WO2022243609A1 - Methods and constructs for locating and profiling single cells in a biological sample - Google Patents
Methods and constructs for locating and profiling single cells in a biological sample Download PDFInfo
- Publication number
- WO2022243609A1 WO2022243609A1 PCT/FI2022/050347 FI2022050347W WO2022243609A1 WO 2022243609 A1 WO2022243609 A1 WO 2022243609A1 FI 2022050347 W FI2022050347 W FI 2022050347W WO 2022243609 A1 WO2022243609 A1 WO 2022243609A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- bead
- sequence
- oligonucleotide
- visually detectable
- wells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/155—Modifications characterised by incorporating/generating a new priming site
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/149—Particles, e.g. beads
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
- C12Q2565/10—Detection mode being characterised by the assay principle
- C12Q2565/102—Multiple non-interacting labels
Definitions
- the present invention generally relates to preparation of biological samples for next generation sequencing.
- the invention utilizes a random combination of microbeads with microscopically detectable or otherwise visible labels coupled to sequence barcode for spatial labelling and identification of mRNA or DNA products originating from a single position and for locating said single position in the sample slide.
- RNA expression profiling has been applied to single cells in suspensions, typically utilizing microwells or emulsion droplets where the single cells are encapsulated together with microbeads coated with unique cell barcode sequence and poly-T which capture the poly- A mRNA of the lysing cell, labelling the 3 ’ end of the mRNA with the cell barcode sequence in reverse transcription reaction and cDNA synthesis (see e.g. Macosko et al 2015 and WO2016040476 by the Broad Institute Inc.). After sequencing the mRNA transcripts derived from same original cell can be grouped together based on the cell barcode, and separate gene expression profiles of all cells generated. The current cell barcoding beads, however, are targeted only to cells in suspension.
- WO2021046232 discloses a system based on optically readable barcodes for characterization of molecular interactions of single cells. The system is relying on the use of oligonucleotide probes with multiple fluorescent labels. Improved methods are still in need.
- the present invention as defined in the appended claims is based on a novel design of microbeads with visible labels coupled with label specific barcodes that make it possible to link the obtained mRNA or DNA sequencing data to spatial coordinates of the cells in a biological sample profiled for RNA expression.
- One object of the invention is to provide construct for detecting nucleic acid targets, said construct comprising a bead, preferably a magnetic bead, wherein said bead comprises one or several visually detectable features and/or said bead is coupled to one or several visually detectable entities, and wherein said bead comprises an oligonucleotide, and said oligonucleotide comprises a) an amplification handle sequence, b) a barcode sequence specific to one or several of said visually detectable features and/or entities and c) a 3’ terminal capture or anchor sequence, and wherein said oligonucleotide is arranged to be detachable from said bead.
- said terminal capture or anchor sequence comprises a poly-A sequence for hybridizing to a complementary poly-T sequence on commercially available cell barcoding beads.
- the cell barcoding sequence can be placed on the same construct with visible labels.
- Another object of the invention is to provide a composition comprising several constructs as defined above preferably with a mixture of distinct visually detectable features or entities.
- Another object of the invention is to provide a well plate or chip comprising the composition according to the present invention loaded to the wells of said plate or chip.
- Another object of the invention is to provide a kit comprising the well plate or chip as defined above and a computer readable entity comprising a file of a photograph or scan of said plate or chip with the composition of the present invention loaded to the wells of said plate or chip.
- Another object of the invention is to provide a use of said construct or composition for identifying desired nucleic acid targets or mRNA sequencing products originating from a single cell or position in biological sample.
- Another object of invention is to provide a method for profiling biological samples on a single cell level, the method comprising the steps of:
- a microscope preferably a light microscope or a fluorescence microscope, before and/or after loading the biological sample to said substrate; and - optionally determining the location or coordinate of a specific well having a distinct visually detectable feature and/or entity or combination thereof in the loaded substrate.
- Figure 1 A. Current methods for single cell RNAseq using random loading of Cell barcoding (CellBC) beads to wells or droplets. The unique bead specific cell barcode and polyT sequences on bead oligos capture and tag the polyA RNAs from the lysing cell. Spatial coordination between image and data is not, however, possible.
- FIG. 3 Commercially available CellBC barcoding beads have millions of copies of a unique CellBC sequence on their surface oligo, created typically with split and pool synthesis, e.g. in DropSeq method a stretch of random 12 nucleotide barcode gives rise to nearly 17 million different barcodes and therefore 17 million different microbeads (Macosko et al, Cell 2015 May 21;161(5): 1202-1214). The polyT stretch on the oligos will capture and hybridize polyA tailed RNA from the cells from tissue section. The CellBC beads look identical under the microscope.
- Microwells with ColourBC microbeads are scanned with fluorescence microscope, stitched digital image saved and microbead combinations in each microwell are recorded by image analysis programs. After loading of CellBC beads the polyA RNA from lysed cells or tissue sections are hybridized to the CellBC barcode oligos, along with the synthetic polyA tailed ColourBC oligos released by UV from the ColourBC microbeads. After reverse transcription, cDNA amplification and sequencing library preparation and sequencing, the CellBC sequences are determined from the reads. After read alignment against target genome the counts of the gene reads along with the read counts of the ColourBC sequences are ordered into a matrix for each CellBC. Positional microwell coordinate is interpret for each CellBC by linking the ColourBC read information to the analysed microscope image of each micro well.
