Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
  • A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
  • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P13/00—Drugs for disorders of the urinary system
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/1096—Transferases (2.) transferring nitrogenous groups (2.6)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y206/00—Transferases transferring nitrogenous groups (2.6)
  • C12Y206/01—Transaminases (2.6.1)
  • C12Y206/01044—Alanine--glyoxylate transaminase (2.6.1.44)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y206/00—Transferases transferring nitrogenous groups (2.6)
  • C12Y206/01—Transaminases (2.6.1)
  • C12Y206/01051—Serine--pyruvate transaminase (2.6.1.51)
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2217/00—Genetically modified animals
  • A01K2217/07—Animals genetically altered by homologous recombination
  • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2227/00—Animals characterised by species
  • A01K2227/10—Mammal
  • A01K2227/105—Murine
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2267/00—Animals characterised by purpose
  • A01K2267/03—Animal model, e.g. for test or diseases
  • A01K2267/0306—Animal model for genetic diseases
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/16011—Human Immunodeficiency Virus, HIV
  • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
  • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2800/00—Nucleic acids vectors
  • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE

Definitions

• the present invention can be included in the field of gene therapy, particularly in the treatment of Primary Hyperoxaluria type 1.
• the present invention relates to a lentiviral vector for gene therapy, capable of treating Primary Hyperoxaluria type 1.
• PH1 Primary Hyperoxaluria Type 1 (OMIM#259900) is an inherited rare autosomal recessive metabolic disease. It is caused by a deficiency in the alanine:glyoxylate aminotransferase (AGT; EC 2.6.1.44) enzyme, encoded by the AGXT gene. AGT activity is limited to hepatic peroxisomes in humans. This enzyme is only active intracellularly and is not secreted into the extracellular space. PH1 is characterized by an overproduction of oxalate in the liver. Oxalate is an end product of metabolism in mammals that is normally excreted by the urine.
• AGT alanine:glyoxylate aminotransferase
• the kidney When produced in large amounts, the kidney is the first organ affected due to the aggregates of calcium oxalate (CaOx) that are formed in the urinary space (urolithiasis) and renal tissue (nephrocalcinosis), causing interstitial fibrosis and renal failure. As a result of renal damage, the glomerular filtration rate (GFR) decreases and chronic kidney disease rises. Ultimately, around 60% of PH1 patients progress to end-stage renal disease by the age of 40. Subsequent systemic involvement, with widespread CaOx precipitation, called oxalosis, put life at risk for PH1 patients (Cochat et al., 2012; Sas et al., 2020).
• CaOx calcium oxalate
• Gene therapy has the potential to be curative with one-time dosing, by restoring AGT activity through delivery of a functional copy of the AGXT gene.
• gene therapy for inherited metabolic liver diseases is mostly based on in vivo approaches. Liver sinusoidal endothelial cells have a fenestrated structure, facilitating access and gene transfer to hepatocytes (Piccolo & Brunetti-Pierri, 2015).
• AAV vectors are widely adopted for in vivo liver-directed gene therapy, given their remarkable safety and efficacy profile shown in pre-clinical models and clinical trials.
• AAV-vector based gene transfer to the liver of clotting factors for the treatment of the coagulation disorder hemophilia is among the most successful applications of gene therapy (George et al.
• Lentiviral vectors are attractive vehicles for liver gene therapy, by virtue of their ability to stably integrate in the genome of target cells and the low prevalence of pre-existing immunity against vector components in humans.
• the use of a LV harbouring FIX for the treatment of Haemophilia B has shown promising results in mice, dogs and non-human primates (Annoni et al., 2013; Cantore et al., 2015; Milani et al., 2019).
• LV based on the vector used for the treatment of Haemophilia B will be used.
• LV are designed to target transgene expression to hepatocytes by a combination of transcriptional (synthetic liver-specific promoter) and post-transcriptional control (microRNAs 142 target sequences, specific for hematopoietic cells, responsible for the degradation of any mRNA from the vector that are ectopically expressed in antigen presenting cells in liver and spleen) (Annoni et al., 2013).
• the proposed LV includes an enhanced version of AGXT that confers a higher stability to the protein (Mesa-Torres et al., 2014).
• FIG. 1 Lentiviral vector constructs.
• the developed reporter lentiviral vector expresses an eGFP gene which codifies for Green Fluorescence Protein (GFP). Hepatocyte-specific expression of this transgene is achieved due to the presence of two different transcriptional control elements, a specific hepatic promoter (TTR) composed of a synthetic enhancer, a murine TTR enhancer and a part of the murine TTR promoter, and four target sequences of a hematopoietic specific miRNA-142-3 to block the transgene expression in Antigen Presenting Cells (APCs) and, therefore, the development of an immune response.
• TTR specific hepatic promoter
• APCs Antigen Presenting Cells
• Therapeutic lentiviral vector LV.ET.AGXT- RHEAM.142-3pT. It was developed from the same lentiviral vector structure, as the reporter lentiviral vector, and expresses an improved version of the AGXT gene, AGXT-RHEAM, with five amino acid changes, which codifies for a more active form of AGT protein As well as in reporter LV, hepatocyte-specific expression of the therapeutic transgene is achieved due to the presence of two different transcriptional control elements, a specific hepatic promoter (TTR) and four repetitions of a target sequence of a hematopoietic specific miRNA-142-3.
• TTR specific hepatic promoter
• FIG. 1 In vivo testing protocol of the gene therapy approach efficacy study. To study the efficacy of the proposed strategy two kinds of experiments were performed. A. C57BL/6 adult male mice were intravenously injected with a single dose of reporter lentiviral vector and were sacrificed four weeks later. Afterwards, the number of genome copies of the lentiviral vector integrated, as well as the percentage of transduced cells were analysed in the target tissue, the liver, to determine the transduction efficacy. Moreover, a biodistribution study was performed to determine the security of the procedure, by analysis of vector copy number (VCN) in spleen, lungs, bone marrow, lymph nodes, thymus, brain, testicles, pancreas, and kidneys. B.
• VCN vector copy number
• mice were intravenously injected with different doses of the therapeutic lentiviral vector.
• three different control groups were included, two of them composed of Agxtt 1 mice non-injected or injected with the reporter lentiviral vector, and the other one composed of non-injected C57BL/6 wild-type mice.
• All mice groups were subjected to an ethylene glycol challenge, in which they were supplemented with 0.5% ethylene glycol in drinking water, to induce overloading in oxalate production.
• urine oxalate concentration and weight two different PH1 end-points, were measured.
• mice were sacrificed, and kidney damage was defined. After the sacrifice, the transduction efficacy of the therapeutic lentiviral vector was analyzed by VCN and AGXT expression in liver. In reporter lentiviral vector injected Agxtt 1 mice percentage of transduced cells was also analysed to complete the results obtained with the therapeutic lentiviral vector.
• FIG. 4 AGXT expression analysis in the liver of Agxtt 1 injected mice after the in vivo lentiviral vector treatment. Comparison with physiological mouse Agxt expression in C57BL/6 wild-type mice. AGXT expression in therapeutic lentiviral vector injected Agxtt 1 mice was analysed by RT-qPCR. Representation of AGXT expression representation was referred to a housekeeping gene.
• msTbp low level of expression
• msActb high level of expression
• A. AGXT expression referred to msTbp expression in the liver of LV.ET.AGXT-RHEAM.142-3pT injected Agxtt 1 mice and non-injected wild-type mice.
• Non-injected Agxtt 1 mice did not show AGXT expression.
• AGXT expression referred to ms Actb expression in the liver of LV.ET.AGXT-RHEAM.142-3pT injected Agxtt 1 mice and non-injected wild-type mice.
• Agxt physiological expression referred to ms Actb was 340.5 % (141-374.5). Although the differences in Agxt expression levels depending on the housekeeping gene, differences among groups were maintained.
• Figure 5. Percentage of transduced cells in reporter lentiviral vector C57BL/6 and Agxtt 1 injected mice. Percentage of eGFP expressing hepatocytes in liver sections of reporter lentiviral vector injected wild-type C57BL/6 and Agxtt 1 mice was defined by immunostaining and following image analysis by QuPath ® software. A-E. Representative images of immunostaining for eGFP in liver sections of all mice groups. Green: eGFP; blue: nuclei stained with DAPI. F-H.
• FIG. 6 Biodistribution analysis. To determine the safety of the proposed therapeutic strategy, the number of lentiviral vector integrated genomes was analysed in C57BL/6 wild type mice injected with two different doses of the reporter lentiviral vector. The number of LV genome copies integrated into different tissues of injected wild-type C57BL/6 mice was analysed by qPCR. Integration of reporter lentiviral vector genome was only observed in liver, the target tissue, and in lungs, spleen, and bone marrow.
• PH1 end-points Weight evolution during ethylene glycol challenge. Weight progress was analysed during the ethylene glycol challenge. Animal weight was measured at a basal time point before the challenge and on days 3 and 7 of the challenge. In this figure, the gain or loss in weight of each animal to the basal weight is represented. Two different negative control groups are represented, one composed of Agxtt 1 non-injected mice and the other one composed of Agxtt 1 mice injected at two different doses of LV.ET.GFP.142-3pT (1.4-10 8 TU/mouse and 5- 10 8 TU/mouse). It is also included a positive control group composed of wild-type C57BL/6 non-injected mice.
• Therapeutic lentiviral vector injected Agxtt 1 mice are divided into three different groups according to the dose received (2.5- 10 8 , 5-10 8 or 10- 10 s TU/mouse). In the case of therapeutic lentiviral vector treated mice, there was not observed a decrease in body weight and an increase was observed on day 7 of the challenge whereas in the case of untreated mice (the non-injected or reporter lentiviral vector injected Agxtt 1 mice) they experienced a weight loss during the challenge.
• Kidney damage Score Kidney damage development after ethylene glycol challenge. To determine kidney damage in treated and non-treated mice subjected to ethylene glycol challenge, kidney histological samples were classified according to the “kidney damage score” as 0: no damage; 1 : normal architecture, but the presence of some damage signs such as dilated ducts; 2: architecture partially affected and an increase in the presence of dilated ducts; 3: tissue architecture highly affected and the presence of calcium oxalate crystals can be observed, indicating a nephrocalcinosis stage.
• A Representative images of haematoxylin-eosin kidney sections of each mice group.
• mice From each group, there is a representative image of samples with a kidney damage score of 0-1 , which indicates none or mild kidney damage, and a representative image of samples with a kidney damage score of 2-3, which indicates moderate or severe kidney damage.
• the number of mice that developed that level of kidney damage to the total number of mice in each group is specified in each image.
• B. Representation of kidney damage stage of each animal.
• Grey band represents the development of nephrocalcinosis.
• none of the mice injected with the middle dose of therapeutic lentiviral vector developed nephrocalcinosis.
• FIG. 10 Transduction enhancers: Cyclosporin H increases reporter lentiviral vector transduction in HepG2 cell line. HepG2 cells were transduced with different administration regimens of LV.ET.eGFP.142-3pT and cyclosporine H (CsH) combinations. Fold increase of the percentage of eGFP positive cells between the different CsH treated conditions compared to reporter lentiviral vector transduced cells without CsH is represented. In the first transduction protocol, HepG2 cells were subjected to different concentrations of CsH (4, 8 or, 16 mM) during lentiviral vector transduction. Cells were transduced with a lentiviral vector MOI of 0.3. Three technical replicates of each condition were performed.
• CsH cyclosporine H
• Basal transduction levels were 36.67% and in the different CsH treated samples a transduction percentage of 37.67%, 44.3% and, 51.5% in 4, 8 and, 16 mM CsH conditions were observed, which means a fold-increase of 1.03, 1.2 and, 1.4 respectively.
• another CsH administration regimen was tested. HepG2 cells were pre-treated with CsH for 16 hours before transduction, and CsH was added together with LV.ET.eGFP.142-3pT during lentiviral transduction. The only CsH concentration tested was 16 mM. In this CsH administration regimen, a fold-increase in eGFP positive cells of 2.35 to the control group was observed.
• FIG. 11 LV.ET.eGFP.142-3pT construct.
• Figure 12. LV.ET.AGXT-RHEAM.142-3pT construct.
• FIG. 13 Comparison of LV.ET.eGFP.142-3pT transduction efficacy in vitro and in vivo.
• HepG2 cells were transduced with LV.ET.eGFP.142-3pT at different Multiplicity of Infection (MOI).
• MOI Multiplicity of Infection
• Three days after transduction the percentage of eGFP positive cells was determined by flow cytometry. Using MOIs of about 1, we achieved a transduction percentage of 50%, whereas higher MOIs achieved 100% transduction.
• adult C57BL/6 (filled circle) or Agxtt 1 mice (open circle) were intravenously injected with LV. ET.
• eGFP.142- 3pT at different doses (T10 8 TU/mouse, 1.4- 10 s TU/mouse, 2-10 8 TU/mouse and 5-10 8 TU/mouse).
