WO2022233287A1

WO2022233287A1 - Vaccine reagent and vaccination method

Info

Publication number: WO2022233287A1
Application number: PCT/CN2022/090848
Authority: WO
Inventors: 李航文; 张爱华; 张育坚; 姚卫国; 林昂; 黄雷
Original assignee: 斯微(上海)生物科技股份有限公司
Priority date: 2021-05-04
Filing date: 2022-05-04
Publication date: 2022-11-10
Also published as: CN115698295B; CN115698295A

Abstract

A vaccine combination, a kit and a method for preventing and/or treating novel coronavirus infections. The combination contains a first composition and a second composition, wherein the first composition contains an inactivated vaccine, and the second composition contains an mRNA vaccine.

Description

A vaccine reagent and inoculation method

This application claims the priority of Chinese Patent Application No. 202110488951.8, which was filed on May 4, 2021 and is entitled "A Vaccine Reagent and Vaccination Method", the entire contents of which are incorporated herein by reference.

technical field

The present invention relates to the field of biotechnology, in particular to vaccine combinations, kits and methods for preventing and/or treating novel coronavirus infection.

Background technique

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) caused a global pandemic. SARS-CoV-2 has the characteristics of high transmissibility and high lethality, which can cause severe viral pneumonia and respiratory disease in infected people, called "coronavirus disease 2019 (COVID-19)".

A variety of vaccines against SARS-CoV-2 have been developed, including inactivated virus vaccines, viral vector-based vaccines, recombinant protein vaccines, DNA vaccines, and mRNA vaccines. SARS-CoV-2 has high variability, and multiple mutant strains have been developed, and some of them have shown high immune escape characteristics, posing new challenges to existing vaccines. There is an urgent need for drugs and methods for preventing and/or treating coronavirus infection.

CN112043825A discloses a subunit vaccine of novel coronavirus spike protein S1 region for preventing novel coronavirus infection. The subunit vaccine includes a novel coronavirus spike protein S1 region antigen and an adjuvant, and is administered 2-3 times by subcutaneous or intramuscular injection for the prevention of novel coronavirus.

CN112546213A discloses a method for preparing a novel coronavirus vaccine, wherein the novel coronavirus vaccine is an inactivated vaccine in which part of the viral membrane is split to expose the nucleocapsid N antigen, and specifically discloses the use of the KMS1 strain (GenBank accession number: Inactivated vaccine prepared by MT226610.1).

CN111218459A discloses a novel coronavirus vaccine using human type 5 replication-deficient adenovirus as a carrier. The vaccine uses the replication-deficient human adenovirus type 5 with E1 and E3 combined deletion as a vector, and uses HEK293 cells integrating the adenovirus E1 gene as a packaging cell line, and the protective antigen gene carried is an optimized design of the 2019 new coronavirus (SARS-CoV-2) S protein gene (Ad5-nCoV).

SUMMARY OF THE INVENTION

In one aspect, the present invention provides a vaccine combination comprising a first composition and a second composition, wherein the first composition comprises an inactivated vaccine; and the second composition comprises an mRNA vaccine.

In one embodiment, the first composition comprises an inactivated viral antigen of SARS-CoV-2; and the second composition comprises mRNA encoding a polypeptide antigen comprising furin with inactivation A SARS-CoV-2 spike protein variant of a cleavage site; wherein the inactive furin cleavage site has the amino acid sequence of QSAQ. In one embodiment, the first composition comprises an inactivated viral antigen of a SARS-CoV-2 KMS-1 strain; and the polypeptide antigen has the amino acid sequence of SEQ ID NO:3. In one embodiment, the mRNA comprises the nucleotide sequence of SEQ ID NO:11. In a specific embodiment, the mRNA comprises the nucleotide sequence of SEQ ID NO:13.

In one embodiment, the mRNA comprises modified uridine. In a specific embodiment, 100% of the uridine in the mRNA is replaced by 1-methylpseudouridine.

In further embodiments, the second composition further comprises a cationic polymer that associates with the mRNA as a complex and a lipid particle that encapsulates the complex. In one embodiment, the cationic polymer is protamine.

In a specific embodiment, the lipid particle comprises M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol and DMG-PEG 2000, the M5 having the following structure:

In a preferred embodiment, the molar ratio of M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol and DMG-PEG 2000 is 40:15:43.5:1.5.

In one embodiment, the first composition is an inactivated whole virus vaccine.

In one embodiment, the first composition further comprises an adjuvant. In one embodiment, the adjuvant is Al(OH) ₃ .

In yet another aspect, the present invention provides a kit comprising a first container and a second container, wherein the first container comprises a first composition as described herein, and the second container comprises a composition as described herein of the second composition.

The present invention also provides the use of the vaccine combination of the present invention in the preparation of a vaccine for preventing and/or treating SARS-CoV-2 infection or inducing immunity against SARS-CoV-2 in a subject in need thereof answer.

Some embodiments of the vaccine combinations, kits, vaccines, uses or methods of the invention include:

(a) administering to a subject in need thereof an effective amount of said first composition in at least one dose; and

(b) then administering to the subject an effective amount of the second composition in at least one dose.

Further embodiments of the vaccine combinations, kits, vaccines, uses or methods of the invention include:

(a) administering to the subject an effective amount of the first composition in two doses; and

(b) then administering to the subject an effective amount of the second composition in one dose.

In one embodiment, the two doses are administered to the subject at an interval of about 1 week to about 8 weeks. In a preferred embodiment, the two doses are administered to the subject at an interval of about 2 weeks to about 6 weeks. In a specific embodiment, the two doses are administered to the subject at an interval of about 4 weeks.

In one embodiment, an effective amount of the second composition is administered to the subject in one dose within about 5 to about 9 months after administration of the last dose of the first composition. By. In one embodiment, an effective amount of the second composition is administered to the subject in one dose within about 7 months after administration of the last dose of the first composition.

Description of drawings

Figure 1 shows the expression results of candidate mRNAs in DC2.4 cells analyzed by flow cytometry.

Figure 2 shows the titer levels of neutralizing antibodies against wild-type pseudovirus in immune sera induced by candidate mRNA vaccine formulations analyzed by pseudovirus neutralization assay. Shown are ₅₀ % inhibitory dilution (ID50) titers, mean±SEM, N=8.

Figure 3 shows the titer levels of neutralizing antibodies against B.1.351 variant pseudovirus in immune sera induced by candidate mRNA vaccine formulations analyzed by pseudovirus neutralization assay. Shown are ₅₀ % inhibitory dilution (ID50) titers, mean±SEM, N=8.

Figure 4 shows a schematic diagram of a heterologous prime/boost immunization schedule using inactivated vaccines and mRNA vaccines.

Figure 5A shows antigens (Spike (Pre-fusion S) or RBD before fusion) in subjects' sera measured by ELISA before (day 0) and after (

days

7, 14 and 21) mRNA vaccine booster immunizations ) specific binding IgG levels. As a comparison, antigen-specific binding IgG levels in convalescent sera of COVID-19 patients were also analyzed. Reciprocal antibody titers are shown. Filled circles, subject serum; triangles, convalescent serum. D0, day 0; D7, day 7; D14, day 14; D21, day 21.

Figure 5B shows neutralizing antibody levels in subjects' sera measured by pseudovirus neutralization test (pVNT) before (day 0) and after (

days

7, 14 and 21) mRNA vaccine booster immunizations. As a comparison, neutralizing antibody levels in convalescent sera of COVID-19 patients were also analyzed. Shown are 50% inhibitory concentration ( _IC50 ) titers. Filled circles, subject serum; triangles, convalescent serum. D0, day 0; D7, day 7; D14, day 14; D21, day 21.

Figure 6 shows antigen-specific T cell responses in subjects analyzed by ELISpot before (day 0) and after (day 14) mRNA vaccine booster immunizations. Isolated PBMCs were continuously stimulated with S-ECD protein at a concentration of 10 μg/ml for 20 hours, then the frequency of IFN-γ, IL-2 or IL-21 secreting T cells was assessed by ELISpot and counted as puncta formation cells (SFC)/10 ⁶ PBMCs. D0, day 0; D14, day 14.

Figure 7 shows the frequency of Spike-specific IgG ⁺ memory B cells (MBCs) in subjects analyzed by flow cytometry before (day 0) and after (days 7 and 21) mRNA vaccine booster immunizations . Cells were gated on CD20 ⁺ IgD ^- IgM ^- class-switched B cells. D0, day 0; D7, day 7; D21, day 21.

Detailed ways

General terms and definitions

All patents, patent applications, scientific publications, manufacturer's specifications and guides, etc. cited herein, whether above or below, are incorporated by reference in their entirety. Nothing herein should be construed as an admission that the present disclosure is not entitled to antedate such disclosure.

Unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Also, the terms used herein are related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, and microbiology, which are terms widely used in the corresponding fields (see, e.g., Molecular Cloning: A Laboratory Manual, ^2nd Edition, J. . Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). Meanwhile, for a better understanding of the present invention, definitions and explanations of related terms are provided below.

As used herein, the expressions "comprising", "comprising", "containing" and "having" are open ended and mean that recited elements, steps or components are included but not excluded from other unrecited elements, steps or components. The expression "consisting of" excludes any element, step or component not specified. The expression "consisting essentially of" means that the scope is limited to the specified elements, steps or components, plus optional elements, steps or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of" and "consisting of" are encompassed within the meaning of the expression "comprising".

As used herein, the singular expressions "a," "an," or "the" include plural referents unless the context dictates otherwise. The term "one or more" or "at least one" encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9 or more.

The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each distinct value that falls within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as it is individually recited herein. Unless expressly stated to the contrary, values or ranges presented herein are modified by "about" to mean ±20%, ±10%, ±5%, or ±3% of the recited or claimed value or range.

All methods described herein can be performed in any suitable order unless otherwise indicated.

As used herein, the term "polypeptide" refers to a polymer comprising two or more amino acids covalently linked by peptide bonds. A "protein" may comprise one or more polypeptides, wherein the polypeptides interact covalently or non-covalently. Unless otherwise indicated, "polypeptide" and "protein" are used interchangeably.

As used herein, a "variant" of a reference polypeptide refers to a polypeptide that differs from the reference polypeptide by virtue of at least one amino acid modification. The reference polypeptide can be naturally occurring or a modified form of the wild-type polypeptide. As used herein, "polypeptide variant" and "mutant polypeptide" have the same meaning. Polypeptide variants can be, for example, mutants, post-translationally modified variants, isoforms, species variants, species homologues, and the like. Polypeptide variants can be prepared by recombinant DNA techniques, for example by modifying known amino acid sequences by altering the coding sequence. Polypeptide variants can also be prepared by chemical synthesis or enzymatic methods. According to the present invention, the S protein variant may have the same S protein as the wild type S protein (eg (original virus strain Wuhan-Hu-1 (Genbank accession number: MN908947.3), an exemplary amino acid sequence is shown in SEQ ID NO: 1 ) ) comparable or higher ability to induce an immune response, ie exhibit comparable or enhanced immunogenicity to wild-type S protein.