- a set of 2 CellBC beads with colours Coll and Col2 (out of e.g. 12 features) are in a well with 3 ColourBC beads with colour combinations B, BG and GYR (out of e.g. 16).
- the synthetic, (photo)cleavable polyA ending oligos with ColourBCs are released by UV light or chemically and the released oligos will hybridize to the poly-T oligos of both CellBC beads.
- the bound cellular polyA RNA will also get unique barcodes from these same 2 CellBC beads, and sequence data from these can be merged.
- the chip contains wells with the Coll CellBC bead with the same 3 ColourBC beads and wells with Col2 CellBC also with the same 3 ColourBC beads, the mapping of the data from these wells spatially is challenging even if the bead specific CellBC sequences are distinct.
- the transcriptome profile similarities between the cell barcodes can be utilized in spatial prediction.
- the ColourBC beads can have multiple alternative sequence tags for the same colour or visible feature, to increase the number of distinct combinations in the sequence level, e.g. visually identical blue beads having either B1 (GCACTA), B2 (TCTAGG), B3 (CATTGT) sequences, all independently tagging the blue beads.
- Random sets of CellBC l-CellBC(n) sequences can be created in several ways, e.g. by bridge amplification. First a PCRhandlel oligo (SEQ ID NO: 31) together with a separate cleavable polyA oligo (SEQ ID NO:32), are immobilized densely to all wells and used then as primers in bridge amplification PCR for a template oligo that contains a reverse complement sequence of PCRhandlel, a random CellBC sequence e.g.
- N(12) or NNNNNNNNNNNNNN, and polyA sequence SEQ ID NO:33.
- Adding the template oligo to the bridge amplification PCR reaction in very diluted concentration allows local clustering of only one or a few different CellBC sequences per well, creating therefore unique set of amplified cell barcodes per well.
- the polyT oligo is cleaved and removed, leaving only single stranded CellBC containing mRNA capture oligos to the well surface.
- the well array can be loaded and imaged with the cells and random sets of ColourBC beads with an oligo comprising PCRhandle2, a feature tagging barcode and a polyA. This cleavable oligo from the ColourBC beads will bind to the immobilized CellBC oligos along with the mRNA from the lysed cells, providing spatial information for each cell and well, as in previous Figures.
- compositions and methods described in detail below provides means to generate location data for a single cell of a biological sample, such as a tissue section, among single-cell transcriptome data, on the scale of tens of thousands of cells per experiment.
- a biological sample such as a tissue section
- the efficiency of any number of diagnostic techniques and applications for assaying various disease states can be enhanced by use of the compositions described herein.
- the methods and compositions described herein greatly expand the power of single-cell phenotyping by combining location information and transcripts from the same single cells at an unprecedented scale.
- the term “construct” refers to a chemically synthesized and optionally genetically engineered assembly that comprises a bead attached (preferably covalently) to at least one oligonucleotide sequence by a linker.
- Each oligonucleotide sequence preferably comprises several functional elements: an amplification handle sequence; a barcode sequence, an optional unique molecular barcode (UMB) sequence that is positioned adjacent to the barcode on its 5' or 3' end, and an anchor sequence for hybridizing to a capture sequence that comprises a sequence complementary to the anchor.
- UMB unique molecular barcode
- bead refers herein to a solid support which may encompass any type of solid, porous, or hollow sphere, ball, bearing, cylinder, or other similar configuration composed of plastic, ceramic, metal, or polymeric material (e.g., hydrogel) onto which a nucleic acid can be immobilized (e.g., covalently or non-covalently).
- the bead may comprise a discrete particle that may be spherical (e.g., microspheres) or have a non-spherical or irregular shape, such as cubic, cuboid, pyramidal, cylindrical, conical, oblong, or disc-shaped, and the like.
- amplification handle generally refers to a functional component of the oligonucleotide sequence in the construct of the present disclosure that provides an annealing site for amplification of the oligonucleotide sequence.
- the amplification handle when present in first or additional oligonucleotide sequences, can be the same or different, depending upon the techniques intended to be used for amplification.
- BC generally describes a defined oligonucleotide sequence, which when it is a functional element of the construct of the present disclosure, can be used for identifying a particular cell or well in a substrate.
- UMB unique molecular barcode“
- UMB generally refers to a random nucleotide, which when it is a functional element of the construct of the present disclosure, is specific for that construct.
- the UMB permits identification of amplification duplicates of the construct oligonucleotide sequence with which it is associated.
- the “linker” refers to any moiety used to attach or associate the bead to the oligonucleotide sequence portion of the constructs.
- the linker is a covalent bond.
- the linker is a non-covalent bond.
- the linkers used in the constructs of the compositions and methods are in one embodiment cleavable.
- the linkers used in the constructs of the compositions and methods are in one embodiment non-cleavable.