• Corresponding MOIs were calculated only according to the estimated number of hepatocytes in the liver of these mice as previously described (Park et al., 2000; Schmitt et al., 2010). Therefore, the mice were injected with the following MOIs: 0.8, 1.1, 2, and 4. Percentage of transduced hepatocytes was determined 4 weeks later in liver histology samples.
• mice were intravenously injected with a single dose of LV.ET.eGFP.142-3pT (5-10 8 TU/mouse) by intravenous injection in combination or not with dexamethasone (Fortecortin®).
• Dexamethasone was administered by intraperitoneal injection at a dose of 5 mg/kg body weight in three consecutive administrations: 12 hours and 2 hours before lentiviral vector injection and 4 hours after. Four weeks later mice were sacrificed.
• mice treated only with the reporter lentiviral vector we observed 1.48 (1.2-1.76) copies per diploid genome whereas in mice also treated with dexamethasone 0.92 (0.38-1.4) copies per diploid genome were detected, a significant reduction (p ⁇ 0.05) compared with mice treated only with the lentiviral vector.
• mice treated only with the reporter lentiviral vector we observed 4.434 (2.167-7.55) % eGFP positive hepatocytes, whereas in mice treated with the combination of the lentiviral vector and dexamethasone we obtained 18.11 (6.381-19.79) % eGFP positive hepatocytes, a significant increase (p ⁇ 0.05) with respect to the mice treated only with the lentiviral vector.
• D- E Representative images of immunostaining for eGFP in liver sections of all mice groups.
• the present invention provides a lentivirus vector (LV) comprising a nucleic acid, wherein the nucleic acid comprises a transcriptional unit, wherein the transcriptional unit is defined herein as comprising, from 5’ to 3’, an hepatocyte-specific promoter, preferably a ET promoter, a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine-Pyruvate Aminotransferase (hereinafter referred to as AGXT-RHEAM) protein, a woodchuck hepatitis virus posttranscriptional regulatory element (hereinafter referred to as WPRE), preferably a mutated WPRE, and at least one copy of at least one miRNA target sequence; wherein the hepatocyte-specific promoter, the WPRE and the at least one copy of at least one miRNA target sequence are operably linked to and regulate the expression of AGXT-RHEAM.
• LV lentivirus vector
• the nucleic acid comprises the following: an engineered hepatocyte-specific promoter with at least 98% sequence identity over the full length of SEQ ID NO: 16, a nucleotide sequence encoding for an optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM), wherein the AGXT-RHEAM protein has at least 98% amino acid sequence identity over the full length of SEQ ID NO: 52, a mutated optimized woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) with at least 98% sequence identity over the full length of SEQ ID NO: 21, and at least a copy of at least one miRNA target sequence, wherein the miRNA target sequence is selected from the group consisting of miRNA-142-3, miR-181, miR-223, or miR-30b, wherein the engineered hepatocyte-specific promoter, the WPRE and the at least a copy of at least one miRNA target sequence are operably linked to and regulate the
• the amino acid sequence of the Alanine-Glyoxylate and Serine-Pyruvate Aminotransferase consists of SEQ ID NO: 52.
• the nucleotide sequence of the engineered hepatocyte-specific promoter consists of SEQ ID NO: 16.
• the nucleotide sequence of the mutated optimized woodchuck hepatitis virus posttranscriptional regulatory element consists of SEQ ID NO: 21.
• the nucleotide sequence encoding for the optimized Alanine-Glyoxylate and Serine-Pyruvate Aminotransferase (AGXT-RHEAM) protein consists of SEQ ID NO: 29.
• the at least a copy of at least one miRNA target sequence consists of four copies of the target sequence of miRNA-142-3 with at least 95%, preferably 98%, sequence identity over the full length of SEQ ID NO 22.
• the nucleic acid comprised in the lentiviral vector further comprises, preferably from 5’ to 3’, the following: a) a 5’ long terminal repeat (LTR), b) a primer binding site (PBS) c) a psi packaging signal, d) the Stem-loop 4 (SL4) region of wild-type HIV virus, e) a Rev responsive element (RRE), f) a DNA flap central polypurine tract (cPPT), and g) a 3’ long terminal repeat (LTR), wherein, preferably, the nucleotide further comprises a DenvRFI region located between d) and e), and a DenvRF2 region located between e) and f).
• the lentiviral vector comprises a nucleic acid, wherein the nucleic acid comprises from 5’ to 3’ the following nucleotides: a) a 5’ long terminal repeat (LTR), b) a primer binding site (PBS) c) a psi packaging signal, d) the Stem-loop 4 (SL4) region of wild-type HIV virus, e) a Rev responsive element (RRE), f) a DNA flap central polypurine tract (cPPT), g) an engineered hepatocyte-specific promoter with at least 95%, preferably 98%, sequence identity over the full length of SEQ ID NO 16, h) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein with at least 95%, preferably 98%, sequence identity over the full length of SEQ ID NO 29, i) a nucleotide sequence encoding optimized Alanine-Glyoxy
• the at least a copy of at least one miRNA target sequence of j) consists of four copies of the target sequence of miRNA-142-3 with at least 95%, preferably 98%, most preferably 100%, sequence identity over the full length of SEQ ID NO 22.
• the nucleotide comprised in said lentiviral vector further comprises:
• the 5 ' long terminal repeat comprised in the nucleotide of said lentiviral vector has at least 95%, preferably 98%, most preferably 100%, sequence identity over the full length of SEQ ID NO 4.
• the primer binding site comprised in the nucleotide of said lentiviral vector has at least 95%, preferably 98%, most preferably 100%, sequence identity over the full length of SEQ ID NO 9.
• the psi packaging signal comprised in the nucleotide of said lentiviral vector has at least 95%, preferably 98%, most preferably 100%, sequence identity over the full length of SEQ ID NO 10.
• the Stem-loop 4 (SL4) comprised in nucleotide of said lentiviral vector has at least 95%, preferably 98%, most preferably 100%, sequence identity over the full length of SEQ ID NO 11.
• the Rev responsive element (RRE) comprised in the nucleotide of said lentiviral vector has at least 95%, preferably 98%, most preferably 100%, sequence identity over the full length of SEQ ID NO 13.
• the DNA flap central polypurine tract (cPPT) comprised in the nucleotide of said lentiviral vector has at least 95%, preferably 98%, most preferably 100%, sequence identity over the full length of SEQ ID NO 15.
• the 3 ' long terminal repeat comprised in the nucleotide of said lentiviral vector has at least 95%, preferably 98%, most preferably 100%, sequence identity over the full length of SEQ ID NO 23.
• the DenvRFI comprised in the nucleotide of said lentiviral vector has at least 95%, preferably 98%, most preferably 100%, sequence identity over the full length of SEQ ID NO 12.
• the DenvRF2 comprised in the nucleotide of said lentiviral vector has at least 95%, preferably 98%, most preferably 100%, sequence identity over the full length of SEQ ID NO 14.
• the full-length nucleotide of said lentiviral has at least 95%, preferably 98%, most preferably 100% sequence identity with SEQ ID NO 30 (LV.ET.AGXT-RHEAM.142-3pT).
• the present invention relates to a host cell or a substantially pure population of cells comprising (e.g., transduced) the lentiviral vector as defined in the first aspect or in any of its embodiments.
• the host cell or the substantially pure population of cells are hepatic cells.
• the present invention relates to an isolated nucleic acid comprising the nucleotide comprised in the lentiviral vector as defined in the first aspect or any of its embodiments.
• the present invention provides a pharmaceutical composition
• a pharmaceutical composition comprising the lentiviral as defined in the first aspect or in any of its embodiments, the host cell or the substantially pure population of cells according to the second aspect or any of its embodiments, and/or the nucleic acid as defined in the third aspect or any of its embodiments and a pharmaceutically acceptable carrier or diluent.
• the present invention provides the lentiviral vector according to the first aspect or any of its embodiment, the host cell or the substantially pure population of cells according to the second aspect or any of its embodiments, the isolated nucleic acid according to the third aspect or any of its embodiments, or the pharmaceutical composition of the fourth aspect or any of its embodiments for use as a medicament.
• the present invention provides the lentiviral vector according to the first aspect or any of its embodiment, the host cell or the substantially pure population of cells according to the second aspect or any of its embodiments, the isolated nucleic acid according to the third aspect or any of its embodiments, or the pharmaceutical composition of the fourth aspect or any of its embodiments for use in the treatment of Primary Hyperoxaluria, preferably Primary Hyperoxaluria type 1, the use comprising administering to the subject said lentiviral, said host cell or population of cells, or said composition.
• Primary Hyperoxaluria preferably Primary Hyperoxaluria type 1
• the use according to the fifth and sixth aspect is in combination with an immune response inhibitor, preferably dexamethasone, ciclosporin A, ciclosporin H and/or rapamycin, or any combination thereof.
• an immune response inhibitor preferably dexamethasone, ciclosporin A, ciclosporin H and/or rapamycin, or any combination thereof.
• the conjunctive term "and/or" between multiple recited elements is understood as encompassing both individual and combined options. For instance, where two elements are conjoined by "and/or", a first option refers to the applicability of the first element without the second. A second option refers to the applicability of the second element without the first. A third option refers to the applicability of the first and second elements together. Any one of these options is understood to fall within the meaning, and therefore satisfy the requirement of the term "and/or” as used herein. Concurrent applicability of more than one of the options is also understood to fall within the meaning, and therefore satisfy the requirement of the term "and/or.”
• a protein or nucleotide that "consists essentially of" a protein or nucleotide is a protein or nucleotide that has considerably the same amino acid or nucleotide sequence as the specified protein or nucleotide.
• isolated designates a biological material (cell, polypeptide, polynucleotide, or a fragment, variant, or derivative thereof) that has been removed from its original environment (the environment in which it is naturally present).
• a polynucleotide present in the natural state in a plant or an animal is not isolated, however the same polynucleotide separated from the adjacent nucleic acids in which it is naturally present, is considered “isolated.”
• Nucleic acids “nucleic acid molecules,” “oligonucleotide,” and “polynucleotide” are used interchangeably and refer to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single strandedform, or a double-stranded helix.
• RNA molecules phosphate ester polymeric form of ribonucleosides
• deoxyribonucleosides deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine
• DNA molecules any phosphoester analogs thereof, such as
• nucleic acid molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA and chromosomes.
• a “coding region” or “coding sequence” is a portion of polynucleotide which consists of codons translatable into amino acids.
• downstream refers to a nucleotide sequence that is located 3’ to a reference nucleotide sequence.
• downstream nucleotide sequences relate to sequences that follow the starting point of transcription.
• upstream refers to a nucleotide sequence that is located 5’ to a reference nucleotide sequence.
• upstream nucleotide sequences relate to sequences that are located on the 5’ side of a coding region or starting point of transcription.
• the term "gene regulatory region” or “regulatory region” refers to nucleotide sequences located upstream (5' sequences), within, or downstream (3' sequences) of a coding region, and which influence the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites and stem-loop structures. If a coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3’ to the coding sequence.
• posttranscriptional regulatory element refers to a DNA sequence that when transcribed creates a tertiary structure which enhances or inhibits the expression of a protein.
• Transcriptional control sequences refer to DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
• promoter refers to a DNA sequence to which RNA polymerase can bind to in order to initiate transcription.
• the sequence may further contain binding sites for various proteins that regulate transcription, such as transcription factors.
• the promoter sequence may be composed of different promoter fragments (either different or the same fragments) that are localized closely in the DNA sequence and may be separated by linkers or spacers. Such promoters are referred to as chimeric promoters.
• treatment and “therapy”, as used in the present application, refer to a set of hygienic, pharmacological, surgical and/or physical means used with the intent to cure and/or alleviate a disease and/or symptoms with the goal of remediating the health problem.
• treatment and “therapy” include preventive and curative methods, since both are directed to the maintenance and/or reestablishment of the health of an individual or animal. Regardless of the origin of the symptoms, disease and disability, the administration of a suitable medicament to alleviate and/or cure a health problem should be interpreted as a form of treatment or therapy within the context of this application.
• terapéuticaally effective amount refers to an amount of matter which has a therapeutic effect, and which is able to treat PH1.
• the terms “individual”, “patient” or “subject” are used interchangeably in the present application and are not meant to be limiting in any way.
• the “individual”, “patient” or “subject” can be of any age, sex and physical condition.
• pharmaceutically acceptable carrier or “pharmaceutically acceptable diluent” means any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art.
• Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and, without limiting the scope of the present invention, include: additional buffering agents; preservatives; co-solvents; antioxidants, including ascorbic acid and methionine; chelating agents such as EDTA; metal complexes (e.g., Zn-protein complexes); biodegradable polymers, such as polyesters; salt-forming counterions, such as sodium, polyhydric sugar alcohols; amino acids, such as alanine, glycine, glutamine, asparagine, histidine, arginine, lysine, ornithine, leucine, 2-phenylalanine, glutamic acid, and threonine; organic sugars or sugar alcohols, such as lactitol, stachyose, mannose, sorbose, xylose, ribose, ribitol, myoinisitose, myoinis
• the phrase "subject in need thereof includes subjects, such as mammalian subjects, that would benefit from administration of a nucleic acid molecule, a polypeptide, or vector provided herein, e.g., to improve hemostasis.
• the term "optimized,” with regard to nucleotide sequences, refers to a polynucleotide sequence that encodes a polypeptide, wherein the polynucleotide sequence has been mutated to enhance a property of that polynucleotide sequence.
• lentivirus refers to a genus of retroviruses that cause chronic and deadly diseases characterized by long incubation periods, in the human and other mammalian species.
• a “vector” is any vehicle which can be used to artificially carry foreign genetic material into a cell.
• a “lentiviral vector” refers to a recombinant lentivirus which carries a nucleic acid into a cell.
• transcriptional unit as used herein is meant the nucleotide sequence comprised in the LV vector of the present invention that comprises from 5 ' to 3 ' an hepatocyte-specific promoter, preferably the ET promoter, a nucleotide sequence encoding optimized Alanine- Glyoxylate and Serine-Pyruvate Aminotransferase (AGXT-RHEAM) protein, a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), preferably a mutated WPRE, and at least one copy of at least one miRNA target sequence; wherein the hepatocyte- specific promoter, the WPRE and the at least one copy of at least one miRNA target sequence are operably linked to and regulate the expression of AGXT-RHEAM.
• an hepatocyte-specific promoter preferably the ET promoter
• lentiviral vectors represent an attractive tool for gene delivery
• the efficiency of transduction is key to ensure that enough cells are genetically corrected in order to obtain the desired therapeutic effect.
• the rate of transduction observed in vitro does not correspond to the transduction efficiency achieved in vivo, and this is especially accentuated when the vectors are not or cannot be delivered directly to the tissue where the genetic correction is desired (for instance, in the case of liver-specific diseases), but they are delivered by other routes, such as parenteral route, where the vector is incorporated into blood stream and is targeted by host ' s immune response.
• the authors of the present invention present in Figure 13 the transduction efficiency of the same lentiviral vector used in vitro (in HepG2 cells) and in vivo (C57BL/6 mice), demonstrating that there is a significant reduction in the percentage of transduced cells when the virus is in an in vivo context. Additionally, the transduction efficiency does not only vary from in vitro/in vivo, or from local delivery versus systemically delivery, but it also varies depending on the type of the lentivirus used and its ability to transduce the cells and to integrate into the host cell genome. Particularly, the ability to transduce the target cell is clearly influenced by the lentiviral backbone (Johnson et al., 2021, Mol Therapy).
• hemophilia e.g., hemophilia A
• some diseases such as hemophilia (e.g., hemophilia A)
• hemophilia A can be treated with lentiviral vectors even though their transduction efficiency in vivo does not even reach 10% of cells. This is because, in these cases, an in vivo transduction efficacy of as low as 5% can be enough to obtain a therapeutic effect that is sufficient to revert the phenotype of the disease.
• PH1 it is widely accepted that at least 40% of hepatic cells need to be corrected, that is, need to efficiently produce AGXT protein, in order to revert, at least partially, the PH1 phenotype. Castello et al.
• lentiviral vector that is able to correct the deficiency in the expression of AGXT protein in hepatic cells causing a decrease in the oxalate accumulation and thus partially reverting the PH1 phenotype, as shown in Fig. 7-9.
• this effect provided by the lentiviral vector described herein was achieved despite of the fact that, as shown in Fig. 5, said lentiviral vector was only able to transduce about 5% of the cells in vivo.
• the present invention meets an important need in the art by providing lentiviral vectors comprising a codon optimized AGXT sequence that, upon transduction into a hepatic cell, increases the intracellular levels of AGXT protein and results in a great therapeutic efficacy to treat PH1.
• a schematic representation of the nucleic acid sequence comprised in the lentiviral vector provided herein is presented in Fig. 12.
• the present invention provides a lentivirus vector (LV) comprising a nucleic acid, wherein the nucleic acid comprises a transcriptional unit, wherein the transcriptional unit is defined herein as comprising, from 5’ to 3’, an hepatocyte-specific promoter, preferably a ET promoter, a nucleotide sequence encoding optimized Alanine- Glyoxylate and Serine-Pyruvate Aminotransferase (hereinafter referred to as AGXT-RHEAM) protein, a woodchuck hepatitis virus posttranscriptional regulatory element (hereinafter referred to as WPRE), preferably a mutated WPRE, and at least one copy of at least one miRNA target sequence; wherein the hepatocyte-specific promoter, the WPRE and the at least one copy of at least one miRNA target sequence are operably linked to and regulate the expression of AGXT-RHEAM.
• an hepatocyte-specific promoter preferably a ET promoter
• a coding sequence and a gene expression control sequence are said to be operably linked when they are linked in such a way as to place the expression or transcription and/or translation of the coding sequence under the influence or control of the gene expression control sequence.
• the hepatocyte-specific promoter, the WPRE and the at least one copy of at least one miRNA target sequence are operably linked to nucleotide sequence encoding optimized AGXT-RHEAM protein so that the expression levels of AGXT are regulated by the promoter and WPRE.
• the nucleic acid comprised in the LV vector according to the first aspect further comprises one or more lentiviral backbone elements, which are defined as nucleic acids encoding for the necessary proteins for the LV to carry out its function (infect the cell and integrate into the viral genome to persist in the cell) and nucleic acids encoding for the necessary regulatory sequences for the LV to carry out its functions.
• lentiviral backbone elements which are defined as nucleic acids encoding for the necessary proteins for the LV to carry out its function (infect the cell and integrate into the viral genome to persist in the cell) and nucleic acids encoding for the necessary regulatory sequences for the LV to carry out its functions.
• the LV vector of the first aspect comprises a nucleic acid, wherein the nucleic acid comprises 1) a transcriptional unit and 2) one or more LV vector backbone elements. It is noted that all the nucleic acid comprised in the transcriptional unit and in the LV vector backbone can be combined. Each of these two components are characterized in detail below:
• transcriptional unit is referred herein as to the nucleic acid sequence comprised in a LV vector of the present invention that comprises from 5 ' to 3 ' an hepatocyte- specific promoter, a nucleotide sequence encoding optimized AGXT-RHEAM protein, a WPRE element, and at least one copy of at least one miRNA target sequence; wherein the hepatocyte-specific promoter, the WPRE and the at least one copy of at least one miRNA target sequence are operably linked to and regulate the expression of AGXT-RHEAM.
• the nucleic acid sequence comprised in the lentiviral vector comprises at least one tissue specific promoter, i.e., a promoter that will regulate the expression of the optimized AGXT protein in a particular tissue or cell type.
• a tissue specific promoter in the lentiviral vector selectively enhances expression of the optimized AGXT protein in a target liver cell.
• the target liver cell is a hepatocyte or a precursor cell thereof.
• the isolated nucleic acid molecule comprised in the lentiviral vector is stably integrated into the genome of the target cell or target tissue, for example, in the genome of a hepatocyte.
• the lentiviral vector comprises a hepatocyte-specific promoter for transgene expression.
• the nucleotide comprising the hepatocyte-specific promoter is an engineered hepatocyte-specific promoter.
• the tissue specific promoter that selectively enhances expression of the optimized AGXT protein in a target liver cell comprises a transthyretin promoter (TTRp).
• TTRp transthyretin promoter
• the hepatocyte-specific promoter is a chimeric promoter.
• the chimeric hepatocyte-specific promoter is the ET promoter, which consists of a synthetic enhancer, a transthyretin enhancer (hereinafter referred to as TTR enhancer), a transthyretin promoter (hereinafter referred to as TTRp), and a transthyretin 5 ' UT (hereinafter referred to as mTTR 5’ UT).
• TTR enhancer a transthyretin enhancer
• TTRp transthyretin promoter
• mTTR 5’ UT transthyretin 5 ' UT
• the synthetic enhancer of the ET promoter comprises SEQ ID NO: 17 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 17.
• the synthetic enhancer of the ET promoter comprises SEQ ID NO: 17 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 17.
• the synthetic enhancer of the ET promoter is SEQ ID NO: 17 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 17.
• the nucleotide sequence of the synthetic enhancer of the ET promoter comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO:17.
• the TTR enhancer of the ET promoter is a murine TTR enhancer (mTTR enhancer) and comprises SEQ ID NO: 18 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 18.
• mTTR enhancer of the ET promoter comprises SEQ ID NO: 18 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 18.
• the mTTR enhancer of the ET promoter is SEQ ID NO: 18 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 18.
• the nucleotide sequence of the mTTR enhancer of the ET promoter comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO:18.
• the transthyretin promoter (TTRp) of the ET promoter is a murine TTRp (mTTRp) and comprises SEQ ID NO: 19 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 19.
• the mTTRp of the ET promoter comprises SEQ ID NO: 19 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 19.
• the mTTRp of the ET promoter is SEQ ID NO: 19 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 19.
• the nucleotide sequence of the mTTRp of the ET promoter comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 19.
• the transthyretin 5 ' UT (TTR 5’ UT) of the ET promoter is a murine TTR 5 ' UT (mTTR 5 ' UT) and comprises SEQ ID NO: 20 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 20.
• the mTTR 5’ UT of the ET promoter comprises SEQ ID NO: 20 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 20.
• the mTTR 5’ UT of the ET promoter is SEQ ID NO: 20 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 20.
• the nucleotide sequence of the mTTR 5’ UT of the ET promoter comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO:20.
• sequence identity between two sequences can be determined through conventional methods. For example, by using standard alignment logarithms known in the state of the art such as BLAST (Altschul etal., 1990. J Mol Biol. 215(3): 403-10). In a preferred embodiment, the sequence identity between two sequences is determined using BLAST.
• the hepatocyte-specific promoter is the ET promoter which consists of a synthetic enhancer of SEQ ID NO: 17, an mTTR enhancer of SEQ ID NO: 18, a mTTRp of SEQ ID NO: 19, and a mTTR 5 ' UT of SEQ ID NO: 20, or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 17, 18, 19, or 20, respectively.
• the nucleotide sequence of the hepatocyte-specific ET promoter comprises SEQ ID NO: 16 or a sequence, which is at least 98% identical over the full length of SEQ ID NO: 16.
• the nucleotide sequence of the hepatocyte-specific ET promoter comprises SEQ ID NO: 16 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 16.
• the nucleotide sequence of the hepatocyte-specific ET promoter is SEQ ID NO: 16 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 16.
• the nucleotide sequence comprised in the lentiviral vector and that is a liver-specific promoter that selectively enhances expression of the optimized AGXT protein in a target liver cell comprises, consists, or consists essentially of ET promoter of SEQ ID NO:16.
• Lentiviral vectors provided herein comprise codon optimized polynucleotides encoding the optimized AGXT protein.
• the codon optimized polynucleotides AGXT is operably linked to at least one, preferably two, expression control sequence, including a promoter and a posttranscriptional element.
• the present invention provides a lentiviral vector comprising an isolated nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide with similar activity to AGXT.
• the nucleotide sequence comprised in the lentiviral vector and encoding for AGXT-RHEAM encodes for a signal peptide that locates the newly synthetized protein in the peroxisome of the cell.
• the nucleotide sequence encoding for AGXT-RHEAM comprises SEQ ID NO: 29 or a sequence, which is at least 98% identical over the full length of SEQ ID NO: 29.
• the nucleotide sequence encoding for AGXT-RHEAM comprises SEQ ID NO: 29 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 29.
• nucleotide sequence encoding for AGXT-RHEAM is SEQ ID NO: 29 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 29.
• the nucleotide sequence comprised in the lentiviral vector and encoding for AGXT-RHEAM comprises, consists, or consists essentially of SEQ ID NO:29.
• the amino acid sequence of AGXT-RHEAM comprises SEQ ID NO: 52 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 52.