As used herein, modifications to amino acid sequences can include, for example, amino acid substitutions, additions and/or deletions. "Amino acid addition" refers to the addition of one or more amino acids to an amino acid sequence. Amino acid additions can occur anywhere in the amino acid sequence, including but not limited to the middle, amino-terminal and/or carboxy-terminal ends of the amino acid sequence. Amino acid additions that occur in the middle of an amino acid sequence may also be referred to as "amino acid insertions." "Amino acid deletion" refers to the removal of one or more amino acids from an amino acid sequence. Amino acid deletions can occur anywhere in the amino acid sequence. Amino acid deletions that occur at the N- and/or C-terminus can also be referred to as truncations. Truncated variants may also be referred to as "fragments." "Amino acid substitution" refers to the replacement of an amino acid residue at a particular amino acid position with another amino acid residue. Herein, "amino acid modification" may also be referred to as "mutation".

As used herein, the amino acid sequence of a reference polypeptide or a portion of an amino acid sequence (eg, a subunit, domain, or substructure) can be determined by optimally aligning the amino acid sequences of the two with the amino acid sequence of another polypeptide (eg, as described herein) domains) or between specified amino acid positions in both. As used herein, "a polypeptide variant comprising an amino acid substitution at the amino acid N corresponding to the reference polypeptide" or "a polypeptide variant comprising an amino acid substitution compared to the reference polypeptide" means that the polypeptide variant is identical to the reference polypeptide at the point corresponding to the reference polypeptide. The amino acid position N of the polypeptide contains a different amino acid, but the amino acid at other positions of the polypeptide variant is not limited, that is, the amino acid at other positions may be the same as or different from the amino acid at the corresponding position in the reference polypeptide). Similarly, "the polypeptide variant has an amino acid at the position corresponding to amino acid N of the reference polypeptide is X _aa ", only means that the amino acid of the polypeptide variant at the amino acid position N corresponding to the reference polypeptide is X _aa , but for Amino acids at other positions of the polypeptide variant are not limiting.

As used herein, the terms "% identity" or "percent identity" in reference to sequences refer to the percentage of nucleotides or amino acids that are identical in an optimal alignment between the sequences being compared. Differences between two sequences can be distributed over local regions (segments) or the entire length of the sequences being compared. The percent identity between two sequences is usually determined after optimal alignment of segments or "comparison windows". Optimal alignment can be performed manually, or with the aid of algorithms known in the art, including but not limited to those described in Smith and Waterman, 1981, Ads App. Math. 2, 482 and Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443 Homology algorithm, similarity search method described in Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or using computer programs such as Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, GAP, BESTFIT, FASTA, BLAST P, BLAST N and TFASTA in Wis. For example, the percent identity of two sequences can be determined using the BLASTN or BLASTP algorithms publicly available on the National Center for Biotechnology Information (NCBI) website.

Percent identity is obtained by determining the number of identical positions corresponding to the sequences being compared, dividing this number by the number of positions being compared (eg, in the reference sequence), and multiplying this result by 100. In some embodiments, the degree of identity is given to a region of at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the entire length of the reference sequence. In some embodiments, the degree of identity is given over the entire length of the reference sequence. Alignment to determine sequence identity can be performed using tools known in the art, preferably using optimal sequence alignment, e.g., using Align, using standard settings, preferably EMBOSS::needle, Matrix:Blosum62, Gap Open 10.0, Gap Extend 0.5.

As used herein, "nucleotides" include deoxyribonucleotides and ribonucleotides and derivatives thereof. As used herein, "ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. "Nucleotides" are generally referred to by the single letter representing the bases in them: "A(a)" refers to deoxyadenosine or adenylate, "C(c)" refers to deoxycytidine or cytidine, "G(c)" refers to deoxyguanylic acid or guanylic acid, "U(u)" refers to uridylic acid, and "T(t)" refers to deoxythymidylic acid.

As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA) ). "Polynucleotide sequence", "nucleic acid sequence" and "nucleotide sequence" are used interchangeably to refer to the ordering of nucleotides in a polynucleotide.

As used herein, "codon" refers to a sequence of three consecutive nucleotides in a polynucleotide (also known as a triplet codon) that encodes a specific amino acid. Synonymous codons (codons encoding the same amino acid) are used with different frequencies in different species, known as "codon bias". It is generally believed that, for a given species, coding sequences that use its preferred codons can have higher translation efficiency and accuracy in expression systems for that species. Thus, polynucleotides can be "codon-optimized," ie, changing the codons in the polynucleotide to reflect the codons preferred by the host cell, preferably without changing the amino acid sequence it encodes. A polynucleotide (eg, mRNA) may comprise codons optimized for a host (eg, a subject, particularly a human) cells, such that it is optimally expressed in the host (eg, a subject, particularly a human).

As used herein, the term "vector" refers to a vehicle used to introduce nucleic acid into a host cell. Vectors can include expression vectors and cloning vectors. In general, an expression vector contains the desired coding sequence and the appropriate DNA sequences necessary to express the operably linked coding sequence in a particular host organism (eg, bacteria, yeast, plant, insect, or mammal) or in an in vitro expression system . Cloning vectors are typically used to engineer (perform recombinant DNA manipulation) and amplify desired DNA fragments, and may lack functional sequences required to express the desired DNA sequence. Examples of vectors include, but are not limited to, plasmids, cosmids, bacteriophage (eg, lambda phage) vectors, viral vectors (eg, retrovirus, adenovirus, or baculovirus vectors), or artificial chromosomes (eg, bacterial artificial chromosomes (BAC), yeast artificial chromosome (YAC) or P1 artificial chromosome (PAC) vector.

As used herein, the term "expression" includes transcription and/or translation of a nucleotide sequence. Thus, expression can involve the production of transcripts and/or polypeptides. The term "transcription" refers to the process of transcribing the genetic code in a DNA sequence into RNA (transcript). The term "in vitro transcription" refers to the in vitro synthesis of RNA, especially mRNA, in a cell-free system (eg, in a suitable cell extract) (see, eg, Pardi N., Muramatsu H., Weissman D., Karikó K. ( 2013). In: Rabinovich P. (eds) Synthetic Messenger RNA and Cell Metabolism Modulation. Methods in Molecular Biology (Methods and Protocols), vol 969. Humana Press, Totowa, NJ.). The term "transcription" encompasses "in vitro transcription".

As used herein, "isolated" refers to a substance (eg, a polynucleotide or polypeptide) that is separated from the source or environment in which it exists. An isolated polynucleotide or polypeptide can exist in substantially pure form (eg, in a composition), or can exist in a non-natural environment, eg, a host cell. mRNA as described herein can be isolated.

The term "naturally occurring" refers to the fact that an object can be found in nature. For example, polypeptides or polynucleotides that are present in organisms (including viruses) and that can be isolated from natural sources and have not been intentionally modified by humans in the laboratory are naturally occurring.

As used herein, the term "immunogenicity" refers to the ability to generate an immune response against an antigen in a host animal. The immune response forms the basis of protective immunity elicited by vaccines against specific infectious organisms.

As used herein, the term "recombinant" means "produced by genetic engineering". In general, recombinant molecules (eg, recombinant proteins and recombinant nucleic acids) are non-naturally occurring. mRNA as described herein can be a recombinant molecule.

The term "expressed on the cell surface" means that a molecule, such as an antigen, is associated with and located on the plasma membrane of a cell, with at least a portion of the molecule facing the extracellular space and accessible from outside the cell, for example, by being located at Antibodies outside the cell. In some embodiments, a protein comprising an inactive furin cleavage site as described herein is compared to a S protein comprising an active furin cleavage site (eg, a furin cleavage site having the amino acid sequence RRAR). The polypeptide is expressed at higher levels on the host cell surface.

As used herein, the term "binding antibody" refers to an antibody or fragment thereof capable of recognizing and binding to a particular antigen. As used herein, the term "neutralizing antibody (NAb)" refers to an antibody capable of neutralizing, ie preventing, inhibiting, reducing or interfering with the ability of a pathogen to initiate and/or maintain infection in a host (eg, a host organism or host cell). or fragments thereof. According to the present invention, binding or neutralizing antibodies against SARS-CoV-2 S protein or fragments thereof can be produced in a subject vaccinated with the vaccine compositions described herein, for example in the subject's immune serum. Titer levels of binding or neutralizing antibodies in immune serum can be measured using methods known in the art.

The term "antigen" refers to a substance that contains an epitope against which an immune response can be raised. In certain embodiments, the antigen may bind to a T cell epitope or T or B cell receptor, or to an immunoglobulin such as an antibody.

As used herein, "polypeptide antigen" refers to a polypeptide as an antigen, including but not limited to the polypeptide antigen itself or a processed product thereof (eg, an antigen that is processed and presented in vivo). According to the present invention, the polypeptide encoded by the mRNA described herein or its processed product can be a polypeptide antigen and can be used as an antigen in a vaccine to induce an immune response.

The term "transfection" refers to the introduction of a polynucleotide into a host cell. Host cells for transfection of the polynucleotides described herein can exist in vitro or in vivo. In some embodiments, the host cells can be cells of a subject, particularly a patient, eg, a patient infected with the novel coronavirus. Transfection can be transient or stable. In general, transient transfection does not involve integration into the host cell genome. Stable transfection can be achieved by transfection using viral or transposon-based systems.

Coronavirus

As used herein, "severe acute respiratory syndrome coronavirus 2", "novel coronavirus" and "SARS-CoV-2" are used interchangeably. SARS-CoV-2 is known to be the causative agent of "Coronavirus Disease 2019 (COVID-19)".

SARS-CoV-2 is a positive-sense single-stranded RNA ((+)ssRNA) enveloped virus belonging to the β genus of the family Coronaviridae. SARS-CoV-2 encodes 4 structural proteins: spike protein (S), envelope protein (E), membrane protein (M) and nucleocapsid protein (N). Among them, the spike protein (S protein) mediates the specific binding of the virus to the host cell and the fusion of the viral envelope and the host cell membrane, so it is a key molecule for the virus to infect the host cell.

As used herein, "SARS-CoV-2 spike protein", "spike", "SARS-CoV-2 S protein" or "S protein" refers to the spike protein of SARS-CoV-2. The SARS-CoV-2 S protein is synthesized as a glycoprotein of approximately 1273-1300 amino acids (an exemplary amino acid sequence is shown in SEQ ID NO: 1), which includes an N-terminal signal peptide, an S1 subunit, and an S2 subunit. The S1 subunit contains the N-terminal domain, receptor binding domain (RBD) and subdomains 1 and 2 (SD1/2). The S2 subunit contains a fusion peptide (FP), heptapeptide repeats HR1 and HR2, a transmembrane domain and a cytoplasmic domain. A description of the SARS-CoV-2 S protein can also be found, for example, in Huang Y et al., Acta Pharmacol Sin. 2020;41(9):1141-1149.

Studies have shown that the RBD of the S1 subunit recognizes target host cells by interacting with the specific receptor angiotensin-converting enzyme 2 (ACE2), while the S2 subunit is responsible for membrane fusion. In its natural state, the S protein exists on the virus surface in a metastable prefusion trimer conformation. During infection, RBD binds to host cell receptors, and host proteases (such as Furin) cleaves the S1/S2 cleavage site of the S protein, destabilizing the prefusion trimer, resulting in shedding of the S1 subunit and The S2 subunit transitions to the stable conformation after fusion. The Furin cleavage site is an exposed loop structure containing multiple arginine residues, which contains the amino acid motif Arg-X _aa -X _bb -Arg (wherein X _aa is any amino acid; X _bb is any amino acid, preferably is Arg or Lys. The amino acid sequence of the Furin cleavage site in the S protein is Arg-Arg-Ala-Arg ("RRAR"), corresponding to amino acids 682-685 in SEQ ID NO:1.