- the linker is a cleavable linker, e.g., disulfide bond or photocleavable bond.
- the parts of the construct are linked to each other via a streptavidin-biotin linkage.
- the linker comprises a complex of biotin bound to the construct oligonucleotide sequence by a disulfide bond, with streptavidin fused and coated to the bead.
- the biotin is coated to the bead and the streptavidin is fused to the construct oligonucleotide sequence.
- the bead surface is carboxylated and the oligonucleotide sequence is aminated and linked to the bead with EDC reaction. Photocleavable amino group can be used to enable photocleavage with UV light.
- substrate is preferably meant a slide, a multi-well plate or a chip.
- the substrates are conventional and can be glass, polymer or of any conventional materials suitable for the particular assay or diagnostic protocols.
- the substrates can comprise a matrix of microwells for positioning cells from a biological sample.
- the substrate can be also a membrane with well structure and with microscopic pores in the well bottoms, to enable easier washing and bead loading.
- visible and “visually detectable” are used herein to refer to a feature of the present constructs or an entity coupled to said construct that are observable by visual inspection, with or without prior illumination, or chemical or enzymatic activation.
- visually detectable features may refer to color, size or shape of the construct.
- visually detectable features can absorb and emit light in a region of the spectrum ranging from about 400 to about 800 nm.
- the detection of the present construct by its visible properties means that the construct is preferably observed, with or without illumination or chemical or enzymatic activation, with the aid of an optically based detection device, including, without limitation, absorption spectrophotometers, transmission light microscopes, fluorescence microscopes, digital cameras and scanners.
- an optically based detection device including, without limitation, absorption spectrophotometers, transmission light microscopes, fluorescence microscopes, digital cameras and scanners.
- a “biological sample” as used in the methods described herein refers to a naturally-occurring sample or deliberately prepared sample or library containing one or more cells.
- a sample contains a population of cells or cell fragments, including without limitation cell membrane components, exosomes, and sub-cellular components.
- the cells may be a homogenous population of cells, such as isolated cells of a particular type, or a mixture of different cell types, such as from a biological fluid or tissue of a human or mammalian or other species subject.
- Still other samples for use in the methods and with the compositions include, without limitation, blood samples, including serum, plasma, whole blood, and peripheral blood, saliva, and urine.
- the sample is a “tissue section” referring to a piece of tissue that has been obtained from a subject, fixed, sectioned, and mounted on a planar surface, e.g., a microscope slide.
- Tissue sections can also be classified as “planar cellular samples” referring to a substantially planar, i.e., two dimensional, material that contains cells.
- a planar cellular sample can be made by, e.g., cutting a three dimensional tissue biopsy that contains cells into sections and mounting the sections onto a planar surface.
- the cells may be fixed using any number of reagents including formalin, ethanol, methanol, DSP, paraformaldehyde, methanol: acetic acid and other similar fixing or tissue/R A stabilizing reagents.
- the constructs and methods described herein can be used to analyze cells from a subject to determine, for example, what kind of cell types exists in the tissue, in which locations and proportions they exist, whether the cell is normal or not, or to determine whether the cells are responding to a treatment.
- the method may be employed to determine the degree of dysplasia in cancer cells.
- the cells may be a sample from a multicellular organism.
- a biological sample may be isolated from an individual, e.g., from a soft tissue.
- the method may be used to distinguish different types of cancer cells in fresh frozen, cryopreserved and methanol fixed, or formalin fixed paraffin embedded (FFPE) samples.
- FFPE formalin fixed paraffin embedded
- the method described above can be practiced on planar cellular samples that have been fixed in other ways.
- the present invention is directed to a construct for detecting nucleic acid targets, said construct comprising a bead, preferably a magnetic bead, wherein said bead comprises one or several visually detectable features and/or said bead is coupled to one or several visually detectable entities, and wherein said bead comprises an oligonucleotide, and said oligonucleotide comprises a) an amplification handle sequence, b) a barcode sequence specific to one or several of said visually detectable features and/or entities and c) a 3’ terminal capture or anchor sequence, and wherein said oligonucleotide is arranged to be detachable from said bead.
- a bead preferably a magnetic bead
- said bead comprises one or several visually detectable features and/or said bead is coupled to one or several visually detectable entities
- said bead comprises an oligonucleotide
- said oligonucleotide comprises a) an amplification handle
- said visually detectable feature is the size of the bead, color of the bead, shape of the bead or a combination thereof.
- said oligonucleotide is linked to said bead via a cleavable linkage.
- said cleavable linkage is a photocleavable, streptavidin- biotin, or carboxylate-amine linkage.
- said bead is coupled to said one or several visually detectable entities via a streptavidin-biotin or carboxylate-amine linkage or via any other linkage.
- said one or several visually detectable entities comprise a fluorescent label, preferably, without limitation, selected from the group consisting of: cyanine dyes, Texas Red dyes and fluorescein amidite dyes.
- said bead is further coupled to an antigen or an antibody.
- said amplification handle sequence is complementary to a PCR primer comprising a next generation sequencing compatible adapter sequence.
