CN115698295B

CN115698295B - Vaccine reagent and inoculation method

Info

Publication number: CN115698295B
Application number: CN202280003504.1A
Authority: CN
Inventors: 李航文; 张爱华; 张育坚; 姚卫国; 林昂; 黄雷
Original assignee: Siwei Shanghai Biotechnology Co ltd
Current assignee: Siwei Shanghai Biotechnology Co ltd
Priority date: 2021-05-04
Filing date: 2022-05-04
Publication date: 2023-05-16
Anticipated expiration: 2042-05-04
Also published as: CN115698295A; WO2022233287A1

Abstract

Vaccine combinations, kits and methods for preventing and/or treating novel coronavirus infections. The combination comprises a first composition and a second composition, wherein the first composition comprises an inactivated vaccine; and the second composition comprises an mRNA vaccine.

Description

Vaccine reagent and inoculation method

The present application claims priority from chinese patent application 202110488951.8 entitled "a vaccine agent and vaccination method", filed on 5/4 of 2021, the contents of which are incorporated herein by reference in their entirety.

Technical Field

The present invention relates to the field of biotechnology, in particular to vaccine combinations, kits and methods for the prevention and/or treatment of novel coronavirus infections.

Background

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) causes a global pandemic. SARS-CoV-2 has the property of high transmissibility and mortality, and can cause severe viral pneumonia and respiratory diseases in infected persons, called "coronavirus disease 2019 (COVID-19)".

Various vaccines against SARS-CoV-2 have been developed, including inactivated viral vaccines, viral vector-based vaccines, recombinant protein vaccines, DNA vaccines and mRNA vaccines. SARS-CoV-2 has high variability, multiple variant strains have been developed, and some of them have shown high immune escape properties, which present new challenges to existing vaccines. There is a need for medicaments and methods for preventing and/or treating coronavirus infections.

CN112043825a discloses a subunit vaccine for preventing novel coronavirus infection in the novel coronavirus spike protein S1 region. The subunit vaccine comprises a novel coronavirus spike protein S1 region antigen and an adjuvant, and is applied for 2-3 times by subcutaneous or intramuscular injection for preventing the novel coronavirus.

CN112546213a discloses a method for preparing a novel coronavirus vaccine, wherein the novel coronavirus vaccine is an inactivated vaccine that is partially split up from the viral membrane to expose the nucleocapsid N antigen, and specifically discloses an inactivated vaccine prepared using KMS1 strain (GenBank accession No. MT 226610.1).

CN111218459a discloses a novel coronavirus vaccine using human type 5 replication defective adenovirus as a vector. The vaccine takes replication defective human adenovirus 5 with combined deletion of E1 and E3 as a vector, HEK293 cells integrating adenovirus E1 genes as a packaging cell line, and the carried protective antigen genes are 2019 novel coronavirus (SARS-CoV-2) S protein genes (Ad 5-nCoV) which are optimally designed.

Disclosure of Invention

In one aspect, the invention provides a vaccine combination comprising a first composition and a second composition, wherein the first composition comprises an inactivated vaccine; and the second composition comprises an mRNA vaccine.

In one embodiment, the first composition comprises an inactivated viral antigen of SARS-CoV-2; and the second composition comprises an mRNA encoding a polypeptide antigen comprising a SARS-CoV-2 spike protein variant having an inactivated furin cleavage site; wherein the inactivated furin cleavage site has the amino acid sequence of QSAQ. In one embodiment, the first composition comprises an inactivated viral antigen of a SARS-CoV-2 KMS-1 strain; and the polypeptide antigen has the amino acid sequence of SEQ ID NO. 3. In one embodiment, the mRNA comprises the nucleotide sequence of SEQ ID NO. 11. In a specific embodiment, the mRNA comprises the nucleotide sequence of SEQ ID NO. 13.

In one embodiment, the mRNA comprises a modified uridine. In a specific embodiment, 100% of uridine in said mRNA is replaced by 1-methyl pseudouridine.

In further embodiments, the second composition further comprises a cationic polymer associated with the mRNA as a complex and a lipid particle encapsulating the complex. In one embodiment, the cationic polymer is protamine.

In a specific embodiment, the lipid particle comprises M5, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000, the M5 having the following structure:

In a preferred embodiment, the molar ratio of M5, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000 is 40:15:43.5:1.5.

In one embodiment, the first composition is an inactivated whole virus vaccine.

In one embodiment, the first composition further comprises an adjuvant. In one embodiment, the adjuvant is Al (OH) ₃ 。

In yet another aspect, the invention provides a kit comprising a first container comprising a first composition as described herein and a second container comprising a second composition as described herein.

The invention also provides the use of the vaccine combination of the invention in the preparation of a vaccine for the prevention and/or treatment of a SARS-CoV-2 infection or for inducing an immune response against SARS-CoV-2 in a subject in need thereof.

Some embodiments of the vaccine combinations, kits, vaccines, uses or methods of the present invention comprise:

(a) Administering an effective amount of the first composition to a subject in need thereof in at least one dose; and is also provided with

(b) An effective amount of the second composition is then administered to the subject in at least one dose.

Further embodiments of the vaccine combinations, kits, vaccines, uses or methods of the present invention comprise:

(a) Administering an effective amount of the first composition to the subject in two doses; and is also provided with

(b) An effective amount of the second composition is then administered to the subject in a dose.

In one embodiment, the two doses are administered to the subject at intervals of about 1 week to about 8 weeks. In a preferred embodiment, the two doses are administered to the subject at intervals of about 2 weeks to about 6 weeks. In a specific embodiment, the two doses are administered to the subject at about 4 week intervals.

In one embodiment, an effective amount of the second composition is administered to the subject in one dose within about 5 to about 9 months after the last dose of the first composition is administered. In one embodiment, an effective amount of the second composition is administered to the subject in one dose within about 7 months after the last dose of the first composition is administered.

Drawings

FIG. 1 shows the results of expression of candidate mRNA in DC2.4 cells analyzed by flow cytometry.

Figure 2 shows the titer levels of neutralizing antibodies against wild-type pseudoviruses in immune serum induced by candidate mRNA vaccine formulations analyzed by pseudovirus neutralization assays. Shown is 50% inhibition dilution (ID ₅₀ ) Titer, mean ± SEM, n=8.

FIG. 3 shows the level of neutralizing antibodies against pseudovirus of the B.1.351 variant in immune serum induced by candidate mRNA vaccine formulations analyzed by the pseudovirus neutralization assay. Shown is 50% inhibition dilution (ID ₅₀ ) Titer, mean ± SEM, n=8.

Figure 4 shows a schematic of a heterologous prime/boost vaccination regimen using inactivated and mRNA vaccines.

Figure 5A shows antigen (Pre-fusion Spike (Pre-fusion S) or RBD) specific binding IgG levels in the serum of subjects measured by ELISA before (day 0) and after (days 7, 14 and 21) mRNA vaccine boost immunization. As a comparison, antigen-specific binding IgG levels in convalescent serum of covd-19 patients were also analyzed. Reciprocal antibody titers are shown. Filled circles, subject serum; triangle, convalescence serum. D0, day 0; d7, day 7; d14, day 14; d21, day 21.

Fig. 5B shows neutralizing antibody levels in the serum of subjects measured by the pseudovirus neutralization test (pnnt) before (day 0) and after (days 7, 14 and 21) mRNA vaccine booster immunization. As a comparison, the level of neutralizing antibodies in convalescent serum of covd-19 patients was also analyzed. Shown is 50% inhibition concentration (IC ₅₀ ) Titer. Filled circles, subject serum; triangle, convalescence serum. D0, day 0; d7, day 7; d14, day 14; d21, day 21.

FIG. 6 shows the resistance in subjects analyzed by ELISPot before (day 0) and after (day 14) mRNA vaccine booster immunizationA primordial specific T cell response. Isolated PBMC were stimulated with S-ECD protein at a concentration of 10. Mu.g/ml for 20 hours, then the frequency of IFN-. Gamma.secreting, IL-2 or IL-21 secreting T cells was assessed by ELISPot and counted as Spot Forming Cells (SFC)/10 ⁶ PBMCs were used. D0, day 0; d14, day 14.

FIG. 7 shows Spike specific IgG in subjects analyzed by flow cytometry before (day 0) and after (days 7 and 21) mRNA vaccine booster immunization ⁺ Frequency of Memory B Cells (MBCs). Cell in CD20 ⁺ IgD ^- IgM ^- Class switching B cells. D0, day 0; d7, day 7; d21, day 21.

Detailed Description

General terms and definitions

All patents, patent applications, scientific publications, manufacturer's instructions and guidelines, and the like, cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the disclosure is not entitled to antedate such disclosure.

Unless otherwise defined, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Also, the terms related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, as used herein, are terms that are widely used in the relevant art (see, e.g., molecular Cloning: A Laboratory Manual, 2) ^nd Edition, j. Sambrook et al eds., cold Spring Harbor Laboratory Press, cold Spring Harbor 1989). Meanwhile, in order to better understand the present invention, definitions and explanations of related terms are provided below.

As used herein, the terms "comprises," "comprising," "includes," "including," "having" and "containing" are open-ended, meaning the inclusion of the stated elements, steps or components, but not the exclusion of other non-recited elements, steps or components. The expression "consisting of … …" does not include any elements, steps or components not specified. The expression "consisting essentially of … …" means that the scope is limited to the specified elements, steps, or components, plus any optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of … …" and "consisting of … …" are encompassed within the meaning of the expression "comprising".

As used herein, the singular forms "a," "an," or "the" include plural referents unless the context clearly dictates otherwise. The term "one or more" or "at least one" encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9 or more.

Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. Unless specifically indicated to the contrary, the numerical values or ranges set forth herein are modified by "about" to mean the enumerated or claimed values or ranges are + -20%, + -10%, + -5%, or + -3%.

All methods described herein can be performed in any suitable order unless otherwise indicated.

As used herein, the term "polypeptide" refers to a polymer comprising two or more amino acids covalently linked by peptide bonds. A "protein" may comprise one or more polypeptides, wherein the polypeptides interact with each other by covalent or non-covalent means. Unless otherwise indicated, "polypeptide" and "protein" may be used interchangeably.

As used herein, a "variant" of a reference polypeptide refers to a polypeptide that differs from the reference polypeptide by at least one amino acid modification. The reference polypeptide may be naturally occurring or may be a modified form of the wild-type polypeptide. In this context, "polypeptide variants" and "mutant polypeptides" have the same meaning. The polypeptide variants may be, for example, mutants, post-translational modification variants, isoforms, species variants, species homologs, and the like. Polypeptide variants may be prepared by recombinant DNA techniques, for example, by modification of known amino acid sequences by altering the coding sequence. Polypeptide variants may also be prepared by chemical synthesis or enzymatic methods. According to the invention, the S protein variant may have an ability to induce an immune response comparable to or higher than that of a wild-type S protein, e.g.the S protein of the wild-type S protein (original virus strain Wuhan-Hu-1 (Genbank accession number: MN 908947.3), exemplary amino acid sequences being shown in SEQ ID NO: 1), i.e.exhibit an immunogenicity comparable to or enhanced by the wild-type S protein.

