WO2022233241A1 - Pharmaceutical composition containing squalene and mannitol, and use thereof - Google Patents

Abstract

A pharmaceutical composition containing squalene and mannitol, and the use thereof in the preparation of drugs for preventing or treating enteritis. The composition can significantly alleviate the symptoms of enteritis, and mainly can control the levels of inflammatory factors such as IL6, TNFα and IL17A.

Description

Pharmaceutical composition comprising squalene and mannitol and use thereof technical field

The invention belongs to the field of medicine, in particular to a pharmaceutical composition comprising squalene and mannitol and its use in preparing a medicine for preventing or treating enteritis.

Background technique

Colitis and proctitis are diffuse inflammation of the mucosa of the colon and rectum. Colitis is also called nonspecific ulcerative colitis. Chronic inflammation of the gut is closely associated with approximately one in five human cancers. It is mainly caused by a combination of factors such as environmental exposure, diet, genetic polymorphism, and immune response dysfunction. Mouse models play a key role in the study of these diseases. Mouse models of intestinal inflammation can be divided into chemically induced models, genetic models, transitional metastasis models and spontaneous models. Studies in these models have demonstrated persistent antigen exposure in the gut lumen, loss of intestinal epithelial barrier function, dysfunction and dysregulation of innate and adaptive immune responses, and other mechanisms that contribute to chronic intestinal inflammation.

Dextran sodium sulfate (DSS)-induced colitis model in mice. This experimental model of colitis was established by recycling dextran sodium sulfate (DSS) in drinking water. Both acute and chronic colitis can be induced by controlling the dose and duration. In healthy wild-type mice, the main persistent symptoms after DSS administration are massive fecal hemorrhage, diarrhea, and weight loss, especially after cyclic administration, which is usually given to mice for a period of 5-7 DSS around 3% for 7-14 days followed by normal drinking water for 7-14 days. The colonic pathology of this model resembles that of ulcerative colitis, with tissue sections showing erosion of the intestinal epithelial barrier by inflammatory cells and extensive lymphocyte and neutrophil infiltration of ulcerative colitis. Feeding mice four cycles of DSS followed by four months of normal drinking water resulted in the development of chronic inflammation in the colon and subsequent development of colorectal cancer. DSS is thought to induce metabolic toxicity of epithelial cells directly in the basal crypts, which impairs the mucosal barrier of the gut and promotes mucosal invasion by gut microbes and their products. Although DSS itself is not genotoxic, it can directly and indirectly activate macrophages and other inflammatory cells, producing immune-mediated colitis with immune signatures similar to those observed in genetic models.

Studies have shown that the key to the pathogenesis of colitis is the abnormal immune response of the immune system against intestinal flora and food antigens, resulting in inflammatory damage caused by the accumulation of a large number of inflammatory factors in the intestinal tract. There is still no specific treatment for colitis. The main purpose of the existing salicylic acid preparations, glucocorticoids and immunosuppressive drugs is to achieve clinical remission and avoid the occurrence of complications. Long-term use will bring serious adverse effects to patients. Therefore, the search for new treatment methods for colitis has become a hot and difficult point of research at home and abroad.

Squalene (SQ for short) (C ₃₀ H ₅₀ , 2,6,10,15,19,23-6methyl-2,6,10,14,18,22-tetracosahexaene) is An all-trans triterpene compound with a dynamically folded structure in chloroform solution. Since squalene was discovered by Japanese chemist Dr. Honman Maru in 1906, it has attracted the interest of domestic and foreign researchers due to its good biological activity and wide application in food, medicine, cosmetics and other fields. Squalene contains 6 non-conjugated double bonds and has strong antioxidant activity. Squalene is easily emulsified in standard cosmetic formulations (e.g. creams, ointments, sunscreens) and, therefore, can be used in creams (cold creams, cleansers, moisturizers), lotions, hair oils, hair creams, lip balms, It is used as a moisturizing agent in cosmetics such as aromatic oils and powders, and also acts as an antioxidant and free radical scavenger. In addition, squalene can also be used as a high-fat agent for high-end soaps.

The prior art involving squalene is as follows:

CN202010649412 relates to a gynecological gel and a preparation method thereof. A gynecological gel, in parts by weight, at least comprises the following components: 20-50 parts of plant active substances, 10-30 parts of squalene, and the like.