Vaccine combination

In one general aspect, the present invention provides a vaccine combination comprising a first composition and a second composition, wherein the first composition comprises an inactivated vaccine; and the second composition comprises an mRNA vaccine.

As used herein, "vaccine" may include one or more vaccine compositions. In some embodiments, a vaccine may also be referred to as a "vaccine agent" or "vaccine combination." As used herein, the term "vaccine composition" refers to a composition comprising an antigen that upon vaccination into a subject induces an immune response sufficient to prevent and/or alleviate infection with a pathogen or disease associated at least one symptom. Antigens in vaccine compositions can include, for example, polypeptide antigens, polynucleotides (including but not limited to RNA (eg, mRNA) and DNA) expressing polypeptide antigens, inactivated or inactivated viral antigens, or combinations thereof. Thus, the compositions of the vaccine combinations herein may also be referred to as vaccine compositions, eg, a first vaccine composition, a second vaccine composition.

Those skilled in the art will appreciate that the vaccine combinations, vaccine reagents or different components of the vaccines described herein, such as the first composition, the second composition or the inactivated vaccine reagent and the mRNA vaccine reagent, may be contained in the same or different Compositions or packages for simultaneous or separate administration, preferably separate and at timed intervals.

Vaccine compositions may also contain vehicles, adjuvants and/or excipients. Physiological saline or distilled water can be used as vehicles. As used herein, the term "adjuvant" refers to a substance capable of promoting, prolonging and/or enhancing an immune response. Examples of adjuvants include, but are not limited to, oil emulsions (eg, Freund's adjuvant), aluminum hydroxide, mineral oil, bacterial products (eg, pertussis toxin). Non-limiting examples of excipients include aluminum phosphate, aluminum hydroxide, and potassium aluminum sulfate.

The vaccine composition is preferably administered parenterally. As used herein, the term "parenteral administration" refers to administration by any means other than through the gastrointestinal tract. In some embodiments, the vaccine compositions as described herein are administered by nasal, intravenous, subcutaneous, intradermal, or intramuscular administration. In a preferred embodiment, the vaccine composition as described herein is administered by subcutaneous, intradermal or intramuscular injection.

The first and second compositions as described herein can be used as vaccines or vaccine compositions for inducing an immune response against SARS-CoV-2 in a subject or for preventing and/or treating a subject in need thereof SARS-CoV-2 infection in subjects.

second composition

In one general aspect, the present invention relates to a second composition for providing an antigen comprising mRNA encoding a polypeptide antigen comprising a SARS-CoV-2 spike with an inactivated furin cleavage site A protein variant wherein the inactive furin cleavage site has the amino acid sequence of QSAQ. In one embodiment, the polypeptide antigen has the amino acid sequence of SEQ ID NO:3.

As used herein, an "inactive Furin cleavage site" refers to an amino acid sequence that cannot be recognized and cleaved by Furin. As used herein, an "active furin cleavage site" or "furin cleavage site" refers to an amino acid sequence capable of being recognized and cleaved by furin. The mRNA-encoded polypeptide antigens described herein contain an inactivated Furin cleavage site Gln-Ser-Ala-Gln (QSAQ), resulting in higher expression levels in host cells and/or stronger induction in subjects immune response.

In some embodiments, the second composition as described herein may also be referred to as an "mRNA vaccine" or "mRNA vaccine agent". As used herein, "mRNA" refers to messenger RNA. In general, mRNA may comprise a 5'UTR sequence, a coding sequence for a polypeptide, a 3'UTR sequence, and optionally a poly(A) sequence. mRNA can be produced, for example, by in vitro transcription, recombinant production, or chemical synthesis. mRNA may be in vitro transcribed RNA (IVT-RNA). IVT-RNA can be obtained by in vitro transcription using a DNA template by RNA polymerase (eg, as described herein).

As used herein, "coding sequence" refers to a nucleotide sequence in a polynucleotide that can serve as a template for the synthesis of a defined nucleotide sequence (eg, tRNA and mRNA) or a defined amino acid sequence in a biological process. The coding sequence can be a DNA sequence or an RNA sequence.

The mRNA comprises a nucleotide sequence encoding a polypeptide antigen as described herein. In a specific embodiment, the mRNA comprises the nucleotide sequence of SEQ ID NO:11. In another specific embodiment, the mRNA encodes a polypeptide having the amino acid sequence of SEQ ID NO:3 and comprises at least 80%, 85%, 90%, 95% of the nucleotide sequence of SEQ ID NO:11 , 96%, 97%, 98% or 99% identical nucleotide sequences.

In further embodiments, the mRNA further comprises structural elements that contribute to the stability and/or translation efficiency of the RNA, including but not limited to 5' cap, 5' UTR, 3' UTR and poly(A) sequences .

As used herein, the term "5'cap" generally refers to an N7-methylguanosine structure (also known as " ^m7G cap", " ^m7Gppp ") linked to the 5' end of the mRNA by a 5' to 5' triphosphate bond -"). The 5' cap can be co-transcribed to the RNA during in vitro transcription (eg, using an anti-reverse cap analog "ARCA"), or can be attached to the RNA post-transcriptionally using a capping enzyme. In some embodiments, cap analogs are used to generate 5' cap-modified RNAs. A description of "cap analogs" can be found, for example, in Contreas, R. et al. (1982). Nucl. Acids Res.. 10, 6353-6363 and US7074596B2. Examples of cap analogs include, but are not limited to, N7-methylguanosine-5'-triphosphate-5'guanosine (m ⁷ G(5')ppp(5')G), N7-methylguanosine-5 '-5'-adenosine triphosphate (m ⁷ G(5')ppp(5')A) and 3'-O-Me-m ⁷ G(5')ppp(5')G(ARCA). The mRNA can be either Cap0 (unmethylated ribose of the adjacent nucleotide of m7G), Cap1 (methylated of the ribose of the adjacent nucleotide of m7G) or Cap2 (the second nucleotide downstream of m7G) ribose methylation) structure of mRNA.

As used herein, the term "untranslated region (UTR)" generally refers to a region in RNA (eg, mRNA) that is not translated into an amino acid sequence (noncoding region), or a corresponding region in DNA. Generally, a UTR located 5' (upstream) of the open reading frame (start codon) may be referred to as a 5' untranslated region (5'UTR); a UTR located 3' (downstream) of the open reading frame (stop codon) UTRs may be referred to as 3' untranslated regions (3' UTRs). In the presence of a 5' cap, the 5' UTR is located downstream of the 5' cap, eg, directly adjacent to the 5' cap. In certain embodiments, an optimized "Kozak sequence" may be included in the 5'UTR, eg, adjacent to the initiation codon, to improve translation efficiency. Preferably, the "3'UTR" does not contain a poly(A) sequence. In the presence of a poly(A) sequence, the 3'UTR is located upstream of the poly(A) sequence, eg, directly adjacent to the poly(A) sequence.

As used herein, the term "poly(A) sequence" or "poly(A) tail" refers to a nucleotide sequence comprising contiguous or discontinuous adenine nucleotides. The poly(A) sequence is usually located at the 3' end of the RNA, such as the 3' end (downstream) of the 3' UTR. In some embodiments, the poly(A) sequence contains no nucleotides other than adenylate at its 3' end. Poly(A) sequences can be generated by DNA-dependent RNA polymerase transcription from the coding sequence of the DNA template during the preparation of IVT-RNA, or ligated to the IVT by a DNA-independent RNA polymerase (poly(A) polymerase) - the free 3' end of the RNA, eg the 3' end of the 3' UTR.

In one embodiment, the poly(A) sequence comprises contiguous adenosine nucleotides. In one embodiment, the poly(A) sequence may comprise at least 20, 30, 40, 50, 60, 70, 80 or 100 and up to 120, 150, 180, 200 or 300 adenosine nucleotides. In one embodiment, the contiguous adenylate sequence in the poly(A) sequence is interrupted by a sequence comprising U, C or G nucleotides.

In one embodiment, the mRNA as described herein comprises (1) a 5' cap; (2) a 5' UTR; (3) a nucleotide sequence encoding a polypeptide antigen comprising a flyin with inactivation A SARS-CoV-2 spike protein variant of a protease cleavage site, wherein the inactivated furin cleavage site has the amino acid sequence of QSAQ; (4) 3' UTR; and (5) poly(A) sequence . In one embodiment, the 5'UTR comprises the nucleotide sequence of SEQ ID NO:7. In one embodiment, the nucleotide sequence encoding the polypeptide antigen comprises the nucleotide sequence of SEQ ID NO: 11. In one embodiment, the 3' UTR comprises the nucleotide sequence of SEQ ID NO:8. In one embodiment, the poly(A) sequence comprises the nucleotide sequence of SEQ ID NO:9. In a specific embodiment, the mRNA comprises the nucleotide sequence of SEQ ID NO:13.

The mRNA as described herein can be a nucleoside-modified mRNA. In one embodiment, the mRNA is modified by replacing one or more uridines with modified uridines. Examples of modified uridines may include, but are not limited to: 1-methyluridine, 1-methyl-pseudouridine, 3-methyl-uridine, 3-methyl-pseudouridine, 2-methoxy - uridine, 5-methoxy-uridine, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine , uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxy Hydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio- Uridine, 5-Methylaminomethyl-uridine, 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine, 5-carbamoylmethyl-uridine, 5-Carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- Taurine methyl-uridine, 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uridine, 1-taurine methyl-4-thio- pseudouridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio- 1-Methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), Dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy yl-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine , 5-(Prenylaminomethyl)uridine, 5-(Prenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2'-O-methyl - Uridine, 5,2'-O-dimethyl-uridine, 2'-O-methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxy Carbonylcarbonylmethyl-2'-O-methyl-uridine, 5-carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl yl-uridine, 3,2'-O-dimethyl-uridine, 5-(prenylaminomethyl)-2'-O-methyl-uridine, 1-thio-uridine, 5-(2-Methoxycarbonylvinyl)uridine and 5-[3-(1-E-propenylamino)uridine.

In a specific embodiment, 100% of the uridine in the mRNA is replaced by 1-methylpseudouridine. In one embodiment, the mRNA comprises the nucleotide sequence of SEQ ID NO: 13, wherein 100% of the uridine is replaced by 1-methylpseudouridine.

According to some embodiments of the invention, the second composition as described herein is a lipopolyplex (LPP). As used herein, "lipopolyplex" or "LPP" refers to a core-shell structure comprising a nucleic acid core encapsulated by a lipid shell (particle), the nucleic acid core comprising nucleic acid associated with a polymer (e.g. mRNA). In some embodiments, the second composition comprises an mRNA as described herein, a cationic polymer associated with the mRNA as a complex, and a lipid particle encapsulating the complex.