As used herein, modifications to an amino acid sequence may include, for example, amino acid substitutions, additions, and/or deletions. "amino acid addition" refers to the addition of one or more amino acids to an amino acid sequence. Amino acid additions may occur anywhere in the amino acid sequence, including, but not limited to, the middle, amino-terminal, and/or carboxy-terminal of the amino acid sequence. Amino acid additions that occur in the middle of an amino acid sequence may also be referred to as "amino acid insertions". "amino acid deletion" refers to the removal of one or more amino acids from an amino acid sequence. Amino acid deletions may occur anywhere in the amino acid sequence. Amino acid deletions occurring at the N and/or C termini may also be referred to as truncations. Truncated variants may also be referred to as "fragments". "amino acid substitution" refers to the replacement of an amino acid residue at a particular amino acid position with another amino acid residue. Herein, "amino acid modification" may also be referred to as "mutation".

As used herein, the correspondence between amino acid sequences or portions of amino acid sequences (e.g., subunits, domains, or subdomains) or the correspondence between specified amino acid positions of a reference polypeptide and another polypeptide can be determined by optimally aligning the amino acid sequences of the two polypeptides (e.g., as described herein). Herein, "a polypeptide variant comprises an amino acid substitution at amino acid N corresponding to a reference polypeptide" or "a polypeptide variant comprises an amino acid substitution as compared to a reference polypeptide" means that the polypeptide variant comprises a different amino acid than the reference polypeptide at amino acid position N corresponding to the reference polypeptide, but no limitation is placed on the amino acids at other positions of the polypeptide variant, i.e., the amino acids at other positions may be the same or different from the amino acids at the corresponding positions of the reference polypeptide. Similarly, the amino acid of a "polypeptide variant" at a position corresponding to amino acid N of a reference polypeptide is X _aa ", only indicates the amino group of the polypeptide variant at amino acid position N corresponding to the reference polypeptideThe acid is X _aa However, amino acids at other positions of the polypeptide variant are not limited.

As used herein, the term "% identity" or "percent identity" with respect to sequences refers to the percentage of nucleotides or amino acids that are identical in the optimal alignment between the sequences to be compared. The difference between the two sequences may be distributed over a local area (section) or the entire length of the sequences to be compared. Typically, the percent identity between two sequences is determined after optimal alignment of the segments or "comparison windows". The optimal alignment may be performed manually or by means of algorithms known in the art, including but not limited to the local homology algorithms described in Smith and Waterman,1981,Ads App.Math.2,482 and Neddleman and Wunsch,1970, j.mol. Biol.48,443, the similarity search method described in Pearson and Lipman,1988,Proc.Natl Acad.Sci.USA 88,2444, or using computer programs such as GAP, BESTFIT, FASTA, BLAST P, BLAST N and tfast a in Wisconsin Genetics Software Package, genetics Computer Group,575Science Drive,Madison,Wis. For example, the percent identity of two sequences may be determined using the BLASTN or BLASTP algorithm commonly available at the National Center for Biotechnology Information (NCBI) website.

The percent identity is obtained by determining the number of identical positions corresponding to the sequences to be compared, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100. In some embodiments, the degree of identity is given to a region of at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the entire length of the reference sequence. In some embodiments, the degree of identity is given to the entire length of the reference sequence. Alignment for determining sequence identity can be performed using tools known in the art, preferably using optimal sequence alignment, e.g., using Align, using standard settings, preferably EMBOSS:: needle, matrix: blosum62, gap Open 10.0, gap extension 0.5.

Herein, "nucleotide" includes deoxyribonucleotides and ribonucleotides and derivatives thereof. As used herein, "ribonucleotide" refers to a nucleotide that has a hydroxy group at the 2' -position of the β -D-ribofuranosyl group. "nucleotide" is generally referred to by the single letter representing the base therein: "A (a)" means deoxyadenylate or adenylate, "C (C)" means deoxycytidylate or cytidylate, "G (C)" means deoxyguanylate or guanylate, "U (U)" means uridylate, "T (T)" means deoxythymidylate.

As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA). "Polynucleotide sequence", "nucleic acid sequence" and "nucleotide sequence" are used interchangeably to refer to the ordering of nucleotides in a polynucleotide.

As used herein, "codon" refers to three consecutive nucleotide sequences (also known as triplet codes) in a polynucleotide that encode a particular amino acid. Synonymous codons (codons encoding the same amino acid) are used differently in different species, termed "codon bias". It is generally believed that for a given species, coding sequences using codons that are favored by it can have higher translational efficiency and accuracy in the expression system of that species. Thus, a polynucleotide may be "codon optimized," i.e., codons in the polynucleotide are altered to reflect codons favored by the host cell, preferably without altering the amino acid sequence it encodes. A polynucleotide (e.g., mRNA) may comprise codons optimized for the host (e.g., subject, particularly human) cell such that it is optimally expressed in the host (e.g., subject, particularly human).

As used herein, the term "vector" refers to a vehicle for introducing nucleic acid into a host cell. Vectors may include expression vectors and cloning vectors. Generally, expression vectors contain the desired coding sequence and appropriate DNA sequences necessary for expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect or mammal) or in an in vitro expression system. Cloning vectors are generally used to engineer (perform recombinant DNA procedures) and amplify desired DNA fragments and may lack the functional sequences required to express the desired DNA sequences. Examples of vectors include, but are not limited to, plasmid, cosmid, phage (e.g., lambda phage) vectors, viral vectors (e.g., retroviral, adenoviral, or baculovirus vectors), or artificial chromosome (e.g., bacterial Artificial Chromosome (BAC), yeast Artificial Chromosome (YAC), or P1 Artificial Chromosome (PAC)) vectors.

As used herein, the term "expression" includes transcription and/or translation of a nucleotide sequence. Thus, expression may involve the production of transcripts and/or polypeptides. The term "transcription" relates to the process of transcribing the genetic code in a DNA sequence into RNA (transcript). The term "In vitro transcription" refers to the synthesis of RNA, in particular mRNA, in vitro In a cell-free system (e.g. In a suitable cell extract) (see e.g. Pardi n., muramatsu h., weissman d., karik et al (2013): in: rabinovich p. (eds) Synthetic Messenger RNA and Cell Metabolism modules In Molecular Biology (Methods and Protocols), vol 969.Humana Press,Totowa,NJ). The term "transcription" encompasses "in vitro transcription".

As used herein, "isolated" refers to a substance (e.g., a polynucleotide or polypeptide) that is separate from the source or environment in which it is present. The isolated polynucleotide or polypeptide may be present in a substantially pure form (e.g., in a composition), or may be present in a non-natural environment, e.g., a host cell. The mRNA as described herein may be isolated.

The term "naturally occurring" refers to the fact that an object may be found in nature. For example, polypeptides or polynucleotides that are present in organisms (including viruses) and that can be isolated from natural sources and that have not been intentionally modified by man in the laboratory are naturally occurring.

As used herein, the term "immunogenic" refers to being able to generate an immune response against an antigen in a host animal. The immune response forms the basis of protective immunity elicited by vaccines against specific infectious organisms.

As used herein, the term "recombinant" means produced by "genetic engineering. In general, recombinant molecules (e.g., recombinant proteins and recombinant nucleic acids) are non-naturally occurring. The mRNA as described herein may be a recombinant molecule.

The term "expressed on the cell surface" means that a molecule, such as an antigen, correlates with and is located on the plasma membrane of a cell, with at least a portion of the molecule facing the extracellular space and being accessible from the outside of the cell, e.g., by an antibody located outside the cell. In some embodiments, a polypeptide comprising a furin cleavage site inactivated as described herein is expressed at a higher level on the surface of a host cell than an S protein comprising an active furin cleavage site (e.g., a furin cleavage site having the amino acid sequence RRAR).

As used herein, the term "binding antibody" refers to an antibody or fragment thereof that is capable of recognizing and binding to a particular antigen. As used herein, the term "neutralizing antibody (NAb)" refers to an antibody or fragment thereof that is capable of neutralizing, i.e., preventing, inhibiting, reducing, or interfering with the ability of a pathogen to initiate and/or maintain an infection in a host (e.g., host organism or host cell). According to the invention, a binding or neutralizing antibody to SARS-CoV-2S protein or fragment thereof can be produced in a subject vaccinated with the vaccine compositions described herein, e.g., in the immune serum of the subject. The titer level of bound or neutralizing antibodies in immune serum can be measured using methods known in the art.

The term "antigen" refers to a substance comprising an epitope therein against which an immune response may be generated. In particular embodiments, the antigen may bind to a T cell epitope or T or B cell receptor, or to an immunoglobulin, such as an antibody.

In this context, "polypeptide antigen" refers to a polypeptide that is an antigen, including but not limited to the polypeptide antigen itself or processed products thereof (e.g., antigens that are processed and presented in vivo). According to the invention, the polypeptide encoded by the mRNA described herein, or a processed product thereof, may be a polypeptide antigen and induce an immune response as an antigen in a vaccine.

The term "transfection" relates to the introduction of a polynucleotide into a host cell. Host cells used to transfect the polynucleotides described herein may be present in vitro or in vivo. In some embodiments, the host cell may be a cell of a subject (particularly a patient, e.g., a patient infected with a novel coronavirus). Transfection may be transient or stable. In general, transient transfection does not involve integration into the host cell genome. Stable transfection may be achieved by transfection using viral or transposon based systems.

Coronavirus

As used herein, "severe acute respiratory syndrome coronavirus 2," "novel coronavirus," and "SARS-CoV-2" may be used interchangeably. SARS-CoV-2 is known to be the causative agent of "coronavirus disease 2019 (COVID-19)".

SARS-CoV-2 is a plus-sense single-stranded RNA ((+) ssRNA) enveloped virus belonging to the genus beta of the family Coronaviridae. SARS-CoV-2 encodes 4 structural proteins: spike protein (S), envelope protein (E), membrane protein (M) and nucleocapsid protein (N). Among them, spike protein (S protein) mediates specific binding of virus to host cells and fusion of viral envelope with host cell membrane, and is thus a key molecule for virus infection of host cells.

As used herein, "SARS-CoV-2 spike protein", "spike", "SARS-CoV-2S protein" or "S protein" refers to a spike protein of SARS-CoV-2. SARS-CoV-2S protein is synthesized as a glycoprotein having about 1273-1300 amino acids (an exemplary amino acid sequence is shown in SEQ ID NO: 1) that comprises an N-terminal signal peptide, an S1 subunit and an S2 subunit. The S1 subunit comprises an N-terminal domain, a Receptor Binding Domain (RBD) and subdomains 1 and 2 (SD 1/2). The S2 subunit comprises Fusion Peptides (FP), heptad repeats HR1 and HR2, a transmembrane domain, and a cytoplasmic domain. For a description of SARS-CoV-2S protein see, e.g., huang Y et al, acta Pharmacol sin.2020;41 (9):1141-1149.