CN202010229789 provides a squalene oxygen injection composition, in parts by weight, the raw materials at least comprise: 2-8 parts of plant extracts, 1-3 parts of skin conditioners, 0.3-1.5 parts of compound essential oils, 0.5-2.5 parts of lactic acid bacteria A fermentation product; the skin conditioning agent includes at least squalene.

CN202010198469 discloses a cationic squalene liposome and a preparation method thereof, which provide a basis for squalene to be used in immune enhancers, vaccine adjuvants and other drug delivery systems.

CN201810448569 discloses a preparation method of soybean squalene microcapsules. The pre-obtained squalene is subjected to a complex coacervation method, and gelatin and gum arabic (1:1) are used as wall materials to prepare microcapsules that are uniformly dispersed and embedded. Good soy squalene microcapsules.

CN201710103776 relates to a vitamin D preparation containing squalene vegetable oil.

CN201510065477 provides a preparation method of a nanoemulsion vaccine adjuvant, using squalene as an oil phase.

CN201410210662 discloses a preparation method of squalene microcapsules, using squalene as core material, sorbitan fatty acid ester or polysorbate as oil phase emulsifier, using gelatin-acacia-maltodextrin-sucrose ester as composite wall.

Mannitol, also known as mannitol, is an isomer of sorbitol, the molecular formula is C ₆ H ₁₄ O ₆ , and the molecular weight is 182.17 g/mol. It is easily soluble in water, is a white and transparent solid, has a sweet taste similar to sucrose, and can also be used as a sweetener. Mannitol is a good diuretic in medicine, reducing intracranial pressure, intraocular pressure and treating kidney medicine, dehydration medicine, sugar substitute, and also used as an excipient for tablets and a diluent for solid and liquid.

SUMMARY OF THE INVENTION

The purpose of the present invention is to study the effect of a composition comprising squalene and mannitol and intestinal inflammation. The inventor's research found that the preparation containing squalene and mannitol can act as an immunomodulator, activate the body's innate immune response, enhance the immune tolerance function of the colorectum, and thereby regulate the inflammatory response of intestinal disorders.

In view of this, the present invention realizes through the following technical solutions:

One aspect of the present invention provides a composition for preventing or treating enteritis, characterized in that: the composition comprises squalene and mannitol.

The dosage form of the composition may be an emulsion, or other formulations in the art that facilitate the absorption of squalene and mannitol into the human body.

Preferably, the composition further comprises an emulsifier. Preferably, the composition further comprises water.

Preferably, the emulsifier is selected from one or more of cationic surfactants, anionic surfactants, zwitterionic surfactants and nonionic surfactants. Described non-ionic surfactant is selected from fatty acid sorbitans (that is, spans), polysorbates (that is, Tween), polyoxyethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, polyoxyethylene- Polyoxypropylene copolymers, polyoxyethylene-polyoxypropylene block copolymers, monoglycerol fatty acid esters, triglyceride fatty acid esters, polyoxyethylene castor oil, polyglycerol fatty acid esters, sucrose fatty acid esters and One or more of glycerol monostearate;

The anionic surfactant is one selected from the group consisting of sodium stearate, potassium stearate, sodium oleate, potassium oleate, calcium stearate, sodium lauryl sulfate and cetyl sulfated castor oil. species, or a mixture of two or more;

Preferably, the emulsion is selected from: Tween 80, Span 80, sodium lauryl sulfate, polyglycerol fatty acid ester or polyoxyethylene castor oil;

Preferably, the emulsifier is Tween 80.

Preferably, in terms of weight percentage, based on the total weight of the composition as 100%, the squalene accounts for 0.001-30%, preferably 0.2-15%, more preferably 0.2-5%, still more preferably 0.2%, 0.5%, 1%, 3%, 10%, 15%, 20%, or 25%, more preferably 0.2%;

Preferably, the mannitol accounts for 0.001-30%, preferably 0.5-15%, more preferably 1-10%, still more preferably 0.2%, 0.5%, 1%, 3%, 10%, 15%, 20%, or 25%, more preferably 5%;

Preferably, the emulsifier accounts for 0.001-30%, preferably 0.05-15%, more preferably 0.1-5%, still more preferably 0.2%, 0.5%, 1%, 3%, 10%, 15%, 20%, or 25%, more preferably 0.5%.

Preferably, the composition further contains other pharmaceutically acceptable carriers or excipients.

