effect, and can be appropriately selected. , may have a blunt end or may have a protruding end (overhang). Above all, the siRNA preferably has a structure in which the 3′ end of each strand protrudes by 2 to 6 bases, and more preferably has a structure in which the 3′ end of each strand protrudes by 2 bases. In addition, siRNA produced from the nucleotide sequence of mRNA of RNase H2A can be used as an active ingredient of a pharmaceutical composition for treating prostate cancer, regardless of whether the effect is large or small.

As the siRNA of the present invention, as shown in Table 1, for example, the sense strand of SEQ ID NO: 1 (21 bases) and the antisense strand of SEQ ID NO: 2 (21 bases) targeting SEQ ID NO: 14 (23 bases) siRNA consisting of (siRNASEH2A # 1 in the examples described later), the sense strand of SEQ ID NO: 3 (21 bases) and the antisense strand of SEQ ID NO: 4 (21 bases) with SEQ ID NO: 15 (23 bases) as the target sequence siRNA (same siRNASEH2A#2) consisting of a sense strand of SEQ ID NO: 5 (21 bases) targeting SEQ ID NO: 16 (23 bases) and an antisense strand of SEQ ID NO: 6 (21 bases) (same as siRNA SEH2A #3), siRNA consisting of a sense strand of SEQ ID NO: 7 (21 bases) targeting SEQ ID NO: 17 (23 bases) and an antisense strand of SEQ ID NO: 8 (21 bases) (same siRNA SEH2A #4), siRNA (same siRNASEH2A#5) consisting of the sense strand of SEQ ID NO: 9 (21 bases) and the antisense strand of SEQ ID NO: 10 (21 bases) targeting SEQ ID NO: 18 (23 bases), SEQ ID NO: 19 (23 bases) siRNA (same siRNA SEH2A#6) consisting of the sense strand of SEQ ID NO: 11 (21 bases) and the antisense strand of SEQ ID NO: 12 (21 bases) targeting SEQ ID NO: 11 (21 bases).

(target sequence)
#1: CTCAGCATCCGAGAATCAGGAGG (858-880) (SEQ ID NO: 14)
#2: CCGTTCTTCCCACCGATATTTCC (933-935) (SEQ ID NO: 15)
#3: GTCTACGCCATCTGTTATTGTCC (226-248) (SEQ ID NO: 16)
#4: GCCACTGGGCTTATACAGTATGC (451-473) (SEQ ID NO: 17)
#5: CTGCAGGACTTGGATACTGATTA (685-707) (SEQ ID NO: 18)
#6: TGGGTGTTGGTTGATTAATTTTA (1147-1169) (SEQ ID NO: 19)

(Production method)
The double-stranded RNA (particularly siRNA) of the present invention can be produced based on conventionally known techniques.
For example, single-stranded RNAs of 18-base length to 29-base length corresponding to the desired sense strand and antisense strand are chemically synthesized using an existing automatic DNA/RNA synthesizer or the like, and then synthesized. It can be produced by annealing. In addition, by constructing a desired siRNA expression vector, such as the vector of the present invention described below, and introducing the expression vector into cells, siRNA can also be produced using intracellular reactions.

In the DNA contained in the vector, it is preferable that a promoter sequence for controlling transcription of the double-stranded nucleic acid is linked upstream (5' side) of the base sequence encoding the double-stranded nucleic acid. The promoter sequence is not particularly limited and can be appropriately selected. Examples thereof include pol II promoters such as CMV promoter, and pol III promoters such as H1 promoter and U6 promoter. Furthermore, it is more preferable that a terminator sequence for terminating transcription of the double-stranded nucleic acid is ligated downstream (3' side) of the base sequence encoding the double-stranded nucleic acid. The terminator sequence is also not particularly limited and can be appropriately selected depending on the purpose.

The vector is not particularly limited as long as it contains the DNA, and can be appropriately selected depending on the purpose. Examples thereof include plasmid vectors and virus vectors. The vector is preferably an expression vector capable of expressing the double-stranded nucleic acid (particularly siRNA).
The expression mode of the double-stranded nucleic acid is not particularly limited and can be appropriately selected according to the purpose. For example, as a method of expressing siRNA as a double-stranded nucleic acid, two short single-stranded RNAs are expressed. A method (tandem type), a method of expressing single-stranded RNA as shRNA (short hairpin RNA) (hairpin type), and the like can be mentioned. Here, shRNA is a single-stranded RNA containing a dsRNA region of about 18 to 29 bases and a loop region of about 3 to 9 bases. to form a hairpin-shaped double-stranded RNA. The shRNA is then cleaved by Dicer (RNase III enzyme) into siRNA, which can function to suppress the expression of target genes.