Studies have shown that RBD of the S1 subunit recognizes target host cells by binding to the specific receptor angiotensin converting enzyme 2 (ACE 2), whereas the S2 subunit is responsible for membrane fusion. In the natural state, the S protein exists on the virus surface in a metastable pre-fusion trimer conformation. During infection, RBD binds to host cell receptors and host protease (e.g., furin) cleaves S1/S2 cleavage of S proteinCleavage sites disrupt the stability of the pre-fusion trimer, leading to shedding of the S1 subunit and conversion of the S2 subunit into a stable conformation after fusion. The Furin cleavage site is an exposed cyclic structure containing multiple arginine residues comprising the amino acid motif Arg-X _aa -X _bb -Arg (wherein X _aa Is any amino acid; x is X _bb Any amino acid, preferably Arg or Lys. The amino acid sequence of the Furin cleavage site in the S protein is Arg-Arg-Ala-Arg ("RRAR") corresponding to amino acids 682-685 of SEQ ID NO. 1.

Vaccine combinations

In a general aspect, the present invention provides a vaccine combination comprising a first composition and a second composition, wherein the first composition comprises an inactivated vaccine; and the second composition comprises an mRNA vaccine.

Herein, a "vaccine" may include one or more vaccine compositions. In some embodiments, the vaccine may also be referred to as a "vaccine agent" or "vaccine combination". As used herein, the term "vaccine composition" refers to a composition comprising an antigen that, when vaccinated into a subject, induces an immune response sufficient to prevent and/or reduce at least one symptom associated with a pathogen or disease infection. Antigens in a vaccine composition can include, for example, polypeptide antigens, polynucleotides expressing polypeptide antigens (including but not limited to RNA (e.g., mRNA) and DNA), inactivated or inactivated viral antigens, or combinations thereof. Thus, the composition in the vaccine combinations herein may also be referred to as a vaccine composition, e.g. a first vaccine composition, a second vaccine composition.

It will be appreciated by those skilled in the art that the vaccine combinations, vaccine agents or different components of the vaccine described herein, e.g. the first composition, the second composition or the inactivated vaccine agent and the mRNA vaccine agent, may be contained in the same or different compositions or packages for simultaneous or separate administration, preferably separately and at intervals.

The vaccine composition may further comprise a vehicle, adjuvant and/or excipient. Saline or distilled water may be used as a vehicle. As used herein, the term "adjuvant" refers to a substance capable of promoting, extending and/or enhancing an immune response. Examples of adjuvants include, but are not limited to: oil emulsions (e.g., freund's adjuvant), aluminum hydroxide, mineral oil, bacterial products (e.g., pertussis toxin). Non-limiting examples of excipients include aluminum phosphate, aluminum hydroxide, and aluminum potassium sulfate.

The vaccine composition is preferably administered parenterally. As used herein, the term "parenteral administration" refers to administration in any manner other than by the gastrointestinal tract. In some embodiments, the vaccine compositions as described herein are administered nasally, intravenously, subcutaneously, intradermally, or intramuscularly. In a preferred embodiment, the vaccine composition as described herein is administered by subcutaneous, intradermal or intramuscular injection.

The first and second compositions as described herein may be used as a vaccine or vaccine composition for inducing an immune response against SARS-CoV-2 in a subject or preventing and/or treating a SARS-CoV-2 infection in a subject in need thereof.

Second composition

In a general aspect, the present invention relates to a second composition for providing an antigen comprising an mRNA encoding a polypeptide antigen comprising a SARS-CoV-2 spike protein variant having an inactivated furin cleavage site, wherein the inactivated furin cleavage site has the amino acid sequence of QSAQ. In one embodiment, the polypeptide antigen has the amino acid sequence of SEQ ID NO. 3.

As used herein, an "inactivated Furin (Furin) cleavage site" refers to an amino acid sequence that is not recognized and cleaved by Furin. As used herein, an "active furin cleavage site" or "furin cleavage site" refers to an amino acid sequence capable of being recognized and cleaved by furin. The mRNA encoded polypeptide antigen described herein comprises an inactivated Furin cleavage site Gln-Ser-Ala-Gln (QSAQ) to have a higher expression level in the host cell and/or to induce a stronger immune response in the subject.

In some embodiments, the second composition as described herein may also be referred to as an "mRNA vaccine" or "mRNA vaccine reagent". As used herein, "mRNA" refers to messenger RNA. In general, mRNA can comprise a 5'utr sequence, a coding sequence for a polypeptide, a 3' utr sequence, and optionally a poly (a) sequence. mRNA can be produced, for example, by in vitro transcription, recombinant production or chemical synthesis. The mRNA can be in vitro transcribed RNA (IVT-RNA). IVT-RNA can be obtained by in vitro transcription with a DNA template by RNA polymerase (e.g., as described herein).

As used herein, "coding sequence" refers to a nucleotide sequence in a polynucleotide that can be used as a template for synthesis of a polypeptide having a defined nucleotide sequence (e.g., tRNA and mRNA) or a defined amino acid sequence in a biological process. The coding sequence may be a DNA sequence or an RNA sequence.

The mRNA comprises a nucleotide sequence encoding a polypeptide antigen as described herein. In a specific embodiment, the mRNA comprises the nucleotide sequence of SEQ ID NO. 11. In another specific embodiment, the mRNA encodes a polypeptide having the amino acid sequence of SEQ ID NO. 3 and comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO. 11.

In further embodiments, the mRNA further comprises structural elements that help to improve stability and/or translation efficiency of the RNA, including, but not limited to, 5' caps, 5' utrs, 3' utrs, and poly (a) sequences.

As used herein, the term "5' cap" generally relates to an N7-methylguanosine structure (also known as "m" or ⁷ G cap "," m ⁷ Gppp- ". The 5' cap may be co-transcribed into the RNA in vitro transcription (e.g., using an anti-reverse cap analogue "ARCA") or may be post-transcriptionally linked to the RNA using a capping enzyme. In some embodiments, cap analogs are used to generate 5' cap modified RNAs. For a description of "cap analogues" see, for example, contreeas, R.et al (1982) Nucl. Acids Res. 10,6353-6363 and US7074596B2. Examples of cap analogs include, but are not limited to, N7-methylguanosine-5 '-triphosphate-5' guanosine (m) ⁷ G(5’)ppp(5’) G), N7-methylguanosine-5 '-triphosphate-5' -adenosine (m) ⁷ G (5 ') ppp (5 ') A) and 3' -O-Me-m ⁷ G (5 ') ppp (5') G (ARCA). The mRNA may be an mRNA comprising the structure of Cap0 (no methylation of ribose of adjacent nucleotides of m 7G), cap1 (methylation of ribose of adjacent nucleotides of m 7G), or Cap2 (methylation of ribose of a second nucleotide downstream of m 7G).

As used herein, the term "untranslated region (UTR)" generally refers to a region in RNA (e.g., mRNA) that is not translated into an amino acid sequence (non-coding region), or a corresponding region in DNA. In general, a UTR located 5' (upstream) of an open reading frame (start codon) may be referred to as a 5' untranslated region (5 ' UTR); the UTR located 3' (downstream) of the open reading frame (stop codon) may be referred to as the 3' untranslated region (3 ' UTR). In the presence of a 5 'cap, the 5' UTR is located downstream of the 5 'cap, e.g., immediately adjacent to the 5' cap. In particular embodiments, an optimized "Kozak sequence" may be included in the 5' utr, e.g., adjacent to the start codon, to increase translation efficiency. Preferably, the "3' UTR" does not comprise a poly (A) sequence. In the presence of a poly (A) sequence, the 3' UTR is located upstream of the poly (A) sequence, e.g., immediately adjacent to the poly (A) sequence.

As used herein, the term "poly (a) sequence" or "poly (a) tail" refers to a nucleotide sequence comprising continuous or discontinuous adenylates. The poly (A) sequence is typically located at the 3' end of the RNA, e.g., 3' end (downstream) of the 3' UTR. In some embodiments, the poly (a) sequence does not comprise nucleotides other than adenylate at its 3' end. Poly (A) sequences may be transcribed from the coding sequence of the DNA template by a DNA-dependent RNA polymerase during the preparation of IVT-RNA or may be linked to the free 3' end of the IVT-RNA, e.g.the 3' end of the 3' UTR, by a DNA-independent RNA polymerase (Poly (A) polymerase).

In one embodiment, the poly (A) sequence comprises contiguous adenylates. In one embodiment, the poly (a) sequence can comprise at least 20, 30, 40, 50, 60, 70, 80, or 100 and up to 120, 150, 180, 200, or 300 adenylates. In one embodiment, the contiguous adenylate sequence in the poly (a) sequence is interrupted by a sequence comprising U, C or G nucleotides.

In one embodiment, an mRNA as described herein comprises (1) a 5' cap; (2) 5' UTR; (3) A nucleotide sequence encoding a polypeptide antigen comprising a SARS-CoV-2 spike protein variant having an inactivated furin cleavage site, wherein the inactivated furin cleavage site has the amino acid sequence of QSAQ; (4) 3' UTR; and (5) a poly (A) sequence. In one embodiment, the 5' UTR comprises the nucleotide sequence of SEQ ID NO. 7. In one embodiment, the nucleotide sequence encoding the polypeptide antigen comprises the nucleotide sequence of SEQ ID NO. 11. In one embodiment, the 3' UTR comprises the nucleotide sequence of SEQ ID NO. 8. In one embodiment, the poly (A) sequence comprises the nucleotide sequence of SEQ ID NO. 9. In a specific embodiment, the mRNA comprises the nucleotide sequence of SEQ ID NO. 13.

The mRNA as described herein may be a nucleoside modified mRNA. In one embodiment, the mRNA is modified by replacing one or more uridine with a modified uridine. Examples of modified uridine may include, but are not limited to: 1-methyluridine, 1-methyl-pseudouridine, 3-methyl-uridine, 3-methyl-pseudouridine, 2-methoxy-uridine, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurine methyl-uridine, 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uridine, 1-taurine methyl-4-thio-pseudouridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5, 6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 3- (3-amino-3-carboxypropyl) uridine, 5- (isocyanatomethyl) uridine, 5- (2-thio) -methyl-1-deaza-uridine, 2 '-methyl-2' -thio-amino-2 '-methyl-2' -thio-2 '-O-methyl-2' -thio-uridine, 2 '-O-methyl-2' -O-thio-uridine, O-methyl-2 '-O-thio-2' -O-methyl-uridine, 5-methoxycarbonylmethyl-2 ' -O-methyl-uridine, 5-carbamoylmethyl-2 ' -O-methyl-uridine, 5-carboxymethylaminomethyl-2 ' -O-methyl-uridine, 3,2' -O-dimethyl-uridine, 5- (isopentenylaminomethyl) -2' -O-methyl-uridine, 1-thio-uridine, 5- (2-methoxycarbonylvinyl) uridine and 5- [3- (1-E-propenyl amino) uridine.

In a specific embodiment, 100% of uridine in said mRNA is replaced by 1-methyl pseudouridine. In one embodiment, the mRNA comprises the nucleotide sequence of SEQ ID NO. 13, wherein 100% of the uridine is replaced by 1-methyl pseudouridine.

According to some embodiments of the invention, the second composition as described herein is a lipid multimeric complex (LPP). As used herein, "lipid multimeric complex" or "LPP" refers to a core-shell structure comprising a nucleic acid core, comprising a nucleic acid (e.g., mRNA) associated with a polymer, encapsulated by a lipid outer shell (particle). In some embodiments, the second composition comprises an mRNA as described herein, a cationic polymer associated with the mRNA as a complex, and a lipid particle encapsulating the complex.