Preferably, the pharmaceutically acceptable carrier or adjuvant contains one or more of preservatives, co-emulsifiers, antioxidants and flavoring agents.

Preferably, the co-emulsifier is selected from: methyl cellulose, sodium carboxymethyl cellulose, carboxypropyl cellulose, sodium alginate, agar, tragacanth, gum arabic, xanthan gum, guar gum , one or more of pectin, bentonite, cetyl alcohol, beeswax, glycerol monostearate, stearic acid, stearyl alcohol, glycerin, polyethylene glycol, polyglycerol ester and povidone.

Preferably, the antioxidant is selected from sodium sulfite, sodium bisulfite, sodium thiosulfate, sodium metabisulfite, ascorbic acid, propyl gallate, ascorbyl palmitate, tert-butyl-parahydroxyanisole, di-tert-butylparaben One or more of cresol and vitamin E.

Preferably, the flavoring agents are pharmaceutically acceptable sweeteners, mucilage agents, and aromatic agents.

Preferably, the sweetener includes one or more of inulin, sucrose, steviol glycosides, sodium saccharin, aspartame and sucralose.

Another aspect of the present invention provides a use of the above composition in the preparation of a medicament for preventing or treating enteritis;

Preferably, the enteritis is colitis or proctitis.

Preferably, the colitis is ulcerative colitis.

Preferably, the composition is a combination of squalene, mannitol and tween.

Further preferably, the components of the composition are: 0.2% squalene, 5% mannitol, 0.5% Tween 80, and the balance is water.

The emulsion of the present invention can be prepared by the following emulsification methods: phase inversion emulsification method, PIT emulsification method, alternate liquid addition emulsification method, ultrasonic emulsification method, low energy emulsification method, microfluidization method, high pressure homogenization method and the like.

The emulsification equipment of the present invention can be selected from a constant temperature magnetic stirrer, a colloid mill, a high-speed disperser, an ultrasonic emulsifier, a high-speed stirrer, a high-pressure homogenizer, and the like.

Preferably, the emulsion can be prepared by the following method: mix the components according to the prescription, prepare a medicinal liquid, and add the medicinal liquid into a high-pressure homogenizer (for example, JN-10HC high-pressure homogenizer, Guangzhou Juneng Company). Homogenize in the sample cup and set the pressure to 100-5000 bar to form an emulsion of the above components. The above pressure can also be 200, 400, 500, 900, 1500, 2000, or 5000 bar, etc.

Beneficial effects of the present invention:

Oral administration of CKJ-A can significantly improve the DSS-induced enteritis phenotype in mice, and its main target is to significantly change the intestinal tract by inhibiting the number of macrophages, myeloid suppressor cells and dendritic cells. The expression level of intestinal inflammatory factors ultimately protects the survival of epithelial cells and maintains the integrity of intestinal epithelial tissue. CKJ-A can improve the symptoms of enteritis, mainly can control the levels of inflammatory factors IL6, TNFα, IL17A and so on. The results from the mouse animal model show that the therapeutic effect of CKJ-A is comparable to that of the clinical drug mesalazine (also known as 5-aminosalicylic acid, 5-ASA). At the same time, the composition of the present invention reduces the production cost, and only 0.2% of the active ingredients squalene and mannitol can obtain a significant therapeutic effect.

Description of drawings

Figure 1 is a diagram of the treatment process of the mice in the intervention group;

Figure 2. Changes in body weight of mice in the control group and the intervention group;

Figure 3. Changes in the disease activity index of mice in the control group and the intervention group;

Figure 4. The intestinal length diagram of mice in the control group and the intervention group;

Figure 5 HE staining results and statistics of mice in the control group and the intervention group (20×);

Figure 6. Results and statistics of intestinal permeability of mice in the control group and the intervention group (40×);

Figure 7 Changes in intestinal immune cells of mice in the control group and the intervention group;

Figure 8 Changes of intestinal immune factors in mice in the control group and the intervention group.

Detailed ways

The concept of the present invention and the resulting technical effects will be clearly and completely described below with reference to the embodiments and accompanying drawings, so as to fully understand the purpose, features and effects of the present invention. The following examples are intended to illustrate the present invention by way of example, and are not intended to limit the protection scope of the present invention.