• the amino acid sequence of AGXT-RHEAM comprises SEQ ID NO: 52 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 52.
• amino acid sequence of AGXT-RHEAM is SEQ ID NO: 52 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 52.
• the AGXT-RHEAM protein encoded by the nucleotide sequence comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 52.
• WHV woodchuck hepatitis virus
• WPRE post-transcriptional regulatory element
• Lentiviral vectors provided herein also comprise at least one posttranscriptional regulatory element operably linked to the nucleotide encoding for the optimized AGXT.
• said posttranscriptional regulatory element is the WHV (woodchuck hepatitis virus) post-transcriptional regulatory element (WPRE).
• WPRE woodchuck hepatitis virus post-transcriptional regulatory element
• the posttranscriptional regulatory element is mutated to increase the safety of the vector.
• the mutated WPRE contains a mutation in gene X frame.
• the nucleotide sequence comprising the mutated WPRE comprises SEQ ID NO: 21 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 21.
• the nucleotide sequence comprising the mutated WPRE comprises SEQ ID NO: 21 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 21.
• the nucleotide sequence comprising the mutated WPRE is SEQ ID NO: 21 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 21.
• the nucleotide sequence WPRE comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO:21.
• the present invention also provides at least one copy of at least one miRNA target sequence operably linked to the optimized AGXT-RHEAM nucleotide sequence. More than one copy of a miRNA target sequence may be included in the transcription unit to increase the effectiveness of the system.
• the one or more miRNA target sequences can be the same or different.
• the transcription unit comprised in the lentiviral vector comprises 1, 2, 3, 4, 5, 6, 7 or 8 copies of the same or different miRNA target sequence.
• the target sequence is a miRNA-142-3 target.
• the lentiviral vector comprises one or more target sequences for miRNA-142-3 to reduce immune response to the transgene product.
• the lentiviral vector comprisesl, 2, 3, preferably 4, 5, 6, 7 or 8 repetitions or copies of miRNA-142-3 target sequences.
• incorporating one or more target sequences for miRNA-142-3 into the transcription unit of the lentivirus of the present invention allows for a desired transgene expression profile and/or a reduced immunogenicity.
• incorporating one or more target sequences for miRNA-142-3 may suppress transgene expression in intravascular and extravascular hematopoietic lineages, whereas transgene expression is maintained in non- hematopoietic cells.
• the complementary sequence of hematopoietic- specific microRNAs, such as miRNA-142-3 is incorporated into the 3' untranslated region of a lentiviral vector, making the transgene-encoding transcript susceptible to miRNA-mediated down-regulation.
• the target sequence can be fully or partially complementary to the miRNA.
• the term "fully complementary” means that the target sequence has a nucleic acid sequence which is 100 % complementary to the sequence of the miRNA which recognizes it.
• the nucleic acid sequence comprised in the transcription unit comprises four repetitions of the target sequence of miRNA-142-3.
• the nucleotide sequence comprising the miRNA-142-3 comprises SEQ ID NO: 22 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 22.
• the nucleotide sequence comprising the miRNA-142-3 comprises SEQ ID NO: 22 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 22.
• the nucleotide sequence comprising the miRNA-142-3 is SEQ ID NO: 22 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 22.
• the nucleotide sequence of miRNA-142-3 comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 22.
• the target sequence is an miR-181 target. In some embodiments, the target sequence is an miR-223 target. In some embodiments, the target sequence is an miR- 122 target. In some embodiments, the target sequence is an miR-30b target. In a preferred embodiment, the miRNA target sequence is selected from the group consisting of miRNA- 142-3, miR-181, miR-223, or miR-30b.
• the transcription unit the hepatocyte-specific promoter, the nucleotide sequence encoding optimized AGXT-RHEAM protein, the WPRE element, and the at least one copy of at least one miRNA target sequence
• the hepatocyte-specific promoter the nucleotide sequence encoding optimized AGXT-RHEAM protein, the WPRE element, and the at least one copy of at least one miRNA target sequence
• the transcription unit comprised in the nucleic acid of the lentiviral vector comprises or consists of: a) an engineered hepatocyte-specific promoter with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 16, b) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 29, c) a mutated optimized woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 21, and d) at least a copy of at least one miRNA target sequence, and wherein a), c) and d) are operably linked to and regulate the expression of b).
• an engineered hepatocyte-specific promoter with
• the d) at least a copy of at least one miRNA target sequence consists of four copies of the target sequence of miRNA-142-3, preferably with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 22.
• the transcription unit comprised in the nucleic acid of the lentiviral vector comprises or consists of: a) an engineered hepatocyte-specific promoter with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 16, b) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein, wherein the AGXT-RHEAM protein has at least 95%, preferably 98%, most preferably 100%, amino acid sequence identity over the full length of SEQ ID NO: 52, c) a mutated optimized woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 21, and d) at least a copy of at least one miRNA target sequence, wherein the miRNA target sequence is selected from the group consisting of miRNA-
• the d) at least a copy of at least one miRNA target sequence consists of four copies of the target sequence of miRNA-142-3, preferably with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 22.
• the transcription unit comprised in the nucleic acid of the lentiviral vector comprises consists of: a) an engineered hepatocyte-specific promoter consisting of SEQ ID NO 16, b) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein, wherein the AGXT-RHEAM protein consists of SEQ ID NO: 52, c) a mutated optimized woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) consisting of SEQ ID NO 21, and d) at least a copy of at least one miRNA target sequence, wherein the miRNA target sequence is selected from the group consisting of miRNA-142-3, miR-181, miR-223, or miR-30b, and wherein a), c) and d) are operably linked to and regulate the expression of b).
• WPRE woodchuck hepatitis virus posttranscriptional regulatory element
• the d) at least a copy of at least one miRNA target sequence consists of four copies of the target sequence of miRNA-142-3, preferably with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 22.
• the transcription unit comprised in the nucleic acid of the lentiviral vector comprises or consists of: a) an engineered hepatocyte-specific promoter with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 16, b) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 29, c) a mutated optimized woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 21, and d) at least a copy of at least one miRNA target sequence, wherein the miRNA target sequence is selected from the group consisting of miRNA-142-3, miR-181, miR-223, or miR-30b,
• the d) at least a copy of at least one miRNA target sequence consists of four copies of the target sequence of miRNA-142-3, preferably with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 22.
• the transcription unit comprised in the nucleic acid of the lentiviral vector comprises or consists of: a) an engineered hepatocyte-specific promoter consisting of SEQ ID NO 16, b) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein consisting of SEQ ID NO 29, c) a mutated optimized woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) consisting of SEQ ID NO 21, and d) at least a copy of at least one miRNA target sequence, wherein the miRNA target sequence is selected from the group consisting of miRNA-142-3, miR-181, miR-223, or miR-30b, and wherein a), c) and d) are operably linked to and regulate the expression of b).
• the d) at least a copy of at least one miRNA target sequence consists of four copies of the target sequence of miRNA-142-3, preferably with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 22.
• Lentiviral vector backbone elements consists of four copies of the target sequence of miRNA-142-3, preferably with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 22.
• the lentiviral vector backbone elements are defined as nucleic acids sequences needed for the LV to carry out its function (infect the cell and integrate into the viral genome to persist in the cell).
• Lentiviruses include members of the bovine lentivirus group, equine lentivirus group, feline lentivirus group, ovinecaprine lentivirus group, and primate lentivirus group.
• the lentiviral vector provided herein is "third-generation" lentiviral vector.
• the term “third-generation” lentiviral vector refers to a lentiviral packaging system that has the characteristics of a second-generation vector system, and that further lacks a functional tat gene, such as one from which the tat gene has been deleted or inactivated.
• the gene encoding rev is provided on a separate expression construct.
• a "second-generation" lentiviral vector system refers to a lentiviral packaging system that lacks functional accessory genes, such as one from which the accessory genes vif, vpr, vpu, and nef have been deleted or inactivated.
• packaging system refers to a set of viral constructs comprising genes that encode viral proteins involved in packaging a recombinant virus. Typically, the constructs of the packaging system will ultimately be incorporated into a packaging cell.
• the third-generation lentiviral vector provided herein is a self inactivating lentiviral vector.
• the lentiviral vector is a VSV.G pseudo type lentiviral vector.
• the lentiviral vector is a vector of a recombinant lentivirus capable of infecting non-dividing cells. In certain embodiments, the lentiviral vector is a vector of a recombinant lentivirus capable of infecting liver cells (e.g., hepatocytes).
• the lentiviral genome and the proviral DNA typically have the three genes found in retroviruses: gag, pol and env, which are flanked by two long terminal repeat (LTR) sequences.
• the gag gene encodes the internal structural (matrix, capsid and nucleocapsid) proteins; the pol gene encodes the RNA-directed DNA polymerase (reverse transcriptase), a protease and an integrase; and the env gene encodes viral envelope glycoproteins.
• the 5' and 3' LTR's serve to promote transcription and polyadenylation of the virion RNA's.
• the LTR contains all other cis-acting sequences necessary for viral replication.
• the lentiviruses have additional genes including vif, vpr, tat, rev, vpu, net and vpx (in HIV-I, HIV-2 and/or SIV)
• the lentiviral vector has the HIV virulence genes env, vif, vpr, vpu and net deleted without compromising the ability of the vector to transduce non-dividing cells.
• Adjacent to the 5' LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient encapsidation of viral RNA into particles (the Psi site).
• the sequences necessary for encapsidation (or packaging of retroviral RNA into infectious virions) may be missing from the viral genome, the cis defect prevents encapsidation of genomic RNA. However, the resulting mutant remains capable of directing the synthesis of all virion proteins.
• the lentiviral vector provided herein comprises a nucleic acid, wherein the nucleic acid comprises a transcription unit.
• said nucleic acid comprised in the lentiviral vector comprises upstream, that is, at the 5 ' region of the transcriptional unit as defined above, and in order from 5 ' to 3 ' , at least one of the following: a) a 5’ long terminal repeat (5 ' LTR), b) a primer binding site (PBS), c) a psi packaging signal, d) the Stem-loop 4 (SL4) region of wild-type HIV virus, e) a Rev responsive element (RRE), and f) a DNA flap central polypurine tract (cPPT) or any combination thereof.
• a 5’ long terminal repeat 5 ' LTR
• PBS primer binding site
• SL4 Stem-loop 4
• RRE Rev responsive element
• cPPT DNA flap central polypurine tract
• said nucleic acid comprised in the lentiviral vector further comprises upstream, that is, at the 5 ' region of the transcriptional unit as defined above, I) a DenvRFI region located between d) and e), and m) a DenvRF2 region located between e) and f), or any combination thereof.
• upstream that is, at the 5 ' region of the transcriptional unit as defined above, I) a DenvRFI region located between d) and e), and m) a DenvRF2 region located between e) and f), or any combination thereof.
• said nucleic acid comprised in the lentiviral vector further comprises downstream, that is, at the 3 ' region of the transcriptional unit as defined above, a k) 3’ long terminal repeat (LTR).
• the lentiviral vector comprises a deletion of the U3 region of the 5' LTR. The deletion of the U3 region of the 5' LTR can be the complete deletion or a partial deletion.
• nucleotides a) to f) and j) to k) are comprised in the present invention and in combination with the transcription unit described in the section above.
• nucleotides a) to f) and j) to k) and their preferred embodiments are further defined below.
• said nucleic acid comprised in the lentiviral vector further comprises, preferably upstream (that is, at the 5 ' region) of the transcriptional unit as defined above, and preferably in order from 5 ' to 3 ' , at least one of the following: a) a 5’ long terminal repeat (5 ' LTR), b) a primer binding site (PBS), c) a psi packaging signal, d) the Stem-loop 4 (SL4) region of wild-type HIV virus, e) a Rev responsive element (RRE), and f) a DNA flap central polypurine tract (cPPT) or any combination thereof.
• a 5’ long terminal repeat 5 ' LTR
• PBS primer binding site
• SL4 Stem-loop 4
• RRE Rev responsive element
• cPPT DNA flap central polypurine tract