As used herein, the term "cationic polymer" refers to any ionic polymer capable of carrying a net positive charge at a specified pH to electrostatically bind nucleic acids. Examples of cationic polymers include, but are not limited to: poly-L-lysine, protamine and Polyethylenimine (PEI). The polyethyleneimine may be a linear or branched polyethyleneimine. As used herein, the term "protamine" refers to arginine-rich low molecular weight basic proteins that are present in sperm cells of various animals (particularly fish) and bind to DNA in place of histones. In a preferred embodiment, the cationic polymer is protamine (e.g., protamine sulfate).

Lipids used to form the lipid particles may include ionizable cationic lipids, phospholipids and steroid-modified lipids.

The ionizable cationic lipid carries a net positive charge at, for example, an acidic pH, and is neutral at a higher pH (e.g., physiological pH). Examples of ionizable cationic lipids include, but are not limited to: dioctadecyl amidoglycyl spermine (dioctadecylamidoglycyl spermine, DOGS), N4-cholesteryl-spermine (N4-cholesteryl-spermine), 2-dioleyl-4- (2-dimethylaminoethyl) - [1,3] -dioxolane (2, 2-dioleyl-4- (2-dimethylminethyl) - [1,3] -dioleyl, DLin-KC 2-DMA), triacontanyl-6,9,28,31-tetraen-19-yl-4- (dimethylamino) butanoate (hepatriacta-6,9,28,31-tetraen-19-yl-4- (dimethylamino) butanoate, DLin-MC 3-DMA), heptadec-9-yl-8- ((2-hydroxyethyl) (6-oxo-6- ((decyloxy) hexyl) amino) (ptecan-9-yl-8- ((2-hydroxy-6- (dimethylamino) butanoate) (6-1-dioxa-6-1-hydroxy) 1-dicarboxyl-4- (dimethylamino) butanoate, ((1, 6-dioxa-2-dioxa) 2-hydroxy-6-dicarboxyl) butanoate. In one embodiment, the ionizable cationic lipid comprises M5 having the structure:

Examples of phospholipids include, but are not limited to: 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1-palmitoyl-2-oleoyl-phosphoethanolamine (POPE), distearoyl-phospholipidylcholine (DSPC), distearoyl-phospholipidyl-phosphoethanolamine (DSPE), dioleoyl-phospholipidylcholine (DOPC), dimyristoyl-phospholipidylcholine (DMPC), DPPC), ditolylphosphoryl phosphatidylcholine (DAPC), ditolylphosphoryl phosphatidylcholine (DBPC), ditridecylphospholipid line (DTPC), ditetradecylphospholipid Line (DLPC), palmitoyl-phosphatidylcholine (POPC), ditolyl-phosphatidylethanolamine (DPPE), ditolyl-phosphatidylethanolamine (DLPE).

Examples of steroids include, but are not limited to, for example, cholesterol, cholestanol, cholestanone, cholestenone, cholestyl-2 '-hydroxyethyl ether, cholestyl-4' -hydroxybutyl ether, tocopherol, and derivatives thereof.

As used herein, the term "polyethylene glycol modified lipid" refers to a molecule comprising a polyethylene glycol moiety and a lipid moiety. Examples of polyethylene glycol modified lipids include, but are not limited to: 1, 2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol (1, 2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol, DMG-PEG), 1,2-Dioleoyl-rac-glycerol, methoxy-polyethylene glycol (1, 2-Dioleoyl-rac-glycerol, methoxypolyethylene Glycol, dog eg)), and 1, 2-Distearoyl-sn-glycerol-3-phosphoethanolamine-poly (ethylene glycol) (1, 2-Distearoyl-sn-glycerol-3-phosphoethanolamine-Poly (ethylene glycol), DSPE-PEG). In one embodiment, the polyethylene glycol modified lipid is DMG-PEG, such as DMG-PEG 2000. In one embodiment, the DMG-PEG 2000 has the following structure:

wherein n has an average value of 44.

In one embodiment, the lipid particle comprises: (1) M5; (2) 1, 2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE); (3) cholesterol; and (4) DMG-PEG 2000; wherein said M5 has the structure:

In a specific embodiment, the molar ratio of M5, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000 is 40:15:43.5:1.5.

In a specific embodiment, the second composition comprises an mRNA having the nucleotide sequence of SEQ ID No. 13, protamine associated with the mRNA as a complex, and a lipid particle encapsulating the complex, wherein the lipid particle comprises: (1) M5; (2) 1, 2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE); (3) cholesterol; and (4) DMG-PEG 2000; wherein said M5 has the structure:

in a specific embodiment, the lipid particle comprises M5, 1, 2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE), cholesterol, and DMG-PEG 2000 in a molar ratio of 40:15:43.5:1.5, wherein the M5 has the following structure:

first composition

In another general aspect, the present invention is directed to a first composition for providing an antigen comprising an inactivated viral antigen of SARS-CoV-2. In some embodiments, the first composition as described herein may also be referred to as a SARS-CoV-2 inactivated vaccine or a COVID-19 inactivated vaccine. As used herein, the term "inactivated vaccine" refers to a vaccine composition containing an infectious organism or pathogen that is no longer capable of replication or growth. Inactivation can be accomplished by a variety of methods, including freeze thawing, chemical treatment (e.g., treatment with formalin or beta-propiolactone), sonication, radiation, heating, or any other conventional means sufficient to prevent replication or growth of the organism while maintaining its immunogenicity. Examples of inactivated vaccines include inactivated whole virus vaccines and split vaccines. In some embodiments, the first composition is an inactivated whole virus vaccine.

In one embodiment, the first composition comprises an inactivated viral antigen of SARS-CoV-2 KMS-1 strain (GenBank accession number: MT 226610.1). In one embodiment, the first composition further comprises an adjuvant. In a specific embodiment, the adjuvant is Al (OH) ₃ 。

In a specific embodiment, the first composition comprises an inactivated viral antigen of SARS-CoV-2 KMS-1 strain (GenBank accession number: MT 226610.1) and Al (OH) as an adjuvant ₃ . In a specific embodiment, the first composition is covifer ^TM . In one embodiment, each dose of the Kevefu ^TM SARS-CoV-2 KMS-1 strain (GenBank accession number: MT 226610.1) inactivated virus comprising 100 or 150EU (EU, virus antigen concentration determined by ELISA) suspended in 0.5ml of buffered saline, 0.25mg of Al (OH) ₃ . Venfu of SARS-CoV-2 inactivated vaccine ^TM See also PuJ, et al, the safety and immunogenicity of an inactivated SARS-CoV-2vaccine in Chinese adults aged 18-59years:A phase I randomized,double-blind, controlled trial. Vaccine.2021 May 12;39 (20) 2746-2754, the relevant content of which is incorporated herein by reference in its entirety.

In one embodiment, the vaccine combination of the invention comprises a first composition and a second composition, wherein the first composition comprises an inactivated viral antigen of SARS-CoV-2; and the second composition comprises an mRNA encoding a polypeptide antigen, wherein the polypeptide antigen has the amino acid sequence of SEQ ID NO. 3. In a specific embodiment, the second composition comprises an mRNA having the nucleotide sequence of SEQ ID NO. 13. In a preferred embodiment, the mRNA comprises a modified uridine. In a specific embodiment, 100% of uridine in said mRNA is replaced by 1-methyl pseudouridine.

In one embodiment, the second composition further comprises a cationic polymer associated with the mRNA as a complex and a lipid particle encapsulating the complex. In a specific embodiment, the cationic polymer is protamine.

In one embodiment, the first composition comprises an inactivated viral antigen of a SARS-CoV-2 KMS-1 strain. In a further embodiment, the first composition comprises an inactivated viral antigen of SARS-CoV-2 KMS-1 strain and Al (OH) ₃ . In a specific embodiment, the first composition is covifer ^TM 。

In one embodiment, the vaccine combination of the invention comprises a first composition and a second composition, wherein the first composition comprises an inactivated viral antigen of a SARS-CoV-2 KMS-1 strain; and the second composition comprises an mRNA having the nucleotide sequence of SEQ ID NO. 13, a cationic polymer associated with the mRNA as a complex, and a lipid particle encapsulating the complex.

In a specific embodiment, the vaccine composition of the present invention comprises a first composition and a second composition, wherein the first composition comprises an inactivated viral antigen of SARS-CoV-2 KMS-1 strain and Al (OH) ₃ The method comprises the steps of carrying out a first treatment on the surface of the And the second composition comprises an mRNA having the nucleotide sequence of SEQ ID No. 13, protamine associated with the mRNA as a complex, and a lipid particle encapsulating the complex, wherein the lipid particle comprises: (1) M5; (2) 1, 2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE); (3) cholesterol; and (4) DMG-PEG 2000; wherein said M5 has the structure:

and wherein the mRNA optionally comprises a modified uridine. In a specific embodiment, 100% of the uridine of said mRNA is replaced by 1-methyl pseudouridine. In a further embodiment, M5, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine DOPE), cholesterol and DMG-PEG 2000 at a molar ratio of 40:15:43.5:1.5.

The present invention also provides a vaccine reagent comprising an inactivated vaccine reagent and an mRNA vaccine reagent, wherein the inactivated vaccine reagent is a first composition as described herein; and the mRNA vaccine agent is a second composition as described herein.

Kit for detecting a substance in a sample

In one aspect, the invention provides a kit comprising a first container comprising a first composition as described herein and a second container comprising a second composition as described herein. Suitable containers may include, for example, vials, tubes, and syringes. In a preferred embodiment, the first and second compositions are provided in unit dosage form.

In some embodiments, the kit further comprises a content tag and/or instructions for use. In some embodiments, the kit comprises instructions regarding the dosage and/or method of administration of one or more components of the packaged vaccine.

Heterologous prime-boost vaccination

The invention also relates to the use of the vaccine combinations, kits or vaccines of the invention in a heterologous prime-boost vaccination regimen/method to induce an immune response in a subject in need thereof that provides protective and/or therapeutic immunity against SARS-CoV-2.

Herein, a regimen/method comprising administering different antigen compositions (e.g., vaccines) against or involving the same pathogen or disease, disorder or condition is referred to as a "heterologous prime-boost" immunization (vaccination) regimen/method. Preferably, the heterologous prime-boost vaccination (or vaccination) regimen/method involves at least two administrations of different antigen compositions (e.g., a first composition and a second composition as described herein) that are directed against the same specific pathogen or the same specific disease, disorder, or condition.

The terms "priming" and "boosting" are intended to have their ordinary meaning in the art. "priming" or "initial immunization" refers to immunization of a subject with a first antigen composition (e.g., vaccine) to induce immunity of the subject against an antigen, which can be recalled upon subsequent exposure to the same antigen or a similar antigen. According to some embodiments of the invention, the "initial immunization" may include more than one immunization. The first composition as described herein may also be referred to as a "priming composition" or "priming agent". "boost" or "booster vaccination" refers to administration of a subsequent antigen composition (e.g., vaccine) after an earlier (priming) antigen composition. In some embodiments, following initial immunization of a subject (e.g., administration of a priming composition), one or more booster doses may be administered to the same subject to re-expose the same immunogenic antigen or antigen having at least one cross-reactive antigenic determinant with the antigen used in the priming composition. The second composition as described herein may also be referred to as a "strengthening composition" or "strengthening agent".