The present invention takes mice induced with acute ulcerative colitis as experimental objects, and studies the relationship between the composition comprising squalene and mannitol and ulcerative colitis. Preferably the composition further comprises an emulsifier (Tween 80).

The colonic mucosa of mice induced with acute ulcerative colitis was severely damaged, with obvious congestion and edema, extensive erosions, deep ulceration, damaged glands and disordered arrangement, and a large number of lymphocytes and neutrophils were seen in the mucosa and submucosa. Infiltration of cells, the degree of mucosal damage in mice after intragastric administration of a composition emulsion (CKJ-A) containing mannitol, squalene and an emulsifier (Tween 80) was significantly reduced, the colonic mucosa was intact, and some mild congestion was seen Edema and a small amount of inflammatory cell infiltration, enteritis disease activity index score is lower than the control saline group, the experiment shows that the composition emulsion containing mannitol and squalene has preventive and therapeutic effects on induced colitis. The intestinal permeability of the control saline group was higher than that of the composition emulsion intervention group, indicating that the composition emulsion intervention containing mannitol and squalene could reduce the intestinal permeability of colitis, thereby improving the symptoms of colitis in mice. The infiltration of intestinal immune cells (macrophages, suppressive myeloid cells and dendritic cells) in the control group was significantly higher than that in the composition emulsion intervention group, and the expression levels of immune factors (TNFα, IL6 and IL17A) were also significantly higher than those in the combination The composition emulsion intervention group showed that the composition emulsion intervention containing mannitol and squalene had the effect of inhibiting inflammation. However, mannitol emulsion (CKJ-T) and squalene emulsion (CKJ-Z) alone had no obvious effect, and had no significant improvement on enteritis.

Example

1. Preparation example: All the components need to use a JN-10HC high-pressure homogenizer (Guangzhou Juneng Company) for homogeneous emulsification. In weight percent, the balance is water.

Preparation Example 1: Squalene Emulsion (Squalene 0.2% + Tween 80 0.1%)

Preparation Example 2: Mannitol Emulsion (Mannitol 3% + Tween 80 0.1%)

Preparation Example 3: Composition Emulsion (Squalene 0.2% + Mannitol 3% + Tween 80 0.1%)

Preparation example 4: composition emulsion (squalene 0.2% + mannitol 3% + polyglycerol fatty acid ester 0.1%)

Preparation Example 5: Composition Emulsion (Squalene 0.2% + Mannitol 5% + Span 80 0.1%)

Preparation Example 6: Composition Emulsion (Squalene 0.2% + Mannitol 3% + Sodium Lauryl Sulfate 0.1%)

Preparation example 7: composition emulsion (squalene 0.2% + mannitol 3% + polyoxyethylene castor oil 0.1%)

Preparation Example 8: Composition Emulsion (Squalene 0.01% + Mannitol 0.1% + Tween 80 0.1%)

Preparation Example 9: Composition Emulsion (Squalene 30% + Mannitol 3% + Tween 80 0.1%)

Preparation Example 10: Composition Emulsion (Squalene 10% + Mannitol 30% + Tween 80 15%)

Preparation Example 11: Composition Emulsion (Squalene 5% + Mannitol 8% + Tween 80 5%)

Preparation Example 12: Composition Emulsion (Squalene 0.5% + Mannitol 2% + Tween 80 0.5%)

Preparation Example 13: Composition Emulsion (Squalene 0.5% + Mannitol 2% + Tween 80 10%)

Preparation Example 14: Composition Emulsion (Squalene 0.2% + Mannitol 5% + Tween 80 0.5% + Appropriate amount of methyl cellulose + appropriate amount of sodium sulfite + appropriate amount of inulin)

Preparation Example 15: Composition Emulsion (Squalene 0.2% + Mannitol 5% + Tween 80 0.5% + Guar Gum Appropriate amount + Sodium Sulfite Appropriate Approach + Inulin Approach)

Preparation example 16: composition emulsion (squalene 0.2% + mannitol 5% + Tween 80 0.5% + inulin appropriate amount)

2. Effect experiment

Experimental animals and groups

Thirty-five male, 6-8 week old, C57BL/6J healthy mice were purchased from Shanghai Slack Laboratory Animal Co., Ltd. Randomly divided into five groups, 7 in each group, divided into control saline group, CKJ-T (mannitol emulsion, preparation example 2), CKJ-Z (squalene emulsion, preparation example 1), CKJ-A (composition Emulsion, preparation example 3), positive control group (mesalazine). In this experiment, dextran sulfate sodium salt (DSS) was used to model mice.