• said nucleic acid comprised in the lentiviral vector further comprises, preferably upstream (that is, at the 5 ' region) of the transcriptional unit as defined above h) a DenvRFI region located between d) and e), and i) a DenvRF2 region located between e) and f), or any combination thereof.
• the nucleic acid comprised in the lentiviral vector further comprises, preferably downstream (that is, at the 3 ' region) of the transcriptional unit as defined above a g) 3’ long terminal repeat (LTR).
• nucleotides a), b), c), d), e), f), h) and i) and g) is comprised in the present invention and in combination with the transcription unit described in the section above.
• the nucleotide sequence comprising the 5’ LTR comprises SEQ ID NO: 4 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 4.
• the nucleotide sequence comprising the 5’ LTR comprises SEQ ID NO: 4 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 4.
• the nucleotide sequence comprising the 5’ LTR is SEQ ID NO: 4 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 4.
• the nucleotide sequence of 5’ LTR comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO:4.
• the 5 ' LTR region comprises a CMV promoter, preferably a chimeric CMV promoter, and/or a RU5 element.
• the chimeric CMV promoter comprises or consists of a CMV enhancer and a CMV promoter.
• the 5 ' LTR region comprises or consists of a CMV enhancer, a CMV promoter, a RU5 element, and/or any combination thereof.
• the nucleotide sequence comprising the chimeric CMV promoter comprises SEQ ID NO: 5 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 5.
• the nucleotide sequence comprising the Chimeric CMV promoter comprises SEQ ID NO: 5 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 5.
• the nucleotide sequence comprising the chimeric CMV promoter is SEQ ID NO: 5 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 5.
• the nucleotide sequence of chimeric CMV promoter comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO:5.
• the nucleotide sequence comprising the CMV enhancer comprises SEQ ID NO: 6 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 6.
• the nucleotide sequence comprising the CMV enhancer comprises SEQ ID NO: 6 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 6.
• the nucleotide sequence comprising the CMV enhancer is SEQ ID NO: 6 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 6.
• the nucleotide sequence of CMV enhancer comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 6.
• the nucleotide sequence comprising the CMV promoter comprises SEQ ID NO: 7 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 7.
• the nucleotide sequence comprising the CMV promoter comprises SEQ ID NO: 7 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 7.
• the nucleotide sequence comprising the CMV promoter is SEQ ID NO: 7 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 7.
• the nucleotide sequence of CMV promoter comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO:7.
• the nucleotide sequence comprising the RU5 element comprises SEQ ID NO: 8 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 8.
• the nucleotide sequence comprising the RU5 element comprises SEQ ID NO: 8 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 8.
• the nucleotide sequence comprising the RU5 element is SEQ ID NO: 8 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 8.
• the nucleotide sequence of RU5 element comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 8.
• sequences necessary for reverse transcription of the genome which are the tRNA primer binding site (hereinafter referred to as PBS or PBS SL23).
• the nucleotide sequence comprising the PBS SL23 comprises SEQ ID NO: 9 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 9.
• the nucleotide sequence comprising the PBS SL23 comprises SEQ ID NO: 9 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 9.
• the nucleotide sequence comprising the PBS SL23 is SEQ ID NO: 9 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 9.
• the nucleotide sequence of the PBS SL23 comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 9.
• the lentiviral vector provided herein comprises at least a psi (Y) packaging signal, also called the psi site, for efficient encapsulation of viral RNA into particles.
• Y psi packaging signal
• the nucleotide sequence comprising the psi packaging signal comprises SEQ ID NO: 10 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 10.
• the nucleotide sequence comprising the psi packaging signal comprises SEQ ID NO: 10 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 10.
• the nucleotide sequence comprising the psi packaging signal is SEQ ID NO: 10 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 10.
• the nucleotide sequence of the psi packaging signal comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 10.
• the nucleotide of the PSI packaging signal partially overlaps with the PBS SL23 and with the Stem-loop 4 (SL4) region of wild-type HIV virus, which is defined below.
• the lentiviral vector provided herein further comprises one or more nucleotide sequences encoding for a gag protein, a DenvRFI, a Rev-response element (hereinafter referred to as RRE), a DenVRF2, a central polypurine track (hereinafter referred to as cPPT), and/or any combination thereof.
• RRE Rev-response element
• cPPT central polypurine track
• the lentiviral vector provided herein comprises at least a Stem-loop 4 (SL4) region of wild-type HIV virus (hereinafter referred to as SL4mgag).
• SL4mgag Stem-loop 4
• the nucleotide sequence comprising the SL4mgag comprises SEQ ID NO: 11 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 11.
• the nucleotide sequence comprising the SL4mgag comprises SEQ ID NO: 11 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 11.
• the nucleotide sequence comprising the SL4mgag is SEQ ID NO: 11 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 11.
• the nucleotide sequence of the SL4mgag comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 11.
• the lentiviral vector provided herein comprises at least a DenvRFI element.
• the nucleotide sequence comprising the DenvRFI comprises SEQ ID NO: 12 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 12.
• the nucleotide sequence comprising the DenvRFI comprises SEQ ID NO: 12 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 12.
• the nucleotide sequence comprising the DenvRFI is SEQ ID NO: 12 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 12.
• the nucleotide sequence of the DenvRFI comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 12.
• the nucleotide of the DenvRFI partially overlaps with the nucleotide of the SL4mgag defined above and with the nucleotide of the RRE, which is defined below.
• the nucleotide sequence comprising the RRE comprises SEQ ID NO: 13 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 13.
• the nucleotide sequence comprising the RRE comprises SEQ ID NO: 13 or a sequence which is at least 75%, 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 13.
• the nucleotide sequence comprising the RRE is SEQ ID NO: 13 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 13.
• the nucleotide sequence of RRE comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 13.
• the lentiviral vector provided herein comprises at least a DenvRF2 element.
• the nucleotide sequence comprising the DenvRF2 comprises SEQ ID NO: 14 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 14.
• the nucleotide sequence comprising the DenvRF2 comprises SEQ ID NO: 14 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 14.
• the nucleotide sequence comprising the DenvRF2 is SEQ ID NO: 14 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 14.
• the nucleotide sequence of the DenvRF2 comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 14.
• the nucleotide sequence comprising the cPPT comprises SEQ ID NO: 15 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 15.
• the nucleotide sequence comprising the cPPT comprises SEQ ID NO: 15 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 15.
• the nucleotide sequence comprising the cPPT is SEQ ID NO: 15 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 15.
• the nucleotide sequence of cPPT comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 15.
• the lentiviral vector comprises a nucleic acid, wherein the nucleic acid comprises a 3 ' long terminal repeat (hereinafter referred to as 3 ' LTR).
• 3’ LTR is involved in mRNAs polyadenylation during lentiviral vector production.
• the 3 ' LTR comprises a deletion of the U3 region of the 3' LTR.
• the deletion of the U3 region of the 3' LTR can be the complete deletion or a partial deletion.
• the nucleotide sequence comprising the 3 ' LTR comprises SEQ ID NO: 23 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 23.
• the nucleotide sequence comprising the 3 ' LTR comprises SEQ ID NO: 23 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 23.
• the nucleotide sequence comprising the 3 ' LTR is SEQ ID NO: 23 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 23.
• the nucleotide sequence of 3 ' LTR comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 23.
• the 3’ LTR is composed of a truncated U3 element (hereinafter referred to as AU3) and the elements R and U5 (hereinafter referred to as RU5) from wild- type HIV-1, being a self-inactivating lentiviral vector.
• AU3 truncated U3 element
• RU5 the elements R and U5
• the nucleotide sequence comprising the AU3 comprises SEQ ID NO: 24 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 24.
• the nucleotide sequence comprising the AU3 comprises SEQ ID NO: 24 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 24.
• the nucleotide sequence comprising the AU3 is SEQ ID NO: 24 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 24.
• the nucleotide sequence of DII3 comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 24.
• the nucleotide sequence comprising the RU5 comprises SEQ ID NO: 25 or a sequence which is at least 98% identical over the full length of SEQ ID NO: 25.
• the nucleotide sequence comprising the RU5 comprises SEQ ID NO: 25 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 25.
• the nucleotide sequence comprising the RU5 is SEQ ID NO: 25 or a sequence which is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 25.
• the nucleotide sequence of RU5 comprised in the lentiviral vector comprises, consists, or consists essentially of SEQ ID NO: 25.
• the RU5 nucleotide is located between the chimeric CMV promoter and the PBS SL123 nucleotide.
• the PBS SL123 nucleotide is located between the 5 ' LTR nucleotide and the Psi packaging signal.
• the Psi packaging signal nucleotide is located between the PBS SL123 nucleotide and the Stem-loop 4 (SL4) region of wild-type HIV virus nucleotide.
• the DenvRFI nucleotide is located between the SL4mgag nucleotide and the RRE nucleotide.
• the DenvRF2 nucleotide is located between the RRE nucleotide and the cPPT nucleotide.
• the cPPT nucleotide is located between the RRE nucleotide and the ET promoter nucleotide.
• the at least one copy of at least one miRNA target sequence is located between the mutated WPRE nucleotide and the 3 ' LTR nucleotide.
• the lentiviral vector comprises a nucleic acid, wherein the nucleic acid comprises from 5’ to 3’ the following nucleotides: a) a 5’ long terminal repeat (LTR), b) a primer binding site (PBS) c) a psi packaging signal, d) the Stem-loop 4 (SL4) region of wild-type HIV virus e) a Rev responsive element (RRE), f) a DNA flap central polypurine tract (cPPT), g) an engineered hepatocyte-specific promoter with at least 95%, preferably 98%, sequence identity over the full length of SEQ ID NO 16, h) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein with at least 95%, preferably 98%, sequence identity over the full length of SEQ ID NO 29, i) a mut
• the nucleotide comprised in said lentiviral vector further comprises:
• SL4 Stem-loop 4
• RRE Rev responsive element
• cPPT DNA flap central polypurine tract
• the lentiviral vector comprises a nucleic acid, wherein the nucleic acid comprises from 5’ to 3’ the following nucleotides: a) a 5’ long terminal repeat (LTR) with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 5, b) a primer binding site (PBS) with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 9, c) a psi packaging signal with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 10, d) a Stem-loop 4 (SL4) region of wild-type HIV virus with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 11, e) a Rev responsive element (RRE) with at least 95%, preferably 98%, more preferably 100%, sequence identity
• LTR long terminal repeat
• PBS primer binding site
• the at least a copy of at least one miRNA target sequence consists of four repetitions of the target sequence of miRNA-142-3 with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 22.
• the nucleotide comprised in said lentiviral vector further comprises:
• the lentiviral vector comprises a nucleic acid, wherein the nucleic acid comprises from 5’ to 3’ the following nucleotides: a) a 5’ long terminal repeat (LTR), b) a primer binding site (PBS), c) a psi packaging signal, d) a Stem-loop 4 (SL4) region of wild-type HIV virus, e) a Rev responsive element (RRE), f) a DNA flap central polypurine tract (cPPT), g) an engineered hepatocyte-specific promoter, with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 16, h) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO:
• the at least a copy of at least one miRNA target sequence consists of four repetitions of the target sequence of miRNA-142-3.
• the lentiviral vector comprises a nucleic acid, wherein the nucleic acid comprises from 5’ to 3’ the following nucleotides: a) a 5’ long terminal repeat (LTR) with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 5, b) a primer binding site (PBS) with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 9, c) a psi packaging signal with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 10, d) a Stem-loop 4 (SL4) region of wild-type HIV virus with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 11, e) a Rev responsive element (RRE) with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO:
• LTR
• the at least a copy of at least one miRNA target sequence consists of four repetitions of the target sequence of miRNA-142-3 with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 22.
• the lentiviral vector comprises a nucleic acid