According to the invention, priming induces a higher level of immune response to an antigen when subsequently immunized (e.g., a composition comprising an antigen having at least one cross-reactive epitope) with a different antigen composition (e.g., a composition comprising an antigen having at least one cross-reactive epitope) than the level of immune response obtained by immunization with a single antigen composition (e.g., a separate priming composition). In some embodiments, the heterologous prime-boost regimens/methods of the invention result in a significant increase in antigen-specific binding antibodies (e.g., binding IgG) and neutralizing antibody levels in the subject. In some embodiments, the heterologous prime-boost regimens/methods of the invention result in a significant increase in T cells secreting IFN- γ, IL-2, or IL-21 in a subject. In some embodiments, the heterologous prime-boost regimens/methods of the invention result in a significant increase in spike protein-specific memory B cells in a subject.

In one aspect, the invention provides the use of a vaccine combination of the invention in the manufacture of a vaccine for preventing and/or treating a SARS-CoV-2 infection or inducing an immune response against SARS-CoV-2 in a subject in need thereof.

The present invention also provides a vaccine combination of the invention for use as a vaccine for preventing and/or treating a SARS-CoV-2 infection or inducing an immune response against SARS-CoV-2 in a subject in need thereof.

In yet another aspect, the invention provides a method for preventing and/or treating SARS-CoV-2 infection. The invention also provides a method of inducing an immune response against SARS-CoV-2 in a subject in need thereof.

Thus, some embodiments of the vaccine combinations, kits, vaccines or methods of the invention involve separately administering a first composition and a second composition as described herein to a subject in a prime-boost vaccination regimen.

Some embodiments of the vaccine combinations, kits, vaccines, uses or methods of the present invention comprise: (a) Administering an effective amount of a first composition as described herein to a subject in need thereof in at least one dose; and (b) subsequently administering an effective amount of a second composition as described herein to the subject in at least one dose.

In some embodiments, the first composition is administered in two or more doses (e.g., 3, 4, or 5 doses) prior to the administration of the second composition. In some embodiments, the second composition is administered at least one dose (e.g., 1, 2, 3, 4, 5, 6, or 7 doses) after administration of the first composition.

In some embodiments, the second composition is administered within about 48 weeks, 44 weeks, 40 weeks, 36 weeks, 32 weeks, 28 weeks, 24 weeks, 20 weeks, 16 weeks, 12 weeks, 8 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week or within about 56 days, 28 days, 14 days, or 7 days after administration of the first composition.

In some embodiments, the two doses are administered to the subject at intervals of about 1 week to about 8 weeks (e.g., about 1, 2, 3, 4, 5, 6, 7, or 8 weeks). In one embodiment, the two doses are administered to the subject at intervals of about 2 weeks to about 6 weeks. In a preferred embodiment, the two doses are administered to the subject at about 4 week intervals.

In some embodiments, an effective amount of the second composition is administered to the subject in at least one dose within about 5 to about 9 months (e.g., within about 5, 6, 7, 8, or 9 months) after the last dose of the first composition is administered. In a specific embodiment, an effective amount of the second composition is administered to the subject in at least one dose within about 7 months after the last dose of the first composition is administered.

In some embodiments of administering two doses of the first composition, wherein an effective amount of the second composition is administered to the subject within about 5 to about 9 months (e.g., within about 5, 6, 7, 8, or 9 months) after the administration of the second dose of the first composition. In a specific embodiment, an effective amount of the second composition is administered to the subject in one dose within about 7 months after administration of the second dose of the first composition.

As used herein, the term "effective amount" refers to an amount sufficient to prevent or inhibit the occurrence of a disease, disorder or condition and/or to slow, alleviate, delay the progression or severity of a disease, disorder or condition. In this context, an "effective amount" also refers to an amount sufficient to induce an immune response. The effective amount is affected by factors including, but not limited to: the rate and severity of development of the disease, disorder or condition, the age, sex, weight and physiological condition of the subject, the frequency of administration and the particular route of administration. An effective amount may be administered in one or more doses (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more). An effective amount may be achieved by continuous or intermittent administration. In some embodiments, the effective amount is provided in one or more administrations. In a preferred embodiment, the effective amount is provided in unit dosage form.

According to some embodiments of the invention, the vaccine combinations, kits, vaccines or methods of the invention can be used to induce an immune response against SARS-CoV-2 in a subject. According to some embodiments of the invention, the vaccine combinations, kits, vaccines or methods of the invention may be used for preventing and/or treating SARS-CoV-2 infection in a subject in need thereof.

In one embodiment, the SARS-CoV-2 is a SARS-CoV-2 original strain, such as the Wuhan-Hu-1 strain (Genbank accession number: MN 908947.3). In one embodiment, the SARS-CoV-2 is a variant of SARS-CoV-2. In one embodiment, the SARS-CoV-2 variant is selected from Alpha (B.1.1.7 and Q lineages), beta (B.1.351 and offspring lineages), gamma (P.1 and offspring lineages), delta (B.1.617.2 and AY lineages) and Omicron (lineages B.1.1.529 and BA lineages, e.g., BA.1 and BA.2) variants.

In a particular embodiment, the SARS-CoV-2 has a wild-type SARS-CoV-2S protein. In one embodiment, the wild-type SARS-CoV-2S protein comprises the amino acid sequence of SEQ ID NO. 1.

In other specific embodiments, the SARS-CoV-2 has a mutant SARS-CoV-2S protein. The mutant SARS-CoV-2S protein can comprise one or more amino acid additions, substitutions and/or deletions as compared to the wild-type SARS-CoV-2S protein. In one embodiment, the mutant SARS-CoV-2S protein comprises one or more of the following amino acid substitutions compared to SEQ ID NO. 1: d614G, K417N, E484K and N501Y. In one embodiment, the mutant SARS-CoV-2S protein comprises the following amino acid substitutions compared to SEQ ID NO. 1: N501Y and D614G. In one embodiment, the mutant SARS-CoV-2S protein comprises the following amino acid substitutions compared to SEQ ID NO. 1: K417N, N501Y and D614G. In one embodiment, the mutant SARS-CoV-2S protein comprises the following amino acid substitutions compared to SEQ ID NO. 1: E484K, N501Y and D614G. In one embodiment, the mutant SARS-CoV-2S protein comprises the following amino acid substitutions compared to SEQ ID NO. 1: d80A, D215G, K417N, E484K, N501Y, D G and a701V. In one embodiment, the mutant SARS-CoV-2S protein comprises the following amino acid substitutions compared to SEQ ID NO. 1: L18F, K417N, E484K, N501Y, D614G, D80A, D G and a701V; and optionally the deletion of amino acids 242-244.

Description of the embodiments

Embodiments of the present invention may also be exemplified as follows:

embodiment 1 is a vaccine combination comprising a first composition and a second composition, wherein the first composition comprises an inactivated vaccine; and the second composition comprises an mRNA vaccine.

Embodiment 2 is the vaccine combination of embodiment 1, wherein the first composition comprises an inactivated viral antigen of SARS-CoV-2; and the second composition comprises an mRNA encoding a polypeptide antigen comprising a SARS-CoV-2 spike protein variant having an inactivated furin cleavage site; wherein the inactivated furin cleavage site has the amino acid sequence of QSAQ.

Embodiment 3 is the vaccine combination of

embodiment

1 or 2, wherein the first composition comprises an inactivated viral antigen of a SARS-CoV-2KMS-1 strain; and the polypeptide antigen has the amino acid sequence of SEQ ID NO. 3.

Embodiment 4 is the vaccine combination of any one of embodiments 1-3, wherein the mRNA comprises the nucleotide sequence of SEQ ID No. 11.

Embodiment 5 is the vaccine combination of any one of embodiments 1-3, wherein the mRNA comprises the nucleotide sequence of SEQ ID No. 13.

Embodiment 6 is the vaccine combination of any one of embodiments 1-5, wherein the mRNA comprises a modified uridine.

Embodiment 7 is the vaccine combination of any one of embodiments 1-5, wherein 100% of uridine in said mRNA is replaced by 1-methyl pseudouridine.

Embodiment 8 is the vaccine combination of any one of embodiments 1-7, wherein the second composition further comprises a cationic polymer associated with the mRNA as a complex and a lipid particle encapsulating the complex.

Embodiment 9 is the vaccine combination of embodiment 8, wherein the cationic polymer is protamine.

Embodiment 10 is the vaccine combination of embodiment 8 or 9, wherein the lipid particle comprises M5, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000, the M5 having the following structure:

embodiment 11 is the vaccine combination of embodiment 10, wherein the molar ratio of M5, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000 is 40:15:43.5:1.5.

Embodiment 12 is the vaccine combination of any one of embodiments 1-11, wherein the first composition is an inactivated whole virus vaccine.

Embodiment 13 is the vaccine combination of any one of embodiments 1-12, wherein the first composition further comprises an adjuvant.

Embodiment 14 is the vaccine combination of embodiment 13, wherein the adjuvant is Al (OH) ₃ 。

Embodiment 15 is a kit comprising a first container comprising a first composition as defined in any one of embodiments 1-3 and 12-14 and a second container comprising a second composition as defined in any one of embodiments 1-11.

Embodiment 16 is the use of the vaccine combination of any one of embodiments 1-14 in the preparation of a vaccine for preventing and/or treating a SARS-CoV-2 infection or inducing an immune response against SARS-CoV-2 in a subject in need thereof.

Embodiment 17 is the vaccine combination of any one of embodiments 1-14, the kit of embodiment 15, or the use of embodiment 16, wherein

Embodiment 18 is the vaccine combination, kit or use of embodiment 17, wherein

Embodiment 19 is the vaccine combination, kit or use of embodiment 18, wherein the two doses are administered to the subject at intervals of about 1 week to about 8 weeks.

Embodiment 20 is the vaccine combination, kit or use of embodiment 18, wherein the two doses are administered to the subject at intervals of about 2 weeks to about 6 weeks.

Embodiment 21 is the vaccine combination, kit or use of embodiment 18, wherein the two doses are administered to the subject at about 4 week intervals.

Embodiment 22a is the vaccine combination, kit or use of any one of embodiments 17-21, wherein an effective amount of the second composition is administered to the subject in one dose within about 5 to about 9 months after the last dose of the first composition is administered.

Embodiment 22b is the vaccine combination, kit or use of any one of embodiments 18-21, wherein an effective amount of the second composition is administered to the subject in one dose within about 5 to about 9 months after administration of the second dose of the first composition.

Embodiment 23a is the vaccine combination, kit or use of any one of embodiments 17-21, wherein an effective amount of the second composition is administered to the subject in one dose within about 7 months after the last dose of the first composition is administered.

Embodiment 23b is the vaccine combination, kit or use of any one of embodiments 18-21, wherein an effective amount of the second composition is administered to the subject in one dose within about 7 months after the second dose of the first composition is administered.

Embodiment 24 is a method for preventing and/or treating a SARS-CoV-2 infection or inducing an immune response against SARS-CoV-2 in a subject in need thereof, comprising:

(a) Administering an effective amount of the first composition to the subject at least once; and

(b) Subsequently administering an effective amount of a second composition to the subject at least once;

wherein the method comprises the steps of

The first composition is as defined in any one of embodiments 1-3 and 12-14;

the second composition is as defined in any one of embodiments 1 to 11.