Preparation of the IBD model

Acute ulcerative colitis was induced by drinking 2.5% DSS solution in experimental mice. On the 1st, 3rd, 5th, and 7th days after the start of DSS treatment, intragastric administration was performed, and the dosage was 200 microliters per animal. The treatment process is shown in Figure 1. During the experiment, the weight changes, fecal shape and blood in the stool of the mice were recorded every day, and the final statistical analysis was carried out; the mice were sacrificed on the 9th day, and two sections of intestinal tissue (0.5 cm near the anus were used for slicing, and 1 cm upward was used for extraction). RNA) was used for subsequent histopathological and immunopathological analysis.

3. Experimental results

Changes in mouse body weight:

The body weights of the five groups of mice were measured, and their body weight changes are shown in Table 1 and Figure 2. The mice in the experimental group had loose stools with mucus about 3 days after the model was established, and the symptoms gradually increased, and the symptoms became more serious about 5 days. Symptoms such as pus and bloody stools, weight loss, weight loss, dull hair, significantly reduced diet, chills, laziness, etc., will appear in about 5 days with loose mucus, weight loss, weight loss, dull hair, significantly reduced diet, fear Cold, lazy movement and other symptoms; pus and blood in the stool, weight loss, significantly reduced diet, chills, lazy movement and other results showed that the experimental group had obvious colitis, indicating that the IBD model was successfully established.

Table 1. Changes in body weight of mice

The results show that: from the results in Table 1, it can be seen that CKJ-T and CKJ-Z, compared with the normal saline group, have no significant difference in body weight, while CKJ-A has a significant effect on reducing the weight loss of mice, basically reaching Mesalamine levels.

For the compositions of Preparation Examples 4-16, the inventors conducted the same experiment, and the experimental results showed that the body weight of mice was between 87-90 on the 9th day, which was also significantly higher than that of CKJ-T and CKJ-Z.

Mouse Disease Activity Index:

Scoring criteria for the severity of colitis injury: Combined with this experiment, the disease activity index (DAI) score of colitis was carried out with reference to the criteria of Suthceland LR. The specific scoring criteria were: formed granular stool, negative occult blood test score of 0; loose and non-adherent Semi-granular stools in the anus, such as negative occult blood score 1, positive occult blood test score 2; liquid stools adhered to the anus, positive occult blood test score 3, bloody stools with visible blood score 4.

The severity of colitis injury in the test group was evaluated, and the DAI of the mice in the 5 groups was calculated every day. The results are shown in Table 2 and Figure 3.

Table 2. Mouse Disease Activity Index

mean ± standard error	Control saline	Mesalamine	CKJ-A	CKJ-T	CKJ-Z
Day 0	0.00	0.00	0.00	0.00	0.00
Day 1	0.00	0.10±0.06	0.00	0.05±0.05	0.05±0.05
Day 2	0.00	0.00	0.05±0.05	0.00	0.05±0.05
3rd day	0.38±0.05	0.33±0.00	0.43±0.10	0.38±0.05	0.48±0.07
Day 4	0.43±0.06	0.33±0.00	0.48±0.10	0.52±0.10	0.81±0.12
Day 5	0.76±0.14	0.52±0.07	1.19±0.12	1.00±0.15	1.29±0.17
Day 6	1.57±0.28	1.00±0.07	1.48±0.18	1.90±0.12	2.29±0.13
Day 7	2.52±0.14	1.71±0.11	2.10±0.14	2.43±0.16	2.95±0.13
Day 8	3.10±0.12	1.81±0.18	2.43±0.06	2.86±0.12	3.19±0.10

Day 9

3.19±0.10

1.90±0.19

2.57±0.10

2.95±0.13

3.24±0.06

The results showed that the DAI of the CKJ-A administration group was significantly higher than that of the control saline group and CKJ-T and CKJ-Z, and the results showed that CKJ-A could significantly improve the colitis injury in mice.

Changes in mouse gut length:

The five groups of mice were sacrificed on the 9th day, and the whole colon was taken out, and the colon of the five groups of mice was roughly morphologically observed. The results are shown in Figure 4 . See Table 3 and Figure 4. The experimental results show that the colon in the test group is shortened, with obvious congestion and edema, and there is a large area of erosion; however, after CKJ-A treatment, the colonic edema and erosion are lighter than those in the control saline group and the single administration group. The area is small, indicating that CKJ-A has obvious therapeutic effect.

