WO2022250405A1 - 렌티바이러스에 의해 특정 유전자가 삽입된 보툴리눔 독소에 민감한 세포 - Google Patents

렌티바이러스에 의해 특정 유전자가 삽입된 보툴리눔 독소에 민감한 세포 Download PDF

Info

Publication number
WO2022250405A1
WO2022250405A1 PCT/KR2022/007323 KR2022007323W WO2022250405A1 WO 2022250405 A1 WO2022250405 A1 WO 2022250405A1 KR 2022007323 W KR2022007323 W KR 2022007323W WO 2022250405 A1 WO2022250405 A1 WO 2022250405A1
Authority
WO
WIPO (PCT)
Prior art keywords
botulinum toxin
cells
cell
measuring
septin2
Prior art date
Application number
PCT/KR2022/007323
Other languages
English (en)
French (fr)
Inventor
장성수
임일호
이학섭
안용식
최두진
Original Assignee
주식회사 에이티지씨
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220063008A external-priority patent/KR20220159283A/ko
Application filed by 주식회사 에이티지씨 filed Critical 주식회사 에이티지씨
Priority to CA3219818A priority Critical patent/CA3219818A1/en
Priority to EP22811598.6A priority patent/EP4349992A1/en
Priority to BR112023024599A priority patent/BR112023024599A2/pt
Priority to CN202280037765.5A priority patent/CN117529557A/zh
Publication of WO2022250405A1 publication Critical patent/WO2022250405A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/24—Metalloendopeptidases (3.4.24)
    • C12Y304/24069—Bontoxilysin (3.4.24.69), i.e. botulinum neurotoxin
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a cell for measuring botulinum toxin activity and a method for measuring botulinum toxin activity using the same.
  • Botulinum toxin is a neurotoxin produced by Clostridium botulinum, a gram-positive anaerobic bacterium that grows on rotten canned food and spoiled meat. It is classified into 8 neurotoxins, 7 of which (A, B, C, D, E, F, G) can cause nerve paralysis.
  • the size is about 150 kDa, and it is composed of a non-toxin protein complex in addition to the botulinum toxin protein, and the size of each complex is generated up to 900 kDa depending on the type of neurotoxin.
  • the type of action, target, and active period are different.
  • botulinum toxin type A is known as one of the deadliest biological agents. This botulinum toxin blocks the signal that causes muscle spasm or contraction to cause paralysis. Since being approved by the US FDA in 1989 as a biological agent based on this function, it has been widely used for therapeutic or cosmetic purposes. .
  • diseases such as strabismus, torticollis, blepharospasm, inability to relax, dentition, back pain, etc., and for cosmetic purposes, wrinkles, frown lines, square jaw treatment, hyperhidrosis, etc. is used for the treatment of
  • mouse LD 50 a lethality test using a mouse.
  • the unit on the label of the pharmaceutical preparation is the mouse LD 50 unit.
  • it has limitations such as the large number of mice required, the high cost for the test, and the difficulty in seeing differences according to the serotype of botulinum toxin ( Korean Patent Publication No. 10-2012-0134154).
  • the present invention was made to solve the above problems in the prior art, and an object of the present invention is to provide a cell for measuring botulinum toxin activity and a method for measuring botulinum toxin activity using the same.
  • These cells are cells overexpressing SEPTIN2 or Thioredoxin (TXN) genes, and can evaluate all of botulinum toxin binding, cellular uptake, cytoplasmic translocation and protease activity, as well as significantly improved sensitivity to botulinum toxin, resulting in low
  • a dose of botulinum toxin can also be verified with high accuracy.
  • the activity of the botulinum toxin pharmaceutical composition in the form of raw materials and finished drugs can also be measured.
  • the present invention provides cells for measuring botulinum toxin activity overexpressing SEPTIN2 or Thioredoxin (TXN).
  • the cell may overexpress the gene by inserting the SEPTIN2 or TXN gene into the cell, preferably by a method such as transduction or transfection, but generally known It is not limited thereto as long as it is a method of inserting genes into existing cells.
  • the SEPTIN2 is preferably a human SEPTIN2 gene, more preferably a gene expressing a 3,726 bp mRNA sequence of NCBI accession number NM_001008491.2, but variants thereof are also included in the scope of the present invention. Specifically, it may include a sequence having a sequence homology of 90% or more, more preferably 95% or more, and most preferably 98% or more to the mRNA sequence of NM_001008491.2.
  • Percentage of sequence homology is determined by comparing the optimally aligned sequence to the comparison region, wherein a portion of the nucleotide sequence in the comparison region is added or added compared to the reference sequence (not including additions or deletions) to the optimal alignment of the sequences. It may contain deletions (ie gaps).
  • the TXN is preferably a human TXN gene, more preferably a gene expressing a 737bp mRNA sequence of NCBI accession number NM_003329.4, but variants thereof are also included in the scope of the present invention.
  • sequence homology may include a sequence having a sequence homology of 90% or more, more preferably 95% or more, and most preferably 98% or more to the mRNA sequence of NM_003329.4. “Percentage of sequence homology” is determined by comparing the optimally aligned sequence to the comparison region, wherein a portion of the nucleotide sequence in the comparison region is added or added compared to the reference sequence (not including additions or deletions) to the optimal alignment of the sequences. It may contain deletions (ie gaps).
  • the cells are characterized in that their susceptibility to botulinum toxin intoxication is increased compared to wild type cells due to overexpression of SEPTIN2 or TXN genes.
  • the cells are preferably SiMa cells, LAN-2 cells, PC12 cells, Neuro-2a cells, LA1-55n cells, N18 cells, SH-SY5Y cells, Kelly cells, NB69 cells .
  • the botulinum toxin may be selected from the group consisting of botulinum serotypes A, B, C, D, E, F and G.
  • the present invention comprises the steps of a) treating and culturing the botulinum toxin to the cells for measuring the activity of the botulinum toxin; b) lysing the cultured cells and collecting the cell lysate; and c) measuring the amount of SNAP-25 cleavage product in the cell lysate.
  • the amount of the SNAP-25 cleavage product is characterized by measuring using a sandwich immunoassay (ELISA), Western blot, etc., but is known as a method used to detect proteins If there is a method, it is not limited thereto.
  • ELISA sandwich immunoassay
  • Western blot etc.
  • the present invention provides a kit for measuring botulinum toxin activity, comprising the cell for measuring botulinum toxin activity as an active ingredient.
  • the present invention provides a use for measuring botulinum toxin activity of the cell for measuring botulinum toxin activity.
  • Cells for measuring botulinum toxin activity according to the present invention have significantly improved sensitivity to botulinum toxin by overexpressing SEPTIN2 or Thioredoxin, so even low doses of botulinum toxin can be verified with high accuracy, as well as botulinum toxin binding and cell absorption , it is expected to be able to replace a number of animal experiments because it can evaluate both translocation into the cytoplasm and protease activity.
  • the activity of not only botulinum toxin but also botulinum toxin pharmaceutical compositions in the form of raw materials and finished drugs can be measured, it is expected that the method can be easily applied to industries in various fields using botulinum toxin.
  • TXN Thioredoxin
  • FIG. 2 is a diagram briefly illustrating a pLenti-C-Myc-DDK-P2A-Puro vector map.
  • FIG 3 is a view showing the results of microscopic examination of the cultured 293FT cell line according to an embodiment of the present invention.
  • FIG. 4 is a schematic diagram showing a method for preparing a transduced cell line using a lentivirus according to an embodiment of the present invention.
  • FIG. 5 is a view showing a method of separating and culturing cell lines into individual colonies using a cloning cylinder according to an embodiment of the present invention.
  • FIG. 6 is a view showing the results of Western blotting for proteins expressed in the transduced cell line according to an embodiment of the present invention.
  • FIG. 7 is a diagram showing binding sites of primers prepared for PCR according to an embodiment of the present invention.
  • FIG. 8 is a view showing the result of confirming the introduced gene by PCR according to an embodiment of the present invention.
  • FIG. 9 is a schematic diagram showing the principle of sandwich ELISA.
  • FIG. 10 is a diagram showing the result of confirming the sensitivity to botulinum toxin between a control group and a cell line transduced with the SEPTIN2 gene according to an embodiment of the present invention by comparing the amount of SNAP-25 cut.
  • 11 is a view showing the result of confirming the sensitivity to botulinum toxin between a control group and a transduced cell line according to an embodiment of the present invention through a raw data ratio between each group.
  • FIG. 12 is a view showing the result of confirming the sensitivity to botulinum toxin between a control group and a cell line transduced with a Thioredoxin gene according to an embodiment of the present invention by comparing the amount of SNAP-25 cut.
  • FIG. 13 is a diagram showing the results of measuring the activity of a botulinum toxin pharmaceutical composition (raw drug product) according to an embodiment of the present invention using a cell line transduced.
  • FIG. 14 is a diagram showing the results of measuring the activity of a botulinum toxin pharmaceutical composition (finished drug product) according to an embodiment of the present invention using a cell line transduced.
  • 15 is a diagram briefly showing the entire development process of the present invention.
  • the present inventors have prepared a cell line with improved sensitivity for measuring botulinum toxin activity, and confirmed that the activity of botulinum toxin can be stably measured using the cell line of the present invention. has been completed.
  • a "botulinum toxin” may be produced bacterially or by recombinant techniques, but includes any known type of botulinum toxin and any subsequently discovered type, including engineered variants or fusion proteins.
  • Botulinum toxin is classified into 8 neurotoxins, and 7 types of botulinum toxin serotypes A, B, C, D, E, F and G can cause nerve paralysis. These proteins are divided into proteins that contain complexes and proteins that do not contain complexes.
  • the pure toxin protein has a molecular weight of 150 kDa, and various proteins are produced, such as 300 kDa, 500 kDa, and 900 kDa, depending on the presence or absence of complex formation.
  • the botulinum toxin of the present invention may alternatively be a botulinum toxin derivative, ie, a compound having botulinum toxin activity but containing one or more chemical or functional modifications relative to the native or recombinant, native botulinum toxin.
  • a botulinum toxin can be a modified neurotoxin (e.g., a neurotoxin having one or more amino acid deletions, modifications or substitutions relative to the original or recombinantly produced neurotoxin, derivative or fragment thereof).
  • a botulinum toxin can be a botulinum toxin that has been modified in a way that enhances its properties or reduces its undesirable side effects, but still retains the desired botulinum toxin activity.
  • the botulinum toxin may be a toxin produced using recombinant or synthetic chemical techniques (e.g., a recombinant peptide, fusion protein, or hybrid neurotoxin prepared from subunits or domains of different botulinum toxin serotypes). (See, eg, US Pat. No. 6,444,209)).
  • a botulinum toxin may also be part of an entire molecule that has been shown to have the requisite botulinum toxin activity, and in such cases, is used as such or as part of a combination or conjugate molecule, such as a fusion protein. It can be.
  • the botulinum toxin may be in the form of a precursor of botulinum toxin, which may itself be non-toxic, such as a non-toxic zinc protease, which may become toxic upon proteolytic degradation.
  • cell means all eukaryotic cells susceptible to botulinum toxin poisoning by botulinum toxin, or all eukaryotic cells capable of absorbing botulinum toxin.
  • Eukaryotic cells refer to cells derived from various mammals, such as, for example, mice, rats, pigs, cattle, sheep, horses, primates and humans.
  • manufactured cell line is synonymous with an established cell line, an immortal cell line, or a transformed cell line, and means a cell selected for infinite proliferation.
  • the transformed cell line disclosed herein exhibits consistent sensitivity to botulinum toxin activity over multiple cell passages, and "sensitivity to botulinum toxin activity" refers to a signal detected by a non-treated control or background signal. It means the lowest concentration of botulinum toxin that can be measured.
  • vector means a DNA fragment, nucleic acid molecule, etc. delivered into a cell, and the vector replicates DNA and can be independently remanufactured in a host cell. May be used interchangeably with the term “delivery vehicle”.
  • Expression vector means a recombinant DNA molecule comprising a coding sequence of interest and appropriate nucleic acid sequences necessary to express an operably linked coding sequence in a particular host organism.
  • the recombinant vector or plasmid of the present invention includes a gene encoding SEPTIN2 or Thioredoxin, and thus refers to all vectors capable of overexpressing SEPTIN2 or Thioredoxin in cells.
  • kit means a device capable of measuring the activity of botulinum toxin by including the cell for measuring botulinum toxin activity of the present invention, and includes botulinum toxin itself, raw material drug of botulinum toxin, and finished drug of botulinum toxin. It can be used to measure the activity of botulinum toxin, such as, etc., and the kit of the present invention may further include a cell lysing agent for lysing cells, antibodies and reagents for ELISA, a manual, etc. in addition to the cells for measuring the botulinum toxin activity of the present invention. However, if it can be used in the botulinum toxin activity measurement method of the present invention, it may be additionally included.
  • Example 1 Cultivation of cell line 293FT for lentivirus production
  • 293FT a cell line commonly used for lentivirus production, is derived from the 293F cell line, and is a cell line that stably expresses the SV40 large T antigen through pCMVSPORT6TAg.neo plasmid, and is a representative cell line used for lentivirus production. Since the 293FT cell line encodes the neomycin resistance gene in the plasmid, it was cultured using a medium containing geneticin, a neomycin analog, during all cell cultures except for cell thawing.
  • 293FT cell stock (Thermo, R700-07) was mixed with DMEM ( Gibco) medium and centrifuged at 200xg for 3 minutes to remove the supernatant and obtain the cells.
  • the obtained cells were resuspended using a culture medium, then dispensed into a 100 mm cell culture dish and cultured in a 37°C, 5% CO 2 incubator for 24 hours. Afterwards, the culture medium was removed and 10% FBS (Gibco), 1X NEAA (Gibco), 2 mM L-glutamine (Gibco), 1% penicillin-streptomycin (Gibco) and 500 ⁇ g/mL geneticin selective antibiotic (Gibco) were added.
  • DMEM (Gibco) medium After replacement with the DMEM (Gibco) medium, it was cultured. And when the cell confluency increased to 90% or more, subculture was performed again. In the subculture, the existing culture medium was first removed and 5 mL of DPBS (Gibco) was added, which is 50% of the culture volume, and washed with water. Then, DPBS was removed, 2 mL of 20% of the culture volume of TrypLE (Gibco) was added, and reacted for 2 minutes in a 37°C, 5% CO 2 incubator. After the reaction was completed, a culture medium was additionally added, and the supernatant was removed by centrifugation at 800xg and 4° C. for 2 minutes.
  • DPBS DPBS
  • TrypLE TrypLE
  • the number of cells is measured using trypan blue (Gibco) and a hematocytometer, and subcultured by dispensing 2x10 6 cells with 10 mL of culture medium in a 100 mm cell culture dish. And subculture was carried out in the same way as above every 3 to 4 days.
  • Example 2 Gene selection and coding plasmid construction for cell line production susceptible to BoNT/A poisoning
  • SEPTIN2 (SEPT2) serves to protect BoNT / A from degradation in cells, and Thioredoxin (TXN) acts to separate the disulfide bond between the heavy and light chains of BoNT / A. It is known.
  • Origene pLenti-ORF plasmids (SEPTIN2: RC224864L3, TXN: RC208876L3) into which the genes encoding each protein were inserted were inserted into the pLenti-C-Myc-DDK-P2A-Puro vector. It was commissioned by the company.
  • SEPTIN2 the amino acid sequence of SEQ ID NO: 9 (DNA sequence: SEQ ID NO: 10) was used, and to prepare Thioredoxin, the amino acid sequence of SEQ ID NO: 11 (DNA sequence: SEQ ID NO: 12) was used.
  • the pLenti-C-Myc-DDK-P2A-Puro vector map is shown in FIG. 2 . After the tube containing the lyophilized pLenti-ORF plasmid was centrifuged at 5000xg for 3 minutes, 100 ⁇ L of distilled water was added, pipetted, and stored in a -20°C freezer until use.
  • the plasmid was thawed at room temperature, and 100 ⁇ L of competent cells (RBC bioscience) was thawed at 4°C.
  • 2 ⁇ L of the thawed plasmid was treated with water-soluble cells, reacted at 4 ° C for 10 minutes, subjected to heat shock at 37 ° C for 1 minute, and then added with 700 ⁇ L of LB broth and stirred in a 37 ° C shaking incubator for 15 minutes. cultured for a while.