• the nucleic acid comprises from 5’ to 3’ the following nucleotides: a) a 5’ long terminal repeat (LTR), b) a primer binding site (PBS) c) a psi packaging signal, d) the Stem-loop 4 (SL4) region of wild-type HIV virus e) a Rev responsive element (RRE), f) a DNA flap central polypurine tract (cPPT), g) an engineered hepatocyte-specific promoter with at least 95%, preferably 98%, sequence identity over the full length of SEQ ID NO 16, h) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein with at least 95%, preferably 98%, sequence identity over the full length of SEQ ID NO 29, i) a mutated optimized wood
• the nucleotide comprised in said lentiviral vector further comprises:
• SL4 Stem-loop 4
• RRE Rev responsive element
• cPPT DNA flap central polypurine tract
• the lentiviral vector comprises a nucleic acid, wherein the nucleic acid comprises, preferably from 5’ to 3’, the following: a) a 5’ long terminal repeat (LTR), b) a primer binding site (PBS) c) a psi packaging signal, d) the Stem-loop 4 (SL4) region of wild-type HIV virus, e) a Rev responsive element (RRE), f) a DNA flap central polypurine tract (cPPT), g) an engineered hepatocyte-specific promoter with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 16, h) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein, wherein the AGXT- RHEAM protein has at least 95%, preferably 98%, most preferably 100%, amino acid sequence identity over the full length
• LTR long
• the j) at least a copy of at least one miRNA target sequence consists of four copies of the target sequence of miRNA-142-3, preferably with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 22.
• the nucleotide comprised in said lentiviral vector further comprises:
• SL4 Stem-loop 4
• RRE Rev responsive element
• cPPT DNA flap central polypurine tract
• the lentiviral vector comprises a nucleic acid, wherein the nucleic acid comprises, preferably from 5’ to 3’, the following: a) a 5’ long terminal repeat (LTR), b) a primer binding site (PBS) c) a psi packaging signal, d) the Stem-loop 4 (SL4) region of wild-type HIV virus, e) a Rev responsive element (RRE), f) a DNA flap central polypurine tract (cPPT), g) an engineered hepatocyte-specific promoter consisting of SEQ ID NO 16, h) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein, wherein the protein consists of SEQ ID NO: 52, i) a mutated optimized woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) consisting of SEQ ID NO 21 , j
• WPRE
• the j) at least a copy of at least one miRNA target sequence consists of four copies of the target sequence of miRNA-142-3, preferably with at least 95%, preferably 98%, most preferably 100% sequence identity over the full length of SEQ ID NO 22.
• the nucleotide comprised in said lentiviral vector further comprises:
• SL4 Stem-loop 4
• RRE Rev responsive element
• cPPT DNA flap central polypurine tract
• the lentiviral vector comprises a nucleic acid, wherein the nucleic acid comprises, preferably from 5’ to 3’, the following nucleotides: a) a 5’ long terminal repeat (LTR) with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 5, b) a primer binding site (PBS) with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 9, c) a psi packaging signal with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 10, d) a Stem-loop 4 (SL4) region of wild-type HIV virus with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 11, e) a Rev responsive element (RRE) with at least 95%, preferably 98%, more preferably 100%, sequence identity
• the at least a copy of at least one miRNA target sequence consists of four repetitions of the target sequence of miRNA-142-3 with at least 95%, preferably 98%, more preferably 100%, sequence identity over the full length of SEQ ID NO: 22.
• the full-length nucleotide comprised in the lentiviral provided herein has at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity over the full length of SEQ ID NO 30 (LV.ET.AGXT-RHEAM.142-3pT).
• the full-length nucleotide comprised in the lentiviral provided comprises, consists, or consists essentially of SEQ ID NO: 30.
• the lipid coat of the viral particle can include membrane bound polypeptides that were previously present on the surface of the host cell.
• the lentiviral vector has a modified expression of one or more polypeptides on its surface that inhibit an immune response to the lentiviral vector following administration to a human subject.
• the surface of the lentiviral vector comprises one or more CD47 molecules.
• CD47 is a "marker of self-protein, which is ubiquitously expressed on human cells. Surface expression of CD47 inhibits macrophage- induced phagocytosis of endogenous cells through the interaction of CD47 and macrophage expressed-SIRPa. Cells expressing high levels of CD47 are less likely to be targeted and destroyed by human macrophages in vivo.
• the lentiviral vector comprises a high concentration of CD47 polypeptide molecules on its surface.
• the lentiviral vector is produced in a cell line that has a high expression level of CD47. In certain embodiments, the lentiviral vector is produced in a cell line, wherein the cell line has high expression of CD47 on the cell membrane. In particular embodiments, the lentiviral vector is produced in a CD47high HEK 293T cell, wherein the HEK 293T is has high expression of CD47 on the cell membrane. In some embodiments, the HEK 293T cell is modified to have increased expression of CD47 relative to unmodified HEK 293T cells. In certain embodiments, the CD47 is human CD47. In an embodiment, the surface of the lentiviral vector lacks expression or has a reduced expression of one or more major histocompatibility complex of class I (MHCI). In certain embodiment, the MHCI is human MHCI.
• MHCI major histocompatibility complex of class I
• the present invention relates to a host cell (e.g., a hepatocyte) or a substantially pure population of cells comprising (e.g., transduced) the lentiviral vector as defined in the first aspect or in any of its embodiments.
• a host cell e.g., a hepatocyte
• a substantially pure population of cells comprising (e.g., transduced) the lentiviral vector as defined in the first aspect or in any of its embodiments.
• the host cell or the substantially pure population of cells are hepatic cells.
• the present invention relates to an isolated nucleic acid comprising the nucleotide comprised in the lentiviral vector as defined in the first aspect or any of its embodiments.
• the present invention provides a pharmaceutical composition
• a pharmaceutical composition comprising the lentiviral as defined in the first aspect or in any of its embodiments, the host cell or the substantially pure population of cells according to the second aspect or any of its embodiments, and/or the nucleic acid as defined in the third aspect or any of its embodiments and a pharmaceutically acceptable carrier or diluent.
• the substantially pure population of cells according to the second aspect or any of its embodiments, or the pharmaceutical composition of the fourth aspect or any of its embodiments the composition for administration are contacted or transduced with the lentiviral vector according to the first aspect or any of its embodiments, either in vivo, in vitro, or ex vivo.
• a pharmaceutical composition as described herein may also contain other substances. These substances include, but are not limited to, cryoprotectants, lyoprotectants, surfactants, bulking agents, anti-oxidants, and stabilizing agents. In some embodiments, the pharmaceutical composition may be lyophilized.
• cryoprotectant includes agents which provide stability to the lentiviral vector against freezing-induced stresses, by being preferentially excluded from the lentiviral vector’s surface. Cryoprotectants may also offer protection during primary and secondary drying and long-term product storage.
• cryoprotectants include sugars, such as sucrose, glucose, trehalose, mannitol, mannose, and lactose; polymers, such as dextran, hydroxyethyl starch and polyethylene glycol; surfactants, such as polysorbates (e.g., PS-20 or PS-80); and amino acids, such as glycine, arginine, leucine, and serine.
• a cryoprotectant exhibiting low toxicity in biological systems is generally used.
• a lyoprotectant is added to a pharmaceutical composition described herein.
• Non-limiting examples of lyoprotectants include sugars, such as sucrose or trehalose; an amino acid, such as monosodium glutamate, non-crystalline glycine or histidine; a methylamine, such as betaine; a lyotropic salt, such as magnesium sulphate; a polyol, such as trihydric or higher sugar alcohols, e.g., glycerin, erythritol, glycerol, arabitol, xylitol, sorbitol, and mannitol; propylene glycol; polyethylene glycol; pluronics; and combinations thereof.
• the amount of lyoprotectant added to a pharmaceutical composition is generally an amount that does not lead to an unacceptable amount of degradation of the strain when the pharmaceutical composition is lyophilized.
• a bulking agent is included in the pharmaceutical composition.
• bulking agents may also impart useful qualities in regard to modifying the collapse temperature, providing freeze-thaw protection, and enhancing the strain stability over long-term storage.
• Non-limiting examples of bulking agents include mannitol, glycine, lactose, and sucrose.
• Bulking agents may be crystalline (such as glycine, mannitol, or sodium chloride) or amorphous (such as dextran, hydroxyethyl starch) and are generally used in formulations in an amount from 0.5% to 10%.
• compositions described herein may also be included in a pharmaceutical composition described herein, provided that they do not adversely affect the desired characteristics of the pharmaceutical composition.
• harmaceutically acceptable carrier means any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art.
• Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and include: additional buffering agents; preservatives; co-solvents; antioxidants, including ascorbic acid and methionine; chelating agents such as EDTA; metal complexes (e.g., Zn- protein complexes); biodegradable polymers, such as polyesters; salt-forming counterions, such as sodium, polyhydric sugar alcohols; amino acids, such as alanine, glycine, glutamine, asparagine, histidine, arginine, lysine, ornithine, leucine, 2-phenylalanine, glutamic acid, and threonine; organic sugars or sugar alcohols, such as lactitol, stachyose, mannose, sorbose, xylose, ribose, ribitol, myoinisitose, myoinisitol, galactose, gal
• the pharmaceutical composition may be prepared for oral, sublingual, buccal, intravenous, intramuscular, subcutaneous, intraperitoneal, conjunctival, rectal, transdermal, intrathecal, topical and/or inhalation-mediated administration.
• the pharmaceutical composition may be a solution which is suitable for intravenous, intramuscular, conjunctival, transdermal, intraperitoneal and/or subcutaneous administration.
• the pharmaceutical composition may be a solution which is suitable for sublingual, buccal and/or inhalation-mediated administration routes.
• the pharmaceutical composition may be a gel or solution which is suitable for intrathecal administration.
• the pharmaceutical composition may be an aerosol which is suitable for inhalation-mediated administration.
• the pharmaceutical composition may be prepared for intrathecal administration.
• the pharmaceutical composition may further comprise common excipients and carriers which are known in the state of the art.
• conventional nontoxic solid carriers may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
• the pharmaceutical composition may further comprise cryoprotectants, lyoprotectants, surfactants, bulking agents, anti-oxidants, stabilizing agents and pharmaceutically acceptable carriers.
• the pharmaceutical compositions are generally supplied in finely divided form along with a surfactant and propellant. The surfactant must, of course, be nontoxic, and is generally soluble in the propellant.
• esters or partial esters of fatty acids containing from 6 to 22 carbon atoms such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride.
• Mixed esters, such as mixed or natural glycerides may be employed.
• a carrier can also be included, as desired, as with, e.g., lecithin for intranasal delivery.
• traditional binders and carriers may include, for example, polyalkalene glycols or triglycerides.
• a suitable pharmaceutical composition for injection can comprise a buffer (e.g. acetate, phosphate or citrate buffer), a surfactant (e.g. polysorbate), optionally a stabilizer agent (e.g. human albumin), etc.
• a buffer e.g. acetate, phosphate or citrate buffer
• a surfactant e.g. polysorbate
• optionally a stabilizer agent e.g. human albumin
• the lentiviral vector can be delivered directly to the site of the adverse cellular population, that is the hepatocytes, thereby increasing the exposure of the diseased tissue to the therapeutic agent.
• the lentiviral vector provided herein can optionally be administered in combination with other agents that are effective in treating the disorder or condition in need of treatment (e.g., prophylactic or therapeutic).
• the administration of lentiviral vectors provided herein in conjunction or combination with an adjunct therapy means the sequential, simultaneous, coextensive, concurrent, concomitant or contemporaneous administration or application of the therapy and the disclosed polypeptides.
• the lentiviral vector is administered in combination with other agents that are able to induce hepatic cell proliferation, such as, but not limited to, triiodothyronine hormone, human-interleukin 6, and/or derivatives thereof.
• the lentiviral vector is administered in combination with other agents that are able to inhibit the immune response against the lentiviral vector, such as, but not limited to, dexamethasone, ciclosporin A, ciclosporin H, rapamycin, and/or derivatives thereof.
• the lentiviral vector is administered in combination with other agents that are able to increase the number of specific receptor in target cells for VSV-G pseudotyped lentivirus, such as, but not limited to, statins, iron quelators, and/or derivatives thereof.
• the lentiviral vector is administered in combination with other agents that are able to block apoptosis in transduced hepatocytes, such as, but not limited to, antioxidants such as N-acetylcysteine, and/or derivatives thereof.