The tandem-type siRNA expression vector contains a DNA sequence encoding a sense strand and a DNA sequence encoding an antisense strand that constitute the siRNA, and is upstream (5' side) of the DNA sequence encoding each strand. A promoter sequence is ligated to each strand, and a terminator sequence is ligated downstream (3' side) of the DNA sequence encoding each strand.

In the hairpin-type siRNA expression vector, a DNA sequence encoding a sense strand and a DNA sequence encoding an antisense strand constituting the siRNA are arranged in opposite directions, and the sense strand DNA sequence and the antisense strand DNA sequences are linked via a loop sequence, and a promoter sequence is linked upstream (5' side) and a terminator sequence is linked downstream (3' side).

<<RNase H2 inhibitory compound>>
A pharmaceutical composition of the invention may comprise an RNase H2 inhibitory compound. The RNase H2 inhibitory compound is not particularly limited, but has the following formula (1):

(Wherein, X is a single bond, an alkylene group having 1 to 3 carbon atoms, or -NH-CO-C-,
Y is a single bond or -CS-,
R ¹ is a 5- to 6-membered aromatic heterocyclic group which may have a substituent, a phenyl group which may have a substituent, a cycloalkyl group having 5 to 6 carbon atoms which may have a substituent, or an alkyl group having 3 to 8 carbon atoms,
R ² is a cycloalkyl group having 5 to 6 carbon atoms which may have a substituent, a 5- to 6-membered aromatic heterocyclic group which may have a substituent, a phenyl group which may have a substituent, or an alkyl group having 3 to 8 carbon atoms,
The hydrogen atom (H) of —NH— may be dissociated, and the nitrogen atom (N) may bond with the sulfur atom (S) of the substituent of the R ² group to form a ring structure)
The compound represented by is mentioned.

As used herein, “X is a single bond” means that R ¹ and a nitrogen atom (N) are directly bonded. Moreover, "Y is a single bond" means that R ² and the carbon atom (C) are bonded as they are.
Examples of the alkylene group having 1 to 3 carbon atoms include methylene group, ethylene group and propylene group.
A 5- to 6-membered aromatic heterocyclic group which may have a substituent means a group obtained by removing one hydrogen atom from an aromatic heterocyclic ring containing a heteroatom in the ring. Heteroatoms include oxygen, sulfur, or nitrogen atoms. Specific aromatic heterocyclic groups or condensed rings thereof include pyridyl, pyrazyl, pyrimidyl, quinolyl, isoquinolyl, pyrrolyl, indolenyl, imidazolyl, carbazolyl, thienyl, and furyl groups. be done. When the aromatic heterocyclic group has a substituent, the hydrogen atom of the aromatic heterocyclic group is replaced with another group, but the number of substituents is not limited, and is, for example, 1 to 5. Two substituents together may also be fused with a 5- to 6-membered aromatic heterocyclic group as an aromatic ring, heteroaromatic ring, saturated heterocyclic ring, or cycloalkyl ring, and bicyclic , or three or more rings may be condensed.
A cycloalkyl group having 5 to 6 carbon atoms includes a cyclopentyl group or a cyclohexyl group.
Examples of alkyl groups having 3 to 8 carbon atoms include propyl, butyl, pentyl, hexyl, heptyl and octyl groups.

Examples of the substituent include an alkyl group having 1 to 3 carbon atoms, a halogen atom (eg, a chlorine atom, a fluorine atom, or a bromine atom), an amide group (—CO—NH ₂ ), a carboxy group, a methoxycarbonyl group, or an ethyl Toshikicarbonyl group is mentioned.
As substituents of an aromatic heterocyclic group, a phenyl group, or a cycloalkyl group, two substituents together form an aromatic ring, an aromatic heterocyclic ring, a saturated heterocyclic ring, or a cycloalkyl ring, an aromatic It may be condensed with a heterocyclic group, a phenyl group, or a cycloalkyl group, and may be a condensed ring having two, three or more rings. The aromatic ring, aromatic heterocyclic ring, saturated heterocyclic ring or cycloalkyl ring is preferably 5-membered or 6-membered. These condensed rings may further have the substituents described above.