Table 3. Changes in mouse gut length

	Control saline	Mesalamine	CKJ-A	CKJ-T	CKJ-Z
mean ± standard error	4.17±0.23	5.10±0.20	5.09±0.23	4.41±0.16	4.37±0.15

For Preparation Examples 4-16, the inventors conducted the same experiment, and the experimental results showed that the intestinal changes of mice were significantly better than those of CKJ-T and CKJ-Z.

Hematoxylin-eosin (HE) staining results:

Partial colon tissues of five groups of mice were taken, washed with PBS, and fixed with formic acid solution for 24 hours. The dehydration process proceeds from low-concentration ethanol to high-concentration ethanol. Putting the specimen in 70% ethanol for a short period of time can not only dehydrate the specimen, but also continue to fix the specimen. At the beginning of film production, after the specimens were immersed in 80% ethanol overnight, they were immersed in 95% ethanol for two times, each for 2 h each time, 100% ethanol twice for each time, 1.5 h each time, and xylene transparent twice for 40 min each. /Second-rate. In the transparent process, observe the degree of transparency with the naked eye to avoid insufficient or excessive transparency. Paraffin 3 times, 30min, 1h and 1.5h respectively, routinely immersed in paraffin (the melting point of embedding wax is 58℃～60℃), cut out 5um thick wax slices, unfold the slices in a 42℃ water bath, and bake the slices conventionally. The baked wax slices were dewaxed twice with xylene, each 10min/time, and rehydrated with absolute ethanol and 95% ethanol to 70% ethanol gradually, 2min for each stage, after 3min in distilled water, hematoxylin staining for 15min, 1 Differentiate with % hydrochloric acid alcohol for 30s, rinse with running water for 20min, stain with eosin for 2min, permeate with water, 95% ethanol for 2min, 100% ethanol for 2min, xylene for 2 times, each 5min/time, and seal with neutral gum.

Histological scoring criteria: ① Inflammation: none: 0 points, mild: 1 point, moderate: 2 degrees, severe: 3 points; ② Goblet cells: no disappearance: 0 points, disappearance: 1 point; ③ Lesion depth : None: 0 points, submucosa: 1 point, muscularis: 2 points, serosa: 3 points; ④Ulcer: None: 0 points, Erosion: 1 point, Ulcer: 2 points; ⑤Crypt abscess: None: 0 points, yes: 1 point.

The results are shown in Table 4 and Figure 5. The colonic mucosa of the mice in the control saline group was severely damaged, with obvious congestion and edema, extensive and large-area erosion, formation of deep ulcers, destruction of the glands and disordered arrangement, and a large number of lymphocytes in the mucosa and submucosa. , neutrophil infiltration. The degree of mucosal damage in the mice in the CKJ-A administration group was significantly reduced, and the colonic mucosa was intact, with some mild hyperemia and edema and a small amount of inflammatory cell infiltration, indicating that CKJ-A has a significant therapeutic effect.

Table 4. Hematoxylin-eosin (HE) staining results

	Control saline	Mesalamine	CKJ-A	CKJ-T	CKJ-Z
mean ± standard error	6.29±0.29	4.86±0.26	5.00±0.22	7.00±0.31	7±0.31

Changes in intestinal permeability:

The paraffin sections of mouse colorectal tissue were placed in an incubator at 72 °C overnight, dewaxed with xylene, hydrated with gradient alcohol, antigen retrieval with sodium citrate, dropped with blocking solution, added with 1:100 anti-occludin primary antibody, overnight at 4 °C, and the first After 2 days, the slices were taken out, and the appropriate secondary antibody working solution was added dropwise to incubate at room temperature for 30 minutes. Diaminobenzidine (DAB) developed color, and the color development time was controlled under the microscope. The distribution characteristics of occludin in intestinal epithelial cells were observed under low magnification, and 5 concentrated occludin staining areas were selected from each section, counted under high magnification (×200), and the average value was obtained. Intestinal permeability experiments were performed on five groups of mice. The results are shown in Table 5 and Figure 6. The results showed that the intestinal permeability of the CKJ-A administration group was significantly lower than that of the control saline group, indicating that the use of CKJ-A A can significantly reduce the intestinal permeability of DSS-induced colitis.