As used herein, the term "cationic polymer" refers to any ionic polymer capable of carrying a net positive charge to electrostatically bind nucleic acids at a specified pH. Examples of cationic polymers include, but are not limited to, poly-L-lysine, protamine, and polyethyleneimine (PEI). The polyethyleneimine can be linear or branched polyethyleneimine. As used herein, the term "protamine" refers to an arginine-rich, low molecular weight basic protein that is present in the sperm cells of various animals, particularly fish, and binds DNA instead of histones. In a preferred embodiment, the cationic polymer is protamine (eg, protamine sulfate).

Lipids used to form lipid particles can include ionizable cationic lipids, phospholipids and steroids, and polyethylene glycol-modified lipids.

Ionizable cationic lipids have a net positive charge at, eg, acidic pH, and are neutral at higher pH (eg, physiological pH). Examples of ionizable cationic lipids include, but are not limited to: dioctadecylamidoglycyl spermine (DOGS), N4-cholesteryl-spermine (N4-cholesteryl-spermine), 2,2- Dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane(2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane , DLin-KC2-DMA), triheptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butyrate (heptatriaconta-6,9,28,31 -tetraen-19-yl-4-(dimethylamino)butanoate, DLin-MC3-DMA), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decane) Oxy)hexyl)amino)octanoate)(heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate),((4-hydroxybutyl) Azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate ). In one embodiment, the ionizable cationic lipid comprises M5, which has the following structure:

Examples of phospholipids include, but are not limited to: 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, DOPE), 1-palmitoyl-2-oil Acylphosphatidylethanolamine (1-palmitoyl-2-oleoylphosphatidylethanolamine, POPE), distearoylphosphatidylcholine (DSPC), distearoyl-phosphatidylethanolamine (DSPE), dioleoyl phospholipid Dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), diarachidoylphosphatidylcholine (DAPC) , Dibehenoylphosphatidylcholine (DBPC), Ditricosanoylphosphatidylcholine (DTPC), Diligoceroylphatidylcholine (DLPC), Palmitoyl oleoyl -Palmitoyloleoyl-phosphatidylcholine (POPC), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE) and dilauroyl-phosphatidylethanolamine Ethanolamine (dilauroyl-phosphatidylethanolamine, DLPE).

Examples of steroids include, but are limited to, for example, cholesterol, cholestanol, cholestanone, cholestenone, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, tocopherol, and the like. derivative.

As used herein, the term "polyethylene glycol modified lipid" refers to a molecule comprising a polyethylene glycol moiety and a lipid moiety. Examples of polyethylene glycol-modified lipids include, but are not limited to: 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (1,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol, DMG-PEG), 1,2-dioleoyl-rac-glycerol, methoxy-polyethylene glycol (1,2-Dioleoyl-rac-glycerol, methoxypolyethylene Glycol, DOGPEG)) and 1,2- Distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (1,2-Distearoyl-sn-glycero-3-phosphoethanolamine-Poly(ethylene glycol), DSPE-PEG). In one embodiment, the polyethylene glycol-modified lipid is DMG-PEG, such as DMG-PEG 2000. In one embodiment, DMG-PEG 2000 has the following structure:

where n has an average value of 44.

In one embodiment, the lipid particle comprises: (1) M5; (2) 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE); (3) cholesterol; and (4) DMG-PEG 2000; wherein said M5 has the following structure:

In a specific embodiment, the molar ratio of M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol and DMG-PEG 2000 is 40:15:43.5:1.5.

In a specific embodiment, the second composition comprises mRNA having the nucleotide sequence of SEQ ID NO: 13, protamine associated with the mRNA as a complex, and a lipid encapsulating the complex. A lipid particle, wherein the lipid particle comprises: (1) M5; (2) 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE); (3) cholesterol; and (4) DMG- PEG 2000; wherein said M5 has the following structure:

In a specific embodiment, the lipid particle comprises M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol and DMG- PEG 2000, wherein said M5 has the following structure:

first composition

In another general aspect, the present invention relates to a first composition for providing an antigen comprising an inactivated viral antigen of SARS-CoV-2. In some embodiments, the first composition as described herein may also be referred to as a SARS-CoV-2 inactivated vaccine or a COVID-19 inactivated vaccine. As used herein, the term "inactivated vaccine" refers to a vaccine composition containing an infectious organism or pathogen that is no longer able to replicate or grow. Inactivation can be accomplished by a variety of methods, including freeze-thaw, chemical treatment (eg, with formalin or beta-propiolactone), sonication, radiation, heat, or sufficient to prevent the organism from replicating or growing while maintaining its immunity Any other conventional means of originality. Examples of inactivated vaccines include inactivated whole virus vaccines and split vaccines. In some embodiments, the first composition is an inactivated whole virus vaccine.

In one embodiment, the first composition comprises an inactivated viral antigen of the SARS-CoV-2 KMS-1 strain (GenBank accession number: MT226610.1). In one embodiment, the first composition further comprises an adjuvant. In a specific embodiment, the adjuvant is Al(OH) ₃ .

In a specific embodiment, the first composition comprises an inactivated viral antigen of the SARS-CoV-2 KMS-1 strain (GenBank Accession No: MT226610.1) and Al(OH) ₃ as an adjuvant. In a specific embodiment, the first composition is Covifor ^™ . In one embodiment, each dose of ^CoviforTM comprises 100 or 150 EU (EU, viral antigen concentration determined by ELISA assay) of the SARS-CoV-2 KMS-1 strain ( GenBank accession number: MT226610.1) inactivated virus and 0.25 mg of Al(OH) ₃ . For a description of the SARS-CoV-2 inactivated vaccine ^CoviforTM , please refer to Pu J, et al. The safety and immunogenicity of an inactivated SARS-CoV-2 vaccine in Chinese adults aged 18-59 years: A phase I randomized , double-blinded, controlled trial. Vaccine. 2021 May 12; 39(20): 2746-2754. The relevant contents of which are all incorporated herein by reference.

In one embodiment, the vaccine combination of the present invention comprises a first composition and a second composition, wherein the first composition comprises an inactivated viral antigen of SARS-CoV-2; and the second composition comprises encoding The mRNA of a polypeptide antigen, wherein the polypeptide antigen has the amino acid sequence of SEQ ID NO:3. In a specific embodiment, the second composition comprises mRNA having the nucleotide sequence of SEQ ID NO:13. In preferred embodiments, the mRNA comprises modified uridine. In a specific embodiment, 100% of the uridine in the mRNA is replaced by 1-methylpseudouridine.

In one embodiment, the second composition further comprises a cationic polymer associated with the mRNA as a complex and a lipid particle encapsulating the complex. In a specific embodiment, the cationic polymer is protamine.

In one embodiment, the first composition comprises an inactivated viral antigen of the SARS-CoV-2 KMS-1 strain. In a further embodiment, the first composition comprises an inactivated viral antigen of the SARS-CoV-2 KMS-1 strain and Al(OH) ₃ . In a specific embodiment, the first composition is Covifor ^™ .

In one embodiment, the vaccine combination of the present invention comprises a first composition and a second composition, wherein the first composition comprises an inactivated viral antigen of a SARS-CoV-2 KMS-1 strain; and the first composition comprises an inactivated viral antigen of a SARS-CoV-2 KMS-1 strain; The two compositions comprise an mRNA having the nucleotide sequence of SEQ ID NO: 13, a cationic polymer associated with the mRNA as a complex, and a lipid particle encapsulating the complex.

In a specific embodiment, the vaccine combination of the present invention comprises a first composition and a second composition, wherein the first composition comprises an inactivated viral antigen of the SARS-CoV-2 KMS-1 strain and Al(OH) ) ₃ ; and the second composition comprises mRNA having the nucleotide sequence of SEQ ID NO: 13, protamine associated with the mRNA as a complex, and lipid particles encapsulating the complex, wherein the lipid particle comprises: (1) M5; (2) 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE); (3) cholesterol; and (4) DMG-PEG 2000; Wherein the M5 has the following structure:

and wherein said mRNA optionally comprises modified uridine. In a specific embodiment, 100% of the uridine of the mRNA is replaced by 1-methylpseudouridine. In a further embodiment, the molar ratio of M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol and DMG-PEG 2000 is 40:15:43.5:1.5.

The present invention also provides a vaccine reagent comprising an inactivated vaccine reagent and an mRNA vaccine reagent, wherein the inactivated vaccine reagent is a first composition as described herein; and the mRNA vaccine reagent is as described herein second composition.

Reagent test kit

In one aspect, the present invention provides a kit comprising a first container and a second container, wherein the first container comprises a first composition as described herein, and the second container comprises a composition as described herein second composition. Suitable containers may include, for example, vials, tubes and syringes. In preferred embodiments, the first and second compositions are provided in unit dosage form.

In some embodiments, the kit further comprises a content label and/or instructions for use. In some embodiments, the kit comprises instructions for dosage and/or method of administration of one or more components of the packaged vaccine.

Heterologous Prime-Booster

The present invention also relates to the use of the vaccine combination, kit or vaccine of the present invention in a heterologous prime-boost immunization regimen/method to induce an immune response in a subject in need thereof that provides protection against SARS- Protective and/or therapeutic immunity against CoV-2.

Herein, a regimen/method involving the administration of different antigenic compositions (eg vaccines) against or involving the same pathogen or disease, disorder or condition is referred to as a "heterologous prime-boost" immunization (vaccination) regimen/method . Preferably, the heterologous prime-boost immunization (or vaccination) regimen/method involves at least two administrations of different antigenic compositions (eg, the first and second compositions described herein), the different antigenic combinations The substances are directed against the same specific pathogen or the same specific disease, disorder or condition.

The terms "prime" and "boost" are intended to have their ordinary meanings in the art. "Primary immunization" or "prime immunization" refers to the immunization of a subject with a first antigenic composition (eg, a vaccine) to induce immunity in the subject against an antigen that can be recalled upon subsequent exposure to the same antigen or a similar antigen . According to some embodiments of the invention, "priming immunization" may include more than one immunization. The first composition as described herein may also be referred to as a "priming composition" or "priming agent". A "boost" or "booster immunization" refers to the administration of a later antigenic composition (eg, a vaccine) after an earlier (prime) antigenic composition. In some embodiments, following a primary immunization of a subject (eg, administration of a priming composition), one or more booster doses may be administered to the same subject for re-exposure to the same immunogenic antigen Or an antigen that has at least one cross-reactive epitope with the antigen used in the priming composition. The second composition as described herein may also be referred to as a "boosting composition" or "boosting agent".

According to the present invention, when compared with the level of immune response obtained by immunization with a single antigenic composition (eg, a separate priming composition), when a different antigenic composition (eg, comprising an antigenic determinant having at least one cross-reactivity) is subsequently administered A composition of antigens) immunization ("boost") with the prime immunization induces higher levels of immune responses to the antigen. In some embodiments, the heterologous prime-boost regimens/methods of the invention result in a significant increase in the levels of antigen-specific binding antibodies (eg, binding IgG) and neutralizing antibodies in a subject. In some embodiments, the heterologous prime-boost regimens/methods of the invention result in a significant increase in T cells secreting IFN-γ, IL-2 or IL-21 in a subject. In some embodiments, the heterologous prime-boost regimens/methods of the invention result in a significant increase in Spike-specific memory B cells in a subject.