  • the culture medium was centrifuged at 13,000 rpm for 1 minute to remove the supernatant, and the remaining pellet was used for plasmid purification using the DNA-spin Plasmid DNA Purification Kit (iNtRON) according to the provided protocol.
  • the nucleotide sequence of the purified plasmid was analyzed by requesting Cosmogenetech. Primer sequences used for sequencing were shown in Table 1. As a result of sequencing, it was confirmed that SEPTIN2 exactly matches NCBI's accession number NM_001008491.2 and TXN exactly matches NM_003329.4. Through this, it was confirmed that SEPTIN2 or TXN, that is, a plasmid in which the target gene was normally inserted was constructed. did
  • Primer sequence (5' -> 3') sequence number SEPTIN2 V2 AGAGCTCGTTTAGTGAA
  • the plasmid was inoculated into 100 mL of LB broth supplemented with 34 ⁇ g/mL of chloramphenicol, followed by shaking culture at 37° C. for 16 hours. Then, the culture solution was transferred to a 500 mL Centrifuge bottle (Nalgene), centrifuged at 6000xg, 4° C. for 15 minutes, and the supernatant was removed. Then, the plasmid was purified from the pellet using the HiSpeed Plasmid Midi Kit (Qiagen). The purified plasmid was quantified using a Life Science UV/Vis Spectrophotometer DU 730 (Beckman Coulter). The results are shown in Table 2.
  • 293FT cell line which is a cell line with high lentivirus production efficiency, was subcultured in the same manner as in Example 1, and 2.5x10 6 cells were dispensed into a 100 mm cell culture dish. And it was confirmed under a microscope that cell saturation reached 40-50%.
  • Figure 3 For transfection, 1.5 mL of opti-MEM (Gibco) and 5 ⁇ g of pLenti-ORF plasmid were added to a 1.5 mL tube and mixed. Then, 6 ⁇ g of 0.5 ⁇ g/ ⁇ L packaging plasmid (Origene) contained in distilled water was added and mixed, and then 33 ⁇ L of TurboFectin (Origene) was additionally added and mixed.
  • the mixed solution was reacted at room temperature for 15 minutes, then treated in a cell culture dish and cultured for 2 days.
  • the supernatant of the medium containing the virus was collected and stored at 4 ° C., and a new medium was added and cultured for another 1 day.
  • the medium supernatant was collected again, mixed with the medium recovered the day before, filtered using a 0.45 ⁇ m pore filter (Sartorius), and stored at 4° C. until use.
  • Example 4 Construction of transduced cell lines using lentivirus
  • SiMa (DSMZ, ACC164) cell lines subcultured in the same manner as in Example 1 were cultured in RPMI1640 (Gibco) supplemented with 10% FBS, 2 mM L-glutamine (Gibco) and 1% penicillin-streptomycin (Gibco). It was dispensed into a 60 mm cell culture dish to which 4 mL of medium was added and cultured for 16 hours.
  • the trypLE and the cell mixture were mixed by pipetting, and then each was dispensed into a 96-well plate containing 150 ⁇ L of culture medium supplemented with 1 ⁇ g/mL of puromycin.
  • the cell lines were named in the order of distribution. Thereafter, the cells were scaled up and cultured according to the growth of the cells.
  • the primarily expressed protein was confirmed using Western blotting.
  • the medium of the 100 mm cell culture dish cultured by scale-up was removed, and washed with 5 mL of 4° C. DPBS.
  • DPBS washed with 5 mL of 4° C.
  • cells were treated with 200 ⁇ L of RIPA lysis buffer (iNtRON) supplemented with cOmpleteTM and EDTA-free Protease Inhibitor Cocktail (Roche). After transferring the cell lysate to a 1.5 mL tube using a cell lifter (SPL), it was reacted at 4°C for 20 minutes without movement.
  • SPL cell lifter
  • the membrane after blocking was treated with a primary antibody (Myc-tag, Cell Signaling Technology, 2278S, 1:1000 v/v in 2% BSA PBST) that specifically binds to the Myc tag, and then subjected to a Digital Orbital Shaker at 4°C. was reacted for 16 hours. After the reaction was completed, the membrane was soaked in PBST and washed 4 times for 5 minutes each using a Digital Orbital Shaker, and then treated with secondary antibodies (Anti-Rabbit HRP, abcam, ab6721, 1:10000 v/v in PBST) at room temperature. reacted for 1 hour.
  • a primary antibody Myc-tag, Cell Signaling Technology, 2278S, 1:1000 v/v in 2% BSA PBST
  • secondary antibodies Anti-Rabbit HRP, abcam, ab6721, 1:10000 v/v in PBST
  • the membrane was immersed in PBST, washed four times for 5 minutes each using a Digital Orbital Shaker, treated with Pierce ECL Western Blotting Substrate (ThermoFisher), and then protein was detected with ImageQuant LAS 500 (Cytiva). The results are shown in FIG. 6 .
  • genomic DNA was isolated from the cell line and then the transgene portion was amplified using PCR.
  • primers for PCR were designed using the 3'-terminal sequence of the transduced gene only, and then commissioned to CosmoGenetech to manufacture. did Primer sequences used for PCR are shown in Table 3.
  • forward primers for amplification of the TXN or SEPTIN2 genes were designed to bind to the 5'-end sequence of each gene, and the reverse primer common to both genes was DDK- It was designed to bind to the tag sequence.
  • primers GH20 and GH21 capable of amplifying the ⁇ -globin gene were used as positive controls.
  • the transduced SiMa-TXN-3, SiMa-SEPTIN2-1, SiMa-SEPTIN2-2, and SiMa-SEPTIN2-3 cell lines were each 1 ⁇ g/mL of puromycin added to the culture medium containing 100 ml. Divided into mm cell culture dishes, and when the cell confluency reached about 80%, the genomic DNA of each cell line was extracted using the Wizard® Genomic DNA Purification Kit (Promega) according to the protocol provided, and the extracted genomic DNA was It was quantified using Life Science UV/Vis Spectrophotometer DU 730 (Beckman Coulter). The results are shown in Table 4.
  • Electrophoresis was performed using a 1.5% (w/v) DNA agarose gel mixed with 0.01% (v/v) EcoDyeTM Nucleic Acid Staining Solution (Biofact) and the electrophoresis kit Mupid-One (Advance). moved Electrophoresis was performed at 100 V for 35 minutes, and imaging was performed using a Gel Documentation System LSG 1000 (iNtRON). The results are shown in FIG. 8 .
  • the beta globin gene corresponding to the positive control and the TXN gene including the transduced DDK-tag were normally amplified in the SiMa-TXN-3 cell line.
  • all of the SEPTIN2 genes including the transduced DDK-tag were amplified in the cell lines of SiMa-SEPTIN2-1, SiMa-SEPTIN2-2, and SiMa-SEPTIN2-3.
  • a cell lysate of cells treated with the botulinum toxin was first prepared.
  • the SiMa cell line was cultured in a 96-well plate containing RPMI1640 medium supplemented with 10% FBS, 2 mM L-glutamine and 1% penicillin-streptomycin at 1.2 X 10 5 cells/100 ⁇ L/
  • the experimental group SiMa-SEPTIN2-3 cell line was placed in a 96-well plate containing RPMI1640 medium supplemented with 10% FBS, 2 mM L-glutamine, 1% penicillin-streptomycin and 1 ⁇ g/mL puromycin.
  • the medium was removed, and the BoNT/A complex was serially diluted 1.35 times in RPMI1640 supplemented with 1X B-27TM Plus Supplement, 1X N-2 Supplement, and 0.25% Human Serum Albumin (Green Cross). and finally added to each well to make 100 ⁇ L.
  • the medium was removed and lysis buffer (50 mM HEPES (pH 7.4), 150 mM NaCl, 1.5 mM MgCl 2 and 1% Triton X-100) supplemented with protease inhibitor cocktail 110 ⁇ L was applied to each well to lyse the cells. Then, the cell lysate was transferred to a 1.5 mL tube, and the supernatant was obtained by centrifugation at 17,000 rpm and 4° C. for 5 minutes to prepare a cell lysate for sandwich ELISA.
  • lysis buffer 50 mM HEPES (pH 7.4), 150 mM NaCl, 1.5 mM MgCl 2 and 1% Triton
  • Botulinum toxin serotype A acts on the presynapse of the neuromuscular junction and causes the cleavage of Synaptosomal-Associated Protein, 25kDa (SNAP-25) molecule bound to the presynaptic cell membrane. Since it is known that this principle is applied, a sandwich Enzyme-Linked Immunosorbent Assay (ELISA) test method using each antibody capable of recognizing cleaved SNAP-25 and intact SNAP-25 is designed did The principle is briefly shown in FIG. 9 .
  • cleaved Monoclonal Antibody Mybiosource, MBS312597
  • a capture antibody that specifically binds to cleaved SNAP-25
  • 0.1 M sodium carbonate coating buffer coating After diluting to a concentration of 0.2% (v/v) using buffer, pH 9.6), 100 ⁇ L was applied to each well of a Clear Flat-Bottom Immuno Nonsterile 96-Well Plate (ThermoFisher) and moved at 4°C for 16 hours.
  • Anti-SNAP-25 antibody (Sigma-Aldrich, S9684) to a concentration of 0.1% (v/v) using a blocking buffer, 100 ⁇ L was treated in each well, It was reacted for 1 hour in a shaker at 75 rpm at room temperature. Thereafter, all unbound antibodies were removed by washing three times with 200 ⁇ L of PBST, and the secondary antibody, Anti-Rabbit HRP (abcam, ab6721) was diluted to 0.01% (v/v) using a blocking buffer, , 100 ⁇ L of the diluted antibody solution was treated in each well and reacted for 1 hour on a shaker at 75 rpm at room temperature.
  • the TMB solution of the TMB Peroxidase EIA Substrate Kit (Bio-Rad) and the hydrogen peroxide solution were mixed at a ratio of 9: 1, and 50 ⁇ L was applied to each well, and then incubated at 37 ° C in an incubator. Reacted for 30 minutes. Then, after treating each well with 50 ⁇ L of 2 N sulfuric acid, the absorbance (OD450) in the 450 nm wavelength band was measured using a SpectraMax Plus 384 Microplate Reader (Molecular devices).
  • a dose-response curve (four parameters) was created using GraphPad Prism Version 7.00 (GraphPad Software, Inc.), and the EC 50 value was calculated based on the result of the company's mouse titer test (unit). Calculated. Afterwards, all experiments were repeated at least three times, and the results were expressed as mean values ⁇ standard deviations. The results are shown in FIG. 10 .
  • the OD 450 nm value of each group of SiMa cell line was divided by the OD 450 nm value of each group of SEPTIN2-3 cell line, and the degree of response of the cell line to the same botulinum toxin treatment was compared. The results are shown in FIG. 11 .
  • the OD450 SEPTIN2 /OD450 WT value without toxin treatment was 1, whereas when toxin was treated, the value rose to about 1.7, confirming the difference in sensitivity to toxin between cell lines. .
  • the transduced cell line overexpressing the SEPTIN2 gene had increased sensitivity to botulinum toxin compared to the control group (wild type).
  • a cell lysate of cells treated with the botulinum toxin was first prepared.
  • the SiMa cell line was cultured in 8 X 10 4 cells/100 ⁇ L/well in a 96-well plate containing RPMI1640 medium supplemented with 10% FBS, 2 mM L-glutamine and 1% penicillin-streptomycin.
  • SiMa-TXN3 cell line as an experimental group was plated 8 X in a 96-well plate containing RPMI1640 medium supplemented with 10% FBS, 2 mM L-glutamine, 1% penicillin-streptomycin and 1 ⁇ g/mL puromycin. Each was dispensed at a concentration of 10 4 cells/100 ⁇ L/well.
  • lysis buffer 50 mM HEPES (pH 7.4), 150 mM NaCl, 1.5 mM MgCl 2 and 1% Triton X-100 supplemented with protease inhibitor cocktail 110 ⁇ L was applied to each well to lyse the cells. Then, the cell lysate was transferred to a 1.5 mL tube, and the supernatant was obtained by centrifugation at 17,000 rpm and 4° C. for 5 minutes to prepare a cell lysate for sandwich ELISA.
  • lysis buffer 50 mM HEPES (pH 7.4), 150 mM NaCl, 1.5 mM MgCl 2 and 1% Triton X-100
  • Example 6.2 In the same manner as in Example 6.2, the sensitivity of botulinum toxin to the transduced cell line overexpressing the TXN gene was confirmed using the cell lysate of Example 6.3. The results are shown in FIG. 12 .
  • the transduced cell line overexpressing the Thioredoxin gene had increased sensitivity to botulinum toxin compared to the control group (wild type).
  • Example 7 Verification of Biological Activity of BoNT/A Pharmaceutical Composition (Raw Material) by Sandwich ELISA
  • sandwich ELISA was performed using the SiMa-SEPTIN2-3 cell line. More specifically, the SiMa-SEPTIN2-3 cell line was cultured in 1.2 X 10 5 in a 96-well plate containing RPMI1640 medium supplemented with 10% FBS, 2 mM L-glutamine, 1% penicillin-streptomycin and 1 ⁇ g/mL puromycin. It was dispensed at a concentration of cells/100 ⁇ L/well.
  • the medium was removed and treated with 100 ⁇ L of differentiation medium supplemented with 1X B-27TM Plus Supplement, 1X N-2 Supplement, 2 mM L-glutamine and 25 ⁇ g/mL Trisialoganglioside GT 1B . and cultured for 2 days to induce differentiation.
  • the medium was removed, and the BoNT/A complex (botulinum, a raw material from which other substances such as preservation solutions were removed from ATGC-100 was removed) was added to RPMI1640 to which 1X B-27TM Plus Supplement and 1X N-2 Supplement were added. toxin) was serially diluted 1.55 times (serial dilution), and the cells were treated by concentration.
  • lysis buffer 50 mM HEPES (pH 7.4), 150 mM NaCl, 1.5 mM MgCl 2 and 1% Triton X-100 supplemented with protease inhibitor cocktail 110 ⁇ L was applied to each well to lyse the cells. Then, the cell lysate was transferred to a 1.5 mL tube, and the supernatant was obtained by centrifugation at 17,000 rpm and 4° C. for 5 minutes to prepare a cell lysate for sandwich ELISA.
  • lysis buffer 50 mM HEPES (pH 7.4), 150 mM NaCl, 1.5 mM MgCl 2 and 1% Triton X-100
  • cleaved Monoclonal Antibody (Mybiosource), a capture antibody that specifically binds to truncated SNAP-25, was added to 0.1 M sodium carbonate coating buffer , pH 9.6) after dilution to a concentration of 0.8% (v/v), 100 ⁇ L was applied to each well of a Clear Flat-Bottom Immuno Nonsterile 96-Well Plate (ThermoFisher) and left at 4°C for 16 hours without movement. reacted Thereafter, antibodies that did not bind to the wells were removed, and washed three times using 200 ⁇ L of 0.1% polysorbate 20 in PBS (PBST).
  • PBST PBS
  • Anti-SNAP-25 antibody (Sigma-Aldrich, S9684) to a concentration of 0.1% (v/v) using a blocking buffer, 100 ⁇ L was treated in each well, It was reacted for 1 hour in a shaker at 75 rpm at room temperature. Thereafter, all unbound antibodies were removed by washing three times with 200 ⁇ L of PBST, and the secondary antibody, Anti-Rabbit HRP (abcam, ab6721) was diluted to 0.01% (v/v) using a blocking buffer, , 100 ⁇ L of the diluted antibody solution was treated in each well and treated for 1 hour on a shaker at 75 rpm at room temperature.
  • Example 8 Verification of biological activity of BoNT/A pharmaceutical composition (drug product) through sandwich ELISA
  • sandwich ELISA was performed using the SiMa-SEPTIN2-3 cell line. More specifically, the SiMa-SEPTIN2-3 cell line was cultured in 1.2 X 10 5 in a 96-well plate containing RPMI1640 medium supplemented with 10% FBS, 2 mM L-glutamine, 1% penicillin-streptomycin and 1 ⁇ g/mL puromycin. It was dispensed at a concentration of cells/100 ⁇ L/well.
  • the medium was removed and treated with 100 ⁇ L of differentiation medium supplemented with 1X B-27TM Plus Supplement, 1X N-2 Supplement, 2 mM L-glutamine and 25 ⁇ g/mL Trisialoganglioside GT 1B . and cultured for 2 days to induce differentiation.
  • the medium was removed, and the BoNT/A finished product (ATGC-100) was serially diluted 1.4 times in RPMI1640 to which 1X B-27TM Plus Supplement and 1X N-2 Supplement had been added. It was treated by concentration.
  • lysis buffer 50 mM HEPES (pH 7.4), 150 mM NaCl, 1.5 mM MgCl 2 and 1% Triton X-100 supplemented with protease inhibitor cocktail 110 ⁇ L was applied to each well to lyse the cells. Then, the cell lysate was transferred to a 1.5 mL tube, and the supernatant was obtained by centrifugation at 17,000 rpm and 4° C. for 5 minutes to prepare a cell lysate for sandwich ELISA.
  • lysis buffer 50 mM HEPES (pH 7.4), 150 mM NaCl, 1.5 mM MgCl 2 and 1% Triton X-100
  • cleaved Monoclonal Antibody (Mybiosource), a capture antibody that specifically binds to truncated SNAP-25, was added to 0.1 M sodium carbonate coating buffer , pH 9.6) after dilution to a concentration of 0.8% (v/v), 100 ⁇ L was applied to each well of a Clear Flat-Bottom Immuno Nonsterile 96-Well Plate (ThermoFisher) and left at 4°C for 16 hours without movement. reacted Thereafter, antibodies that did not bind to the wells were removed, and washed three times using 200 ⁇ L of 0.1% polysorbate 20 in PBS (PBST).
  • PBST PBS
  • Anti-SNAP-25 antibody (Sigma-Aldrich, S9684) to a concentration of 0.1% (v/v) using a blocking buffer, 100 ⁇ L was treated in each well, It was reacted for 1 hour in a shaker at 75 rpm at room temperature. Thereafter, all unbound antibodies were removed by washing three times with 200 ⁇ L of PBST, and the secondary antibody, Anti-Rabbit HRP (abcam, ab6721) was diluted to 0.01% (v/v) using a blocking buffer, , 100 ⁇ L of the diluted antibody solution was treated in each well and treated for 1 hour on a shaker at 75 rpm at room temperature.
  • the potency of not only botulinum toxin but also botulinum toxin pharmaceutical compositions, that is, raw materials and finished drugs It was confirmed that can be easily measured on a cell basis and the sensitivity can be significantly improved. Therefore, it is expected that the cell line of the present invention can be applied to various industrial fields using botulinum toxin.
  • the cell for measuring botulinum toxin activity of the present invention has significantly improved sensitivity to botulinum toxin, it replaces a number of animal experiments and measures the activity of not only botulinum toxin but also botulinum toxin pharmaceutical compositions in the form of raw materials or finished drugs. It can be widely used in various industrial fields.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 SEPTIN2 또는 Thioredoxin(TXN)을 과발현하는 보툴리눔 독소 활성 측정용 세포, 및 상기 보툴리눔 독소 활성 측정용 세포에 보툴리눔 독소를 처리하고 배양하는 단계; 상기 배양된 세포를 용해시키고 세포 용해액을 수집하는 단계; 및 상기 세포 용해액 내의 SNAP-25 절단 생성물의 양을 측정하는 단계를 포함하는 보툴리눔 독소 활성 측정 방법에 관한 것이다.