- said construct comprises a second oligonucleotide coupled to said bead, said second oligonucleotide comprising a) a second amplification handle sequence preferably complementary to a PCR primer comprising a next generation sequencing compatible adapter sequence, b) a barcode sequence specific to one or several of visually detectable features and/or entities of the bead, c) a barcode sequence specific to the bead, d) an optional unique molecular barcode sequence, and e) a terminal poly-T sequence.
- the present invention is directed to a composition comprising the construct as defined above.
- said composition comprises a mixture of several constructs providing a mixture of distinct visually detectable features or entities.
- said mixture of several constructs comprises at least 2, 3, 4, 5 or 6, preferably at least 16, separate visually detectable features and/or entities.
- said composition comprises multiplicity of said constructs having at least 15 variable sets of visually detectable features such as fluorescent labels coupled to said constructs, wherein in the first construct said fluorescent label consists of a first fluorescent dye; in the second construct said fluorescent label consists of a second fluorescent dye; in the third construct said fluorescent label consists of a third fluorescent dye; in the fourth construct said fluorescent label consists of a fourth fluorescent dye; in the fifth construct said fluorescent label consists of a mix of the first and second fluorescent dyes; in the sixth construct said fluorescent label consists of a mix of the first and third fluorescent dyes; in the seventh construct said fluorescent label consists of a mix of the first and fourth fluorescent dyes; in the eighth construct said fluorescent label consists of a mix of the second and third fluorescent dyes; in the ninth construct said fluorescent label consists of a mix of the second and fourth fluorescent dyes; in the tenth construct said fluorescent label consists of a mix of the third and fourth fluorescent dyes; in the eleventh construct said fluorescent label consists of a mix of the first, second construct said fluorescent label
- said first fluorescent dye is Cy5
- the second fluorescent dye is Cy3
- the third fluorescent dye is Atto425
- the fourth fluorescent dye is FAM.
- different sizes, shapes or visible (non- fluorescent) colours are used in beads, with or without fluorescent dyes, to create multiple distinct bead constructs.
- said composition further comprises a second construct (i.e. a CellBC bead) comprising a bead coupled to a second oligonucleotide, said second oligonucleotide comprising a) a second amplification handle sequence, b) a barcode sequence specific to the bead, c) an optional unique molecular barcode sequence, and d) a second anchor sequence, preferably a poly-T sequence, for hybridizing to a complementary sequence.
- a second construct i.e. a CellBC bead
- a second construct comprising a bead coupled to a second oligonucleotide, said second oligonucleotide comprising a) a second amplification handle sequence, b) a barcode sequence specific to the bead, c) an optional unique molecular barcode sequence, and d) a second anchor sequence, preferably a poly-T sequence, for hybridizing to a complementary sequence.
- said second oligonucleotide comprising a) a second amplification handle sequence, b) a barcode sequence specific to the bead, c) an optional unique molecular barcode sequence, and d) a second anchor sequence, preferably a poly-T sequence, can be attached or immobilized directly to a bottom and/or wall of a well in a substrate (see, e.g., Figure 7).
- the present invention is directed to a use of the construct or the composition as defined above for identifying mRNA sequencing products originating from a single cell.
- the present invention is directed to a method for profiling biological samples on a single cell level, the method comprising the step of:
- the determination of the location or coordinate of the wells/samples is achieved by examining the photograph or the scanned picture obtained in the method as the visual properties of the constructs of the present invention are visible in the photograph or the scanned picture and thus the location of each type of constructs or mixtures thereof can be determined.
- the wells/samples in a substrate are photographed or scanned only once in the present method, i.e the present method does not require taking consecutive photos or scannings of the substrate with changing sets of labels, such as labelled oligonucleotide probes or labelled beads.
- the method comprises the steps of:
- the amplification products contain barcode sequences specific to one or several of visually detectable features and/or entities of the constructs
- the invention thus can be used for creating a single-cell sequencing library by merging uniquely barcoded mRNA capturing microbeads with a single cell in a micro-well; lysing the cell thereby capturing the mRNA on the mRNA capturing oligonucleotides on the microbead; performing a reverse transcription reaction in said micro-well to convert the cells' mRNA to first strand cDNA containing said unique barcodes that record the location of each mRNA at the micro-well plate and subsequently sequencing the cDNAs produced.