• the lentiviral vector according to the first aspect or any of its embodiments is administrated in combination with Cyclosporin H (CsH), which acts as a transduction enhancer.
• CsH Cyclosporin H
• the CsH is administrated in a dose that ranges from 20-1, 15-1, 10-1, 5-1, or 5-2.5 mg/kg.
• the CsH is administered before, at the same time, or after the lentivirus’s administration. Doses intermediate in the above ranges are also intended to be within the scope of the invention.
• the CsH is administered once.
• the CsH is administered more than once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or at least ten times.
• the repetitive administrations of CsH may be performed in the same day or separated in time.
• intervals between single dosages of CsH can be daily, weekly, monthly or yearly.
• the present invention provides the lentiviral vector according to the first aspect or any of its embodiment, the host cell or the substantially pure population of cells according to the second aspect or any of its embodiments, the isolated nucleic acid according to the third aspect or any of its embodiments, or the pharmaceutical composition of the fourth aspect or any of its embodiments for use as a medicament.
• the present invention provides the lentiviral vector according to the first aspect or any of its embodiment, the host cell or the substantially pure population of cells according to the second aspect or any of its embodiments, the isolated nucleic acid according to the third aspect or any of its embodiments, or the pharmaceutical composition of the fourth aspect or any of its embodiments for use in the treatment of Primary Hyperoxaluria, preferably Primary Hyperoxaluria type 1, the use comprising administering to the subject said lentiviral, said host cell or population of cells, or said composition.
• Primary Hyperoxaluria preferably Primary Hyperoxaluria type 1
• the use of the fifth and sixth aspect is in combination with an immune response inhibitor, preferably dexamethasone, ciclosporin A, ciclosporin H and/or rapamycin, or any combination thereof.
• an immune response inhibitor preferably dexamethasone, ciclosporin A, ciclosporin H and/or rapamycin, or any combination thereof.
• the present invention also provides methods of treating, preventing, or ameliorating the PH1 disorder in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the lentiviral vector according to the first aspect or any of its embodiment, the host cell or the substantially pure population of cells according to the second aspect or any of its embodiments, the isolated nucleic acid of the third aspect or any of its embodiments, or the pharmaceutical composition of the fourth aspect or any of its embodiments.
• the administration of a lentiviral vector, the host cell or the substantially pure population of cells, or the composition provided herein does not induce an immune response in a subject or induces a very low immune response in said subject.
• the lentiviral vector, the host cell or the substantially pure population of cells, or the composition of the present invention are administered as a single dose or multiple doses.
• the lentiviral vector, the host cell or the substantially pure population of cells, or the composition of the present invention dose are administered at once or divided into multiple sub-dose, e.g., two sub-doses, three sub-doses, four sub-doses, five sub-doses, six sub-doses, or more than six sub-doses.
• more than one lentiviral vector is administered.
• the lentiviral vector, the host cell or the substantially pure population of cells, or the composition of the present invention are administered as a single dose.
• the dose of lentiviral vector of the present invention, the host cell or the substantially pure population of cells of the present invention or the pharmaceutical composition is administered repeated at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or at least ten times.
• the lentiviral vector of the present invention, the host cell or the substantially pure population of cells of the present invention or the pharmaceutical composition can be administered locally or systemically.
• the route of administration of the lentiviral vectors is parenteral.
• parenteral as used herein includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal or vaginal administration.
• said lentiviral vector can be administrated intravenously, subcutaneously, intramuscularly, or via any mucosal surface, e.g., orally, sublingually, buccally, sublingually, nasally, rectally, vaginally or via pulmonary route.
• the intravenous form of parenteral administration is preferred.
• a form for administration would be a solution for injection, in particular for intravenous or intraarterial injection or drip.
• Effective doses of the compositions provided herein, for the treatment of PH1 vary depending upon many different factors, including means of administration, target site, physiological state of the subject, whether the subject is a human being or an animal, other medications administered, and whether treatment is prophylactic or therapeutic.
• the subject is a human but non-human mammals including transgenic mammals can also be treated.
• Treatment dosages can be titrated using routine methods known to those of skill in the art to optimize safety and efficacy.
• the subjects include, but are not limited to, individuals with PH1.
• the subject is a pediatric subject, whereas in other aspects, the subject is an adult subject.
• the lentiviral vector of the present invention, the host cell or the substantially pure population of cells of the present invention or the pharmaceutical composition can be administered as a single dose or as multiple doses, wherein the multiple doses can be administered continuously or at specific timed intervals.
• In vitro or in vivo assays can be employed to determine optimal dose ranges and/or schedules for administration. Additionally, effective doses can be extrapolated from dose-response curves obtained from animal models.
• the lentiviral vector of the present invention, the host cell or the substantially pure population of cells of the present invention or the pharmaceutical composition is administered at a dose of at least 1 x 10 9 vector genomes/Kg body weight, preferably 1 x 10 10 , 1 x 10 11 or 1 x 10 12 vector genomes/Kg body weight. More preferably, at least or about 4.6 x 10 12 vector genomes/Kg body weight are administered.
• the dose of lentiviral is of at least 5 x 10 2 , 5 x 10 3 , 5 x 10 4 , 5 x 10 5 , 5 x
• the dose of lentiviral is between 5 x 10 2 to 5 x 10 3 ; 5 x 10 3 to 5 x 10 4 ; 5 x 10 4 to 5 x 10 5 ; 5 x 10 5 to 5 x 10 6 ; 5 x 10 6 to 5 x 10 7 ; 5 x 10 8 to 5 x 10 9 ; 5 x 10 9 to 5 x 10 10 ; 5 x 10 10 to 5 x 10 11 ; 5 x 10 11 to 5 x 10 12 transducing units/kg (TU/kg).
• the dose of lentiviral is about 1 x 10 2 , 1 x 10 3 , 1 x 10 4 , 1 x 10 5 , 1 x 10 6 , 1 x
• lentiviral vector of the present invention, the host cell or the substantially pure population of cells of the present invention or the pharmaceutical composition provided herein can be administered on multiple occasions. Intervals between single dosages can be daily, weekly, monthly or yearly. Intervals can also be irregular depending on the development of the disease or the curative effects of said lentivirals.
• compositions containing the lentiviral vector provided herein are administered to a subject not already in the disease state to enhance the subject’s resistance or minimize effects of disease. Such an amount is defined to be a "prophylactic effective dose.”
• a relatively low dosage is administered at relatively infrequent intervals over a long period of time. Some subjects may continue to receive treatment for the rest of their lives.
• a lentiviral vector wherein the lentiviral vector comprises a nucleic acid, wherein the nucleic acid comprises from 5’ to 3’ the following nucleotides: a) a 5’ long terminal repeat (LTR), b) a primer binding site (PBS) c) a psi packaging signal, d) the Stem-loop 4 (SL4) region of wild-type HIV virus e) a Rev responsive element (RRE), f) a DNA flap central polypurine tract (cPPT), g) an engineered hepatocyte-specific promoter with at least 95%, preferably 98%, sequence identity over the full length of SEQ ID NO 16, h) a nucleotide sequence encoding optimized Alanine-Glyoxylate and Serine- Pyruvate Aminotransferase (AGXT-RHEAM) protein with at least 95%, preferably 98%, sequence identity over the full length of SEQ ID NO 29, i) a mutated optimized woodchuck he
• nucleotide comprised in said lentiviral vector further comprises:
• a pharmaceutical composition comprising the lentiviral vector as defined in any of clauses 1 to 6, or the substantially pure population of cells as defined in clause 7, and a pharmaceutically acceptable carrier or diluent.
• EXAMPLE 1 Materials, methods and sequences 1.1 Lentiviral vector construction.
• LV Reporter lentiviral vector
• eGFP Green Fluorescent Protein
• LV.ET.FIX.142-3pT a LV construct previously described by Naldini and Cantore’s group
• eGFP expressing LV was developed by classic cloning techniques.
• LV.ET.FIX.142-3pT was digested by Nhel and Sail restriction enzymes (New England Biolabs®) to remove FIX sequence. Target sequences of Nhel and Sail are in 5’ and 3’ ends of FIX gene, respectively. After digestion of the plasmid with both enzymes, LV structure was isolated by electrophoresis and band purification.
• the expression cassette of LV.ET.eGFP.142-3pT contains an engineered hepatocyte- specific promoter (modified from Enhanced Transthyretin, GenBank accession number AY661265) and target sequences for the hematopoietic-lineage specific microRNA 142 (mature human microRNA 142 SEQ ID NO: 3 - miRNA-142-3p:
• LTR (SEQ ID NO: 4): it is responsible for provirus transcription during lentiviral vector production.
• LTR is composed of a chimeric form of the CMV promoter and a part of wild-type HIV-1 5’ LTR, RU5.
• U3 sequence of wild- type 5’ LTR involves that this lentiviral vector construct is Tat-independent and, therefore, it will be produced in third generation.
• Chimeric CMV promoter (SEQ ID NO: 5): This sequence leads the transcription of provirus during the lentiviral vector production. It is composed of two different sequences, one with enhancer activity and the other one with promoter activity.
• RU5 (SEQ ID NO: 8): Truncated 5’ LTR without RU3. This sequence is necessary for retrotranscription and integration of proviral genome into transduced cells.
• PBS SL23 SL123 (Primer Binding Site) (SEQ ID NO: 9): tRNA is merged to PBS SL23 element during reverse transcription of proviral genome after target cell transduction and before integration into the cell genome.
• RRE Rev-response element
• ET Promoter (SEQ ID NO: 16): It is an engineered hepatocyte-specific promoter. This sequence leads the transgene expression after lentiviral vector genome integration into the target cells. It is a chimeric promoter composed of a synthetic enhancer, an mTTR enhancer, and an mTTR promoter (Enhanced Transthyretin, GenBank accession number AY661265).
• o Synthetic enhancer (SEQ ID NO: 17): CGCGAGTTAATAATTACCAGCGCGGGCCAAATAAATAATCCGCGAGGGG CAGGTGACGTTTGCCCAGCGCGCGCTGGTAATTATTAACCTCGCGAATA TTGATTCGAGGCCGCGATTGCCGCAATCGCGAGGGGCAGGTGACCTTT GCCCAGCGCGCGCG o mTTR enhancer (SEQ ID NO: 18):
• WPRE Woodchuck hepatitis virus
• SEQ ID NO: 21 It increases transgene expression in transduced cells due to improvements in polyadenylation, RNA export from the nuclei and protein synthesis. It contains a mutation in gene X frame to increase security.
• 142-3pT Target sequence of 142-3 micro-RNA, which is specifically expressed in hematopoietic cells. This element increases the expression specificity of the transgene in transduced cells being a transcriptional control element.
• 3’ LTR DR3RU5 (SEQ ID NO: 23): 3’ LTR is involved in mRNAs polyadenylation during lentiviral vector production.
• 3’ LTR is composed of a truncated U3 element and the elements R and U5 from wild-type HIV-1, being a self-inactivating lentiviral vector.
• the integrated viral genome will contain a deletion in viral promoter region (U3), resulting in the transcriptional inactivation of potentially packable viral genomes in the transduced cells.
• LV.ET.eGFP.142-3pT sequence (SEQ ID NO: 26):
• LV.ET.eGFP.142-3pT map LV.ET.eGFP.142-3pT construct. Different elements previously described are represented in Figure 11.
• AGXT-RHEAM a therapeutic LV expressing an improved version of AGXT gene
• Primers were designed to add Nhel (SEQ ID NO: 27 Fw: 5’ CTA GOT AGO ATG GCC TCT CAC AAG CTG CT 3’) and Sail (SEQ ID NO: 28 Rv: 5’ CAA GTC GAC TCA CAG CTT CTT CTT GGG GC 3’) target sequences in 5’ and 3’ ends respectively, to use them in the cloning.
• LV.ET.FIX.142-3pT structure and AGXT- RHEAM sequence were ligated and LV.ET. AGXT-RHEAM.142-3pT vector was obtained.
• LV.ET. AGXT-RHEAM.142-3pT sequence contains the same elements as LV.EG.eGFP.142- 3pT except eGFP, which has been replaced by AGXT-RHEAM coding sequence.
• AGXT-RHEAM SEQ ID NO: 29: This sequence, developed by Eduardo Salido’s group
• LV.ET.AGXT-RHEAM.142-3PT map LV.ET.AGXT-RHEAM.142-3pT construct. Different elements previously described are represented in Figure 12.
• VSV.G-pseudotyped third-generation SIN LVs were produced by calcium phosphate transient transfection into HEK293T cells.
• Ten million HEK293T cells were seeded per 150 cm 2 cell culture dish and 24 hours later cells were transfected with a solution containing a mix of LV genome transfer plasmid (LV.ET.AGXT-RHEAM.142-3pT or LV.ET.eGFP.142- 3pT) and packaging plasmids pMDLg/pRRE,pRSV.Rev, and pMD2.VSV.G.
• the medium was changed 6 hours after transfection and supernatant was collected 2 days later.
• LV.ET.AGXT-RHEAM.142-3pT titration was performed in HepG2, a hepatic cell line, due to the specificity of the target tissue in this strategy.
• 2- 10 5 cells were seeded in 24 well plates. Twenty-four hours after the seed, cells were transduced with serial dilutions of the LV in culture media and the number of cells at day 0 was determined. Five days after transduction, cells were collected, and genomic DNA (gDNA) was extracted using NucleoSpin® Tissue Kit (Macherey Nagel®) following manufacturer’s instructions.
• the number of lentiviral vector genomes (VCN) integrated into transduced cells was determined by qPCR.
• primers SEQ ID NO: 31 Fw: 5’ CAGGACTCGGCTTGCT GAAG 3’; SEQ ID NO: 32 Rv: 5’ TCCCCCGCTT AAT ACT G ACG 3’