Table 5. Changes in occludin positive cells

	Control saline	Mesalamine	CKJ-A	CKJ-T	CKJ-Z
mean ± standard error	48.29±1.55	66.57±1.78	70.00±2.05	49.86±1.20	49.29±0.97

Intestinal immune cell infiltration analysis:

Part of the large intestine was placed in pre-warmed HBSS buffer at 37°C to remove fat, connective tissue, and lymph nodes, and the contents were washed to clean; HBSS buffer, 37 °C water bath for 15 minutes, shake vigorously every 5 minutes; filter through a 200-mesh cell sieve, discard the supernatant, transfer the tissue block to a 50 ml centrifuge tube, add 25 ml of 37 °C preheated HBSS buffer, 37°C water bath for 15 minutes, shake vigorously every 5 minutes; filter through a 200-mesh cell sieve, discard the supernatant, transfer the tissue block to a 50 mL centrifuge tube, add 25 mL of pre-warmed RPMI washing buffer at 37°C, and water bath at 37°C for 15 minutes shake vigorously every 5 minutes; filter through a 200-mesh cell sieve, discard the supernatant, transfer the tissue block to a 50-mL centrifuge tube, add 15 mL of pre-warmed collagenase/DNase mixture at 37°C, and water bath at 37°C for 60 minutes , shake vigorously every 5 minutes; filter with 200 mesh cell sieve, wash the mesh with RPMI washing buffer, then filter with 400 mesh cell sieve, transfer the filtrate to a 50 ml centrifuge tube, and centrifuge at 1200 rpm for 5 minutes. Then, intestinal immune cell infiltration was analyzed by flow cytometry by labeling different surface molecules with antibodies. The results are shown in Tables 6-8 and Figure 7, CKJ-A can inhibit macrophages, myeloid suppressor cells (mainly refers to immature granulocytes, macrophages and dendritic cells) and dendritic cells in the intestine. However, the effect of CKJ-T and CKJ-Z on related immune cells was not significant.

Changes in intestinal immune factors:

Total RNA was extracted from tissue cells using TRIzol reagent and according to the kit instructions, and the RNA was reverse transcribed into cDNA using a reverse transcription kit. Amplification was performed using the first strand of the synthesized cDNA as a template (according to the instructions of the SYBR Green kit). △Ct=Ct _{target gene} -Ct _β-actin , △△Ct=△Ct _treatment group-△Ct _{control group} . The relative difference in the expression of the target gene of different samples = 2 ^-ΔΔCt , the primer sequences are shown in Table 12, and the experiment was repeated more than 3 times. As shown in Tables 9-11 and Figure 8, CKJ-A can significantly inhibit the expression levels of pro-inflammatory factors (TNFα, IL6 and IL17A).

Table 6. Percent Macrophage Infiltration

Table 7. Percent Myeloid Suppressive Cell Infiltration

	Control saline	Mesalamine	CKJ-A	CKJ-T	CKJ-Z
mean ± standard error	15.23±1.63	7.44±0.97	7.40±1.34	17.08±2.49	16.45±1.00

Table 8. Percent Dendritic Cell Infiltration

	Control saline	Mesalamine	CKJ-A	CKJ-T	CKJ-Z
mean ± standard error	12.68±1.74	9.39±0.82	10.65±1.07	14.38±1.55	13.91±0.96

Table 9. TNFα expression levels

Control saline

Mesalamine

CKJ-A

CKJ-T

CKJ-Z

mean ± standard error

0.99±0.07

0.37±0.07

0.27±0.03

0.97±0.14

1.42±0.15

Table 10. IL6 expression levels

	Control saline	Mesalamine	CKJ-A	CKJ-T	CKJ-Z
mean ± standard error	1.00±0.13	0.32±0.10	0.31±0.11	0.90±0.21	1.37±0.25

Table 11. IL17A expression levels

	Control saline	Mesalamine	CKJ-A	CKJ-T	CKJ-Z
mean ± standard error	1.00±0.05	0.41±0.04	0.36±0.04	1.24±0.05	1.42±0.12