Description

렌티바이러스에 의해 특정 유전자가 삽입된 보툴리눔 독소에 민감한 세포
본 발명은 보툴리눔 독소 활성 측정용 세포 및 이를 이용한 보툴리눔 독소 활성 측정 방법 등에 관한 것이다.
보툴리눔 독소(botulinum toxin)는 썩은 통조림이나 상한 고기에서 자라는 그람 양성 혐기성 박테리아인 클로스트리디움 보툴리눔(Clostridium botulinum)이 만들어내는 신경독소이다. 이는 8가지 신경독소로 분류되며, 이중 7종(A, B, C, D, E, F, G)은 신경의 마비를 유발할 수 있다. 크기는 약 150 kDa으로, 보툴리눔 독소 단백질 이외에 비독소 단백질(non-toxin)의 복합체로 구성되어 각 복합체의 크기는 신경독소의 종류에 따라 최대 900 kDa까지 생성된다. 보툴리눔 독소형에 따라 작용 형태와 대상, 활성기간 등이 달라지는데 그 중 보툴리눔 독소 A형의 경우 치명적인 생물학적 작용제 중 하나로 알려져 있다. 이러한 보툴리눔 독소는 근육의 경련 또는 수축을 유발하는 신호를 차단하여 마비를 초래하는 작용을 하는데, 이러한 기능을 기반으로 하는 생물학적 작용제로 1989년 미국 FDA 승인을 받은 이후, 치료 또는 미용 목적으로 폭넓게 사용되고 있다. 치료 목적으로는 사시(strabismus), 사경(torticollis), 안면 경련(blepharospasm), 이완불능, 치열, 요통 등과 같은 질환에, 미용 목적으로는 주름, 찌푸린 주름 제거, 사각턱 치료, 다한증(hyperhidrosis) 등의 치료에 사용되고 있다.
보툴리눔 독소를 치료 및 미용에 사용하기 위해서, 사용 전 생물학적 검증을 필요로 하며, 이러한 검증은 일반적으로 마우스를 이용한 마우스 LD50, 즉, 치사성 시험(lethality test)을 통해 확인된다. 실질적으로, 약제학적 제제의 라벨 상의 유닛은 마우스 LD50 유닛이다. 그러나 통계학적으로 유용한 마우스 LD50 데이터를 제공하기 위해서는 필요로 하는 마우스의 수가 매우 많을 뿐만 아니라, 검사를 위한 비용이 크며, 보툴리눔 독소의 세로타입에 따른 차이를 보기 어렵다는 점 등의 한계점을 가지고 있다(대한민국공개특허 10-2012-0134154).
따라서, 이러한 단점을 극복하기 위해서는 동물을 사용하지 않으면서도 보툴리눔 독소 흡수에 필요한 일체의 모든 단계를 평가할 수 있는 간단하면서도 민감도는 높은 새로운 방식의 보툴리눔 독소 활성 측정 방법이 필요한 실정이다.
본 발명은 상기와 같은 종래 기술상의 문제점을 해결하기 위해 안출된 것으로, 보툴리눔 독소 활성 측정용 세포 및 이를 이용한 보툴리눔 독소 활성 측정 방법 등을 제공하는 것을 그 목적으로 한다. 상기 세포는 SEPTIN2 또는 Thioredoxin(TXN) 유전자를 과발현하는 세포로서, 보툴리눔 독소의 결합, 세포 흡수, 세포질 내로의 전위 및 프로테아제 활성을 모두 평가할 수 있을 뿐만 아니라, 보툴리눔 독소에 대한 민감성이 현저히 향상되었기 때문에 낮은 용량의 보툴리눔 독소도 높은 정확성으로 검증할 수 있다. 또한, 원료의약품 및 완제의약품 상태의 보툴리눔 독소 약학적 조성물의 활성도 측정할 수 있다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명은 SEPTIN2 또는 Thioredoxin(TXN)을 과발현하는 보툴리눔 독소 활성 측정용 세포를 제공한다.
본 발명의 일 구체예에 있어서, 상기 세포는 SEPTIN2 또는 TXN 유전자가 바람직하게는 형질도입(transduction), 형질주입(transfection) 등의 방법으로 세포 내에 삽입되어 상기 유전자가 과발현될 수 있으나, 일반적으로 알려져 있는 세포 내에 유전자를 삽입하는 방식이라면 이에 제한되지 않는다. 상기 SEPTIN2는 바람직하게는 인간의 SEPTIN2 유전자이며, 더욱 바람직하게는 NCBI의 accession number NM_001008491.2의 3,726bp의 mRNA 서열을 발현하는 유전자이나, 이의 변이체 또한 본 발명의 범위에 포함된다. 구체적으로 NM_001008491.2의 mRNA 서열과 90% 이상, 더욱 바람직하게는 95% 이상, 가장 바람직하게는 98 % 이상의 서열 상동성을 가지는 서열을 포함할 수 있다. “서열 상동성의 %”는 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서 뉴클레오티드 서열의 일부는 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다. 그리고 상기 TXN은 바람직하게는 인간의 TXN 유전자이며, 더욱 바람직하게는 NCBI의 accession number NM_003329.4의 737bp의 mRNA 서열을 발현하는 유전자이나, 이의 변이체 또한 본 발명의 범위에 포함된다. 구체적으로 NM_003329.4의 mRNA 서열과 90% 이상, 더욱 바람직하게는 95% 이상, 가장 바람직하게는 98 % 이상의 서열 상동성을 가지는 서열을 포함할 수 있다. “서열 상동성의 %”는 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서 뉴클레오티드 서열의 일부는 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
본 발명의 다른 구체예에 있어서, 상기 세포는 SEPTIN2 또는 TXN 유전자가 과발현됨으로써 야생형(wild type) 세포와 비교하여 보툴리눔 독소 중독(intoxication)에 대한 감수성이 증가된 것을 특징으로 한다.
본 발명의 또 다른 구체예에 있어서, 상기 세포는 바람직하게는 SiMa 세포, LAN-2 세포, PC12 세포, Neuro-2a 세포, LA1-55n 세포, N18 세포, SH-SY5Y 세포, Kelly 세포, NB69 세포, N1E-115 세포, BE(2)-M17 세포, SK-N-BE(2) 세포 등일 수 있으나, 일반적으로 보툴리눔 독소 활성을 측정하는데 사용될 수 있다고 알려져 있는 세포주라면 이에 제한되지 않는다.
본 발명의 또 다른 구체예에 있어서, 상기 보툴리눔 독소는 보툴리눔 세로타입(serotype) A, B, C, D, E, F 및 G로 이루어진 군으로부터 선택될 수 있다.
또한, 본 발명은 a) 상기 보툴리눔 독소 활성 측정용 세포에 보툴리눔 독소를 처리하고 배양하는 단계; b) 상기 배양된 세포를 용해시키고 세포 용해액을 수집하는 단계; 및 c) 상기 세포 용해액 내의 SNAP-25 절단 생성물의 양을 측정하는 단계를 포함하는, 보툴리눔 독소 활성 측정 방법을 제공한다.
본 발명의 일 구체예에 있어서, 상기 SNAP-25 절단 생성물의 양은 샌드위치 면역검정법(ELISA), 웨스턴 블롯(Western blot) 등을 이용하여 측정하는 것을 특징으로 하나, 단백질을 검출하는데 사용하는 방법으로 알려져 있는 방법이라면 이에 제한되지 않는다.
또한, 본 발명은 상기 보툴리눔 독소 활성 측정용 세포를 유효성분으로 포함하는, 보툴리눔 독소 활성 측정용 키트를 제공한다.
또한, 본 발명은 상기 보툴리눔 독소 활성 측정용 세포의 보툴리눔 독소 활성 측정을 위한 용도를 제공한다.
본 발명에 따른 보툴리눔 독소 활성 측정용 세포는 SEPTIN2 또는 Thioredoxin을 과발현함으로써, 보툴리눔 독소에 대한 민감성이 현저히 향상되었기 때문에 낮은 용량의 보툴리눔 독소도 높은 정확성으로 검증할 수 있을 뿐만 아니라 보툴리눔 독소의 결합, 세포 흡수, 세포질 내로의 전위 및 프로테아제 활성을 모두 평가할 수 있기 때문에 다수의 동물실험을 대체할 수 있을 것으로 기대된다. 또한, 보툴리눔 독소뿐만 아니라, 원료의약품 및 완제의약품 상태의 보툴리눔 독소 약학적 조성물의 활성도 측정할 수 있기 때문에 보툴리눔 독소를 이용하는 다양한 분야의 산업에 용이하게 적용할 수 있을 것으로 기대된다.
도 1은 SEPTIN2와 Thioredoxin(TXN)의 기능에 대하여 간략히 나타낸 도면이다.
도 2는 pLenti-C-Myc-DDK-P2A-Puro 벡터맵을 간략히 나타낸 도면이다.
도 3은 본 발명의 일 실시예에 따른 배양된 293FT 세포주를 현미경으로 확인한 결과를 나타낸 도면이다.
도 4는 본 발명의 일 실시예에 따른 렌티바이러스를 이용하여 형질도입된 세포주를 제작하는 방법을 간략하게 나타낸 도면이다.
도 5는 본 발명의 일 실시예에 따른 클로닝 실린더를 이용하여 세포주를 각각의 군체로 분리하여 배양한 방법을 나타낸 도면이다.
도 6은 본 발명의 일 실시예에 따른 형질도입된 세포주에서 발현된 단백질을 웨스턴 블롯팅으로 확인한 결과를 나타낸 도면이다.
도 7은 본 발명의 일 실시예에 따른 PCR을 위하여 제작된 프라이머의 결합 위치를 나타낸 도면이다.
도 8은 본 발명의 일 실시예에 따른 도입된 유전자를 PCR로 확인한 결과를 나타낸 도면이다.
도 9는 샌드위치 ELISA의 원리를 간략하게 나타낸 도면이다.
도 10은 본 발명의 일 실시예에 따른 대조군 및 SEPTIN2 유전자가 형질도입된 세포주 간 보툴리눔 독소에 대한 민감도를 SNAP-25 절단량 비교를 통해 확인한 결과를 나타낸 도면이다.
도 11은 본 발명의 일 실시예에 따른 대조군 및 형질도입된 세포주 간 보툴리눔 독소에 대한 민감도를 각 그룹간 로우데이터 비를 통해 확인한 결과를 나타낸 도면이다.
도 12는 본 발명의 일 실시예에 따른 대조군 및 Thioredoxin 유전자가 형질도입된 세포주 간 보툴리눔 독소에 대한 민감도를 SNAP-25 절단량 비교를 통해 확인한 결과를 나타낸 도면이다.
도 13은 본 발명의 일 실시예에 따른 보툴리눔 독소 약학적 조성물(원료의약품)의 역가를 형질도입된 세포주를 이용하여 그 활성을 측정한 결과를 나타낸 도면이다.
도 14는 본 발명의 일 실시예에 따른 보툴리눔 독소 약학적 조성물(완제의약품)의 역가를 형질도입된 세포주를 이용하여 그 활성을 측정한 결과를 나타낸 도면이다.
도 15는 본 발명의 전체적인 개발 과정을 간략하게 나타낸 도면이다.
본 발명자들은 보툴리눔 독소 활성 측정 방법에 대하여 예의 연구한 결과, 보툴리눔 독소 활성을 측정할 수 있는 민감도가 향상된 세포주를 제작하고, 이를 이용하여 안정적으로 보툴리눔 독소의 활성을 측정할 수 있다는 것을 확인하여 본 발명을 완성하였다.
본 명세서에 있어서, "보툴리눔 독소"는 세균에 의해 생산되거나 또는 재조합 기법에 의해 생산될 수 있으나, 임의의 공지된 종류의 보툴리눔 독소 및 조작된 변이체 또는 융합 단백질을 포함한, 뒤이어 발견될 수 있는 종류의 보툴리눔 독소를 의미한다. 보툴리눔 독소 8가지 신경 독소로 구분되며, 보툴리눔 독소 세로타입(serotype)인 A, B, C, D, E, F 및 G의 7종은 신경 마비를 유발할 수 있다. 이 단백질은 복합체를 포함하는 단백질과 포함하지 않는 단백질로 나뉘며, 순수한 독소 단백질의 분자량은 150 kDa이고 복합체의 형성 유무에 따라 300 kDa, 500 kDa 및 900 kDa으로 다양하게 단백질이 생성된다. 본 발명의 보툴리눔 독소는 대안적으로 보툴리눔 독소 유도체, 즉, 보툴리눔 독소 활성을 가지나 천연 또는 재조합의 원형 보툴리눔 독소에 비해 하나 이상의 화학적 변형 또는 기능적 변형을 포함하는 화합물일 수 있다. 예를 들면, 보툴리눔 독소는 변형된 신경독소(예를 들면, 원형의, 또는 재조합에 의해 생성된 신경독소, 그의 유도체 또는 단편에 비해, 하나 이상의 아미노산 결실, 변형 또는 치환을 갖는 신경독소)일 수 있다. 예를 들면, 보툴리눔 독소는 그의 특성을 강화하거나 또는 그의 바람직하지 않은 부작용을 감소시키나, 여전히 바람직한 보툴리눔 독소 활성을 보유하는 방식으로 변형된 보툴리눔 독소일 수 있다. 대안적으로, 보툴리눔 독소는 재조합 또는 합성 화학 기법을 이용하여 제조된 독소일 수 있다(예를 들면, 상이한 보툴리눔 독소 세로타입의 서브유닛 또는 도메인으로부터 제조된, 재조합 펩티드, 융합 단백질, 또는 하이브리드 신경독소(예를 들면, 미국특허 제6,444,209호 참조)). 보툴리눔 독소는 또한 필요한 보툴리눔 독소 활성을 갖는 것으로 입증된 전체 분자의 일부분일 수 있고, 그와 같은 경우에, 그 자체로 또는 조합 또는 컨쥬게이트(conjugate) 분자, 예를 들면, 융합 단백질의 일부로서 이용될 수 있다. 또한, 보툴리눔 독소는 그 자체로 무독성일 수 있는 보툴리눔 독소의 전구체, 예를 들면, 단백질 가수분해에 의한 분해시 독성이 될 수 있는 무독성 징크 프로테아제(zinc protease)의 형태일 수 있다.
본 명세서에 있어서, "세포"는 보툴리눔 독소에 의한 보툴리눔 독소 중독에 취약한 모든 진핵 세포, 또는 보툴리눔 독소를 흡수할 수 있는 모든 진핵 세포를 의미한다. 진핵 세포는 예를 들어, 쥐, 랫트, 돼지, 소, 양, 말, 영장류 및 인간과 같은 다양한 포유류로부터 유래되는 세포를 의미한다. 본 명세서에 있어서, “제작된 세포주”는 확립된 세포주, 불멸 세포주, 또는 형질전환 세포주와 동의어이며, 무한 증식을 위해서 선택된 세포를 의미한다. 본 명세서에 개시된 형질전환 세포주는 복수의 세포 계대에 대해서 보툴리눔 독소 활성에 대한 일관된 민감도를 나타내며, “보툴리눔 독소 활성에 대한 민감도”란 비-처리 대조군 또는 배경(background) 신호에 의해 검출된 신호를 일관되게 측정할 수 있는 최저의 보툴리눔 독소 농도를 의미한다.