Embodiment 25 is the method of embodiment 24, wherein

Embodiment 26 is the method of embodiment 25, wherein the two doses are administered to the subject at intervals of about 1 week to about 8 weeks.

Embodiment 27 is the method of embodiment 25, wherein the two doses are administered to the subject at intervals of about 2 weeks to about 6 weeks.

Embodiment 28 is the method of embodiment 25, wherein the two doses are administered to the subject at about 4 week intervals.

Embodiment 29a is the method of any one of embodiments 24-28, wherein the effective amount of the second composition is administered to the subject in one dose within about 5 to about 9 months after the last dose of the first composition is administered.

Embodiment 29b is the method of any one of embodiments 25-28, wherein an effective amount of the second composition is administered to the subject in one dose within about 5 to about 9 months after administration of the second dose of the first composition.

Embodiment 30a is the method of any one of embodiments 24-28, wherein the effective amount of the second composition is administered to the subject in one dose within about 7 months after the last dose of the first composition is administered.

Embodiment 30b is the method of any one of embodiments 25-28, wherein an effective amount of the second composition is administered to the subject in one dose within about 7 months after administration of the second dose of the first composition.

Embodiment 31 is the vaccine combination of any one of embodiments 1-14 for use as a vaccine for preventing and/or treating a SARS-CoV-2 infection or inducing an immune response against SARS-CoV-2 in a subject in need thereof, wherein

(a) Administering an effective amount of the first composition to the subject at least once; and is also provided with

(b) An effective amount of the second composition is then administered to the subject at least once.

Embodiment 32 is the vaccine combination of embodiment 31 for use as a vaccine, wherein

Embodiment 33 is the vaccine combination of embodiment 32 for use as a vaccine, wherein the two doses are administered to the subject at intervals of about 1 week to about 8 weeks.

Embodiment 34 is the vaccine combination of embodiment 32 for use as a vaccine, wherein the two doses are administered to the subject at intervals of about 2 weeks to about 6 weeks.

Embodiment 35 is the vaccine combination of embodiment 32 for use as a vaccine, wherein the two doses are administered to the subject at about 4 week intervals.

Embodiment 36a is the vaccine combination of any one of embodiments 31-35 for use as a vaccine, wherein an effective amount of the second composition is administered to the subject in one dose within about 5 to about 9 months after the last dose of the first composition is administered.

Embodiment 36b is the vaccine combination of any one of embodiments 32-35 for use as a vaccine, wherein an effective amount of the second composition is administered to the subject in one dose within about 5 to about 9 months after administration of the second dose of the first composition.

Embodiment 37a is the vaccine combination of any one of embodiments 31-35 for use as a vaccine, wherein an effective amount of the second composition is administered to the subject in one dose within about 7 months after the last dose of the first composition is administered.

Embodiment 37b is the vaccine combination of any one of embodiments 32-35 for use as a vaccine, wherein an effective amount of the second composition is administered to the subject in one dose within about 7 months after administration of the second dose of the first composition.

Embodiment 38 is a vaccine reagent, including an inactivated vaccine reagent and an mRNA vaccine reagent.

Embodiment 39 is the vaccine agent of embodiment 38, wherein the inactivated vaccine agent comprises an inactivated vaccine against one or more infectious diseases.

Embodiment 40 is the vaccine agent of embodiment 38, wherein the mRNA vaccine agent comprises one or more vaccine agents against infectious disease.

Embodiment 41 is the vaccine agent of embodiment 38, wherein the inactivated vaccine agent comprises an inactivated virus, bacterium, fungus, or a split fragment of a virus, bacterium, fungus.

Embodiment 42 is the vaccine agent of embodiment 38, wherein the mRNA vaccine agent comprises a partial RNA sequence of a virus, a bacterium, a fungus, or an mRNA sequence.

Embodiment 43 is the vaccine agent of any one of embodiments 38-42, wherein the inactivated vaccine agent comprises an inactivated viral antigen of SARS-CoV-2; and the mRNA vaccine reagent comprises mRNA encoding a polypeptide antigen comprising a SARS-CoV-2 spike protein variant having an inactivated furin cleavage site; wherein the inactivated furin cleavage site has the amino acid sequence of QSAQ.

Embodiment 44 is the vaccine agent of any one of embodiments 38-43, wherein the inactivated vaccine agent comprises an inactivated viral antigen of a SARS-CoV-2 KMS-1 strain; and the polypeptide antigen has the amino acid sequence of SEQ ID NO. 3.

Embodiment 45 is the vaccine agent of any one of embodiments 38-44, wherein the mRNA comprises the nucleotide sequence of SEQ ID No. 11.

Embodiment 46 is the vaccine agent of any one of embodiments 38-44, wherein the mRNA comprises the nucleotide sequence of SEQ ID No. 13.

Embodiment 47 is the vaccine agent of any one of embodiments 38-46, wherein the mRNA comprises a modified uridine.

Embodiment 48 is the vaccine agent of any one of embodiments 38-46, wherein 100% of uridine in said mRNA is replaced by 1-methyl pseudouridine.

Embodiment 49 is the vaccine agent of any one of embodiments 38-48, wherein the mRNA vaccine agent further comprises a cationic polymer associated with the mRNA as a complex and a lipid particle encapsulating the complex.

Embodiment 50 is the vaccine agent of embodiment 49, wherein the cationic polymer is protamine.

Embodiment 51 is the vaccine agent of embodiment 49 or 50, wherein the lipid particle comprises M5, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000, the M5 having the following structure:

embodiment 52 is the vaccine agent of embodiment 51, wherein the molar ratio of M5, 1, 2-dioleoyl-sn-glycero-3-phosphate ethanolamine (DOPE), cholesterol, and DMG-PEG 2000 is 40:15:43.5:1.5.

Embodiment 53 is the vaccine agent of any one of embodiments 38-52, wherein the inactivated vaccine agent is an inactivated whole virus vaccine.

Embodiment 54 is the vaccine agent of any one of embodiments 38-53, wherein the inactivated vaccine agent further comprises an adjuvant.

Embodiment 55 is the vaccine agent of embodiment 54, wherein the adjuvant is Al (OH) ₃ 。

Embodiment 56 is a method of vaccinating against infectious diseases comprising vaccinating first with an inactivated vaccine reagent and then with an mRNA vaccine reagent; either the inactivated vaccine reagent and the mRNA vaccine reagent are inoculated simultaneously or the mRNA vaccine reagent is inoculated first and then the inactivated vaccine reagent is inoculated.

Embodiment 57 is the method of embodiment 56, wherein the dose of the inactivated vaccine agent is at least 1 unit dose, e.g., 2 units dose, 3 units dose, or at least comprises one needle dose or 2 needle dose.

Embodiment 58 is the method of embodiment 56, further comprising administering at least 1 unit dose of the mRNA vaccine agent, e.g., 2 units dose, 3 units dose, or at least one needle dose or 2 needles dose.

Embodiment 59 is the method of embodiment 56, wherein the time between vaccination with the inactivated vaccine reagent and vaccination with the mRNA vaccine reagent is between 1 and 100 days.

Embodiment 60 is the method of any one of embodiments 56-59, comprising:

(a) Administering an effective amount of an inactivated vaccine agent to the subject at least once; and

(b) Subsequently administering an effective amount of an mRNA vaccine agent to the subject at least once;

wherein the method comprises the steps of

The inactivated vaccine agent is as defined in any one of embodiments 43, 44 and 53-55;

the mRNA vaccine reagent is as defined in any one of embodiments 43-52.

Embodiment 61 is the method of embodiment 60, wherein

(a) Administering an effective amount of the inactivated vaccine agent to the subject in two doses; and is also provided with

(b) An effective amount of the mRNA vaccine agent is then administered to the subject in one dose.

Embodiment 62 is the method of embodiment 61, wherein the two doses are administered to the subject at intervals of about 1 week to about 8 weeks.

Embodiment 63 is the method of embodiment 61, wherein the two doses are administered to the subject at intervals of about 2 weeks to about 6 weeks.

Embodiment 64 is the method of embodiment 61, wherein the two doses are administered to the subject at about 4 week intervals.

Embodiment 65a is the method of any of embodiments 60-64, wherein an effective amount of the mRNA vaccine agent is administered to the subject in one dose within about 5 to about 9 months after the last dose of the inactivated vaccine agent is administered.

Embodiment 65b is the method of any of embodiments 61-64, wherein an effective amount of the mRNA vaccine agent is administered to the subject in one dose within about 5 to about 9 months after the second dose of the inactivated vaccine agent is administered.

Embodiment 66a is the method of any one of embodiments 60-64, wherein an effective amount of the mRNA vaccine agent is administered to the subject in one dose within about 7 months after the last dose of the inactivated vaccine agent is administered.

Embodiment 66b is the method of any one of embodiments 61-64, wherein an effective amount of the mRNA vaccine agent is administered to the subject in one dose within about 7 months after the second dose of the inactivated vaccine agent is administered.

Embodiment 67 is the vaccine agent of any one of embodiments 38-55 for use as a vaccine for preventing and/or treating SARS-CoV-2 infection or inducing an immune response against SARS-CoV-2 in a subject in need thereof, wherein

(a) Administering an effective amount of the inactivated vaccine agent to the subject at least once; and is also provided with

(b) An effective amount of the mRNA vaccine agent is then administered to the subject at least once.

Embodiment 68 is the vaccine agent of embodiment 67 for use as a vaccine, wherein

Embodiment 69 is the vaccine agent of embodiment 68 for use as a vaccine, wherein the two doses are administered to the subject at intervals of about 1 week to about 8 weeks.

Embodiment 70 is the vaccine agent of embodiment 68 for use as a vaccine, wherein the two doses are administered to the subject at intervals of about 2 weeks to about 6 weeks.

Embodiment 71 is the vaccine agent of embodiment 68 for use as a vaccine, wherein the two doses are administered to the subject at about 4 week intervals.

Embodiment 72a is the vaccine agent of any one of embodiments 67-71 for use as a vaccine, wherein an effective amount of the mRNA vaccine agent is administered to the subject in one dose within about 5 to about 9 months after the last dose of the inactivated vaccine agent is administered.

Embodiment 72b is the vaccine agent of any one of embodiments 68-71 for use as a vaccine, wherein an effective amount of the mRNA vaccine agent is administered to the subject in one dose within about 5 to about 9 months after administration of the second dose of the inactivated vaccine agent.

Embodiment 73a is the vaccine agent of any one of embodiments 67-71 for use as a vaccine, wherein an effective amount of the mRNA vaccine agent is administered to the subject in one dose within about 7 months after the last dose of the inactivated vaccine agent is administered.

Embodiment 73b is the vaccine agent of any one of embodiments 68-71 for use as a vaccine, wherein an effective amount of the mRNA vaccine agent is administered to the subject in one dose within about 7 months after the second dose of the inactivated vaccine agent is administered.

Advantageous effects

The vaccine combinations, kits, vaccines or methods of the present invention have at least one of the following beneficial effects:

(1) Significantly increasing the level of antigen-specific binding antibodies (e.g., binding IgG) and neutralizing antibodies in a subject;

(2) Significantly increasing the level of IFN-gamma, IL-2 or IL-21 secreting T cells in a subject; and

(3) Significantly increasing the level of spike protein-specific memory B cells in the subject.