- the method comprises the steps of: i) providing multiple constructs according to the present invention, wherein said constructs comprise a plurality of first beads, wherein said first bead has a specific combination of visually detectable features and/or entities such as colour, labels, a specific bead size or shape, and wherein said first bead is coupled to a first oligonucleotide by a photocleavable linker, said first oligonucleotide comprising a) an amplification handle sequence, b) a barcode sequence specific to one or several of said visually detectable features and/or entities and c) a terminal sequence comprising a poly-A sequence; ii) loading randomly multiple constructs obtained in step i) to microwells, along with capturing constructs comprising a magnetic bead comprising a second oligonucleotide, said second oligonucleotide comprising a) a second amplification handle sequence, b) a barcode sequence specific to the
- the method further comprises the steps of: iv) sealing or compartmentalizing the microwells of the loaded substrate with, e.g., a semipermeable membrane or another porous material, oil or gel layer, or the glass slide carrying the cells or tissues on the surface; v) lysing the cells to release mRNA within microwells with freezing or heating steps, or with a lysis buffer added into the microwells through the membrane or porous sealing on the top or bottom of the microwells, or lysing agent carried by the gel sealing; vi) detaching the first oligonucleotide from the first bead by subjecting the substrate to UV light, and subjecting the samples in micro we 11s to conditions supporting annealing of poly- A and poly-T sequences of the released mRNA and the second oligonucleotide as well as the first and second oligonucleotides with each other in order to bind said mRNA and first oligonucleotide to the magnetic bead
- the method comprises the steps of: i) providing multiple constructs comprising first and second oligonucleotides as defined above, wherein said constructs comprise a plurality of first beads, wherein said first bead has a specific combination of visually detectable features and/or entities such as colour, labels, a specific bead size or shape, and wherein said first bead is coupled to a first oligonucleotide by a photocleavable linker, said first oligonucleotide comprising a) an amplification handle sequence, b) a barcode sequence specific to one or several of said visually detectable features and/or entities and c) a terminal sequence comprising a poly-A sequence, and wherein said first bead further comprises a plurality of second oligonucleotides coupled to said bead, said second oligonucleotide comprising a) a second amplification handle sequence complementary to a PCR primer comprising a next generation sequencing compatible adapter sequence,
- the detection of the construct of the present invention is not dependent on addition of oligonucleotide probe(s) to said wells/samples, said probe(s) comprising an optically readable label and having complementary sequence(s) to said first and/or second oligonucleotide.
- Streptavidin Dynabeads have a capacity of binding ⁇ 200pmols of biotinylated DNA oligos per mg of beads and the labelled and unlabelled oligos were added on beads in 1:1 to 1:10 ratios depending on each fluorochrome’s signal intensities. After incubation of 15 min at RT in rolling tubes the beads were washed thoroughly 5 times with PBS and pelleted by magnet in each washing round. IX Dynabead binding and washing (B&W) Buffer was used in these steps (5 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, 1 M NaCl). Fluorescence intensities and bead integrities were checked with Zeiss Axiolmager microscope.
- Fluorescent microscope scanner Zeiss Axiolmager was used to scan the whole array area for the 4 fluorescent colours and their combinations used on beads, and the associated Zen 2.3 Lite program to form a single stitched large image of the area.
- Image was saved as 4 fluorescent and 1 light microscope channels in a stacked multilayer image format.
- Image analysis and machine learning algorithm was created, trained and validated with a specific machine learning software designed for microscope image analysis. Algorithm was trained to recognize the 16 different classes of beads (constructs) based on their colour combinations, to recognize the 20mpi diameter sized microwells, to count the number of each type of these bead classes within each microwell, and to give a X-Y positioned coordinate on array for each such feature composition.
- the pre-loaded and image coordinated slides can be prepared in stock beforehand and stored at +4°C dry with magnet underneath if handled, and protected from light and dust.
- the wells were sealed with semipermeable membrane and cells lysed with lysis buffer, adapted from Seq-Well protocol (Gierahn et al 2017). 5 min UV light exposure was used to release the photocleavable oligos from the Colour barcode beads.
- Custom read 1 sequencing primer SEQ ID NO: 21
- UMB 8bp molecular barcode
- Standard Illumina read 2 sequencing primers included in the sequencing cartridge produced 55bp reads of the gene sequences derived from captured mRNAs by the CellBC beads, as well as the colour bead barcodes derived from the UV- detached feature oligos that were also captured by the CellBC beads.
- Example 1 Another variation of the protocol described in Example 1 was tested with different sizes (3, 6, 8 or lOum) and visual colours of the beads, combined to just a single fluorescence label FAM.
- Such set of beads is easier to use with large variety of end-user microscopes as they need less optimization compared to multi- fluorescence excitation, emission and filter sets, and possible auto fluorescence limitations of some beads.
- Beads in various sizes, colours and surface coatings or functionalizations are available from many vendors (e.g. Spherotech, Bangs Laboratories, Poly Sciences, Abvigen).
- the linked beads were washed thoroughly at least 3 times to remove the unbound oligos and labels, before mixing the bead batches. Otherwise the protocol was similar to Example 1 , the loaded beads were scanned with Axiolmager fluorescence microscope equipped with a colour camera and the stitched colour image stacked with the green fluorescence image (for FAM label) were analyzed with a machine learning algorithm that was taught to recognize the following 20 classes of beads and recognize and count them from each microwell.
- Random sets of beads from the pool of 20 bead types produces over a million unique combinations of bead types per well (https://stattrek.com/online-calculator/combinations-permutations.aspx) as the sum of all possible 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 bead combinations out of 20 bead types totals to
- the protocol is the method without the commercial Cell barcode beads, but instead the Cell barcode oligo is carried by the coloured or other visibly featured beads, along with the ColourBC oligos (see Figure 4).
- the new CellBC oligo carried on the featured beads carries also an additional ColourBC sequence matching with the colour or feature combination of the beads (SEQ ID NO: 28). It is essential, though, that the featured beads also carry a separate cleavable ColourBC oligo that is released and captured randomly by all beads in a given well.