In one aspect, the present invention provides the use of the vaccine combination of the present invention in the preparation of a vaccine for the prevention and/or treatment of SARS-CoV-2 infection or induction of SARS-CoV-2 infection in a subject in need thereof 2 immune response.

The present invention also provides a vaccine combination of the present invention for use as a vaccine for preventing and/or treating SARS-CoV-2 infection or inducing an immune response against SARS-CoV-2 in a subject in need thereof .

In yet another aspect, the present invention provides a method for preventing and/or treating SARS-CoV-2 infection. The present invention also provides a method of inducing an immune response against SARS-CoV-2 in a subject in need thereof.

Accordingly, some embodiments of the vaccine combinations, kits, vaccines or methods of the invention involve separate administration of a first composition and a second composition as described herein to a subject in a prime-boost immunization regimen .

Some embodiments of the vaccine combinations, kits, vaccines, uses or methods of the invention comprise: (a) administering to a subject in need thereof an effective amount of a first composition as described herein in at least one dose; and (b) then administering to the subject an effective amount of a second composition as described herein in at least one dose.

In some embodiments, the first composition is administered in two or more doses (eg, 3, 4 or 5 doses) prior to administration of the second composition. In some embodiments, the second composition is administered in at least one dose (eg, 1, 2, 3, 4, 5, 6, or 7 doses) following administration of the first composition.

In some embodiments, at about 48 weeks, 44 weeks, 40 weeks, 36 weeks, 32 weeks, 28 weeks, 24 weeks, 20 weeks, 16 weeks, 12 weeks, 8 weeks, 6 weeks after administration of the first composition The second composition is administered within a week, 5 weeks, 4 weeks, 3 weeks, 2 weeks or 1 week or within about 56 days, 28 days, 14 days or 7 days.

In some embodiments, the two doses are administered to the subject at intervals of about 1 week to about 8 weeks (eg, about 1, 2, 3, 4, 5, 6, 7, or 8 weeks) . In one embodiment, the two doses are administered to the subject at an interval of about 2 weeks to about 6 weeks. In a preferred embodiment, the two doses are administered to the subject at an interval of about 4 weeks.

In some embodiments, within about 5 to about 9 months (eg, within about 5, 6, 7, 8, or 9 months) of the last dose of the first composition, an effective amount of the The second composition is administered to the subject in at least one dose. In a specific embodiment, an effective amount of the second composition is administered to the subject in at least one dose within about 7 months after administration of the last dose of the first composition .

In some embodiments where two doses of the first composition are administered, wherein within about 5 to about 9 months (eg, about 5, 6, 7, 8) after administration of the second dose of the first composition or within 9 months), administering to the subject an effective amount of the second composition in one dose. In a specific embodiment, an effective amount of the second composition is administered to the subject in one dose within about 7 months after administration of the second dose of the first composition .

As used herein, the term "effective amount" refers to an amount sufficient to prevent or inhibit the occurrence of a disease, disorder or condition and/or slow, alleviate, delay the development or severity of the disease, disorder or condition. As used herein, an "effective amount" also refers to an amount sufficient to induce an immune response. The effective amount is affected by factors including, but not limited to, the speed and severity of the disease, disorder or condition, the age, sex, weight and physical condition of the subject, the frequency of administration, and the particular route of administration. An effective amount can be administered in one or more doses (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more). An effective amount can be achieved by continuous or intermittent administration. In some embodiments, an effective amount is provided in one or more administrations. In preferred embodiments, the effective amount is provided in unit dosage form.

According to some embodiments of the invention, the vaccine combinations, kits, vaccines or methods of the invention can be used to induce an immune response against SARS-CoV-2 in a subject. According to some embodiments of the invention, the vaccine combinations, kits, vaccines or methods of the invention can be used to prevent and/or treat SARS-CoV-2 infection in a subject in need thereof.

In one embodiment, the SARS-CoV-2 is an original strain of SARS-CoV-2, such as Wuhan-Hu-1 strain (Genbank accession number: MN908947.3). In one embodiment, the SARS-CoV-2 is a SARS-CoV-2 variant. In one embodiment, the SARS-CoV-2 variant strain is selected from the group consisting of Alpha (B.1.1.7 and Q lineage), Beta (B.1.351 and progeny lineage), Gamma (P.1 and progeny lineage), Delta (B.1.617.2 and AY lineages) and Omicron (lineages B.1.1.529 and BA lineages such as BA.1 and BA.2) variants.

In specific embodiments, the SARS-CoV-2 has the wild-type SARS-CoV-2 S protein. In one embodiment, the wild-type SARS-CoV-2 S protein comprises the amino acid sequence of SEQ ID NO:1.

In other specific embodiments, the SARS-CoV-2 has a mutant SARS-CoV-2 S protein. The mutant SARS-CoV-2 S protein may comprise one or more amino acid additions, substitutions and/or deletions compared to the wild type SARS-CoV-2 S protein. In one embodiment, the mutant SARS-CoV-2 S protein comprises one or more of the following amino acid substitutions compared to SEQ ID NO: 1: D614G, K417N, E484K and N501Y. In one embodiment, the mutant SARS-CoV-2 S protein comprises the following amino acid substitutions compared to SEQ ID NO: 1: N501Y and D614G. In one embodiment, the mutant SARS-CoV-2 S protein comprises the following amino acid substitutions compared to SEQ ID NO: 1: K417N, N501Y and D614G. In one embodiment, the mutant SARS-CoV-2 S protein comprises the following amino acid substitutions compared to SEQ ID NO: 1: E484K, N501Y and D614G. In one embodiment, the mutant SARS-CoV-2 S protein comprises the following amino acid substitutions compared to SEQ ID NO: 1: D80A, D215G, K417N, E484K, N501Y, D614G and A701V. In one embodiment, the mutant SARS-CoV-2 S protein comprises the following amino acid substitutions compared to SEQ ID NO: 1: L18F, K417N, E484K, N501Y, D614G, D80A, D215G and A701V; and optionally Deletion of amino acids 242-244.

implementation plan

Embodiments of the present invention can also be enumerated as follows:

Embodiment 1 is a vaccine combination comprising a first composition and a second composition, wherein the first composition comprises an inactivated vaccine; and the second composition comprises an mRNA vaccine.

Embodiment 2 is the vaccine combination of embodiment 1, wherein the first composition comprises an inactivated viral antigen of SARS-CoV-2; and the second composition comprises mRNA encoding a polypeptide antigen comprising a A SARS-CoV-2 spike protein variant with an inactivated furin cleavage site; wherein the inactivated furin cleavage site has the amino acid sequence of QSAQ.

Embodiment 3 is the vaccine combination of

embodiment

1 or 2, wherein the first composition comprises an inactivated viral antigen of a SARS-CoV-2 KMS-1 strain; and the polypeptide antigen has the amino acid of SEQ ID NO:3 sequence.

Embodiment 4 is the vaccine combination of any one of embodiments 1-3, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO: 11.

Embodiment 5 is the vaccine combination of any one of embodiments 1-3, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO: 13.

Embodiment 6 is the vaccine combination of any of embodiments 1-5, wherein the mRNA comprises a modified uridine.

Embodiment 7 is the vaccine combination of any of embodiments 1-5, wherein 100% of the uridine in the mRNA is replaced by 1-methylpseudouridine.

Embodiment 8 is the vaccine combination of any one of embodiments 1-7, wherein the second composition further comprises a cationic polymer associated with the mRNA as a complex and a lipid particle that encapsulates the complex .

Embodiment 9 is the vaccine combination of embodiment 8, wherein the cationic polymer is protamine.

Embodiment 10 is the vaccine combination of embodiment 8 or 9, wherein the lipid particle comprises M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000, wherein Said M5 has the following structure:

Embodiment 11 is the vaccine combination of embodiment 10, wherein the molar ratio of M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000 is 40:15:43.5: 1.5.

Embodiment 12 is the vaccine combination of any of embodiments 1-11, wherein the first composition is an inactivated whole virus vaccine.

Embodiment 13 is the vaccine combination of any of embodiments 1-12, wherein the first composition further comprises an adjuvant.

Embodiment 14 is the vaccine combination of embodiment 13, wherein the adjuvant is Al(OH) ₃ .

Embodiment 15 is a kit comprising a first container and a second container, wherein the first container comprises a first composition as defined in any of embodiments 1-3 and 12-14, the The second container comprises a second composition as defined in any of embodiments 1-11.

Embodiment 16 is the use of the vaccine combination of any one of embodiments 1-14 in the manufacture of a vaccine for preventing and/or treating SARS-CoV-2 infection or inducing in a subject in need thereof a Immune response to SARS-CoV-2.

Embodiment 17 is the vaccine combination of any one of embodiments 1-14, the kit of embodiment 15, or the use of embodiment 16, wherein

Embodiment 18 is the vaccine combination, kit, or use of embodiment 17, wherein

Embodiment 19 is the vaccine combination, kit, or use of embodiment 18, wherein the two doses are administered to the subject at an interval of about 1 week to about 8 weeks.

Embodiment 20 is the vaccine combination, kit, or use of embodiment 18, wherein the two doses are administered to the subject at intervals of about 2 weeks to about 6 weeks.

Embodiment 21 is the vaccine combination, kit, or use of embodiment 18, wherein the two doses are administered to the subject at an interval of about 4 weeks.

Embodiment 22a is the vaccine combination, kit or use of any one of Embodiments 17-21, wherein within about 5 to about 9 months after administration of the last dose of the first composition, an effective amount of of said second composition is administered to said subject in one dose.

Embodiment 22b is the vaccine combination, kit or use of any one of Embodiments 18-21, wherein within about 5 to about 9 months after administration of the second dose of the first composition, will be effective The amount of the second composition is administered to the subject in one dose.

Embodiment 23a is the vaccine combination, kit or use of any one of Embodiments 17-21, wherein within about 7 months after administration of the last dose of said first composition, an effective amount of said The second composition is administered to the subject in one dose.

Embodiment 23b is the vaccine combination, kit, or use of any one of embodiments 18-21, wherein within about 7 months after administration of the second dose of the first composition, an effective amount of all The second composition is administered to the subject in one dose.

Embodiment 24 is a method for preventing and/or treating SARS-CoV-2 infection or inducing an immune response against SARS-CoV-2 in a subject in need thereof, comprising:

(a) administering to the subject at least once an effective amount of the first composition; and

(b) subsequently administering to the subject at least one effective amount of the second composition;

in

The first composition is as defined in any one of Embodiments 1-3 and 12-14;

The second composition is as defined in any one of Embodiments 1-11.

Embodiment 25 is the method of embodiment 24, wherein

Embodiment 26 is the method of embodiment 25, wherein the two doses are administered to the subject at an interval of about 1 week to about 8 weeks.

Embodiment 27 is the method of embodiment 25, wherein the two doses are administered to the subject at an interval of about 2 weeks to about 6 weeks.

Embodiment 28 is the method of embodiment 25, wherein the two doses are administered to the subject at an interval of about 4 weeks.

Embodiment 29a is the method of any one of embodiments 24-28, wherein within about 5 to about 9 months after administration of the last dose of the first composition, an effective amount of the second combination is administered The substance is administered to the subject in one dose.