Examples

The invention is further described by reference to the following examples. It should be understood that these embodiments are by way of example only and are not limiting of the invention. The following materials and instruments are commercially available or prepared according to methods well known in the art. The following experiments were performed according to the manufacturer's instructions or according to methods and procedures well known in the art.

Example 1 preparation of mRNA

1.1 design of S protein variants

S protein variants numbered 212 and 213, respectively, were designed, and the amino acid sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3, respectively. Wherein both

S protein variants

212 and 213 comprise the amino acid substitutions K986P/V987P ("2P" mutation) and D614G, compared to the wild type S protein of SEQ ID NO. 1 (S protein of the original strain Wuhan-Hu-1 (Genbank accession number: MN 908947.3)). Furthermore, the Furin cleavage site (corresponding to amino acids 682-685 of SEQ ID NO: 1) in the S protein variant 213 was mutated to "QSAQ" (Table 1).

TABLE 1

Note that: "-" means that the S protein variant does not comprise a mutation at that amino acid position; "+" indicates that the S protein variant contains the indicated mutation at that amino acid position.

1.2 design and Synthesis of DNA templates

The design and synthesis of DNA templates is described in CN113186203 a.

Briefly, a DNA Open Reading Frame (ORF) sequence encoding the S protein variant of example 1.1 was designed with codons optimized for optimal expression in human cells. The DNA ORF sequences encoding the

S protein variants

212 and 213 are shown in SEQ ID NO. 4 and SEQ ID NO. 5 (Table 2), respectively, and the RNA ORF sequences are shown in SEQ ID NO. 10 and SEQ ID NO. 11, respectively.

The following sequences were then ligated in 5 'to 3' order: t7 promoter sequence (SEQ ID NO: 6), 5'UTR sequence (SEQ ID NO: 7), DNA ORF sequence (SEQ ID NO:4 or SEQ ID NO: 5), 3' UTR sequence (SEQ ID NO: 8) and poly (A) tail (SEQ ID NO: 9), total gene synthesis (Nanjing gold St. Biotechnology Co., ltd.) was carried out using Puc57 as a vector to obtain a plasmid DNA template.

Finally, the plasmid DNA template was linearized using restriction enzymes and PCR amplified (Ai Ben Germany) using a pair of primers (upstream primer: 5'TTGGACCCTCGTACAGAAGCTAATACG 3'; and downstream poly (T) long primer: 5'TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGTTCTAGACCCTCACTTCCTACTCAGG 3') and a high fidelity DNA polymerase-based PCR amplification kit (Bao Ri doctor materials technology (Beijing Co., ltd.) to obtain a DNA template.

1.3 in vitro transcription of mRNA from DNA templates

Methods for preparing in vitro transcribed mRNA using DNA templates are described in CN113186203 a. Briefly, in vitro transcription of RNA was performed using the DNA template prepared in example 1.2 as a template and a T7 RNA polymerase to perform a co-transcription capping reaction, thereby producing Cap1 mRNA. N1-methyl-pseudouridine-5 '-triphosphate was added to the reaction system instead of uridine-5' -triphosphate (UTP), so that the modification ratio of 1-methyl-pseudouridine in the in vitro transcribed Cap1 mRNA was 100%. After transcription, the DNA template was digested with dnaseli (sameil technologies limited) to reduce the risk of residual DNA template.

Cap1 mRNA was purified using DynabeadsMyone (Sesameimer Feiche technologies Co., ltd.). Purified Cap1 mRNA was dissolved in sodium citrate solution. The nucleotide sequences of mRNAs numbered 212 and 213 are shown as SEQ ID NO. 12 and SEQ ID NO. 13 (Table 2), respectively.

TABLE 2

Example 2 verification of cellular expression of candidate mRNA

Expression of mRNA prepared as in example 1.3 was verified in DC2.4 cells (mouse bone marrow derived dendritic cell line; ATCC). Briefly, 2 μg mrna was transfected into DC2.4 cells using transfection reagent Lipofectamine MessengerMax (Invitrogen). The transfected cells were placed in a cell incubator at 37℃with 5% CO ₂ Culturing for 18-24 hr. Cells were then collected and counted after washing with PBS. Take 1x10 ⁶ The cells were placed in a flow tube and the supernatant was centrifuged off. Cells were incubated with bovine serum albumin (Beijing Soy Bao technology Co., ltd.), fcR blocking solution (Miltenyi Biotec) and live/dead dye (BD Biosciences), washed with PBS; then, the recombinant protein hACE2-Fc (Kirschner Co.) was used for incubation and PBS washing; then incubation with PE-labeled anti-Fc antibody (PE-anti-Fc) (BioLegend), PBS wash; cells were resuspended in PBS and the amount of hACE2 bound to the surface of DC2.4 cells (expressed as the Mean Fluorescence Intensity (MFI) value of PE) was detected using a flow cytometer (BD Biosciences).

The results showed (FIG. 1) that both mRNA 212 and mRNA 213 transfected DC2.4 cell surfaces detected a strong PE fluorescent signal, indicating that these mRNAs were correctly translated into functional spike proteins capable of binding to hACE2 in the cell. Furthermore, higher values of PE MFI detected on the surface of mRNA 213 transfected DC2.4 cells than on the surface of mRNA 212 transfected DC2.4 cells indicate that mutation of the Furin cleavage site to "QSAQ" increases the expression level of the S protein variant and/or its binding affinity to hACE 2.

EXAMPLE 3 preparation of mRNA vaccine formulations

Experimental materials

Cationic lipid M5 is a s microbial synthesis; helper phospholipids (DOPE) were purchased from CordenPharma; cholesterol was purchased from Sigma-Aldrich; mPEG2000-DMG (i.e., DMG-PEG 2000) was purchased at Avanti Polar Lipids, inc; PBS was purchased from Invitrogen; protamine sulfate was purchased from Beijing Lian pharmaceutical Co.

Preparation of lipid multimeric complex (LPP-mRNA) formulations:

preparation of an aqueous mRNA solution: mRNA 212 and mRNA 213 prepared as in example 1.3 were diluted to 0.35mg/mL aqueous mRNA with 50mM citric acid-sodium citrate buffer (pH 3-4).

Preparation of lipid solution: cationic lipid (M5): DOPE: cholesterol: DMG-PEG 2000 was dissolved in absolute ethanol at a molar ratio of 40:15:43.5:1.5 to prepare a 10mg/mL lipid solution.

Preparing a protamine sulfate solution: the protamine sulfate is dissolved in water without the nucleotidase to prepare the protamine sulfate solution with the working concentration of 0.2 mg/mL.

Preparation of core nanoparticle (core nanoparticle) solution: using microfluidic technology, a solution of protamine sulfate was mixed with a solution of mRNA under the following conditions to obtain a solution of nuclear nanoparticles formed from protamine and mRNA: volume=4.0 mL; flow rate ratio=3 (mRNA): 1 (protamine solution), total Flow rate=12 mL/min, front waste (start waste) =0.35 mL, rear waste (end waste) =0.1 mL, room temperature.

Preparation of LPP: the core nanoparticle solution was secondarily mixed with the lipid solution under the following conditions: volume= 4.0mL,Flow rate ratio =3 (lipid solution): 1 (core nanoparticle solution), total flow rate=12 mL/min, front waste=0.35 mL, back waste=0.1 mL, room temperature, LPP-mRNA solution was obtained.

Centrifugal ultrafiltration: the LPP-mRNA solution was subjected to ultrafiltration centrifugation to remove ethanol (centrifugal force 3400g, centrifugation time 60min, temperature 4 ℃) and LPP-mRNA 212 (vaccine 212) and LPP-mRNA 213 (vaccine 213; also called SW0123.351 a) formulations were obtained.

Example 4 evaluation of the ability of candidate mRNA vaccine formulations to induce neutralizing antibodies in mice

C57BL/6 mice (Shanghai Ling Biotechnology Co., ltd.) were immunized with LPP-mRNA 212 (vaccine 212) or LPP-mRNA 213 (vaccine 213) preparations prepared in example 3, 8 mice per group. Mice were immunized on day 0 (priming) and day 14 (secondary) by intramuscular injection, with a single immunization dose of 10 μg mRNA per mouse. Mouse immune sera were collected on day 14 (i.e., day 28) after the second immunization, and the titer level of neutralizing antibodies in the immune sera was assessed using a commercial wild-type or b.1.351 variant pseudovirus kit (beijing Tiantan pharmaceutical biotechnology development company; wild-type pseudovirus cat# 80033; b.1.351 variant pseudovirus cat# 80044).

The pseudovirus adopts plasmid for expressing wild type or B.1.351 SARS-CoV-2S protein to replace the plasmid for expressing VSV-G protein and carries luciferase reporter gene. When a pseudovirus is used to infect cells expressing ACE2 on their surface, the S protein binds to ACE2 thereby mediating entry of the pseudovirus into the cell, resulting in expression of luciferase. The ability of immune serum to inhibit pseudovirus infection of ACE2 expressing cells can be characterized as the inhibition rate, which can be calculated by the ratio of the decrease in the luminescence intensity of luciferase-catalyzed substrate luciferin from an immune serum sample compared to a positive control (e.g., a serum-free control). The S protein for wild-type pseudoviruses has the amino acid sequence of SEQ ID NO. 1. The S protein for the pseudovirus of the variant B.1.351 comprises the following mutations relative to SEQ ID NO: 1: amino acid substitutions L18F, D80A, D215G, K417N, E484K, N501Y, D G and a701V; and the deletion of amino acids 242-244.

Briefly, each group of immune sera was diluted 20, 60, 180, 540, 1620, and 4860 fold; adding pseudovirus to diluted immune serum or an equal volume of cell culture medium (as serum-free control) and incubating for 1 hour; subsequently adding an amount of Huh7 cells (human liver cancer cell line expressing endogenous hACE 2; ATCC) to the serum-pseudovirus mixture; after 24 hours, the supernatant was discarded, the cells were lysed and fluorescein was added; luminescence intensity (expressed as Relative Light Units (RLU)) was detected using a microplate reader (Bio-Rad Laboratories), background RLU of cell-only control was subtracted from sample RLU and calculatedInhibition ratio, inhibition ratio = [ (RLU) _{Serum-free control} –RLU _{Cell-only control} )–(RLU _{Immune serum} –RLU _{Cell-only control} )]/(RLU _{Serum-free control} –RLU _{Cell-only control} ) X 100%; the dilution-inhibition curves of the immune sera of each group were plotted, and the corresponding serum dilutions (ID ₅₀ ) Shown is the average value.

The results of neutralization assays of immune serum against wild-type and b.1.351s protein pseudoviruses are shown in figures 2 and 3, respectively. For both pseudoviruses of wild type and b.1.351s proteins, vaccine 213-induced immune sera exhibited neutralizing capacity superior to that of their corresponding vaccine 212-induced immune sera, indicating that mutation of the Furin cleavage site to "QSAQ" significantly improved vaccine-induced immune responses against wild type SARS-CoV-2 strain and b.1.351 variant strain, respectively.