본 명세서에 있어서, "벡터" 또는 “플라스미드”는 세포 내로 전달되는 DNA 단편, 핵산 분자 등을 의미하며, 상기 벡터는 DNA를 복제시키고, 숙주세포에서 독립적으로 재제조될 수 있다. 용어 "전달체"와 호환하여 사용될 수 있다. "발현 벡터"는 목적한 코딩 서열과, 특정 숙주 생물에서 작동가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다. 또한 본 발명의 재조합 벡터 또는 플라스미드는 SEPTIN2 또는 Thioredoxin를 코딩하는 유전자를 포함하고 있어, 세포 내에서 SEPTIN2 또는 Thioredoxin을 과발현시킬 수 있는 모든 벡터를 총칭한다.
본 명세서에 있어서, “키트”란 본 발명의 보툴리눔 독소 활성 측정용 세포를 포함함으로써 보툴리눔 독소의 활성을 측정할 수 있는 기기를 의미하며, 보툴리눔 독소 자체, 보툴리눔 독소의 원료의약품, 보툴리눔 독소의 완제의약품 등의 보툴리눔 독소의 활성을 측정하는데 사용될 수 있으며, 본 발명의 키트에는 본 발명의 보툴리눔 독소 활성 측정용 세포 이외에 세포를 용해시키기 위한 세포 용해제, ELISA를 위한 항체 및 시약, 매뉴얼 등을 추가로 포함할 수 있으나, 본 발명의 보툴리눔 독소 활성 측정 방법에 사용될 수 있는 것이라면 추가로 포함 될 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1: 렌티바이러스 생산용 세포주 293FT의 배양
렌티바이러스 생산에 일반적으로 이용되는 세포주인 293FT는 293F 세포주에서 유래된 것으로, pCMVSPORT6TAg.neo plasmid를 통해 SV40 large T antigen을 안정적으로 발현하는 세포주로서, 렌티바이러스의 생산에 사용되는 대표적인 세포주이다. 293FT 세포주는 상기 plasmid 내에 네오마이신 저항성 유전자를 암호화하고 있기 때문에, 세포 해동을 제외한 모든 세포 배양 시에는 네오마이신 유사체인 geneticin을 포함한 배지를 이용하여 배양하였다. 보다 자세하게는, 293FT cell stock(Thermo, R700-07)을 10% FBS(Gibco), 1X NEAA(Gibco), 2 mM L-glutamine(Gibco) 및 1% penicillin-streptomycin(Gibco)이 첨가된 DMEM(Gibco) 배지에 현탁하고 200xg에서 3분 동안 원심분리하여 상층액을 제거하고 세포를 획득하였다. 획득된 세포는 배양 배지를 이용하여 재현탁한 후, 100 mm 세포배양접시에 분주하여 37℃, 5% CO2 배양기에서 24시간 동안 배양하였다. 이후 배양 배지를 모두 제거하고 10% FBS(Gibco), 1X NEAA(Gibco), 2 mM L-glutamine(Gibco), 1% penicillin-streptomycin(Gibco) 및 500 μg/mL geneticin selective antibiotic(Gibco)이 첨가된 DMEM(Gibco) 배지로 교체한 후, 배양하였다. 그리고 세포 포화도(cell confluency)가 90% 이상으로 증가되면 다시 계대배양을 진행하였다. 계대배양은 우선 기존의 배양 배지를 제거하고 DPBS(Gibco)를 배양부피(culture volume)의 50%인 5 mL을 첨가하여 수세하였다. 그리고 DPBS를 제거하고 TrypLE(Gibco)를 배양부피의 20%인 2 mL을 첨가하고 37℃, 5% CO2 배양기에서 2분간 반응시켰다. 반응이 완료된 후, 배양 배지를 추가로 첨가한 뒤 800xg, 4℃에서 2분 동안 원심분리하여 상층액을 제거하였다. 그리고 배양배지를 이용하여 재현탁한 후, trypan blue(Gibco)와 헤마토사이토미터를 이용하여 세포수를 측정하여 100 mm 세포배양접시에 2x106개의 세포를 10 mL의 배양 배지와 함께 분주하여 계대배양하였으며, 계대배양은 3~4일 마다 상기와 같은 방법으로 실시하였다.
실시예 2: BoNT/A 중독에 취약한 세포주 제작을 위한 유전자 선정 및 암호화 플라스미드 제작
도 1에 나타난 바와 같이, SEPTIN2(SEPT2)는 BoNT/A가 세포 내에서 분해되는 것으로부터 보호하는 역할을 하고, Thioredoxin(TXN)은 BoNT/A의 중쇄와 경쇄 사이의 이황화결합을 분리하는데 작용하는 것으로 알려져 있다. 상기 두 개의 단백질을 세포 내에서 과발현시키기 위하여, pLenti-C-Myc-DDK-P2A-Puro 벡터 내에 각각의 단백질을 코딩하는 유전자가 삽입된 pLenti-ORF 플라스미드(SEPTIN2: RC224864L3, TXN: RC208876L3)를 Origene 사에 의뢰하여 제작하였다. SEPTIN2 제작을 위해서는 서열번호 9의 아미노산 서열(DNA 서열: 서열번호 10)을 이용하였고, Thioredoxin 제작을 위해서는 서열번호 11의 아미노산 서열(DNA 서열: 서열번호 12)을 이용하였다. pLenti-C-Myc-DDK-P2A-Puro 벡터맵은 도 2에 나타내었다. 동결건조된 pLenti-ORF 플라스미드가 담긴 튜브를 5000xg에서 3분 동안 원심분리한 후에, 증류수 100 μL를 첨가하고 파이펫팅한 후에 -20℃ 냉동고에서 사용 전까지 보관하였다.
pLenti-ORF 플라스미드로 형질전환된 균주를 제작하기 위하여, 플라스미드는 상온에서 해동시키고, 수용성 세포(competent cell, RBC bioscience)는 100 μL를 4℃에서 해동하였다. 그리고 해동된 플라스미드 2 μL를 수용성 세포에 처리한 뒤 4℃에서 10분 동안 반응시킨 후, 37℃로 1분간 열충격(heat shock)을 가한 후 LB broth 700 μL를 첨가하고 37℃ 진탕 배양기에서 15분 동안 배양하였다. 배양이 완료된 후, 34 μg/mL의 클로람페니콜이 첨가된 LB 한천 평판(agar plate)에 배양액 20 μL를 첨가하고 스프레더로 고르게 펴주었다. 균을 처리한 한천 평판은 37℃ 배양기에서 16시간 동안 배양하였다. 그리고 한천 평판 위에 생성된 군체(colony)를 각각 클로람페니콜이 첨가된 LB broth 1.5 mL에 접종하고, 37℃ 배양기에서 16시간 동안 진탕배양하였다. 배양이 완료된 후, 배양액을 13,000 rpm으로 1분 동안 원심분리하여 상층액을 제거하고 남은 펠렛은 DNA-spin Plasmid DNA Purification Kit(iNtRON)를 이용하여 제공된 프로토콜에 따라 플라스미드의 정제에 사용하였다. 그리고 정제된 플라스미드의 염기서열은 코스모진텍에 의뢰하여 분석하였다. 염기서열 분석에 이용된 프라이머 서열은 표 1에 나타내었다. 염기서열 분석 결과, SEPTIN2는 NCBI의 accession number NM_001008491.2와, TXN은 NM_003329.4와 정확히 일치하는 것을 확인하였고, 이를 통하여, SEPTIN2 또는 TXN, 즉, 표적 유전자가 정상적으로 삽입된 플라스미드가 제작되었다는 것을 확인하였다.
Name Primer sequence (5' -> 3') 서열번호
SEPTIN2 V2 AGAGCTCGTTTAGTGAA 1
SEPTIN2-600F GGATGAAATTGAAGAACATA 2
TXN V2 AGAGCTCGTTTAGTGAA 3
pLenti-ORF 플라스미드를 대량 생산하기 위하여, 플라스미드로 형질전환된 균주 배양액 500 μL를 34 μg/mL의 클로람페니콜이 첨가된 100 mL의 LB broth에 접종한 후 37℃에서 16시간 동안 진탕배양하였다. 그리고 배양액을 500 mL Centrifuge bottle(Nalgene)로 옮긴 뒤 6000xg, 4℃로 15분 동안 원심분리하고 상층액을 제거하였다. 그리고 HiSpeed Plasmid Midi Kit(Qiagen)를 이용하여 펠렛으로부터 플라스미드를 정제하였다. 정제된 플라스미드는 Life Science UV/Vis Spectrophotometer DU 730(Beckman Coulter)을 이용하여 정량하였다. 그 결과는 표 2에 나타내었다.
Gene A260 A280 260/280 ratio DNA concentration (ng/μL)
TXN 1.119 0.595 1.880 559
SEPTIN2 1.059 0.562 1.884 529
실시예 3: 293FT 세포주 내 형질주입을 통한 렌티바이러스의 제작
렌티바이러스 생산 효율이 높은 세포주인 293FT 세포주를 상기 실시예 1과 동일한 방법으로 계대배양된 2.5x106 개의 세포를 100 mm 세포배양접시에 분주하였다. 그리고 세포 포화도가 40~50%에 도달하는 것을 현미경으로 확인하였다. 그 결과는 도 3에 나타내었다. 그리고 형질주입(transfection)을 위하여 1.5 mL 튜브에 opti-MEM(Gibco) 1.5 mL과 pLenti-ORF 플라스미드 5 μg을 첨가하고 혼합하였다. 그리고 증류수에 담겨있는 0.5 μg/μL의 packaging plasmid(Origene)를 6 μg을 첨가하고 혼합한 후에, TurboFectin(Origene) 33 μL를 추가로 첨가하고 혼합하였다. 혼합 용액은 상온에서 15분간 반응시킨 후에 세포배양접시에 모두 처리하고 2일 동안 배양하였다. 그리고 바이러스가 포함되어 있는 배지 상층액은 회수하여 4℃에서 보관하고, 새로운 배지를 첨가하고 다시 1일간 배양하였다. 그리고 다시 배지 상층액을 회수하여 전날 회수한 배지와 혼합하여준 후에 0.45 μm 공극 여과기(syringe filter, Sartorius)를 이용하여 필터링해준 후에 사용 전까지 4℃에 보관하였다.
실시예 4: 렌티바이러스를 이용한 형질도입 세포주 제작
실시예 1과 동일한 방법으로 계대배양한 4x106 개의 SiMa(DSMZ, ACC164) 세포주를 10% FBS, 2 mM L-glutamine(Gibco) 및 1% penicillin-streptomycin(Gibco)이 첨가된 RPMI1640(Gibco) 배양 배지 4 mL이 첨가된 60 mm 세포배양접시에 분주하고 16시간 동안 배양하였다. 그리고 배양액을 제거해준 후에, 실시예 3과 동일한 방법으로 획득한 렌티바이러스 용액 1 mL과 새로운 배양 배지 3 mL을 혼합하여 첨가하고, 폴리브렌(Sigma-Aldrich)은 최종 농도가 8 μg/mL이 되도록 첨가하고 배양하였다. 다음날 배양액을 제거하고 새로운 배지를 첨가한 후에 다시 1일간 배양하고, 1 μg/mL의 퓨로마이신(Sigma-Aldrich)이 첨가된 새로운 배양배지로 교체하였다. 이후 3~4일 간격으로 퓨로마이신이 포함된 배양배지로 교체하면서 형질도입된 퓨로마이신 약제 내성 세포만을 선별하였다. 렌티바이러스를 이용하여 형질도입된 세포주를 제작하는 방법은 도 4에 간략히 나타내었다.
그리고 배양된 세포주를 각각의 군체로 분리하기 위하여, 도 5에 나타난 바와 같이, 클로닝 실린더(Sigma-Aldrich)를 이용하여 물리적으로 배양접시 내에 공간을 구획하였다. 보다 자세하게는, 배양에 사용했던 배지는 제거하고 DPBS 3 mL을 처리하여 세포를 수세한 후에 각각의 군체에 클로닝 실린더를 부착하고 실린더 내의 DPBS만 따로 제거하였다. 그리고 클로닝 실린더 내에 trypLE 50 μL를 각각 처리하고 37℃, 5% CO2 배양기에서 3 분간 반응시켰다. 이후 trypLE 및 세포 혼합액을 파이펫팅하여 혼합하여준 후에 1 μg/mL의 퓨로마이신이 첨가된 150 μL의 배양배지가 담겨져있는 96-웰 플레이트에 각각 분주하였다. 그리고 분주된 순서대로 세포주의 이름을 명명하였다. 이후 세포의 생장에 따라 스케일업하여 배양하였다.
실시예 5: 형질도입된 세포주의 확인
5.1. 도입된 단백질의 발현 여부 검증
실시예 4와 동일한 방법으로 제작된 형질도입 세포주를 확인하기 위하여, 일차적으로 발현되는 단백질을 웨스턴 블롯팅을 이용하여 확인하였다. 보다 자세하게는, 스케일업하여 배양된 100 mm 세포배양접시의 배지를 제거하고, 4℃의 DPBS 5 mL을 이용하여 수세하였다. 그리고 DPBS를 제거한 후에 cOmplete™ 및 EDTA-free Protease Inhibitor Cocktail(Roche)이 첨가되어있는 RIPA 용해 완충액(iNtRON) 200 μL를 세포에 처리하였다. Cell lifter(SPL)을 이용해 세포 용해액을 1.5 mL tube로 옮겨준 후에 4℃에서 20분 동안 움직임 없이 반응시켰다. 그리고 17,000 rpm, 4℃의 조건으로 30분 동안 원심분리한 후에 상층액을 새로운 1.5 mL 튜브로 옮겨담았다. Pierce™ BCA Protein Assay Kit(ThermoFisher)를 이용하여 상층액 내의 단백질량을 정량하고, 4X Laemmli Sample Buffer(Bio-Rad)로 샘플링한 후에 100℃에서 10분간 가열하여 웨스턴 블롯팅을 위한 시료를 준비하였다. 그리고 15% 폴리아크릴아미드 젤을 이용하여 웨스턴 블롯팅을 실시하였다. 전기영동을 통해 시료 내 단백질을 크기에 따라 분리하고, 100 V, 1시간 조건으로 Immobilon-P PVDF Membrane(Merck)으로 이동시켰다. 단백질의 이동이 완료된 membrane은 Ponceau S(Sigma-Aldrich)로 염색하여 단백질 발현 패턴을 확인하였다. Membrane을 0.1% polysorbate 20 in PBS(PBST)에 담가 5분씩 4회 Digital Orbital Shaker(DAIHAN Scientific)를 이용하여 수세하여 Ponceau S를 제거하고, 블로킹 완충액(5% BSA PBST)을 첨가하고 상온에서 1시간 동안 Digital Orbital Shaker를 이용하여 블로킹시켰다. pLenti-C-Myc-DDK-P2A-Puro 벡터 내의 타겟 유전자, 즉, 삽입된 유전자가 발현되면 발현되는 단백질의 C-말단에는 Myc과 DDK 태그가 함께 발현된다. 따라서, 블로킹이 완료된 membrane에 Myc 태그에 특이적으로 결합하는 1차 항체(Myc-tag, Cell Signaling Technology, 2278S, 1:1000 v/v in 2% BSA PBST)를 처리하고 4℃에서 Digital Orbital Shaker를 이용하여 16시간 동안 반응시켰다. 반응이 완료된 membrane은 PBST에 담가 5분씩 4회, Digital Orbital Shaker를 이용하여 세척하여준 후에, 2차 항체(Anti-Rabbit HRP, abcam, ab6721, 1:10000 v/v in PBST)를 처리하고 상온에서 1시간 동안 반응시켰다. 이후 PBST에 membrane을 담가 5분씩 4회, Digital Orbital Shaker를 이용하여 세척하고, Pierce ECL Western Blotting Substrate(ThermoFisher)를 처리한 후에 ImageQuant LAS 500(Cytiva)으로 단백질을 검출하였다. 그 결과는 도 6에 나타내었다.