Embodiment 29b is the method of any one of embodiments 25-28, wherein within about 5 to about 9 months after administration of the second dose of the first composition, an effective amount of the second The composition is administered to the subject in one dose.

Embodiment 30a is the method of any one of embodiments 24-28, wherein within about 7 months after the last dose of the first composition is administered, an effective amount of the second composition is administered in a The dose is administered to the subject.

Embodiment 30b is the method of any one of embodiments 25-28, wherein within about 7 months after administration of the second dose of the first composition, an effective amount of the second composition is administered with One dose is administered to the subject.

Embodiment 31 is the vaccine combination of any one of embodiments 1-14 for use as a vaccine for preventing and/or treating SARS-CoV-2 infection or inducing in a subject in need thereof protection against SARS - Immune response to CoV-2, where

(a) administering to the subject at least one effective amount of the first composition; and

(b) subsequently administering to the subject at least one time an effective amount of the second composition.

Embodiment 32 is the vaccine combination of embodiment 31 for use as a vaccine, wherein

Embodiment 33 is the vaccine combination of embodiment 32, for use as a vaccine, wherein the two doses are administered to the subject at an interval of about 1 week to about 8 weeks.

Embodiment 34 is the vaccine combination of embodiment 32, for use as a vaccine, wherein the two doses are administered to the subject at an interval of about 2 weeks to about 6 weeks.

Embodiment 35 is the vaccine combination of embodiment 32, for use as a vaccine, wherein the two doses are administered to the subject at an interval of about 4 weeks.

Embodiment 36a is the vaccine combination of any one of embodiments 31-35, for use as a vaccine, wherein within about 5 to about 9 months after administration of the last dose of the first composition, an effective amount of The second composition is administered to the subject in one dose.

Embodiment 36b is the vaccine combination of any one of embodiments 32-35, for use as a vaccine, wherein within about 5 to about 9 months after administration of the second dose of the first composition, an effective amount of of said second composition is administered to said subject in one dose.

Embodiment 37a is the vaccine combination of any one of embodiments 31-35, for use as a vaccine, wherein within about 7 months after the last dose of the first composition is administered, an effective amount of the first composition is administered. The two compositions are administered to the subject in one dose.

Embodiment 37b is the vaccine combination of any one of embodiments 32-35, for use as a vaccine, wherein within about 7 months after administration of a second dose of said first composition, an effective amount of said The second composition is administered to the subject in one dose.

Embodiment 38 is a vaccine agent comprising an inactivated vaccine agent and an mRNA vaccine agent.

Embodiment 39 is the vaccine agent of embodiment 38, wherein the inactivated vaccine agent comprises an inactivated vaccine against one or more infectious diseases.

Embodiment 40 is the vaccine agent of embodiment 38, wherein the mRNA vaccine agent comprises one or more vaccine agents against infectious diseases.

Embodiment 41 is the vaccine agent of embodiment 38, wherein the inactivated vaccine agent comprises an inactivated virus, bacteria, fungus, or a split fragment of a virus, bacteria, fungus.

Embodiment 42 is the vaccine agent of embodiment 38, wherein the mRNA vaccine agent comprises a partial RNA sequence of a virus, bacteria, fungus, or an mRNA sequence.

Embodiment 43 is the vaccine reagent of any one of embodiments 38-42, wherein the inactivated vaccine reagent comprises an inactivated viral antigen of SARS-CoV-2; and the mRNA vaccine reagent comprises mRNA encoding a polypeptide antigen, wherein The polypeptide antigen comprises a SARS-CoV-2 spike protein variant with an inactivated furin cleavage site; wherein the inactivated furin cleavage site has the amino acid sequence of QSAQ.

Embodiment 44 is the vaccine agent of any one of embodiments 38-43, wherein the inactivated vaccine agent comprises an inactivated viral antigen of a SARS-CoV-2 KMS-1 strain; and the polypeptide antigen has SEQ ID NO :3 amino acid sequence.

Embodiment 45 is the vaccine agent of any one of embodiments 38-44, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO: 11.

Embodiment 46 is the vaccine agent of any one of embodiments 38-44, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO: 13.

Embodiment 47 is the vaccine agent of any one of embodiments 38-46, wherein the mRNA comprises a modified uridine.

Embodiment 48 is the vaccine agent of any one of embodiments 38-46, wherein 100% of the uridine in the mRNA is replaced by 1-methylpseudouridine.

Embodiment 49 is the vaccine agent of any one of embodiments 38-48, wherein the mRNA vaccine agent further comprises a cationic polymer that associates with the mRNA as a complex and a lipid particle that encapsulates the complex.

Embodiment 50 is the vaccine agent of embodiment 49, wherein the cationic polymer is protamine.

Embodiment 51 is the vaccine agent of embodiment 49 or 50, wherein the lipid particle comprises M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000, wherein Said M5 has the following structure:

Embodiment 52 is the vaccine agent of embodiment 51, wherein the molar ratio of M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000 is 40:15:43.5: 1.5.

Embodiment 53 is the vaccine agent of any one of embodiments 38-52, wherein the inactivated vaccine agent is an inactivated whole virus vaccine.

Embodiment 54 is the vaccine agent of any one of embodiments 38-53, wherein the inactivated vaccine agent further comprises an adjuvant.

Embodiment 55 is the vaccine agent of embodiment 54, wherein the adjuvant is Al(OH) ₃ .

Embodiment 56 is a method of inoculating an infectious disease vaccine, comprising first inoculating an inactivated vaccine reagent, followed by inoculating an mRNA vaccine reagent; or inoculating an inactivated vaccine reagent and an mRNA vaccine reagent at the same time, or inoculating an mRNA vaccine reagent first, then inoculating the mRNA vaccine reagent Inactivated vaccine reagents.

Embodiment 57 is the method of embodiment 56, and the dose of inoculating the inactivated vaccine agent is at least a 1 unit dose, such as a 2 unit dose, a 3 unit dose, or at least a dose that includes a single shot or a dose of 2 shots.

Embodiment 58 is the method of embodiment 56, further comprising inoculating a dose of at least 1 unit of the mRNA vaccine agent, such as a dose of 2 units, a dose of 3 units, or at least one dose or 2 doses.

Embodiment 59 is the method of embodiment 56, the time interval between vaccination with the inactivated vaccine agent and vaccination with the mRNA vaccine agent is 1-100 days.

Embodiment 60 is the method of any of embodiments 56-59, comprising:

(a) administering to the subject at least once an effective amount of an inactivated vaccine agent; and

(b) subsequently administering to the subject at least once an effective amount of the mRNA vaccine agent;

in

The inactivated vaccine agent is as defined in any of embodiments 43, 44 and 53-55;

The mRNA vaccine agent is as defined in any of embodiments 43-52.

Embodiment 61 is the method of embodiment 60, wherein

(a) administering to the subject an effective amount of the inactivated vaccine agent in two doses; and

(b) then administering to the subject an effective amount of the mRNA vaccine agent in one dose.

Embodiment 62 is the method of embodiment 61, wherein the two doses are administered to the subject at an interval of about 1 week to about 8 weeks.

Embodiment 63 is the method of embodiment 61, wherein the two doses are administered to the subject at an interval of about 2 weeks to about 6 weeks.

Embodiment 64 is the method of embodiment 61, wherein the two doses are administered to the subject at an interval of about 4 weeks.

Embodiment 65a is the method of any one of embodiments 60-64, wherein within about 5 to about 9 months after the last dose of the inactivated vaccine agent is administered, an effective amount of the mRNA vaccine agent is administered. The subject is administered in one dose.

Embodiment 65b is the method of any one of embodiments 61-64, wherein within about 5 to about 9 months after administration of the second dose of the inactivated vaccine reagent, an effective amount of the mRNA vaccine is administered. The agent is administered to the subject in one dose.

Embodiment 66a is the method of any one of embodiments 60-64, wherein within about 7 months after the last dose of the inactivated vaccine agent is administered, an effective amount of the mRNA vaccine agent is administered in a dose administered to the subject.

Embodiment 66b is the method of any one of embodiments 61-64, wherein within about 7 months after administration of the second dose of the inactivated vaccine agent, an effective amount of the mRNA vaccine agent is administered with a The dose is administered to the subject.

Embodiment 67 is the vaccine agent of any one of embodiments 38-55 for use as a vaccine for preventing and/or treating SARS-CoV-2 infection or inducing in a subject in need thereof protection against SARS - Immune response to CoV-2, where

(a) administering to the subject at least once an effective amount of the inactivated vaccine agent; and

(b) subsequently administering an effective amount of the mRNA vaccine agent to the subject at least once.

Embodiment 68 is the vaccine agent of embodiment 67, for use as a vaccine, wherein

Embodiment 69 is the vaccine agent of embodiment 68, for use as a vaccine, wherein the two doses are administered to the subject at an interval of about 1 week to about 8 weeks.

Embodiment 70 is the vaccine agent of embodiment 68, for use as a vaccine, wherein the two doses are administered to the subject at an interval of about 2 weeks to about 6 weeks.

Embodiment 71 is the vaccine agent of embodiment 68, for use as a vaccine, wherein the two doses are administered to the subject at an interval of about 4 weeks.

Embodiment 72a is the vaccine agent of any one of embodiments 67-71, for use as a vaccine, wherein within about 5 to about 9 months after administration of the last dose of the inactivated vaccine agent, an effective amount of The mRNA vaccine agent is administered to the subject in one dose.

Embodiment 72b is the vaccine agent of any one of embodiments 68-71, for use as a vaccine, wherein within about 5 to about 9 months after administration of a second dose of the inactivated vaccine agent, an effective amount of The mRNA vaccine agent is administered to the subject in one dose.

Embodiment 73a is the vaccine agent of any one of embodiments 67-71, for use as a vaccine, wherein an effective amount of the mRNA is administered within about 7 months after the last dose of the inactivated vaccine agent is administered. The vaccine agent is administered to the subject in one dose.

Embodiment 73b is the vaccine agent of any one of embodiments 68-71, for use as a vaccine, wherein within about 7 months after administration of a second dose of the inactivated vaccine agent, an effective amount of the The mRNA vaccine agent is administered to the subject in one dose.

beneficial effect

The vaccine combination, kit, vaccine or method of the present invention has at least one of the following beneficial effects:

(1) Significantly increase the level of antigen-specific binding antibodies (eg, binding IgG) and neutralizing antibodies in the subject;

(2) significantly increase the level of T cells secreting IFN-γ, IL-2 or IL-21 in the subject; and

(3) Significantly increased the level of Spike-specific memory B cells in subjects.

Example

The present invention is further described by reference to the following examples. It should be understood that these embodiments are only illustrative and do not limit the present invention. The following materials and instruments are either commercially available or prepared according to methods well known in the art. The following experiments were performed according to the manufacturer's instructions or according to methods and procedures well known in the art.

Example 1 Preparation of mRNA

1.1 Design of S protein variants

S protein variants with

design numbers

212 and 213, respectively, and the amino acid sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively. Wherein compared with the wild-type S protein of SEQ ID NO: 1 (the S protein of the original virus strain Wuhan-Hu-1 (Genbank accession number: MN908947.3)), the

S protein variants

212 and 213 both contain the amino acid substitution K986P/ V987P ("2P" mutation) and D614G. In addition, the Furin cleavage site in S protein variant 213 (corresponding to amino acids 682-685 of SEQ ID NO: 1) was mutated to "QSAQ" (Table 1).