Example 5 heterologous prime/boost immunization with inactivated and mRNA vaccines

The present study evaluates the potential of heterologous prime/boost vaccination (sequential vaccination) using a devid-19 inactivated vaccine and an mRNA vaccine as a method for preventing and treating SARS-Cov-2 infection.

The inactivated vaccine of COVID-19 for priming was developed by the Institute of Medical Biology (IMBCAMS) of the national academy of medical science, and was evaluated in phase III (clinical Trial gov: NCT 04659239). The inactivated vaccine is approved to be marketed in China at present, and the trade name is Keweifu ^TM ". Each dose contains 100 or 150EU (EU, concentration of viral antigen determined by ELISA) inactivated viral antigen (SARS-CoV-2 KMS-1 strain (GenBank accession number: MT 226610.1)) suspended in 0.5ml of buffered saline and 0.25mg of Al (OH) as an adjuvant ₃ (see PuJ, et al, the safety and immunogenicity of an inactivated SARS-CoV-2vaccine in Chinese adults aged 18-59years:A phase I randomized,double-blinked, controlled trial. Vaccine.2021May 12;39 (20): 2746-2754. The relevant contents of which are incorporated herein in their entirety). The mRNA vaccine used for heterologous booster immunization was the sw0123.351a vaccine prepared as in example 3.

The present study has been completedIs approved by the local ethical committee of the eastern hospitals of the university of Shanghai, china and is carried out according to the declaration of the principle of Helsinki. Two subjects were included in the study and given written informed consent. Subject 1 is male and subject 2 is female, all ages between 50-55 years. These two subjects received two doses of Kevefu at 4 week (28 day) intervals (8.17 and 9.10 in 2020) in phase I clinical trial with inactivated vaccine against COVID-19 (clinical Trial. Gov: NCT 04412538) ^TM (100 EU per dose). About 7 months after the second inactivated vaccine immunization (2021, 4, 8 days), both subjects received one dose of swa23.351 a vaccine (25 μg mRNA) as a booster. Figure 4 shows a schematic of a heterologous prime/boost vaccination regimen.

Peripheral venous blood was collected in EDTA vacuum tubes or Vacutainer blood pigs (BD) before and after booster immunization for preparation of Peripheral Blood Mononuclear Cells (PBMC) and serum samples, respectively. PBMC were isolated using Ficoll-Pague PLUS density gradient solution (GE Healthcare). To compare the antibody responses, serum collected from 15 convalescent covd-19 patients was evaluated using the same method. These patients had PCR-confirmed SARS-CoV-2 infection 1-3 months prior to sample collection.

Experimental method

Measurement of bound IgG

The titer of binding IgG specific for the Spike protein in the pre-fusion conformation (referred to as "pre-fusion Spike" or "pre-fusion S") and the Receptor Binding Domain (RBD) was assessed using an enzyme-linked immunosorbent assay (ELISA). Briefly, pre-antigen fusion Spike or RBD (Genscript) diluted in coating buffer (Biolegend) was coated in 96-well plates (Greiner Bio-One) at a concentration of 100 ng/well and incubated overnight at 4 ℃. The 96-well plates were then washed with PBS (PBST) containing 0.05% Tween-20 and blocked with 2% Bovine Serum Albumin (BSA) for 2 hours at 25 ℃. Subsequently, serum samples serially diluted in PBST (containing 0.2% BSA) were added to the plate and incubated for 2 hours at 25 ℃. After washing the plates with PBST, HRP-conjugated sheep anti-human IgG (1:50,000) was added and incubated for 1 hour at 25 ℃. Finally TMB substrate was added for color development, and the absorbance at 450nm was read (corrected by subtracting the absorbance at 610 nm). The endpoint titer was calculated as the emitted Optical Density (OD) value above 2.1 x background. When the background OD value was less than 0.05, the calculation was performed at 0.05.

Measurement of neutralizing antibodies

pVNT assays were performed as previously reported (Nie J et al Emerg Microbes effect 2020; 9:680-6), in which Vesicular Stomatitis Virus (VSV) expressing SARS-CoV-2 spike protein (strain Wuhan-Hu-1) was used to Infect ACE 2-expressing Huh7 cells.

ELISA spot (ELISPot) assay

The frequency of different types of antigen-specific T cells was quantified by ELISPot assay using human IFN-gamma, IL-2 or IL-21ELISPotplus kit (Mabtech, sweden) according to the manufacturer's instructions. Before detection, 3×10 ⁵ The PBMC were stimulated with the spike protein extracellular domain (S-ECD) (10. Mu.g/ml) for 20 hours. Spots were visualized with BCIP/NBT substrate solution and counted by Immunospot S6 analyzer (CTL).

Memory B cell analysis

The frequency of spike-protein specific memory B cells was assessed by flow cytometry. For probe preparation, biotinylated spike proteins were conjugated with PE or APC labeled Streptavidin (strepitavidin) in a 4:1 molar ratio. First, 10 will be ⁶ The individual PBMC were incubated with the probe for 20 min at 4℃and then LIVE +.

Aqua can be stained with the fixed dead cell staining kit (BD) and the antibody mixture at 4 ℃ for 20 minutes in the dark. Finally, memory B cells were examined by FACS canto (tm) II flow cytometer (BD Biosciences). Data was analyzed using FlowJo v.10.1 (Tree Star). The antibody mixture contained the following fluorescently labeled antibodies: anti-human CD3 Ab (clone: SP 34-2), anti-human CD8 Ab (clone: RPA-T8), anti-human CD14 Ab (clone: M5E 2), anti-human CD16 Ab (clone: 3G 8), anti-human CD20 Ab (clone: 2), anti-human IgM Ab (clone: G20-127) and anti-human IgG Ab (clone: G18-145).

Results

The magnitude and kinetics of antibody (Ab) responses in two subjects were first assessed. On the day of booster vaccination (day 0), as expected, low Spike-specific IgG levels could be detected, which is a consequence of the persistence of responsiveness generated by the priming inactivated vaccine.

Serum samples from subjects were collected before (day 0) and after (days 7, 14 and 21) booster vaccination with mRNA vaccine sw0123.351a, and the binding and neutralizing antibody levels were detected by ELISA assay and pseudovirus neutralization test (pnnt), respectively, and the results are shown in fig. 5A and 5B.

The results showed that IgG levels against Pre-fusion Spike (Pre-fusion S) and RBD showed rapid and robust increases after boost immunization (fig. 5A). IgG levels peaked on day 14, reaching reciprocal titers of 51200 in both subjects. Whereas the geometric mean titers of conjugated IgG (GMT) from convalescent sera of COIVD-19 patients were 7699 (pre-fusion Spike) and 4032 (RBD), respectively. In other words, on day 14 after booster immunization, the titers of the two bound antibodies were 6.7 and 12.7 times the serological level of the recovered patients within 3 months after infection, respectively.

Consistent with the significant increase in bound IgG levels, the level of neutralizing antibodies (NAb) measured by pVNT increased significantly after boost immunization, and reached IC of 2457 on day 14 ₅₀ Titer (fig. 5B). Whereas neutralizing antibodies IC from convalescent serum of COIVD-19 patients ₅₀ The titer was 325. That is, on day 14 post boost immunization, the subject serum had 7.6 times the neutralizing antibody titer than convalescent serum.

The phenotype and magnitude of Spike-specific T cells were also analyzed. Peripheral Blood Mononuclear Cells (PBMC) from the subjects were isolated before (day 0) and after (day 14) booster immunization, and secretion of Spike protein-specific T cells IFN-. Gamma., IL-2 and IL-21 was detected by ELISPot assay, and the results are shown in FIG. 6.

The results show that both subjects had low levels of IFN-gamma secreting T cells that reacted with SARS-CoV-2 antigen as part of the response to the prime-vaccinated inactivated vaccine prior to boost vaccination (day 0). Following stimulation with the antigen S-ECD protein, T cells secreting IFN- γ or IL-2 increased, indicating that mRNA vaccine boosters significantly activated antigen-specific Th1 type cellular immune responses (fig. 6). In contrast, no or very few IL-4 secreting T cells were detected (data not shown). In addition, strong induction of IL-21 secreting T cells was observed (FIG. 6). The presence of IL-21 suggests that the follicular helper T (Tfh) cell response may be responsible for the production of memory B cells and high quality antibodies by mRNA vaccine boosters (fig. 5A, 5B and 7).

Successful vaccination should be able to elicit strong immunological memory, which can respond immediately after secondary antigen exposure. Peripheral Blood Mononuclear Cells (PBMCs) of the subjects were isolated before (day 0) and after (days 7 and 21) booster immunization, and Spike-specific memory B cell levels were detected by flow cytometry, and the results are shown in fig. 7.

The results showed that a small amount of Spike-specific IgG was still detectable in the blood circulation of both subjects 7 months after the second dose of inactivated vaccine (day 0) ⁺ Memory B cells (fig. 7), indicating induction and maintenance of antigen-specific memory B cells. After booster vaccination (days 7 and 21), the apparent increase in specific memory B cells demonstrated further expansion of the Spike-specific memory B cell pool (fig. 7), indicating that sw0123.351a single-needle booster vaccination was able to significantly increase memory B cell levels.

While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

Claims

1. A vaccine combination comprising a first composition and a second composition, wherein

The first composition comprises an inactivated viral antigen of SARS-CoV-2, the first composition being an inactivated whole virus vaccine; and is also provided with

The second composition comprises an mRNA encoding a polypeptide antigen comprising a SARS-CoV-2 spike protein variant having an inactivated furin cleavage site; wherein the inactivated furin cleavage site has the amino acid sequence of QSAQ; the mRNA comprises the nucleotide sequence of SEQ ID NO. 11.

2. The vaccine combination of claim 1, wherein

The first composition comprises an inactivated viral antigen of a SARS-CoV-2KMS-1 strain; and is also provided with

The polypeptide antigen has the amino acid sequence of SEQ ID NO. 3.

3. The vaccine combination of claim 1 or 2, wherein

The mRNA comprises the nucleotide sequence of SEQ ID NO. 13.

4. The vaccine combination of claim 1, wherein

The mRNA comprises a modified uridine.

5. The vaccine combination of claim 1, wherein

100% of the uridine in the mRNA was replaced by 1-methyl pseudouridine.

6. The vaccine combination of claim 1, wherein said second composition further comprises a cationic polymer associated with said mRNA as a complex and lipid particles encapsulating said complex.

7. The vaccine combination of claim 6 wherein said cationic polymer is protamine.

8. The vaccine combination of claim 6 or 7, wherein

The lipid particle comprises M5, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and DMG-PEG 2000, the M5 having the structure:

9. the vaccine combination of claim 8, wherein

The molar ratio of M5, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol and DMG-PEG 2000 was 40:15:43.5:1.5.

10. The vaccine combination of claim 1, wherein the first composition further comprises an adjuvant.

11. The vaccine combination of claim 10, wherein said adjuvant is Al (OH) ₃ 。

12. A kit comprising a first container comprising a first composition as defined in any one of claims 1-2, 10-11 and a second container comprising a second composition as defined in any one of claims 1-9.

13. Use of the vaccine combination according to any one of claims 1-11 for the preparation of a vaccine for the prevention and/or treatment of a SARS-CoV-2 infection or for inducing an immune response against SARS-CoV-2 in a subject in need thereof.