도 6에 나타난 바와 같이, 형질도입된 SiMa 세포주에서 Thioredoxin 단백질 또는 Septin-2 단백질이 발현되는 것을 확인하였다. 다만, SEPTIN2-1 세포주에서는 Septin-2 외에 다른 미확인 밴드가 검출되었다.
5.2. 유전자 도입 여부 검증
실시예 4와 동일한 방법으로 제작된 형질도입 세포주에서 표적 유전자의 도입을 확인하기 위하여, 세포주로부터 유전체 DNA를 분리한 후에 도입 유전자 부분을 PCR을 이용하여 증폭시켰다. PCR을 위한 프라이머는 형질도입된 유전자와 내재성(endogenous) 유전자를 구별하기 위하여, 형질도입된 유전자만 가지고 있는 3'-말단의 서열을 이용하여 프라이머를 디자인한 후, 코스모진텍에 의뢰하여 제작하였다. PCR에 이용된 프라이머 서열은 표 3에 나타내었다. 도 7에 나타난 바와 같이, TXN 또는 SEPTIN2 유전자의 증폭을 위한 정방향 프라이머(forward primer)는 각각의 유전자의 5'-말단 서열에 결합되도록 디자인하였고, 두 유전자 공통의 역방향 프라이머(reverse primer)는 DDK-tag 서열에 결합되도록 디자인하였다. 그리고 베타글로빈(β-globin) 유전자를 증폭시킬 수 있는 프라이머(GH20 및 GH21)를 양성 대조군으로 이용하였다.
Purpose Name Primer sequence (5' -> 3') 서열번호
PCR TXN forward CTTTTCAGGAAGCCTTGG 4
SEPTIN2 forward GTCTAAGCAACAGCCAAC 5
DDK reverse (common) CTTATCGTCGTCATCCTTG 6
Positive control GH20 GAAGAGCCAAGGACAGGTAC 7
GH21 GGAAAATAGACCAATAGGCAG 8
PCR을 위하여, 형질도입된 SiMa-TXN-3, SiMa-SEPTIN2-1, SiMa-SEPTIN2-2, 그리고 SiMa-SEPTIN2-3 세포주를 각각 1 μg/mL의 퓨로마이신이 첨가된 배양배지가 담겨있는 100 mm 세포배양접시에 분주하고, 세포 포화도가 약 80%에 도달하였을 때, Wizard® Genomic DNA Purification Kit(Promega)를 이용하여 제공되는 프로토콜에 따라 각 세포주의 유전체 DNA를 추출하고, 추출된 유전체 DNA는 Life Science UV/Vis Spectrophotometer DU 730(Beckman Coulter)을 이용하여 정량하였다. 그 결과는 표 4에 나타내었다.
Cell line 260/280 ratio DNA concentration (ng/uL)
SiMa-TXN-3 1.937 1072.0
SiMa-SEPTIN2-1 1.830 887.5
SiMa-SEPTIN2-2 1.939 947.0
SiMa-SEPTIN2-3 1.916 1053.0
그리고 유전체 DNA 50 ng, 2X Platinum SuperFi PCR Master Mix 25 μL, 10 μM의 forward primer와 reverse primer를 각각 2.5 μL씩 혼합하고, 최종적으로 50 μL가 되도록 증류수를 첨가하여 PCR 시료를 준비한 후에 PCR을 실시하였다. PCR 조건은 표 5에 나타내었다.
Cycle Procedure Temperature (℃) Time
1 Denaturation 95 30 sec
30 Denaturation 95 30 sec
Annealing 50 30 sec
Elongation 72 1 min 30 sec
1 Elongation 72 5 min
1 Storage 4 Overnight
PCR이 완료된 후에 0.01%(v/v) EcoDye™Nucleic Acid Staining Solution(Biofact)이 혼합된 1.5%(w/v) DNA 아가로오스 젤과 전기영동 키트인 Mupid-One(Advance)을 이용하여 전기영동하였다. 전기영동은 100 V로 35분 동안 실시하였으며, Gel Documentation System LSG 1000(iNtRON)을 이용하여 이미징하였다. 그 결과는 도 8에 나타내었다.
도 8에 나타난 바와 같이, SiMa-TXN-3 세포주에서 양성 대조군에 해당하는 베타글로빈 유전자와, 형질도입된 DDK-tag를 포함한 TXN 유전자가 모두 정상적으로 증폭된 것을 확인하였다. 또한, SiMa-SEPTIN2-1, SiMa-SEPTIN2-2, SiMa-SEPTIN2-3, 각각의 세포주에서도 형질도입된 DDK-tag을 포함한 SEPTIN2 유전자가 모두 증폭된 것을 확인하였다. 상기 결과를 통하여, 형질도입된 유전자를 과발현하는 형질도입 세포주가 정상적으로 제조되었음을 확인할 수 있었다.
실시예 6: 샌드위치 ELISA를 통한 BoNT/A 생물학적 활성 검증
6.1. BoNT/A를 처리한 SiMa-SEPTIN2-3 세포의 세포 용해액 제조
세포 기반 보툴리눔 독소의 생물학적 활성 검증 시스템을 확인하기 위하여, 일차적으로 보툴리눔 독소가 처리된 세포의 세포 용해액을 제조하였다. 보툴리눔 독소를 처리하기 위하여, 대조군으로는 SiMa 세포주를 10% FBS, 2 mM L-glutamine 및 1% penicillin-streptomycin이 첨가된 RPMI1640 배지가 담겨있는 96-웰 플레이트에 1.2 X 105 cells/100 μL/well의 농도로, 실험군으로는 SiMa-SEPTIN2-3 세포주를 10% FBS, 2 mM L-glutamine 및 1% penicillin-streptomycin 및 1 μg/mL 퓨로마이신이 첨가된 RPMI1640 배지가 담겨있는 96-웰 플레이트에 1.2 X 105 cells/100 μL/well의 농도로 각각 분주하였다. 각 세포주를 분주하고 2일 동안 배양한 후에, 배지를 제거하고 1X B-27™ Plus Supplement(Gibco), 1X N-2 Supplement(Gibco), 2 mM L-glutamine 및 25 μg/mL Trisialoganglioside GT1B(Matreya)가 첨가되어 있는 100 μL의 분화배지를 처리하고 2일 동안 배양하여 분화를 유도하였다. 분화 2일 후에 배지를 제거하고, 1X B-27™ Plus Supplement 및 1X N-2 Supplement 및 0.25% Human Serum Albumin(녹십자)이 첨가되어 있는 RPMI1640에 BoNT/A 복합체를 1.35배씩 연속희석(serial dilution)하여 최종적으로 100 μL가 되도록 각 웰에 첨가하였다. 보툴리눔 독소를 처리하고 4일 동안 배양한 후에 배지를 제거하고, protease inhibitor cocktail이 첨가된 용해 완충액(50 mM HEPES(pH 7.4), 150 mM NaCl, 1.5 mM MgCl2 및 1% Triton X-100) 110 μL를 각 웰에 처리하여, 세포를 용해시켰다. 그리고 세포 용해액을 1.5 mL 튜브로 옮겨 담고, 17,000 rpm, 4℃에서 5분 동안 원심분리하여 상층액을 획득하여, 샌드위치 ELISA에 이용할 세포 용해액을 제조하였다.
6.2. 샌드위치 ELISA를 이용한 EC50 확인
보툴리눔 독소 세로타입 A(BoNT/A)는 신경근접합부(neuromuscular junction)의 전시냅스(presynapse)에 작용하여 전시냅스 세포막에 결합되어 있는 Synaptosomal-Associated Protein, 25kDa(SNAP-25) 분자의 절단을 야기하는 것으로 알려져 있기 때문에, 이 원리를 적용하여 절단된 SNAP-25(cleaved SNAP-25), 그리고 온전한 SNAP-25를 인식할 수 있는 각각의 항체를 이용한 샌드위치 Enzyme-Linked Immunosorbent Assay(ELISA) 시험법을 디자인하였다. 그 원리는 도 9에 간략히 나타내었다.
절단된 SNAP-25에 특이적으로 결합하는 포획 항체(capture antibody)인 Mouse Synaptosomal Protein 25kDa(SNAP-25, a.a. 183-197) cleaved Monoclonal Antibody(Mybiosource, MBS312597)를 0.1 M의 sodium carbonate 코팅 완충액(coating buffer, pH 9.6)을 이용하여 0.2%(v/v)의 농도로 희석한 후에 100 μL를 Clear Flat-Bottom Immuno Nonsterile 96-Well Plate(ThermoFisher)의 각 웰에 처리하고 4℃에서 16시간 동안 움직임 없이 반응시켰다. 이후 웰에 결합하지 않은 항체를 제거하고, 0.1% polysorbate 20 in PBS(PBST) 200 μL를 이용하여 3회 세척하였다. 그리고 블로킹 완충액(5% BSA PBST) 200 μL를 각 웰에 처리하고, 상온에서 75 rpm의 조건으로 1 시간 동안 shaker에 두었다. 1시간 후에 블로킹 완충액을 제거하고 PBST 200 μL를 이용하여 3회 세척하고, 실시예 6.1과 동일한 방법으로 획득한 세포 용해액 90 μL를 첨가하고 상온에서 75 rpm의 조건으로 shaker에서 2시간 동안 반응시켰다. 그리고 세포 용해액을 제거하고 PBST 200 μL로 3회 세척하였다. 이후, 검출 항체(detection antibody)인 Anti-SNAP-25 antibody(Sigma-Aldrich, S9684)를 블로킹 완충액을 이용하여 0.1%(v/v)의 농도로 희석한 후에 100 μL를 각 웰에 처리하고, 상온에서 75 rpm의 조건으로 shaker에서 1시간 동안 반응시켰다. 이후, PBST 200 μL를 이용하여 3회 세척하여 결합하지 않은 항체들을 모두 제거하고, 2차 항체인 Anti-Rabbit HRP(abcam, ab6721)를 블로킹 완충액을 이용하여 0.01%(v/v)으로 희석하고, 희석된 항체 용액 100 μL를 각 웰에 처리하고 상온에서 75 rpm 조건으로 shaker에서 1 시간 동안 반응시켰다. 그리고 PBST 200 μL를 이용하여 3회 세척한 후에, TMB Peroxidase EIA Substrate Kit(Bio-Rad)의 TMB 용액과 과산화수소 용액을 9 : 1로 혼합하고, 각 웰에 50 μL를 처리한 후에 37℃ 배양기에서 30분 동안 반응시켰다. 이후 2 N의 황산(sulfuric acid) 50 μL를 각 웰에 처리한 후에, SpectraMax Plus 384 Microplate Reader(Moleculardevices)를 이용하여 450 nm 파장대의 흡광도(OD450)를 측정하였다. 획득한 로우 데이터(raw data)는 GraphPad Prism Version 7.00(GraphPad Software, Inc.)을 이용하여 용량-반응 곡선(four parameters)을 작성하고, 자사 마우스 역가시험 결과(unit)를 기준으로 EC50 값을 산출하였다. 이후 모든 실험은 최소 세 번 이상 반복하였으며, 결과는 평균값 ± 표준편차로 나타내었다. 그 결과는 도 10에 나타내었다.
도 10에 나타난 바와 같이, 대조군인 SiMa 세포주의 EC50은 7.35U/mL (0.49pM), SEPTIN2-3 형질도입 세포주의 EC50는 5.38U/mL(0.36pM)의 값을 나타내는 것을 확인하였다. 이를 통하여, SEPTIN2를 과발현시킴으로써 민감도를 향상시킬 수 있다는 것을 확인할 수 있었다.
또한, 보다 자세히 세포주 간의 민감도 차이를 비교하기 위하여, SiMa 세포주 각 그룹의 OD450nm 값을 SEPTIN2-3 세포주 각 그룹의 OD450nm 값으로 나누어 같은 보툴리눔 독소 처리에 대한 세포주의 반응 정도를 비교하였다. 그 결과는 도 11에 나타내었다.
도 11에 나타난 바와 같이, 독소를 처리하지 않은 OD450SEPTIN2/OD450WT 값은 1인데 반해, 독소를 처리하였을 때는 약 1.7 정도까지 그 값이 상승하여 세포주 간 독소에 대한 감도의 차이를 보이는 것을 확인하였다. 이를 통하여, SEPTIN2 유전자를 과발현하는 형질도입 세포주는 대조군(wild type)과 비교하여 보툴리눔 독소에 대한 민감도가 증가된 것을 확인할 수 있었다.
6.3. BoNT/A를 처리한 SiMa-Thioredoxin 세포의 세포 용해액 제조