- the unique CellBC oligo sequence was created to each bead batch with biotinylated backbone oligo consisting PCRhandlel and optional ColourBC.
- FFPE formalin fixed paraffin embedded
- FFPE formalin fixed paraffin embedded
- snap frozen and TissueTek OCT Compound (Sakura) embedded mouse mammary tumor tissues were sliced with cryomicrotome to 1 OLHTI thick sections on standard microscope glass slide, and kept in -80°C until used. Sections were fixed with methanol and stained with standard hematoxylin-eosin (HE) staining protocol, followed by light microscope image scan to visualize the tissue structure.
- HE hematoxylin-eosin
- a previously prepared microwell slide with ColourBC beads pre-loaded and fluorescently imaged (as described in examples 1 and 3) was kept on magnet and wetted with cell permeabilization buffer (0.1% pepsin in 0.1 N HC1).
- the wetted array was placed on a humidified table-top chamber to prevent evaporation of the small liquid volumes from the microwells in the following steps. Keeping the slides within the chamber, the excess lysis buffer was removed from the top of the slide followed by immediate placing of the tissue section slide on top of it so that the lysis buffer filled wells and the tissue got in contact. Thin piece of metal taped on the backside of the tissue slide helped to hold it tightly and still in place with the power of the magnet under the microwell slide. Alternatively, a mechanical clip could be used.
- Example 1 protocol with commercial, non-magnetic CellBC beads a slide centrifugation step was also needed. Beads in buffer were collected to a single Eppendorf tube and pelleted. The following reverse transcription and library preparation steps were done in bulk reaction on the beads, as referred in example 1, following closely the protocols described in Macosko et al 2015, Gierahn et al 2017 and Stoeckius et al 2017. Data analysis was otherwise similar to the one described in example 1 , but in addition, the microscope image of the original HE-stained tissue section was overlaid on top of the spatial sequencing information of the gene expression derived from the bead coordinated well positions. Matching the tissue and array images for the overlay was guided by the shape of the sequencing data producing area from the microwell slide and with inbuilt assisting marking spots on both slides recorded with microscope and aligned from the images.
- SEQ ID NO: 2 /5PCbio/CCTTGGCACCCGAGAATTCCA TTAGGC BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
- SEQ ID NO: 4 /5PCbio/CCTTGGCACCCGAGAATTCCA ACAGTG BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
- SEQ ID NO: 7 /5PCbio/CCTTGGCACCCGAGAATTCCA ACTTGA BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
- SEQ ID NO: 8 /5PCbio/CCTTGGCACCCGAGAATTCCA TGAACG BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
- SEQ ID NO: 15 /5PCbio/CCTTGGCACCCGAGAATTCCA TAACAG BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
- SEQ ID NO: 16 /5PCbio/CCTTGGCACCCGAGAATTCCA GATGTG BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
- SEQ ID NO: 19 AAGC AGT GGT AT C AAC GC AG AGT (DropSeq-SMART-PCRprimer)
- SEQ ID NO: 22 /Atto425/CCCCCCCC/3bio/ (Colour bead fluorescent labelling oligo)
- SEQ ID NO: 23 /56-FAM/CCCCCCCC/3bio/ (Colour bead fluorescent labelling oligo)
- SEQ ID NO: 24 /5Cy3/CCCCCCCC/3bio/ (Colour bead fluorescent labelling oligo)
- SEQ ID NO: 25 /5Cy5/CCCCCCCC/3bio/ (Colour bead fluorescent labelling oligo)
- SEQ ID NO: 26 CCTTGGCACCCGAGAATT*C*C (Colour bead PCR-handle 2 amplification primer)
- SEQ ID NO: 27 CCTTGGCACCCGAGAATT*C*C (Colour bead PCR-handle 2 amplification primer)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202280036500.3A CN117425737A (zh) | 2021-05-21 | 2022-05-20 | 用于定位和分析生物样品中的单细胞的方法和构建体 |
| EP25183432.1A EP4596710A3 (en) | 2021-05-21 | 2022-05-20 | Methods and constructs for locating and profiling single cells in a biological sample |
| US18/562,871 US20240229104A1 (en) | 2021-05-21 | 2022-05-20 | Methods and constructs for locating and profiling single cells in a biological sample |
| PL22726267.2T PL4244376T3 (pl) | 2021-05-21 | 2022-05-20 | Sposoby i konstrukty do lokalizacji i profilowania pojedynczych komórek w próbce biologicznej |
| AU2022278653A AU2022278653A1 (en) | 2021-05-21 | 2022-05-20 | Methods and constructs for locating and profiling single cells in a biological sample |
| CA3220616A CA3220616A1 (en) | 2021-05-21 | 2022-05-20 | Methods and constructs for locating and profiling single cells in a biological sample |
| JP2023572114A JP2024519113A (ja) | 2021-05-21 | 2022-05-20 | 生物学的試料中の単一細胞を位置特定及びプロファイリングするための方法及び構築体 |
| EP22726267.2A EP4244376B1 (en) | 2021-05-21 | 2022-05-20 | Methods and constructs for locating and profiling single cells in a biological sample |