When the hydrogen atom (H) of the -NH- is dissociated and the nitrogen atom (N) bonds with the sulfur atom (S) of the substituent of the R ² group to form a ring structure, the cycloalkyl group of R ² , It forms a condensed ring with an aromatic heterocyclic group or a phenyl group.

Specific examples of the compound of formula (1) include compounds represented by the following chemical formulas.

The compound represented by the formula (1) is preferably represented by the following formula (2):

2-cyclopentanamide-4-ethyl-5-methylthiophene-3-carboxamide (2-cyclopentaneamido-4-ethyl-5-methylthiophene-3-carboxamide) represented by (hereinafter sometimes referred to as compound A) or the following formula (3):

N-[(furan-2-yl)methyl]-2-{8-thia-4,6-diazatricyclo[7.4.0.02,7]trideca-1 (9), 2 (7 ), 3,5-tetraen-3-ylsulfanyl}acetamide (N-[(furan-2-yl)methyl]-2-{8-thia-4,6-diazatricyclo[7.4.0.02,7]trideca-1 (9),2(7),3,5-tetraen-3-ylsulfanyl}acetamide) (hereinafter sometimes referred to as compound B).

RNase H2 inhibitory compounds used in the present invention include salts thereof. The salt of the RNaseH2 inhibitory compound is a pharmaceutically acceptable salt, and may form an acid addition salt or a salt with a base depending on the type of substituent. Specifically, inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid , lactic acid, malic acid, mandelic acid, tartaric acid, dibenzoyltartaric acid, ditoluoyltartaric acid, citric acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, aspartic acid, glutamic acid, and other organic acids. Salts, salts with inorganic bases such as sodium, potassium, magnesium, calcium and aluminum, salts with organic bases such as methylamine, ethylamine, ethanolamine, lysine and ornithine, salts with various amino acids and amino acid derivatives such as acetylleucine, and ammonium salts etc.

Furthermore, the compounds used in the present invention also include various hydrates and solvates of the above-mentioned RNase H2 inhibitory compounds and salts thereof, and polymorphic substances. The compounds also include compounds labeled with various radioactive or non-radioactive isotopes.

A pharmaceutical composition containing one or more of the RNase H2 inhibitory compounds or salts thereof as an active ingredient may be prepared using excipients commonly used in the art, such as pharmaceutical excipients and pharmaceutical carriers. can be prepared by a commonly used method.
Administration is oral administration in tablets, pills, capsules, granules, powders, liquids, etc.; Any form of parenteral administration such as an ointment, a transdermal patch, a transmucosal liquid, a transmucosal patch, or an inhalant may be used.

Solid compositions for oral administration include tablets, powders, granules and the like. In such solid compositions one or more active ingredients are combined with at least one inert excipient such as lactose, mannitol, glucose, hydroxypropylcellulose, microcrystalline cellulose, starch, polyvinylpyrrolidone. , and/or magnesium aluminometasilicate and the like. The composition may contain inert additives such as lubricants such as magnesium stearate, disintegrants such as sodium carboxymethyl starch, stabilizers, and solubilizers in accordance with conventional methods. . Tablets or pills may, if desired, be sugar-coated or film-coated with gastric or enteric substances.
Liquid compositions for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or elixirs and the like, and commonly used inert diluents such as purified water. or containing ethanol. In addition to inert diluents, the liquid compositions may contain adjuvants such as solubilizers, wetting agents, suspending agents, sweetening agents, flavoring agents, fragrances and preservatives.

Injections for parenteral administration contain sterile aqueous or non-aqueous solutions, suspensions or emulsions. Aqueous solvents include, for example, distilled water for injection or physiological saline. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, alcohols such as ethanol, and polysorbate 80 (pharmacopoeial name). Such compositions may further comprise a tonicity agent, a preservative, a wetting agent, an emulsifying agent, a dispersing agent, a stabilizing agent, or a solubilizing agent. They are sterilized by, for example, filtration through a bacteria-retaining filter, formulation with sterilizing agents or irradiation. They can also be used by preparing a sterile solid composition and dissolving or suspending them in sterile water or a sterile solvent for injection before use.