세포 기반 보툴리눔 독소의 생물학적 활성 검증 시스템을 확인하기 위하여, 일차적으로 보툴리눔 독소가 처리된 세포의 세포 용해액을 제조하였다. 보툴리눔 독소를 처리하기 위하여, 대조군으로는 SiMa 세포주를 10% FBS, 2 mM L-glutamine 및 1% penicillin-streptomycin이 첨가된 RPMI1640 배지가 담겨있는 96-웰 플레이트에 8 X 104 cells/100 μL/well의 농도로, 실험군으로는 SiMa-TXN3 세포주를 10% FBS, 2 mM L-glutamine 및 1% penicillin-streptomycin 및 1 μg/mL 퓨로마이신이 첨가된 RPMI1640 배지가 담겨있는 96-웰 플레이트에 8 X 104 cells/100 μL/well의 농도로 각각 분주하였다. 각 세포주를 분주하고 2일 동안 배양한 후에, 배지를 제거하고 1X B-27™ Plus Supplement(Gibco), 1X N-2 Supplement(Gibco), 2 mM L-glutamine 및 25 μg/mL Trisialoganglioside GT1B(Matreya)가 첨가되어 있는 100 μL의 분화배지를 처리하고 2일 동안 배양하여 분화를 유도하였다. 분화 2일 후에 배지를 제거하고, RPMI1640에 BoNT/A 복합체를 0, 1, 5, 10, 50, 100, 500, 1000, 2000 (pM) 농도로 조제하여 최종적으로 100 μL씩 각 웰에 첨가하였다. 보툴리눔 독소를 처리하고 4일 동안 배양한 후에 배지를 제거하고, protease inhibitor cocktail이 첨가된 용해 완충액(50 mM HEPES(pH 7.4), 150 mM NaCl, 1.5 mM MgCl2 및 1% Triton X-100) 110 μL를 각 웰에 처리하여, 세포를 용해시켰다. 그리고 세포 용해액을 1.5 mL 튜브로 옮겨 담고, 17,000 rpm, 4℃에서 5분 동안 원심분리하여 상층액을 획득하여, 샌드위치 ELISA에 이용할 세포 용해액을 제조하였다.
6.4. 샌드위치 ELISA를 이용한 EC50 확인
실시예 6.2와 동일한 방법으로 TXN 유전자를 과발현하는 형질도입 세포주에 대한 보툴리눔 독소 민감도를 실시예 6.3의 세포 용해액을 이용하여 확인하였다. 그 결과는 도 12에 나타내었다.
도 12에 나타난 바와 같이, Thioredoxin 유전자를 과발현하는 형질도입 세포주는 대조군(wild type)과 비교하여 보툴리눔 독소에 대한 민감도가 증가된 것을 확인할 수 있었다.
실시예 7: 샌드위치 ELISA를 통한 BoNT/A 약학적 조성물(원료의약품)의 생물학적 활성 검증
세포 기반 보툴리눔 독소의 생물학적 활성 검증 시스템이 보툴리눔 독소 약학적 조성물(원료의약품)에도 적용이 가능한지 확인하기 위하여, SiMa-SEPTIN2-3 세포주를 이용하여 샌드위치 ELISA를 실시하였다. 보다 자세하게는, SiMa-SEPTIN2-3 세포주를 10% FBS, 2 mM L-glutamine, 1% penicillin-streptomycin 및 1 μg/mL 퓨로마이신이 첨가된 RPMI1640 배지가 담겨있는 96-웰 플레이트에 1.2 X 105 cells/100 μL/well의 농도로 분주하였다. 그리고 2일 동안 배양한 후에, 배지를 제거하고 1X B-27™ Plus Supplement, 1X N-2 Supplement, 2 mM L-glutamine 및 25 μg/mL Trisialoganglioside GT1B가 첨가되어 있는 100 μL의 분화배지를 처리하고 2일 동안 배양하여 분화를 유도하였다. 분화 2일 후에 배지를 제거하고, 1X B-27™ Plus Supplement, 1X N-2 Supplement가 첨가되어 있는 RPMI1640에 BoNT/A 복합체(ATGC-100에서 보존 용액 등의 다른 물질이 제거된 원료의약품인 보툴리눔 독소)를 1.55배씩 연속희석(serial dilution)하여 세포에 농도별로 처리하였다. 보툴리눔 독소를 처리하고 4일 동안 배양한 후에 배지를 제거하고, protease inhibitor cocktail이 첨가된 용해 완충액(50 mM HEPES(pH 7.4), 150 mM NaCl, 1.5 mM MgCl2 및 1% Triton X-100) 110 μL를 각 웰에 처리하여, 세포를 용해시켰다. 그리고 세포 용해액을 1.5 mL 튜브로 옮겨 담고, 17,000 rpm, 4℃에서 5분 동안 원심분리하여 상층액을 획득하여, 샌드위치 ELISA에 이용할 세포 용해액을 제조하였다.
그리고 절단된 SNAP-25에 특이적으로 결합하는 포획 항체(capture antibody)인 Mouse Synaptosomal Protein 25kDa(SNAP-25, a.a. 183-197) cleaved Monoclonal Antibody(Mybiosource)를 0.1 M의 sodium carbonate 코팅 완충액(coating buffer, pH 9.6)을 이용하여 0.8%(v/v)의 농도로 희석한 후에 100 μL를 Clear Flat-Bottom Immuno Nonsterile 96-Well Plate(ThermoFisher)의 각 웰에 처리하고 4℃에서 16시간 동안 움직임 없이 반응시켰다. 이후 웰에 결합하지 않은 항체를 제거하고, 0.1% polysorbate 20 in PBS(PBST) 200 μL를 이용하여 3회 세척하였다. 그리고 블로킹 완충액(5% BSA PBST) 200 μL를 각 웰에 처리하고, 상온에서 75 rpm의 조건으로 2 시간 동안 shaker에 두었다. 2시간 후에 블로킹 완충액을 제거하고 획득한 세포 용해액 90 μL를 첨가하고 상온에서 75 rpm의 조건으로 shaker에서 2시간 동안 처리하였다. 이후 세포 용해액을 제거하고 PBST 200 μL로 3회 세척하였다. 이후, 검출 항체(detection antibody)인 Anti-SNAP-25 antibody(Sigma-Aldrich, S9684)를 블로킹 완충액을 이용하여 0.1%(v/v)의 농도로 희석한 후에 100 μL를 각 웰에 처리하고, 상온에서 75 rpm의 조건으로 shaker에서 1시간 동안 반응시켰다. 이후, PBST 200 μL를 이용하여 3회 세척하여 결합하지 않은 항체들을 모두 제거하고, 2차 항체인 Anti-Rabbit HRP(abcam, ab6721)를 블로킹 완충액을 이용하여 0.01%(v/v)으로 희석하고, 희석된 항체 용액 100 μL를 각 웰에 처리하고 상온에서 75 rpm 조건으로 shaker에서 1 시간 동안 처리하였다. 그리고 PBST 200 μL를 이용하여 3회 세척한 후에, TMB(ThermoFisher, 34028) 용액을 각 웰에 100 μL를 처리한 후에 상온에서 15분 동안 반응시켰다. 이후 2 N의 황산(sulfuric acid) 100 μL를 각 웰에 처리한 후에, SpectraMax Plus 384 Microplate Reader(Moleculardevices)를 이용하여 450 nm 파장대의 흡광도(OD450)를 측정하였다. 획득한 로우 데이터(raw data)는 GraphPad Prism Version 7.00(GraphPad Software, Inc.)을 이용하여 용량-반응 곡선(four parameters)을 작성하고, 자사 마우스 역가시험 결과(unit)을 기준으로 EC50 값을 산출하였다. 그 결과는 도 13에 나타내었다.
도 13에 나타난 바와 같이, 보툴리눔 독소 용량 의존적으로 SNAP-25 절단량이 증가되는 것을 확인하였다. 그리고 EC50 값은 16.98 U/mL인 것을 확인하였다.
실시예 8: 샌드위치 ELISA를 통한 BoNT/A 약학적 조성물(완제의약품)의 생물학적 활성 검증
세포 기반 보툴리눔 독소의 생물학적 활성 검증 시스템이 또 다른 보툴리눔 독소 약학적 조성물(완제의약품)에도 적용이 가능한지 확인하기 위하여, SiMa-SEPTIN2-3 세포주를 이용하여 샌드위치 ELISA를 실시하였다. 보다 자세하게는, SiMa-SEPTIN2-3 세포주를 10% FBS, 2 mM L-glutamine, 1% penicillin-streptomycin 및 1 μg/mL 퓨로마이신이 첨가된 RPMI1640 배지가 담겨있는 96-웰 플레이트에 1.2 X 105 cells/100 μL/well의 농도로 분주하였다. 그리고 2일 동안 배양한 후에, 배지를 제거하고 1X B-27™ Plus Supplement, 1X N-2 Supplement, 2 mM L-glutamine 및 25 μg/mL Trisialoganglioside GT1B가 첨가되어 있는 100 μL의 분화배지를 처리하고 2일 동안 배양하여 분화를 유도하였다. 분화 2일 후에 배지를 제거하고, 1X B-27™ Plus Supplement, 1X N-2 Supplement가 첨가되어 있는 RPMI1640에 BoNT/A 완제의약품(ATGC-100)을 1.4배씩 연속희석(serial dilution)하여 세포에 농도별로 처리하였다. 보툴리눔 독소를 처리하고 4일 동안 배양한 후에 배지를 제거하고, protease inhibitor cocktail이 첨가된 용해 완충액(50 mM HEPES(pH 7.4), 150 mM NaCl, 1.5 mM MgCl2 및 1% Triton X-100) 110 μL를 각 웰에 처리하여, 세포를 용해시켰다. 그리고 세포 용해액을 1.5 mL 튜브로 옮겨 담고, 17,000 rpm, 4℃에서 5분 동안 원심분리하여 상층액을 획득하여, 샌드위치 ELISA에 이용할 세포 용해액을 제조하였다.
그리고 절단된 SNAP-25에 특이적으로 결합하는 포획 항체(capture antibody)인 Mouse Synaptosomal Protein 25kDa(SNAP-25, a.a. 183-197) cleaved Monoclonal Antibody(Mybiosource)를 0.1 M의 sodium carbonate 코팅 완충액(coating buffer, pH 9.6)을 이용하여 0.8%(v/v)의 농도로 희석한 후에 100 μL를 Clear Flat-Bottom Immuno Nonsterile 96-Well Plate(ThermoFisher)의 각 웰에 처리하고 4℃에서 16시간 동안 움직임 없이 반응시켰다. 이후 웰에 결합하지 않은 항체를 제거하고, 0.1% polysorbate 20 in PBS(PBST) 200 μL를 이용하여 3회 세척하였다. 그리고 블로킹 완충액(5% BSA PBST) 200 μL를 각 웰에 처리하고, 상온에서 75 rpm의 조건으로 2 시간 동안 shaker에 두었다. 2시간 후에 블로킹 완충액을 제거하고 획득한 세포 용해액 90 μL를 첨가하고 상온에서 75 rpm의 조건으로 shaker에서 2시간 동안 처리하였다. 그리고 세포 용해액을 제거하고 PBST 200 μL로 3회 수세하였다. 이후, 검출 항체(detection antibody)인 Anti-SNAP-25 antibody(Sigma-Aldrich, S9684)를 블로킹 완충액을 이용하여 0.1%(v/v)의 농도로 희석한 후에 100 μL를 각 웰에 처리하고, 상온에서 75 rpm의 조건으로 shaker에서 1시간 동안 반응시켰다. 이후, PBST 200 μL를 이용하여 3회 세척하여 결합하지 않은 항체들을 모두 제거하고, 2차 항체인 Anti-Rabbit HRP(abcam, ab6721)를 블로킹 완충액을 이용하여 0.01%(v/v)으로 희석하고, 희석된 항체 용액 100 μL를 각 웰에 처리하고 상온에서 75 rpm 조건으로 shaker에서 1 시간 동안 처리하였다. 그리고 PBST 200 μL를 이용하여 3회 세척한 후에, TMB(ThermoFisher, 34028) 용액을 각 웰에 100 μL를 처리한 후에 상온에서 15분 동안 반응시켰다. 이후 2 N의 황산(sulfuric acid) 100 μL를 각 웰에 처리한 후에, SpectraMax Plus 384 Microplate Reader(Moleculardevices)를 이용하여 450 nm 파장대의 흡광도(OD450)를 측정하였다. 획득한 로우 데이터(raw data)는 GraphPad Prism Version 7.00(GraphPad Software, Inc.)을 이용하여 용량-반응 곡선(four parameters)을 작성하고, 자사 마우스 역가시험 결과(unit)을 기준으로 EC50 값을 산출하였다. 그 결과는 도 14에 나타내었다.
도 14에 나타난 바와 같이, 보툴리눔 독소 용량 의존적으로 SNAP-25 절단량이 증가되는 것을 확인하였다. 그리고 EC50 값은 5.42 U/mL인 것을 확인하였다.
상기 결과들을 통하여, 도 15에 나타난 바와 같이 본 발명의 렌티바이러스를 이용하여 SEPTIN2 또는 TXN 유전자를 과발현하는 세포주를 이용함으로써 보툴리눔 독소뿐만 아니라, 보툴리눔 독소 약학적 조성물, 즉, 원료의약품 및 완제의약품의 역가를 세포 기반으로 용이하게 측정할 수 있으며 그 민감도를 현저히 향상시킬 수 있다는 것을 확인할 수 있었다. 따라서, 본 발명의 세포주를 보툴리눔 독소를 이용하는 다양한 산업 분야에 적용할 수 있을 것으로 기대된다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명의 보툴리눔 독소 활성 측정용 세포는 보툴리눔 독소에 대한 민감성이 현저히 향상되었기 때문에 다수의 동물실험을 대체하여, 보툴리눔 독소뿐만 아니라, 원료의약품 또는 완제의약품 상태의 보툴리눔 독소 약학적 조성물의 활성을 측정하는 다양한 산업 분야에 폭넓게 이용될 수 있다.