| BR112023024326A BR112023024326A2 (pt) | 2021-05-21 | 2022-05-20 | Métodos e construtos para localizar e traçar o perfil de células únicas em uma amostra biológica |
| ES22726267T ES3035340T3 (en) | 2021-05-21 | 2022-05-20 | Methods and constructs for locating and profiling single cells in a biological sample |
| KR1020237043705A KR20240012460A (ko) | 2021-05-21 | 2022-05-20 | 생물학적 샘플에서 단일 세포를 찾고 프로파일링하기 위한 방법 및 구조물 |
| IL308636A IL308636A (en) | 2021-05-21 | 2022-05-20 | Methods and structures for locating and profiling single cells in a biological sample |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP21175329.8 | 2021-05-21 | ||
| EP21175329.8A EP4092133A1 (en) | 2021-05-21 | 2021-05-21 | Methods and constructs for locating and profiling single cells in a biological sample |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022243609A1 true WO2022243609A1 (en) | 2022-11-24 |
Family
ID=76059773
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/FI2022/050347 Ceased WO2022243609A1 (en) | 2021-05-21 | 2022-05-20 | Methods and constructs for locating and profiling single cells in a biological sample |
Country Status (12)
| Country | Link |
|---|---|
| US (1) | US20240229104A1 (cg-RX-API-DMAC7.html) |
| EP (3) | EP4092133A1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2024519113A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20240012460A (cg-RX-API-DMAC7.html) |
| CN (1) | CN117425737A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2022278653A1 (cg-RX-API-DMAC7.html) |
| BR (1) | BR112023024326A2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3220616A1 (cg-RX-API-DMAC7.html) |
| ES (1) | ES3035340T3 (cg-RX-API-DMAC7.html) |
| IL (1) | IL308636A (cg-RX-API-DMAC7.html) |
| PL (1) | PL4244376T3 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2022243609A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024182184A1 (en) * | 2023-02-28 | 2024-09-06 | Becton, Dickinson And Company | Dual indexing particle labels for obtaining linked single cell cytometric and sequence data |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4092133A1 (en) * | 2021-05-21 | 2022-11-23 | SCellex Oy | Methods and constructs for locating and profiling single cells in a biological sample |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016040476A1 (en) | 2014-09-09 | 2016-03-17 | The Broad Institute, Inc. | A droplet-based method and apparatus for composite single-cell nucleic acid analysis |
| US20160253584A1 (en) * | 2015-02-27 | 2016-09-01 | Cellular Research, Inc. | Spatially addressable molecular barcoding |
| WO2021046232A1 (en) | 2019-09-03 | 2021-03-11 | Flexomics, Llc | Optically readable barcodes and systems and methods for characterizing molecular interactions |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4092133A1 (en) * | 2021-05-21 | 2022-11-23 | SCellex Oy | Methods and constructs for locating and profiling single cells in a biological sample |
-
2021
- 2021-05-21 EP EP21175329.8A patent/EP4092133A1/en not_active Withdrawn
-
2022
- 2022-05-20 JP JP2023572114A patent/JP2024519113A/ja active Pending
- 2022-05-20 EP EP22726267.2A patent/EP4244376B1/en active Active
- 2022-05-20 CA CA3220616A patent/CA3220616A1/en active Pending
- 2022-05-20 KR KR1020237043705A patent/KR20240012460A/ko active Pending
- 2022-05-20 BR BR112023024326A patent/BR112023024326A2/pt unknown
- 2022-05-20 IL IL308636A patent/IL308636A/en unknown
- 2022-05-20 US US18/562,871 patent/US20240229104A1/en active Pending
- 2022-05-20 AU AU2022278653A patent/AU2022278653A1/en active Pending
- 2022-05-20 PL PL22726267.2T patent/PL4244376T3/pl unknown
- 2022-05-20 CN CN202280036500.3A patent/CN117425737A/zh active Pending
- 2022-05-20 ES ES22726267T patent/ES3035340T3/es active Active
- 2022-05-20 EP EP25183432.1A patent/EP4596710A3/en active Pending
- 2022-05-20 WO PCT/FI2022/050347 patent/WO2022243609A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016040476A1 (en) | 2014-09-09 | 2016-03-17 | The Broad Institute, Inc. | A droplet-based method and apparatus for composite single-cell nucleic acid analysis |
| US20160253584A1 (en) * | 2015-02-27 | 2016-09-01 | Cellular Research, Inc. | Spatially addressable molecular barcoding |
| WO2021046232A1 (en) | 2019-09-03 | 2021-03-11 | Flexomics, Llc | Optically readable barcodes and systems and methods for characterizing molecular interactions |
Non-Patent Citations (4)
| Title |
|---|
| GIERAHN TMWADSWORTH MH 2NDHUGHES TKBRYSON BDBUTLER ASATIJA RFORTUNE SLOVE JCSHALEK AK: "Seq-Well: portable, low-cost RNA sequencing of single cells at high throughput", NAT METHODS, vol. 14, no. 4, 13 February 2017 (2017-02-13), pages 395 - 398 |
| MACOSKO EVAN Z ET AL: "Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets", CELL, ELSEVIER, AMSTERDAM NL, vol. 161, no. 5, 21 May 2015 (2015-05-21), pages 1202 - 1214, XP029129143, ISSN: 0092-8674, DOI: 10.1016/J.CELL.2015.05.002 * |