Table 1

Note: "-" indicates that the S protein variant contains no mutation at this amino acid position; "+" indicates that the S protein variant contains the indicated mutation at this amino acid position.

1.2 Design and synthesis of DNA templates

The design and synthesis methods of DNA templates are described in CN113186203A.

Briefly, DNA open reading frame (ORF) sequences encoding the S protein variants described in Example 1.1 were designed, codon-optimized for optimal expression in human cells. The DNA ORF sequences encoding

S protein variants

212 and 213 are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively (Table 2), and the RNA ORF sequences are shown in SEQ ID NO: 10 and SEQ ID NO: 11, respectively.

The following sequences were then ligated in 5' to 3' order: T7 promoter sequence (SEQ ID NO:6), 5'UTR sequence (SEQ ID NO:7), DNA ORF sequence (SEQ ID NO:4 or SEQ ID NO:4 or SEQ ID NO:7) ID NO: 5), 3' UTR sequence (SEQ ID NO: 8) and poly(A) tail (SEQ ID NO: 9), using Puc57 as a carrier for full gene synthesis (Nanjing GenScript Biotechnology Co., Ltd.), Obtain plasmid DNA template.

The plasmid DNA template was finally linearized using restriction enzymes, using a pair of primers (upstream primer: 5'TTGGACCCTCGTACAGAAGCTAATACG 3'; and downstream poly(T) long primer: 5'TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGTTCTAGACCCTCACTTCCT polymerase based on high The PCR amplification kit (Bao Ri Doctor Biotechnology (Beijing) Co., Ltd.) was used for PCR amplification (Aibend AG, Germany) to obtain the DNA template.

1.3 In vitro transcription of mRNA from DNA template

The method of preparing in vitro transcribed mRNA using DNA template is described in CN113186203A. Briefly, using the DNA template prepared as in Example 1.2 as the template, a co-transcription capping reaction was performed using T7 RNA polymerase, and the in vitro transcription of RNA was performed to generate Cap1 mRNA. N1-methyl-pseudouridine-5'-triphosphate was added to the reaction system instead of uridine-5'-triphosphate (UTP), therefore, the modification ratio of 1-methyl-pseudouridine in Cap1 mRNA transcribed in vitro is 100%. After transcription, the DNA template was digested with DNaseI (Thermo Fisher Scientific Co., Ltd.) to reduce the risk of residual DNA template.

Cap1 mRNA was purified using DynabeadsMyone (Thermo Fisher Scientific). Purified Cap1 mRNA was dissolved in sodium citrate solution. The nucleotide sequences of mRNAs numbered 212 and 213 are shown in SEQ ID NO: 12 and SEQ ID NO: 13, respectively (Table 2).

Table 2

Example 2 Cell Expression Verification of Candidate mRNA

The expression of mRNA prepared as in Example 1.3 was verified in DC2.4 cells (mouse bone marrow-derived dendritic cell line; ATCC). Briefly, 2 μg of mRNA was transfected into DC2.4 cells using the transfection reagent Lipofectamine MessengerMax (Invitrogen). Place the transfected cells in a cell incubator and continue to culture at 37°C 5% _CO for 18-24h. Cells were then collected and counted after washing with PBS. Take 1x10 ⁶ cells into a flow tube and centrifuge to discard the supernatant. Cells were incubated with bovine serum albumin (Beijing Soleibo Technology Co., Ltd.), FcR blocking solution (Miltenyi Biotec), and live/dead dye (BD Biosciences), washed with PBS; Rui Biotechnology Co., Ltd.), and washed with PBS; then incubated with PE-labeled anti-Fc antibody (PE-anti-Fc) (BioLegend), washed with PBS; resuspended cells in PBS and used a flow cytometer (BD Biosciences) The amount of hACE2 bound to the surface of DC2.4 cells (expressed as mean fluorescence intensity (MFI) value of PE) was detected.

The results showed (Fig. 1) that strong PE fluorescence signals could be detected on the surface of DC2.4 cells transfected with mRNA 212 and mRNA 213, indicating that these mRNAs were correctly translated into functional spike proteins that could bind hACE2. . Furthermore, the PE MFI values detected on the surface of DC2.4 cells transfected with mRNA 213 were higher than those detected on the surface of DC2.4 cells transfected with mRNA 212, indicating that the Furin cleavage site was mutated to "QSAQ" Increase the expression level of the S protein variant and/or its binding affinity to hACE2.

The preparation of embodiment 3 mRNA vaccine preparation

Experimental Materials

Cationic lipid M5 was synthesized by microorganisms; auxiliary phospholipid (DOPE) was purchased from CordenPharma; cholesterol was purchased from Sigma-Aldrich; mPEG2000-DMG (ie DMG-PEG 2000) was purchased from Avanti Polar Lipids, Inc.; PBS was purchased from Invitrogen; sulfuric acid Protamine was purchased from Beijing Silian Pharmaceutical Co., Ltd.

Preparation of lipid polyplex (LPP-mRNA) formulations:

Preparation of mRNA aqueous solution: mRNA 212 and mRNA 213 prepared as in Example 1.3 were diluted to 0.35 mg/mL mRNA aqueous solution with 50 mM citric acid-sodium citrate buffer (pH 3-4).

Preparation of lipid solution: cationic lipid (M5): DOPE: cholesterol: DMG-PEG 2000 was dissolved in absolute ethanol at a molar ratio of 40:15:43.5:1.5 to prepare a 10 mg/mL lipid solution.

Preparation of protamine sulfate solution: Protamine sulfate was dissolved in nuclease-free water to prepare a protamine sulfate solution with a working concentration of 0.2 mg/mL.

Preparation of core nanoparticle solution: Using microfluidic technology, protamine sulfate solution and mRNA solution were mixed to obtain a core nanoparticle solution formed by protamine and mRNA under the following conditions: Volume=4.0mL; Flow rate ratio=3 (mRNA): 1 (protamine solution), Total flow rate=12mL/min, start waste=0.35mL, end waste=0.1mL, room temperature.

Preparation of LPP: The nuclear nanoparticle solution and the lipid solution were mixed twice under the following conditions: Volume=4.0 mL, Flow rate ratio=3 (lipid solution):1 (nuclear nanoparticle solution), Total flow rate= 12mL/min, the former waste=0.35mL, the latter waste=0.1mL, at room temperature, to obtain the LPP-mRNA solution.

Centrifugal ultrafiltration: The LPP-mRNA solution was centrifuged to remove ethanol by ultrafiltration (centrifugation force 3400g, centrifugation time 60min, temperature 4°C), and LPP-mRNA 212 (vaccine 212) and LPP-mRNA 213 (vaccine 213; also known as SW0123 were obtained) .351a) Formulations.

Example 4 Assessment of the ability of candidate mRNA vaccine formulations to induce neutralizing antibodies in mice

C57BL/6 mice (Shanghai Lingchang Biotechnology Co., Ltd.) were immunized with LPP-mRNA 212 (vaccine 212) or LPP-mRNA 213 (vaccine 213) preparations as prepared in Example 3, with 8 mice per group. Mice were immunized on day 0 (primary immunization) and day 14 (secondary immunization) by intramuscular injection, with a single immunization dose of 10 μg mRNA per mouse. The mouse immune serum was collected on the 14th day (ie, the 28th day) after the second immunization, and a commercial wild-type or B.1.351 mutant pseudovirus kit (Beijing Tiantan Pharmaceutical Biotechnology Development Co., Ltd.; wild-type pseudovirus product number) was used. : 80033; B.1.351 variant strain pseudovirus Cat. No. 80044), to evaluate the titer level of neutralizing antibodies in immune serum.

The pseudovirus uses a plasmid expressing wild-type or B.1.351 SARS-CoV-2 S protein instead of a plasmid expressing VSV-G protein, and carries a luciferase reporter gene. When a pseudovirus is used to infect cells that express ACE2 on their surface, the S protein binds to ACE2 to mediate the entry of the pseudovirus into the cell, resulting in the expression of luciferase. The ability of immune serum to inhibit pseudovirus infection of ACE2-expressing cells can be characterized by the rate of inhibition, which can be measured by the luminescence intensity of the luciferase-catalyzed substrate luciferin from a sample of immune serum compared to a positive control (eg, a serum-free control). The percentage of decline is calculated. The S protein used for the wild-type pseudovirus has the amino acid sequence of SEQ ID NO: 1. The S protein for the B.1.351 variant pseudovirus contains the following mutations relative to SEQ ID NO: 1: amino acid substitutions L18F, D80A, D215G, K417N, E484K, N501Y, D614G, and A701V; and deletions of amino acids 242-244.

Briefly, the immune sera from each group were diluted 20, 60, 180, 540, 1620 and 4860-fold; pseudoviruses were added to the diluted immune sera or equal volume of cell culture medium (as a serum-free control) and incubated for 1 hours; then a certain amount of Huh7 cells (a human hepatoma cell line expressing endogenous hACE2; ATCC) was added to the serum-pseudovirus mixture; after 24 hours, the supernatant was discarded, the cells were lysed and luciferin was added; using the enzyme The luminescence intensity (expressed as relative light units (RLU)) was measured by a standard analyzer (Bio-Rad Laboratories), the background RLU of the cell-only control was subtracted from the sample RLU and the inhibition rate was calculated, inhibition rate = [(RLU _{serum-free control} – RLU _{Cell control only} )–(RLU _{immune serum} –RLU _cell _control only)]/(RLU _{serum-free control–} RLU _{cell control only} )×100%; draw the dilution-inhibition rate curve of immune serum in each group, and finally calculate 50% inhibition Corresponding serum dilution ( _ID50 ) at the rate, mean values are shown.

The results of the neutralization assay of immune sera against wild-type and B.1.351 S protein pseudoviruses are shown in Figures 2 and 3, respectively. For both the wild-type and B.1.351 S protein pseudoviruses, the immune sera induced by vaccine 213 showed better neutralization ability than their corresponding vaccine 212-induced immune sera, respectively, indicating that the Furin cleavage site was mutated to " QSAQ" significantly improved vaccine-induced immune responses against wild-type SARS-CoV-2 strains and B.1.351 variants.

Example 5 Heterologous Prime/Boost Immunization Using Inactivated Vaccines and mRNA Vaccines

This study evaluates the potential of heterologous prime/boost immunization (sequential immunization) using inactivated COVID-19 vaccine and mRNA vaccine as a method of preventing and treating SARS-Cov-2 infection.

The inactivated COVID-19 vaccine for priming was developed by the Institute of Medical Biology, Chinese Academy of Medical Sciences (IMBCAMS) and evaluated in a Phase III trial (ClinicalTrial.gov: NCT04659239). The inactivated vaccine has now been approved for marketing in China under the trade name " ^CoweifuTM ". Each dose contains 100 or 150 EU (EU, viral antigen concentration determined by ELISA assay) inactivated viral antigen (SARS-CoV-2 KMS-1 strain (GenBank accession number: MT226610.1) suspended in 0.5 ml buffered saline )) and 0.25 mg of Al(OH) ₃ as an adjuvant (see Pu J, et al. The safety and immunogenicity of an inactivated SARS-CoV-2 vaccine in Chinese adults aged 18-59 years: A phase I randomized, double-blinded, controlled trial. Vaccine. 2021 May 12;39(20):2746-2754., the relevant contents of which are incorporated herein by reference in their entirety). The mRNA vaccine used for the heterologous booster immunization was the SW0123.351a vaccine prepared as in Example 3.