External preparations include ointments, plasters, creams, jellies, poultices, sprays, lotions, eye drops, ophthalmic ointments, and the like. It contains commonly used ointment bases, lotion bases, aqueous or non-aqueous solutions, suspensions, emulsions and the like. For example, ointment or lotion bases include polyethylene glycol, propylene glycol, white petrolatum, bleached beeswax, polyoxyethylene hydrogenated castor oil, glyceryl monostearate, stearyl alcohol, cetyl alcohol, lauromacrogol, sorbitan sesquioleate, and the like. mentioned.

Transmucosal agents such as inhalants and nasal agents are solid, liquid or semi-solid, and can be produced according to conventionally known methods. For example, known excipients, pH adjusters, preservatives, surfactants, lubricants, stabilizers, thickeners and the like may be added as appropriate. Administration can use a suitable inhalation or insufflation device. For example, known devices such as metered dose inhalation devices and nebulizers are used to administer the compounds either alone or as a powder in a formulated mixture, or as a solution or suspension in combination with a pharmaceutically acceptable carrier. be able to. Dry powder inhalers and the like may be for single or multiple doses and may utilize dry powder or powder-containing capsules. Alternatively, it may be in the form of a pressurized aerosol spray or the like using a suitable propellant such as a chlorofluoroalkane, hydrofluoroalkane or carbon dioxide.

The dosage varies depending on the type of disease, symptoms, age, sex, etc. of each individual patient, but in the case of oral administration, it is usually about 0.001 mg / kg to 500 mg / kg per day for adults, and this is once or Administer in 2 to 4 divided doses. When administered by injection, once or twice a day for an adult, about 0.0001 mg/kg to 10 mg/kg is administered by bolus injection or intravenous drip infusion. In the case of inhalation, about 0.0001 mg/kg to 10 mg/kg is administered once or multiple times per day for adults. In the case of a transdermal preparation, the dose of about 0.01 mg/kg to 10 mg/kg per day for adults is applied once or twice a day.

The RNaseH2 inhibitory compound or its salt can be used in combination with various therapeutic or preventive agents for diseases for which the RNaseH2 inhibitory compound or its salt is considered to be effective. The combinations may be administered simultaneously or administered separately sequentially or at desired time intervals. Co-administered formulations may be combined or formulated separately.

Prostate cancer, which is the target of treatment with the pharmaceutical composition of the present invention, is cancer that develops in the prostate gland, and antiandrogen agents are sometimes administered as hormone therapy. The type of prostate cancer to be treated is not particularly limited, but it is particularly effective for androgen-independent prostate cancer (CRPC) that has acquired resistance to hormone therapy. The pharmaceutical composition of the present invention can be effectively used for CRPC that has acquired resistance to hormone therapy, since it exhibits a remarkable anticancer effect on AR-positive and AR-negative CRPC. However, prostate cancer that is not hormonally resistant and resistant to treatment by other mechanisms can also be treated.

<<Treatment method for prostate cancer>>
The RNase H2 inhibitors can be used in methods of treating prostate cancer. That is, the present specification includes the step of administering to a patient with prostate cancer a therapeutically effective amount of an RNase H2 inhibitor such as a double-stranded nucleic acid having an RNAi effect, an anti-RNase H antibody, or an RNase H inhibitory compound. A method of treating cancer is disclosed.

RNase H2 inhibitors for use in methods of treating prostate cancer
The RNase H2 inhibitors can be used in methods of treating prostate cancer. Thus, disclosed are RNase H2 inhibitors, such as double-stranded nucleic acids with said RNAi effect, anti-RNase H antibodies, or RNase H inhibitory compounds, for use in methods of treating prostate cancer.

<<Use of RNase H2 Inhibitor for Manufacture of Pharmaceutical Composition>>
Said RNase H2 inhibitors can be used for the manufacture of a pharmaceutical composition for the treatment of prostate cancer. That is, the present specification describes the use of a double-stranded nucleic acid having an RNAi effect, an anti-RNase H antibody, or an RNase H2 inhibitory substance such as an RNase H inhibitory compound for the production of a pharmaceutical composition for treating prostate cancer. disclose.