Table 12 Inflammatory factor primer sequence information

gene name	Forward primer (5'to 3')	Reverse primer (5'to 3')
β-Actin	GAGCGCAAGTACTCTGTGTG	CGGACTCATCGTACTCCTG
TNF-α	TCAGCCGATTTGCTATCTCA	CGGACTCCGCAAAGTCTAAG
IL-6	CACGGCCTTCCCTACTTCAC	TGCAAGTGCATCATCGTTGT
IL-17A	GCTCCAGAAGGCCCTCAG	CTTTCCCTCCGCATTGACA

Claims (11)

1. A composition for preventing or treating enteritis, characterized in that: the composition comprises squalene and mannitol.
2. The composition according to claim 1, characterized in that, the composition further comprises an emulsifier.
3. The composition according to claim 2, wherein the emulsifier is selected from: one or more of cationic surfactants, anionic surfactants, zwitterionic surfactants and nonionic surfactants; Preferably it is a nonionic surfactant or an anionic surfactant;

   Preferably, the nonionic surfactant is selected from: fatty acid sorbitans, namely Spans, polysorbates, namely Tweens, polyoxyethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, polyoxyethylene- Polyoxypropylene copolymers, polyoxyethylene-polyoxypropylene block copolymers, monoglycerol fatty acid esters, triglyceride fatty acid esters, polyoxyethylene castor oil, polyglycerol fatty acid esters, sucrose fatty acid esters and One or more of glycerol monostearate;

   Preferably, the anionic surfactant is selected from the group consisting of sodium stearate, potassium stearate, sodium oleate, potassium oleate, calcium stearate, sodium lauryl sulfate and cetyl sulfated castor oil one, or a mixture of two or more;

   Preferably, the emulsifier is selected from: Tween 80, Span 80, sodium lauryl sulfate, polyglycerol fatty acid ester or polyoxyethylene castor oil;

   Preferably, the emulsifier is Tween 80.
4. The composition according to claim 3, wherein the squalene accounts for 0.001-30%, preferably 0.2-15%, more preferably 0.001-30% by weight, based on 100% of the total weight of the composition 0.2-5%, still more preferably 0.2%, 0.5%, 1%, 3%, 10%, 15%, 20%, or 25%, still more preferably 0.2%;

   Preferably, the mannitol accounts for 0.001-30%, preferably 0.5-15%, more preferably 1-10%, still more preferably 0.2%, 0.5%, 1%, 3%, 10%, 15%, 20%, or 25%, more preferably 5%;

   Preferably, the emulsifier accounts for 0.001-30%, preferably 0.05-15%, more preferably 0.1-5%, still more preferably 0.2%, 0.5%, 1%, 3%, 10%, 15%, 20%, or 25%, more preferably 0.5%.
5. The composition according to any one of claims 1-4, characterized in that, the composition further contains other pharmaceutically acceptable carriers or adjuvants.
6. The composition according to claim 5, wherein the pharmaceutically acceptable carrier or adjuvant comprises one or more of co-emulsifiers, antioxidants, flavoring agents and preservatives.
7. The composition according to claim 6, wherein the co-emulsifier is selected from the group consisting of: methyl cellulose, sodium carboxymethyl cellulose, carboxypropyl cellulose, sodium alginate, agar, and tragacanth , gum arabic, xanthan gum, guar gum, pectin, bentonite, cetyl alcohol, beeswax, glycerol monostearate, stearic acid, stearyl alcohol, glycerin, polyethylene glycols, polyglycerol esters and One or more of povidone.
8. The composition according to claim 6 or 7, wherein the antioxidant is selected from the group consisting of: sodium sulfite, sodium bisulfite, sodium thiosulfate, sodium metabisulfite, ascorbic acid, propyl gallate, ascorbyl palmitate , one or more of tert-butyl-p-hydroxyanisole, di-tert-butyl-p-cresol and vitamin E.
9. The composition according to any one of claims 6-8, wherein the flavoring agent is a pharmaceutically acceptable sweetener, mucilage or aromatic; preferably, the sweetener is selected from From: one or more of inulin, sucrose, steviol glycosides, sodium saccharin, aspartame and sucralose.
10. The composition according to any one of claims 1-9, wherein the dosage form of the composition is an emulsion.
11. Use of the composition of any one of claims 1-10 in the preparation of a medicament for preventing or treating enteritis;

    Preferably, the enteritis is colitis or proctitis;

    Preferably, the colitis is ulcerative colitis.

Images