This study has been approved by the local ethics committee of Tongji University Dongfang Hospital in Shanghai, China, and was conducted in accordance with the Declaration of Helsinki Principles. Two subjects were included in the study and gave written informed consent. Subject 1 was male and subject 2 was female, both aged 50-55 years. The two subjects were enrolled in a Phase I clinical trial of an inactivated COVID-19 vaccine (ClinicalTrial.gov: NCT04412538) at 4-week (28-day) intervals (August 17, 2020 and September 10, 2020 ) received two doses of ^CoviforTM (100 EU each). Approximately 7 months after the second inactivated vaccine immunization (April 8, 2021), the two subjects each received a dose of SW0123.351a vaccine (25 μg mRNA) as a booster. Figure 4 shows a schematic diagram of a heterologous prime/boost vaccination schedule.

Before and after booster immunizations, peripheral venous blood was collected in EDTA vacuum tubes or Vacutainer serum tubes (BD) for preparation of peripheral blood mononuclear cell (PBMC) and serum samples, respectively. PBMCs were isolated using Ficoll-Pague PLUS density gradient solution (GE Healthcare). To compare antibody responses, sera collected from 15 convalescent COVID-19 patients were evaluated using the same method. These patients had PCR-confirmed SARS-CoV-2 infection 1-3 months before sample collection.

experimental method

Measurement of bound IgG

Titers of the spike protein in the prefusion conformation (referred to as "prefusion Spike" or "prefusion S") and receptor binding domain (RBD) specific binding IgG were assessed using an enzyme-linked immunosorbent assay (ELISA) . Briefly, antigen prefusion Spike or RBD (Genscript) diluted in coating buffer (Biolegend) was coated in 96-well plates (Greiner Bio-One) at a concentration of 100 ng/well and incubated overnight at 4°C. . The 96-well plate was then washed with PBS containing 0.05% Tween-20 (PBST) and blocked with 2% bovine serum albumin (BSA) for 2 hours at 25°C. Subsequently, serum samples serially diluted in PBST (containing 0.2% BSA) were added to the plate and incubated at 25°C for 2 hours. After washing the plate with PBST, HRP-conjugated sheep anti-human IgG (1:50,000) was added and incubated at 25°C for 1 hour. Finally, TMB substrate was added to develop color, and the absorbance at 450nm was read (subtracted the absorbance at 610nm for correction). Endpoint titers were calculated as emission optical density (OD) values above 2.1 x background. When the background OD value is less than 0.05, it is calculated as 0.05. Measurement of neutralizing antibodies

The pVNT assay was performed as previously reported (Nie J et al. Emerg Microbes Infect 2020; 9:680-6) in which a vesicular stomatitis virus expressing the SARS-CoV-2 spike protein (strain Wuhan-Hu-1) was (VSV) was used to infect Huh7 cells expressing ACE2.

Enzyme-linked immunospot (ELISpot) assay

The frequency of different types of antigen-specific T cells was quantified by ELISpot assay using human IFN-γ, IL-2 or IL-21 ELISpotplus kits (Mabtech, Sweden) according to the manufacturer's instructions. ³ x 105 PBMCs were stimulated with spike protein extracellular domain (S-ECD) (10 [mu]g/ml) for 20 hours prior to assay. Spots were developed with BCIP/NBT substrate solution and counted by Immunospot S6 analyzer (CTL).

Memory B cell analysis

The frequency of Spike-specific memory B cells was assessed by flow cytometry. For probe preparation, biotinylated Spike protein was conjugated to PE or APC-labeled Streptavidin at a molar ratio of 4:1. First, 10 ⁶ PBMCs were incubated with the probes for 20 min at 4°C, and then

The Aqua Fixable Dead Cell Staining Kit (BD) and antibody mixture were stained at 4°C for 20 minutes in the dark. Finally, memory B cells were detected by FACS CantoTM II flow cytometer (BD Biosciences). Data were analyzed using FlowJo V.10.1 (Tree Star). The antibody cocktail contains the following fluorescently labeled antibodies: anti-human CD3 Ab(clone:SP34-2), anti-human CD8 Ab(clone:RPA-T8), anti-human CD14 Ab(clone:M5E2), anti-human CD16 Ab(clone:3G8), anti-human CD20 Ab(clone:2), anti-human IgM Ab(clone:G20-127) and anti-human IgG Ab(clone:G18-145).

result

The magnitude and kinetics of antibody (Ab) responses in two subjects were first assessed. On the day of the booster immunization (day 0), as expected, low Spike-specific IgG levels were detected due to the persistence of the responsiveness generated by the prime immunization with the inactivated vaccine.

Serum samples were collected from subjects before (day 0) and after (

days

7, 14, and 21) booster immunization with the mRNA vaccine SW0123.351a, and binding was detected by ELISA assay and pseudovirus neutralization test (pVNT), respectively Antibody levels and neutralizing antibody levels, the results are shown in Figures 5A and 5B.

The results showed that IgG levels against pre-fusion Spike (Pre-fusion S) and RBD showed a rapid and robust increase after booster immunization (Fig. 5A). IgG levels peaked on day 14, reaching reciprocal titers of 51200 in both subjects. The geometric mean titers (GMT) of bound IgG in convalescent sera from COIVD-19 patients were 7699 (Spike before fusion) and 4032 (RBD), respectively. In other words, on day 14 after booster immunization, the titers of the two binding antibodies were 6.7 and 12.7 times higher, respectively, than the serological levels of recovered patients within 3 months of infection.

Consistent with the significant increase in bound IgG levels, neutralizing antibody (NAb) levels measured by pVNT increased significantly after booster immunization and reached an _IC50 titer of 2457 on day 14 (Figure 5B). The neutralizing antibody _IC50 titer of convalescent sera from COIVD-19 patients was 325. That is, on the 14th day after booster immunization, the neutralizing antibody titer of the subject's serum was 7.6 times higher than that of the convalescent serum.

The phenotype and magnitude of Spike-specific T cells were also analyzed. Before (day 0) and after booster immunization (day 14), peripheral blood mononuclear cells (PBMCs) of subjects were isolated and Spike protein-specific T cells IFN-γ, IL-2 and IL were detected by ELISpot assay -21 secretion, the results are shown in Figure 6.

The results showed that before the booster immunization (day 0), as part of the response to the primed inactivated vaccine, both subjects had low levels of secreted IFN- gamma T cells. After stimulation with the antigen S-ECD protein, T cells secreting IFN-γ or IL-2 increased, indicating that the mRNA vaccine booster significantly activated antigen-specific Th1-type cellular immune responses (Figure 6). In contrast, no or very few IL-4 secreting T cells were detected (data not shown). In addition to this, a strong induction of IL-21 secreting T cells was observed (Figure 6). The presence of IL-21 suggests that T follicular helper (Tfh) cell responses may be responsible for the production of memory B cells and high-quality antibodies by the mRNA vaccine booster (Figures 5A, 5B and 7).

Successful vaccination should elicit strong immune memory that can respond immediately after secondary antigen exposure. Peripheral blood mononuclear cells (PBMCs) were isolated from subjects before (day 0) and after booster immunization (days 0) and after (days 7 and 21), and the levels of Spike-specific memory B cells were measured by flow cytometry, and the results are shown in Figure 7.

The results showed that 7 months after the second dose of the inactivated vaccine (day 0), a small amount of Spike-specific IgG ⁺ memory B cells could still be detected in the blood circulation of both subjects (Figure 7), Indicates the induction and maintenance of antigen-specific memory B cells. After booster immunization (days 7 and 21), the significant increase in specific memory B cells demonstrated further expansion of the Spike-specific memory B cell pool (Figure 7), indicating that a single booster immunization with SW0123.351a can significantly improve memory B cell level.

Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone who is familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, , the protection scope of the present invention should be defined by the claims.

sequence listing

Claims

A vaccine combination comprising a first composition and a second composition, wherein

the first composition comprises an inactivated vaccine; and

The second composition comprises an mRNA vaccine.
The vaccine combination of claim 1, wherein

the first composition comprises an inactivated viral antigen of SARS-CoV-2; and

The second composition comprises mRNA encoding a polypeptide antigen comprising a SARS-CoV-2 spike protein variant with an inactive furin cleavage site; wherein the inactive furin cleaves The site has the amino acid sequence of QSAQ.
The vaccine combination of claim 1 or 2, wherein

the first composition comprises an inactivated viral antigen of the SARS-CoV-2 KMS-1 strain; and

The polypeptide antigen has the amino acid sequence of SEQ ID NO:3.
The vaccine combination of any one of claims 1-3, wherein

The mRNA comprises the nucleotide sequence of SEQ ID NO: 11;

Preferably, the mRNA comprises the nucleotide sequence of SEQ ID NO:13.
The vaccine combination of any one of claims 1-4, wherein

the mRNA comprises modified uridine;

Preferably, 100% of the uridine in the mRNA is replaced by 1-methylpseudouridine.
5. The vaccine combination of any of claims 1-5, wherein the second composition further comprises a cationic polymer associated with the mRNA as a complex, and a lipid particle that encapsulates the complex.
6. The vaccine combination of claim 6, wherein the cationic polymer is protamine.
The vaccine combination of claim 6 or 7, wherein

The lipid particle comprises M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol and DMG-PEG 2000, and the M5 has the following structure:

Preferably, wherein the molar ratio of M5, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol and DMG-PEG 2000 is 40:15:43.5:1.5.
8. The vaccine combination of any of claims 1-8, wherein the first composition is an inactivated whole virus vaccine.
9. The vaccine combination of any of claims 1-9, wherein the first composition further comprises an adjuvant, such as Al(OH) 3 .
A kit comprising a first container and a second container, wherein the first container comprises a first composition as defined in any one of claims 1-3, 9 and 10, the second container comprising A second composition as defined in any of claims 1-8.
Use of the vaccine combination according to any one of claims 1 to 10 in the preparation of a vaccine for the prevention and/or treatment of SARS-CoV-2 infection or induction of SARS-CoV-2 infection in a subject in need thereof 2 immune response.
The vaccine combination of any one of claims 1-10, the kit of claim 11 or the use of claim 12, wherein

(a) administering to a subject in need thereof an effective amount of said first composition in at least one dose; and

(b) then administering to the subject an effective amount of the second composition in at least one dose.
The vaccine combination, kit or use of claim 13, wherein

(a) administering to the subject an effective amount of the first composition in two doses; and

(b) then administering to the subject an effective amount of the second composition in one dose.
The vaccine combination, kit or use of claim 14, wherein said two doses are administered to said subject at an interval of about 1 week to about 8 weeks, preferably at an interval of about 2 weeks to about 6 weeks, More preferably, the subject is administered at intervals of about 4 weeks.
The vaccine combination, kit or use of any one of claims 13-15, wherein within about 5 to about 9 months, preferably within about 7 months after administration of the last dose of the first composition, An effective amount of the second composition is administered to the subject in one dose.