《Action》
Although the mechanism by which RNase H2 inhibitors are effective in treating prostate cancer has not been analyzed in detail, it can be presumed as follows. The RNase H2 inhibitor inhibits the expression of RNase H2 mRNA, inhibits the expression of RNase H2 protein, and inhibits the function (activity) of RNase H2, thereby increasing the activity of RNase H2. Cancer can be suppressed. For example, by suppressing the expression or activity of RNase H2, it is presumed that the proliferation of prostate cancer cells can be suppressed by increasing the expression level of the tumor suppressor gene p53 and/or decreasing the expression level of AR.
The RNase H2 inhibitory compound of the present invention can suppress prostate cancer in which RNase H2 activity is enhanced by inhibiting the function (activity) of RNase H2. ¹ and R ² each have a 5- to 6-membered aromatic heterocyclic group, a phenyl group, a cycloalkyl group having 5 to 6 carbon atoms, or an alkyl group having 3 to 8 carbon atoms, thereby exhibiting RNase H2 inhibitory activity. presumed to indicate

The present invention will be specifically described below with reference to examples, but these are not intended to limit the scope of the present invention.

<<Example 1>>
In this example, siRNA against RNase H2A was used to examine the effects on the expression of mRNA and protein in AR-positive prostate cancer cells (LNCaP cells and 22Rv1 cells) and cell proliferation.
Androgen receptor-positive prostate cancer cell lines LNCaP (human left clavicular lymph node-derived prostate cancer cells) and 22Rv1 cells (human prostate cancer-derived epithelial cells) were cultured under conditions of 37° C. and 5% CO ₂ . Roswell Park Memorial Institute (RPMI) 1640 (Sigma-Aldrich Japan, Tokyo, Japan) supplemented with 10% Fetal bovine serum (FBS) and 1% penicillin-streptomycin (Thermofisher, Tokyo, Japan) was used as the medium.

The following siRNA was produced.
siRNA SEH2A#1 (858-880)
5'-CAGCAUCCGAGAAUCAGGAGG-3'
5'-UCCUGAUUCUCGGAUGCUGAG-3'
siRNA SEH2A#2 (933-935)
5'-GUUCUUCCCACCGAUAUUUCC-3'
5'-AAAUAUCGGUGGGAAGAACGG-3'
siRNA SEH2A#3(226-248)
5'-CUACGCCAUCUGUUAUUGUCC-3'
5'-ACAAUAACAGAUGGCGUAGAC-3'
siRNA SEH2A#4(451-473)
5'-CACUGGGCUUAUACAGUAUGC-3'
5'-AUACUGUAUAAGCCCAGUGGC-3'
siRNA SEH2A#5(685-707)
5'-GCAGGACUUGGAUACUGAUUA-3'
5'-AUCAGUAUCCAAGUCCUGCAG-3'
siRNA SEH2A#6 (1147-1169)
5'-GGUGUUGGUUGAUUAAUUUUA-3'
5'-AAAUUAAUCAACCAACACCCA-3'

Control siRNA (silencer select siRNA) was purchased from Thermofisher (Tokyo, Japan). Introduction of siRNA into cells was performed using Lipofectamine RNAiMAX (Thermofisher, Tokyo, Japan) according to the protocol.
Suppression of RNASEH2A expression was measured by qRT-PCR and western blot method using RNASEH2A and AR-specific antibodies. Analysis of cell proliferation ability was performed by counting the number of viable cells. 5×10 ⁴ cells were seeded in a 24-well plate, and RNase H2i was added the next day. Three days after the addition of RNase H2i, the cells were collected with PBS, and the same amount of 0.5% trypan blue staining solution (Nacalaitesque, Kyoto, Japan) was added to stain dead cells. The number of unstained cells was counted with a hemocytometer (NanoEnTek, Seoul, Korea). For analysis, each group was counted three times, and the mean and standard deviation were calculated.

In siRNASEH2A-treated cells, it was confirmed that RNASEH2A and AR mRNA and protein expression levels were suppressed compared to siControl (Fig. 1A, B, D, E). In addition, suppression of RNASEH2A expression was found to suppress cell growth with a significant difference in any siRNASEH2A in 22Rv1, and in LNCaP, siRNASEH2A #2 and #5 with a significant difference ( Figures 1C and F).