Claims (8)

  1. SEPTIN2 또는 Thioredoxin(TXN)을 과발현하는 보툴리눔 독소 활성 측정용 세포.
  2. 제 1 항에 있어서,
    상기 세포는 SEPTIN2 또는 TXN 유전자가 형질도입(transduction)되어 과발현되는 것을 특징으로 하는, 보툴리눔 독소 활성 측정용 세포.
  3. 제 1 항에 있어서,
    상기 세포는 보툴리눔 독소 중독(intoxication)에 대한 감수성이 증가된 것을 특징으로 하는, 보툴리눔 독소 활성 측정용 세포.
  4. 제 1 항에 있어서,
    상기 세포는 SiMa 세포, LAN-2 세포, PC12 세포, Neuro-2a 세포, LA1-55n 세포, N18 세포, SH-SY5Y 세포, Kelly 세포, NB69 세포, N1E-115 세포, BE(2)-M17 세포, 및 SK-N-BE(2) 세포로 이루어진 군으로부터 선택된 어느 하나인 것을 특징으로 하는, 보툴리눔 독소 활성 측정용 세포.
  5. 제 1 항에 있어서,
    상기 보툴리눔 독소는 보툴리눔 세로타입(serotype) A, B, C, D, E, F 및 G로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는, 보툴리눔 독소 활성 측정용 세포.
  6. a) 제 1 항 내지 제 5 항 중 어느 한 항의 보툴리눔 독소 활성 측정용 세포에 보툴리눔 독소를 처리하고 배양하는 단계;
    b) 상기 배양된 세포를 용해시키고 세포 용해액을 수집하는 단계; 및
    c) 상기 세포 용해액 내의 SNAP-25 절단 생성물의 양을 측정하는 단계를 포함하는, 보툴리눔 독소 활성 측정 방법.
  7. 제 6 항에 있어서,
    상기 SNAP-25 절단 생성물의 양은 샌드위치 면역검정법(ELISA) 또는 웨스턴블롯(Western blot)을 이용하여 측정하는 것을 특징으로 하는, 보툴리눔 독소 활성 측정 방법.
  8. 제 1 항 내지 제 5 항 중 어느 한 항의 보툴리눔 독소 활성 측정용 세포를 유효성분으로 포함하는, 보툴리눔 독소 활성 측정용 키트.
PCT/KR2022/007323 2021-05-24 2022-05-24 렌티바이러스에 의해 특정 유전자가 삽입된 보툴리눔 독소에 민감한 세포 WO2022250405A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA3219818A CA3219818A1 (en) 2021-05-24 2022-05-24 Cells sensitive to botulinum toxin into which specific gene has been inserted by lentivirus
EP22811598.6A EP4349992A1 (en) 2021-05-24 2022-05-24 Cells sensitive to botulinum toxin into which specific gene has been inserted by lentivirus
BR112023024599A BR112023024599A2 (pt) 2021-05-24 2022-05-24 Células sensíveis à toxina botulínica dentro das quais um gene específico foi inserido por um lentivírus
CN202280037765.5A CN117529557A (zh) 2021-05-24 2022-05-24 通过慢病毒插入有特定基因的对肉毒杆菌毒素敏感的细胞