• a probe SEQ ID NO: 33 5’- CGCACGGCAAGAGGCGAGG-3’
• Standard curve to extrapolate qPCR data was performed using serial dilutions of a DNA fragment which contains y and human albumin sequence. All reactions were carried out in duplicate in 7500 Fast Real-Time PCR System (Applied Biosystems®).
• Agxtt 1 mice (B6.129SvAgxt tm1U11 ) were developed by targeted mutagenesis in embryonic stem cells (Salido et al., 2006). Wild type C57BL/6 mice were purchased from The Jackson Laboratory®.
• LV.ET.AGXT-RHEAM.142-3pT or LV.ET.GFP.142-3pT was administered in adult male mice (12-14 weeks old) by tail vein injection. According to the experiments performed in Agxtt 1 mice, they received a single dose of LV.ET.AGXT-RHEAM.142-3pT (2.5- 10 8 TU/mouse; 5-10 8 TU/mouse; 1 10 9 TU/mouse) or LV.ET.eGFP.142-3pT (1.4-10 8 TU/mouse; 5-10 8 TU/mouse). LV was injected in a total volume of 200 mI/mouse.
• Wld-type C57BL/6 mice received a single dose of LV.ET.eGFP.142-3pT (T10 8 TU/mouse; 2.5- 10 8 TU/mouse). LV was injected in a total volume of 200 mI/mouse.
• mice were subjected to an ethylene glycol challenge. It has been reported that overloading of oxalate is needed to develop clinical signs of Primary Hyperoxaluria Type 1 in this mouse model. For this reason, 0.5% of ethylene glycol (Ethylene glycol Reagent Plus®, Sigma-Aldrich, REF 102466), a precursor of glyoxylate metabolism, was administered in drinking water for 7 days. During the ethylene glycol challenge, mice were isolated in metabolic cages and 24 hours urine was collected. Moreover, animal body weight was monitored during the whole treatment.
• ethylene glycol Ethylene glycol Reagent Plus®, Sigma-Aldrich, REF 102466
• mice were anesthetised with ketamine (2.5 mg/20 g mouse) + medetomidine (0.2 mg/20 g mouse). Once unconscious, mice were sacrificed by diaphragm disruption and, therefore, they were infused with 20 ml of PBS1X to remove blood from the tissues to facilitate the following analysis. In sacrificed animals, different tissues were collected (liver, spleen, lungs, bone marrow, lymph nodes, thymus, brain, testicles, pancreas, and kidneys).
• the number of integrated lentiviral vector genomes (VCN) in the injected mice tissues was determined by qPCR.
• primers SEQ ID NO: 37 Fw: 5’ CAGGACTCGGCTTGCT GAAG 3’; SEQ ID NO: 38 Rv: 5’ TCCCCCGCTT AAT ACT G ACG 3’
• a probe SEQ ID NO: 39 5’-
• VCN number of copies of y/number of diploid genomes
• RNA from the liver was extracted by Trizol protocol. Briefly, liver fragments were homogenized in Trizol, after which we added chloroform to separate the aqueous phase. RNA was precipitated with isopropanol and glycogene, cleaned with ethanol 70%, and finally resuspended in free nucleases water. To assure the lack of genomic DNA in RNA samples, they were digested with DNase using DNase Max® Kit (Qiagen) following the manufacturer’s instructions. RNA samples were maintained at -80°C.
• mice Agxt physiological expression in the liver of non-injected C57BL/6 mice was extracted from liver samples of non-injected wild-type mice and RT-PCR was performed as explained above.
• primers against mouse Agxt gene were designed (SEQ ID NO: 49 Rv: 5’ GACAAAGCCAGTCTCCTTCTAC 3’; SEQ ID NO: 50 Fw: 5’ GTGACAGGTGTGGTATGATGAA 3’).
• mouse Tbp and mouse Actb were also measured by RT-qPCR. All reactions were carried out in duplicate in Fast Real-Time PCR System (Applied Biosystems®). Quantification of relative expression of the transgene was performed by AACt analysis (Schefe et at., 2006) referenced to two housekeeping genes, mouse Tbp and mouse Actb, separately.
• samples were deparaffinized by incubation in xylene and decreased ethanol dilutions. Afterward, samples were incubated in blocking solution (10% of donkey serum in PBS 1X) for one hour and overnight with Goat-aeGFP (ab6673 abeam®) 1:100 and Rabbit- amsALB (AHP1478) 1:500 in blocking solution.
• blocking solution 10% of donkey serum in PBS 1X
• samples were incubated with secondary antibodies (Donkey-aGoat AF ® 488 (A11055 invitrogen ® ), Donkey- aRabbit AF ® 488 (A21206 invitrogen ® ), Donkey-aGoat AF ® 594 (A11058 invitrogen ® )) 1 :1000 and DAPI 1:1000 in blocking solution for 1 hour.
• samples were mounted with Mowiol® and visualized in a Zeiss Axiolmager microscope. Images of each sample were acquired. Determination of eGFP positive cells in liver immunostaining samples was performed by QuPath® software. The percentage of eGFP expressing cells with respect to the total of hepatocytes in each image was determined. At least ten different fields per sample were analysed (400x magnification).
• mice Twenty four-hour urine from mice was collected to measure the total amount of oxalate removed from the organism in this period. Individual 24-h urines were collected in 50 pi of 5 N HCI and their volume was measured. Urine samples were clarified with activated charcoal and oxalate was measured by enzymatic determination by oxalate oxidation using Oxalate Kit (Trinity Biotech, REF 591 -D) following the manufacturer’s instructions. To determine the concentration of oxalate (pmol) in each sample, a reference curve of known concentrations of oxalate was performed (Oxalate Standard 0.5 mmol/l REF 591-3 Trinity Biotech). Finally, oxalate quantification (pmol/24 h) was calculated using the oxalate concentration and the urine volume.
• Oxalate Kit Trinity Biotech, REF 591 -D
• kidneys were fixed in formalin and embedded in paraffin. Then, 5pm sections were obtained and stained with haematoxylin-eosin. To determine the damage produced we developed a “Kidney Damage Score” in which the stage of each sample was classified into 4 different stages according to the features observed:
• Tissue architecture is highly affected, and we can observe the presence of calcium oxalate crystals, indicating a nephrocalcinosis stage.
• CsH Cyclosporin H
• C57BL/6 mice received a single dose of LV.ET.eGFP.142-3pT (5-10 8 TU/mouse) by tail vein injection. Additionally, they were treated with 5 mg/kg of body weight of dexamethasone (Fortecortin®), intraperitoneally injected in three consecutive administrations: twelve and two hours before the lentiviral vector injection and four hours after. A control group only injected with the lentiviral vector was also included in the experiment.
• LV.ET.eGFP.142-3pT 5-10 8 TU/mouse
• EXAMPLE 2 Lentiviral vector efficiently transduces the liver in C57BL/6 mice and Agxt1 ⁇ ' ⁇ mouse model after intravenous injection.
• liver VCN achieved in the three different groups was 0.615 (0.39-1.46) in Agxtt 1 mice which received 2.5- 10 8 TU/mouse; 0.765 (0.45-1.19) in Agxtt 1 mice which received 5-10 8 TU/mouse and 1.165 (0.85-0.32) in Agxtt 1 mice which received 10-10 8 TU/mouse ( Figure 3).
• EXAMPLE 3 Therapeutic lentiviral vector is efficiently expressed in treated Agxtt 1 mice liver.
• Therapeutic lentiviral injected mice which received a dose of 2.5- 10 8 TU/mouse showed an AGXT expression of 10.88 % (5.62-16.79) referred to ms Tbp expression and of 0.1041 % (0.06007-0.2452) referred to msActb.
• Agxtl 1 mice which received a dose of 5- 10 8 TU/mouse resulted in an AGXT expression of 12.11 % (4.38-14.48) referred to ms Tbp and of 0.1857 % (0.08878-0.2966) referred to msActb.
• Agxtl 1 therapeutic lentiviral vector injected mice with T10 9 TU/mouse showed an AGXT expression of 19.88 % (18.52-28.55) referred to ms Tbp and of 0.3088 % (0.1707-0.4418) referred to msActb ( Figure 4).
• msActb msActb
• EXAMPLE 4 In vivo lentiviral vector injection into C57BL/6 mice has a reduced off-target transduction.
• the number of lentiviral vector integrated genomes was analysed in C57BL/6 wild type mice injected with two different doses of the reporter lentiviral vector. Number of LV genome copies integrated in different tissues of injected wild-type C57BL/6 mice was analysed by qPCR. Integration of reporter lentiviral vector genome was only observed in liver, the target tissue, and in lungs, spleen and bone marrow, that could occur due to the route of administration used in this strategy. C57BL/6 mice injected with T10 8 TU/mouse showed a VCN of 2.72 (2.33-6.2) in lungs, 0.21 (0.14-0.32) in spleen, and 0.05 (0.04-0.09) in bone marrow.
• EXAMPLE 5 Therapeutic lentiviral vector treated Agxtt 1 mice experience a reduction in urine oxalate levels.
• mice Over the seven days of ethylene glycol challenge, mice were isolated in periods of 24 hours and 24-hour urine was collected. Oxalate concentration in urine was measured at three different time points, before the beginning of the treatment (basal measurement) and at days 3 and 7 of the treatment.
• mice were subjected to ethylene glycol challenge.
• lentiviral vector doses 2.5-10 8 TU/mouse, 5-10 8 TU/mouse and 10-10 8 TU/mouse.
• control groups two negative control groups composed of Agxtt 1 mice injected with PBS or with a reporter lentiviral vector (LV.ET.GFP.142-3pT), and a positive control group composed of C57BL/6 wild type mice. All mice groups were subjected to ethylene glycol challenge.
• EXAMPLE 6 Treated mice gain weight during ethylene glycol challenge.
• Example 5 and 6 showed that, although the AGT expression observed in the corrected cells is much lower than the observed in normal hepatocytes, the phenotype correction obtained in the treated animals is unexpectedly much higher. Thus, an unexpected phenotype reversion degree was found considering the hypothesis of “more than 40% cells should be corrected to achieve a therapeutic effect”. In the most efficient group, percentage of transduction is not higher than 20% (see figure 5 with reporter LV).
• EXAMPLE 7 There is a reduction in nephrocalcinosis development in treated mice.
• kidney damage score where 0 represented no damage, 1 represents a mild damage in kidney parenchyma, 2 represents moderate damage which can turn into stage 3 in which we can observe clear signs of nephrocalcinosis, to classify the damage generated because of the ethylene glycol treatment.
• 0 represents no damage
• 1 represents a mild damage in kidney parenchyma
• 2 represents moderate damage which can turn into stage 3 in which we can observe clear signs of nephrocalcinosis, to classify the damage generated because of the ethylene glycol treatment.
• this classification there was a higher percentage of mice, which develop nephrocalcinosis in non- treated groups compared to the treated ones.
• therapeutic LV injected Agxtt 1 mice with 5-10 8 TU/mouse we did not observe any mouse which develops nephrocalcinosis (Figure 9A).
• EXAMPLE 8 The use of Cyclosporin H in lentiviral transduction protocol increases the transduction efficacy in a hepatic cell line in vitro.
• HepG2 cells were subjected to different concentrations of CsH (4, 8, or 16 mM) during the lentiviral vector transduction protocol.
• Cells were transduced with a lentiviral vector MOI of 0.3.
• Basal transduction levels were 36.67% and in the different CsH treated samples a transduction percentage of 37.67%, 44.3%, and 51.5% in 4, 8, and 16 mM CsH conditions were observed, which means a fold-increase of control samples of 1.03, 1.2, and 1.4 respectively ( Figure 10).
• EXAMPLE 9 Dexamethasone treatment improves the transduction efficacy in the liver of in vivo reporter lentiviral vector treated C57BL/6 mice.
• IFN-1 type 1 interferon
• lentiviral vectors can trigger can also hamper the transduction efficacy, and thus the use of inhibitors of said immune response also represents a potential combined treatment after the in vivo administration of the lentivial vector. For this reason, we carried out an experiment in which C57BL/6 mice were treated with dexamethasone (following the protocol described by Agudo et al. 2012, Molecular Therapy vol. 20 no. 12, 2257-2267) in combination with the lentiviral vector.
• mice C57BL/6 mice were treated with a single dose of LV.ET.eGFP.142-3pT (5-10 8 TU/mouse) by tail vein injection. Additionally, they were intraperitoneally injected with 5 mg/kg of body weight of dexamethasone (Fortecortin®), in three consecutive administrations: twelve and two hours before the lentiviral vector injection and four hours after. Four weeks after the combined treatment mice were sacrificed ( Figure 14A).
• LV.ET.eGFP.142-3pT 5-10 8 TU/mouse
• mice treated with the combination of dexamethasone and the reporter lentiviral vector we observed 0.92 (0.38-1.4) integrated copies per diploid genome whereas in mice treated only with the lentiviral vector 1.48 (1.2-1.76) integrated copies per diploid genome were detected, a significant increase compared with mice treated with the combined treatment ( Figure 14B).
• immunostaining analysis reveals a 4.08 fold increase in the percentage of eGFP positive hepatocytes in mice treated with the combined treatment with respect to the mice treated only with the lentiviral vector with 18.11 (6.381-19.79) % eGFP positive hepatocytes and 4.434 (2.167-7.55) % eGFP positive hepatocytes, respectively.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• General Engineering & Computer Science (AREA)
• Biotechnology (AREA)
• Biochemistry (AREA)
• Biomedical Technology (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Public Health (AREA)
• Pharmacology & Pharmacy (AREA)
• Veterinary Medicine (AREA)
• Animal Behavior & Ethology (AREA)
• Microbiology (AREA)
• Epidemiology (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Virology (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Biophysics (AREA)
• Urology & Nephrology (AREA)
• Gastroenterology & Hepatology (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (7)

Applications Claiming Priority (2)

Publications (1)

Family

ID=75746556

Family Applications (1)

Country Status (8)

Citations (3)

Family Cites Families (2)

• 2021
  • 2021-04-26 EP EP21382363.6A patent/EP4083217A1/en not_active Withdrawn
• 2022
  • 2022-04-26 CN CN202280045601.7A patent/CN117561336A/zh active Pending
  • 2022-04-26 KR KR1020237040673A patent/KR20240004627A/ko active Pending
  • 2022-04-26 EP EP22718999.0A patent/EP4330415A1/en not_active Withdrawn
  • 2022-04-26 JP JP2023565998A patent/JP2024516655A/ja active Pending
  • 2022-04-26 MX MX2023012684A patent/MX2023012684A/es unknown
  • 2022-04-26 WO PCT/EP2022/061107 patent/WO2022229223A1/en not_active Ceased
  • 2022-04-26 CA CA3218031A patent/CA3218031A1/en active Pending
  • 2022-04-26 AU AU2022266057A patent/AU2022266057A1/en not_active Abandoned

Patent Citations (3)

Non-Patent Citations (6)

Also Published As

Similar Documents

Legal Events