<<Example 2>>
In this example, siRNASEH2A#1 and siRNASEH2A#5 were used to examine the effect on the expression of the tumor suppressor gene p53.
RNASEH2A expression was suppressed, and protein expression was examined by Western blotting using RNASEH2A, p53, and Ac-p53 specific antibodies. The expression levels of p53 and Ac-p53 were increased in siRNA SEH2A #1 and #5-treated cells compared to siControl (FIGS. 2A and C). Furthermore, when the mRNA expression levels of p53 downstream signals (p53, p21, BAX) were measured by qRT-PCR, the expression levels of p53, p21, and BAX increased in siRNA SEH2A #1 and #5-treated cells compared to siControl. (Fig. 2B and D).

<<Example 3>>
In this example, siRNASEH2A#1 and siRNASEH2A#5 were used to examine the effects on the expression of AR and AR-V7.
Expression of RNASEH2A was suppressed, and protein expression was examined by Western blot method using AR and AR-V7 specific antibodies. Expression of AR and AR-V7 mRNA was also measured by qPCR. Furthermore, the effect of the addition of dihydrotestosterone DHT, which is an androgen, on the antiproliferative effect was investigated.
The expression levels of AR and AR-V7 were decreased in siRNA SEH2A #1 and #5 treated cells compared to siControl (Fig. 3). Furthermore, the DHT-dependent growth-promoting effect was significantly suppressed compared to siControl.

<<Example 4>>
In this example, the in vivo effects of siRNA against RNase H2A on castration-resistant prostate cancer cells were examined in nude mice.
22Rv1 cells were subcutaneously injected into nude mice, and castration was performed after tumor formation was confirmed (N=10). Tumors were injected with siControl and siRNA SEH2A#5 every 48 hours and tumor size was measured. A significant reduction in tumor size was observed with siRNA SEH2A#5 compared to siControl. Furthermore, when proteins were extracted from the tumor and the detection of the expression levels of AR and p53 was examined, an increase in the expression levels of p53 and a decrease in the expression levels of AR and AR-V7 were observed with siRNASEH2A#5 treatment (Fig. 4). ).

<<Example 5>>
In this example, the effects of RNase H2 inhibitory compounds on prostate cancer cell lines were examined. 2-cyclopentaneamido-4-ethyl-5-methylthiophene-3-carboxamide (RNaseH2i#1) and N-[( furan-2-yl)methyl]-2-{8-thia-4,6-diazatricyclo[7.4.0.02,7]trideca-1(9),2(7),3,5-tetraene- 3-ylsulfanyl}acetamide (N-[(furan-2-yl)methyl]-2-{8-thia-4,6-diazatricyclo[7.4.0.02,7]trideca-1(9),2(7) ,3,5-tetraen-3-ylsulfanyl}acetamide;RNaseH2i#2) was used. 22Rv1, LNCaP, and RWPE cells were seeded in 24-well plates at 3×10 ⁴ cells each, and after 24 hours, compound A or compound B was added at 100, 50, 10, 5, 1, 0.5, 0.1, 0.05 μM. Three days after addition, cells were collected with PBS, dead cells were stained with 0.5% trypan blue staining solution, and the number of unstained cells was counted. Each measurement was performed three times, and the percentage of the number of living cells in the control was measured and compared with the number of living cells in the control by t-test for statistical analysis. In 22Rv1 cells, 5 μM of compound A or compound B halved the number of cells compared to the control, and in LNCaP cells, 10 μM of

RNaseH2i#

1 and 5 μM of RNaseH2i#2 halved the number of cells compared to the control. However, no cytostatic effect was observed in RWPE cells, which is a normal prostate epithelial cell line (Fig. 5).

<<Example 6>>
In this example, the effects of RNase H2 inhibitory compounds on p53 and AR were examined. 22Rv1, LNCaP cells were seeded at 1×10 ⁵ in a 6-well plate, RNase H2i#1 or #2 was added 24 hours later, and proteins were collected 48 hours later. A decrease in AR expression in 22Rv1 was observed in RNaseH2i#1 (5 μM) and RNaseH2i#2 (1 and 5 μM), and an increase in p53 expression was observed in both RNaseH2i#1 and #2 (1 and 5 μM) (FIG. 6A). . In LNCaP cells, decreased AR expression was observed with RNase H2i #2 (1 and 5 μM), and increased expression of p53 was observed with both RNase H2i #1 and #2 (1 and 5 μM) (FIG. 6B).