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210066040 2021-05-24
KR10-2021-0066040 2021-05-24
KR10-2022-0063008 2022-05-23
KR1020220063008A KR20220159283A (ko) 2021-05-24 2022-05-23 렌티바이러스에 의해 특정 유전자가 삽입된 보툴리눔 독소에 민감한 세포

Publications (1)

Publication Number Publication Date
WO2022250405A1 true WO2022250405A1 (ko) 2022-12-01

Family

ID=84229351

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/007323 WO2022250405A1 (ko) 2021-05-24 2022-05-24 렌티바이러스에 의해 특정 유전자가 삽입된 보툴리눔 독소에 민감한 세포

Country Status (4)

Country Link
EP (1) EP4349992A1 (ko)
BR (1) BR112023024599A2 (ko)
CA (1) CA3219818A1 (ko)
WO (1) WO2022250405A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6444209B1 (en) 1996-10-28 2002-09-03 Wisconsin Alumni Research Foundation Hybrid botulinal neurotoxins
US20120208271A1 (en) * 2009-03-13 2012-08-16 Allergan, Inc. Cells Useful for Immuno-Based Botulinum Toxin Serotype A Activity Assays
KR20120134154A (ko) 2008-03-14 2012-12-11 알러간, 인코포레이티드 면역-기반 보툴리눔 독소 세로타입 ａ 활성 검정
KR101609894B1 (ko) * 2008-03-14 2016-04-08 알러간, 인코포레이티드 면역-기반 보툴리눔 독소 세로타입 ａ 활성 검정
KR20200072008A (ko) * 2018-12-12 2020-06-22 주식회사 에이비바이오 보툴리눔 독소 활성을 결정하는 세포 기반 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6444209B1 (en) 1996-10-28 2002-09-03 Wisconsin Alumni Research Foundation Hybrid botulinal neurotoxins
KR20120134154A (ko) 2008-03-14 2012-12-11 알러간, 인코포레이티드 면역-기반 보툴리눔 독소 세로타입 ａ 활성 검정
KR101609894B1 (ko) * 2008-03-14 2016-04-08 알러간, 인코포레이티드 면역-기반 보툴리눔 독소 세로타입 ａ 활성 검정
US20120208271A1 (en) * 2009-03-13 2012-08-16 Allergan, Inc. Cells Useful for Immuno-Based Botulinum Toxin Serotype A Activity Assays
KR20200072008A (ko) * 2018-12-12 2020-06-22 주식회사 에이비바이오 보툴리눔 독소 활성을 결정하는 세포 기반 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PIRAZZINI MARCO, AZARNIA TEHRAN DOMENICO, ZANETTI GIULIA, ROSSETTO ORNELLA, MONTECUCCO CESARE: "Hsp90 and Thioredoxin-Thioredoxin Reductase enable the catalytic activity of Clostridial neurotoxins inside nerve terminals", TOXICON, ELMSFORD, NY, US, vol. 147, 1 June 2018 (2018-06-01), US , pages 32 - 37, XP093008794, ISSN: 0041-0101, DOI: 10.1016/j.toxicon.2017.10.028 *
VAGIN OLGA, TOKHTAEVA ELMIRA, GARAY PATTON E., SOUDA PUNEET, BASSILIAN SARA, WHITELEGGE JULIAN P., LEWIS RAMILLA, SACHS GEORGE, WH: "Recruitment of septin cytoskeletal proteins by Botulinum toxin A protease determines its remarkable stability", JOURNAL OF CELL SCIENCE, COMPANY OF BIOLOGISTS LIMITED, CAMBRIDGE, Cambridge , XP093008795, ISSN: 0021-9533, DOI: 10.1242/jcs.146324 *

Also Published As

Publication number Publication date
BR112023024599A2 (pt) 2024-02-20
EP4349992A1 (en) 2024-04-10
CA3219818A1 (en) 2022-12-01

Similar Documents

Publication Publication Date Title
Driks Bacillus subtilis spore coat
Kull et al. Isolation and functional characterization of the novel Clostridium botulinum neurotoxin A8 subtype
Hossain et al. An extracelluar protease, SepM, generates functional competence-stimulating peptide in Streptococcus mutans UA159
Groicher et al. The Staphylococcus aureus lrgAB operon modulates murein hydrolase activity and penicillin tolerance
Kullik et al. Deletion of the alternative sigma factor ςB in Staphylococcus aureus reveals its function as a global regulator of virulence genes
Quisel et al. Control of development by altered localization of a transcription factor in B. subtilis
Butcher et al. Identification of Bacillus subtilis σW‐dependent genes that provide intrinsic resistance to antimicrobial compounds produced by Bacilli
Novak et al. Penicillin tolerance genes of Streptococcus pneumoniae: the ABC‐type manganese permease complex Psa
Pflughoeft et al. Bacillus anthracis sin locus and regulation of secreted proteases
Hossain et al. Mutacins from Streptococcus mutans UA159 are active against multiple streptococcal species
Warscheid et al. A targeted proteomics approach to the rapid identification of bacterial cell mixtures by matrix‐assisted laser desorption/ionization mass spectrometry
Wong et al. Role of neuraminidase-producing bacteria in exposing cryptic carbohydrate receptors for Streptococcus gordonii adherence
Gorasia et al. Protein interactome analysis of the type IX secretion system identifies PorW as the missing link between the PorK/N ring complex and the Sov translocon
Harrington et al. Secretion, maturation, and activity of a quorum sensing peptide (GSP) inducing bacteriocin transcription in Streptococcus gallolyticus
Puymège et al. Conjugative transfer and cis-mobilization of a genomic island by an integrative and conjugative element of Streptococcus agalactiae
Nakamura et al. Unique biological activity of botulinum D/C mosaic neurotoxin in murine species
Waghmare et al. K+ channel-SEC11 binding exchange regulates SNARE assembly for secretory traffic
EP2739746A2 (en) Protease-deficient bacillus antracis
WO2022250405A1 (ko) 렌티바이러스에 의해 특정 유전자가 삽입된 보툴리눔 독소에 민감한 세포
Biswas et al. SmbFT, a putative ABC transporter complex, confers protection against the lantibiotic Smb in streptococci
Wilson et al. An exhaustive multiple knockout approach to understanding cell wall hydrolase function in Bacillus subtilis
Ruhland et al. YjbH requires its thioredoxin active motif for the nitrosative stress response, cell-to-cell spread, and protein-protein interactions in Listeria monocytogenes
Popoff Botulinum toxins, diversity, mode of action, epidemiology of botulism in France
Lin et al. Immunoprecipitation of native botulinum neurotoxin complexes from Clostridium botulinum subtype A strains
Gellings et al. Arcanobacterium haemolyticum utilizes both phospholipase d and arcanolysin to mediate its uptake into nonphagocytic cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22811598

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023572228

Country of ref document: JP

Ref document number: 3219818

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 202280037765.5

Country of ref document: CN

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023024599

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2023132277

Country of ref document: RU

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2022811598

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2022811598

Country of ref document: EP

Effective date: 20240102

ENP Entry into the national phase

Ref document number: 112023024599

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20231124