| MACOSKO EZBASU ASATIJA RNEMESH JSHEKHAR KGOLDMAN MTIROSH IBIALAS ARKAMITAKI NMARTERSTECK EM: "Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets", CELL, vol. 161, no. 5, 21 May 2015 (2015-05-21), pages 1202 - 1214, XP055586617, DOI: 10.1016/j.cell.2015.05.002 |
| STOECKIUS MHAFEMEISTER CSTEPHENSON WHOUCK-LOOMIS BCHATTOPADHYAY PKSWERDLOW HSATIJA RSMIBERT P: "Simultaneous epitope and transcriptome measurement in single cells", NAT METHODS, vol. 14, no. 9, 31 July 2017 (2017-07-31), pages 865 - 868, XP055556042, DOI: 10.1038/nmeth.4380 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024182184A1 (en) * | 2023-02-28 | 2024-09-06 | Becton, Dickinson And Company | Dual indexing particle labels for obtaining linked single cell cytometric and sequence data |
Also Published As
| Publication number | Publication date |
|---|---|
| IL308636A (en) | 2024-01-01 |
| CN117425737A (zh) | 2024-01-19 |
| BR112023024326A2 (pt) | 2024-02-06 |
| AU2022278653A9 (en) | 2024-01-04 |
| EP4596710A2 (en) | 2025-08-06 |
| EP4092133A1 (en) | 2022-11-23 |
| EP4244376C0 (en) | 2025-06-18 |
| CA3220616A1 (en) | 2022-11-24 |
| JP2024519113A (ja) | 2024-05-08 |
| ES3035340T3 (en) | 2025-09-01 |
| EP4596710A3 (en) | 2025-11-12 |
| US20240229104A1 (en) | 2024-07-11 |
| KR20240012460A (ko) | 2024-01-29 |
| PL4244376T3 (pl) | 2025-08-18 |
| EP4244376A1 (en) | 2023-09-20 |
| AU2022278653A1 (en) | 2023-12-14 |
| EP4244376B1 (en) | 2025-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240240241A1 (en) | Rna printing and sequencing devices, methods, and systems | |
| US20240263353A1 (en) | High-throughput single-cell polyomics | |
| US20160010085A1 (en) | Heterologous dna barcoding method | |
| JP6846832B2 (ja) | 一細胞の非破壊的計測情報とゲノム関連情報とを一体的に検出する方法 | |
| EP4244376B1 (en) | Methods and constructs for locating and profiling single cells in a biological sample | |
| Battersby et al. | Optical encoding of microbeads for gene screening: alternatives to microarrays | |
| US12577556B2 (en) | Perturbation beads for use in assays | |
| Li et al. | Spatial transcriptomics: new dimension of understanding biological complexity | |
| WO2000031536A2 (en) | Detecting structural or synthetic information about chemical compounds | |
| WO2023059935A1 (en) | Fluorescent barcoding of microparticles | |
| JP2024519113A5 (cg-RX-API-DMAC7.html) | ||
| US7297520B2 (en) | Large circular sense molecule array | |
| HK40104853A (zh) | 用於定位和分析生物样品中的单细胞的方法和构建体 | |
| US20220025430A1 (en) | Sequence based imaging | |
| US20240361310A1 (en) | Capture Beads for Use in Assays | |
| US20070099193A1 (en) | Probe/target stabilization with add-in oligo | |
| US20240301490A1 (en) | High throughput single cell based assay for capturing genomic information for functional and imaging analysis and methods of use | |
| US20250011847A1 (en) | Methods for indexing single cells and nuclei using nanoball combinatorial identifiers | |
| WO2025159784A1 (en) | Capture beads for use in assays | |
| WO2025160235A1 (en) | Capture beads for use in assays | |
| WO2024196941A1 (en) | Core-shell gel particles for separating and analyzing rna and dna from a cell | |
| WO2023107598A1 (en) | Single-cell culture and sequencing with lipid-modified oligos | |
| JP2006503558A (ja) | 大環状センス分子アレー |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22726267 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2022726267 Country of ref document: EP Effective date: 20230612 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 308636 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3220616 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202280036500.3 Country of ref document: CN Ref document number: 2023572114 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18562871 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 805981 Country of ref document: NZ Ref document number: 2022278653 Country of ref document: AU Ref document number: AU2022278653 Country of ref document: AU |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112023024326 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2022278653 Country of ref document: AU Date of ref document: 20220520 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202347085745 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 20237043705 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020237043705 Country of ref document: KR |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202308832S Country of ref document: SG |
|
| ENP | Entry into the national phase |
Ref document number: 112023024326 Country of ref document: BR Kind code of ref document: A2 Effective date: 20231121 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2022726267 Country of ref document: EP |