<<Example 7>>
In this example, the effects of RNase H2 inhibitory compounds on DNA damage and apoptosis were investigated. The effect on DNA damage was detected by γH2AX, and apoptosis was examined by the expression level of cleaved-Poly (ADP-ribose) polymerase (c-PARP) caused by the degradation of Poly (ADP-ribose) polymerase (PARP), and the TUNEL method. did. In 22Rv1, both RNase H2i#1 and #2 (1 and 5 μM) increased the expression of γH2AX and c-PARP (Fig. 7A). In LNCaP cells, RNaseH2i#1 (5 μM) and RNaseH2i#2 (5 μM) increased the expression of γH2AX, and RNaseH2i#1 (1 and 5 μM) and RNaseH2i#2 (5 μM) increased the expression of c-PARP. (Fig. 7B). Also, in the TUNEL assay, it was found that both RNase H2i#1 and #2 (1 and 5 µM) significantly increased the number of apoptotic cells (Fig. 8).

<<Example 8>>
In this example, the effects of RNase H2 inhibitory compounds on proliferation of prostate cancer cells were examined in vivo. 22Rv1 cells were subcutaneously implanted in BALB/c nude mice, and after confirmation of tumor formation, castration was performed to prepare CRPC model mice. RNase H2i#1 and #2 were intraperitoneally administered to CRPC model mice at 0.5 mg/mouse/dose, 5 times/week, respectively, and the effect on tumor growth was examined. As a result, tumor growth in mice administered with RNase H2i#1 and #2 was significantly suppressed compared to controls (Fig. 9).

The pharmaceutical composition for treating prostate cancer of the present invention can be effectively used for treating prostate cancer.

Claims

A pharmaceutical composition for treating prostate cancer containing an RNase H2 inhibitor as an active ingredient.
The RNase H2 inhibitor is a double-stranded nucleic acid having an RNAi effect on the RNase H2 gene, the sense strand comprising a base sequence corresponding to the target sequence of SEQ ID NO: 13, and a base complementary to the sense strand 2. The pharmaceutical composition for treating prostate cancer according to claim 1, which is a double-stranded nucleic acid comprising an antisense strand comprising the sequence.
The double-stranded nucleic acid is an oligonucleotide siRNA consisting of the base sequences represented by SEQ ID NOS: 1 and 2, an oligonucleotide siRNA consisting of the base sequences represented by SEQ ID NOS: 3 and 4, and SEQ ID NOS: 5 and 6. oligonucleotide siRNA consisting of the base sequence represented by SEQ ID NOS: 7 and 8, oligonucleotide siRNA consisting of the base sequences represented by SEQ ID NOS: 9 and 10, and SEQ ID NOS: 3. The pharmaceutical composition for treating prostate cancer according to claim 2, which is a double-stranded nucleic acid selected from the group consisting of oligonucleotide siRNA consisting of base sequences represented by 11 and 12.
wherein the RNase H2 inhibitor is
Formula (1) below:

(Wherein, X is a single bond, an alkylene group having 1 to 3 carbon atoms, or -NH-CO-C-,
Y is a single bond or -CS-,
R 1 is a 5- to 6-membered aromatic heterocyclic group which may have a substituent, a phenyl group which may have a substituent, a cycloalkyl group having 5 to 6 carbon atoms which may have a substituent, or an alkyl group having 3 to 8 carbon atoms,
R 2 is a cycloalkyl group having 5 to 6 carbon atoms which may have a substituent, a 5- to 6-membered aromatic heterocyclic group which may have a substituent, a phenyl group which may have a substituent, or an alkyl group having 3 to 8 carbon atoms,
The hydrogen atom (H) of —NH— may be dissociated, and the nitrogen atom (N) may bond with the sulfur atom (S) of the substituent of the R 2 group to form a ring structure)
The pharmaceutical composition for treating prostate cancer according to claim 1, which is a compound represented by:
The RNaseH2 inhibitory compound has the following formula (2):

2-cyclopentanamide-4-ethyl-5-methylthiophene-3-carboxamide represented by or the following formula (3):

N-[(furan-2-yl)methyl]-2-{8-thia-4,6-diazatricyclo[7.4.0.02,7]trideca-1 (9), 2 (7 ),3,5-tetraen-3-ylsulfanyl}acetamide, the pharmaceutical composition for treating prostate cancer according to claim 4.