WO2022227927A1

WO2022227927A1 - Degradable polymer material, and self-assembled nano-composite and application thereof

Info

Publication number: WO2022227927A1
Application number: PCT/CN2022/081850
Authority: WO
Inventors: 平渊; 郭家晶; 万涛; 辛虎虎
Original assignee: 浙江大学
Priority date: 2021-04-30
Filing date: 2022-03-19
Publication date: 2022-11-03
Also published as: CN113265050B; CN113265050A

Abstract

The present invention provides a degradable polymer material, and a self-assembled nano-composite and an application thereof. The polymer material is a polydisulfide cation material, and a polymer composite with guanidine group-containing disulfide as the main chain is formed by self-assembly of the polydisulfide cation material and biological macromolecules of nucleotides and proteins. After the polymer composite of the present invention enters cells, under the action of GSH in the cytoplasm, the main chain of a carrier can be rapidly degraded to release encapsulated biological macromolecules into the cytoplasm. Therefore, the material of the present invention is less toxic to cells and has good cytocompatibility. The polymer composite of the invention has high efficiency in an intracellular delivery process, low production cost, and low toxicity, can effectively deliver a variety of biological macromolecules into cells without chemical modification and without affecting its biological activity, and can be applied as carriers in intracellular delivery of plasmids, mRNAs, and proteins. The structure of the polydisulfide cation material is shown in formula (1).

Description

A degradable polymer material and self-assembled nanocomposite and its application

technical field

The invention belongs to the fields of organic chemistry, polymer chemistry, molecular biology, cell biology, biotechnology and the like, and relates to a degradable polymer material and a self-assembled nanocomposite and its application.

technical background

Gene delivery refers to the transfer of exogenous genetic material into cells, so as to realize the regulation of cell biological functions and the treatment of diseases. The term "nucleic acid" as used herein includes various types of nucleic acid polymers such as, but not limited to, plasmid DNA (pDNA), messenger RNA (mRNA), small interfering RNA (siRNA) or antisense oligonucleotides (ASO). Over the past few decades, a variety of nanoparticle gene delivery systems have been developed. Nucleic acid delivery systems can be divided into three distinct categories: (i) physical methods, (ii) viral delivery systems, and (iii) non-viral delivery systems. Because physical methods and virus delivery systems have many drawbacks, such as: physical methods can only be performed at the cellular level, and at the same time, a large number of cells are killed and toxic during processing; although viral delivery systems are highly efficient, they are also highly toxic, and It is easy to cause immune rejection of the body, and the capacity of the packaging plasmid is relatively small, and it can only contain small plasmids (<4.8kb), which limits its wide application. Non-viral DNA delivery systems include lipid or liposome materials, inorganic materials and organic polymer materials, which have obvious advantages over physical methods and viral delivery systems: 1. With hydrophilic and hydrophobic ends, it is easy to form small nanovesicles Or micelles; 2. Degradable, low toxicity; 3. No immunogenicity; 4. The surface can be targeted modified to improve the delivery efficiency of drugs; Design; 6. Stable in nature and easy to prepare on a large scale; 7. It can form stable nanocomplexes with biological macromolecules such as DNA, and is easy to deliver.

Gene editing or genome engineering is a technique for the targeted insertion, replacement or deletion of specific DNA sequences in the genome of a host cell. There are four different nucleases available for this strategy so far: meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR/Cas9 system. In the CRISPR-Cas9 system, the DNA vector can encode both Cas9 protein and target sequence-specific guide RNA (gRNA). After transcribing the gRNA and translating Cas9 mRNA, Cas9 will combine with the gRNA to form a ribonucleoprotein (RNP) complex. The formed ribonucleoprotein complex is guided by the nuclear localization sequence (NLS), which can bring the RNP to the nucleus, while the gRNA can pair with a specific gene sequence in the nuclear genome and guide the Cas9 protein to sequence specificity. Cut, create site-specific double-strand breaks and insert the donor gene through homology-directed repair (HDR) mechanisms, or through non-homologous end joining (NHEJ), which can silence, delete, or repair the gene of interest.

At present, CRISPR/Cas9 technology is a very promising method for the treatment of various genetic diseases, especially single-gene genetic diseases. However, because the Cas9 protein is relatively large (170kDa), the plasmid required to encode its protein is relatively large (about 10.6kb), and the virus can only carry a 4.7kb plasmid. At the same time, the virus has the danger of inserting DNA into the host cell gene. In addition, there are problems such as high immunogenicity and difficulty in large-scale preparation, so the development of organic non-viral gene editing delivery systems has become very critical.

SUMMARY OF THE INVENTION

In order to solve the problem that the macromolecular carrier in the prior art cannot well solve the problem of intracellular delivery of biological macromolecules, the purpose of the present invention is to provide a degradable macromolecular material, which is a polydisulfide cation material, specifically a guanidine group-containing material. A cationic polymer material with a disulfide backbone.

The structure of the polydisulfide cation material is shown in formula (1):

Among them: A=S or Se;

X=O or N, n ₁ and n ₂ are integers between 0 and 20;

R ₁ is a small molecule containing a thiol group that can be used as an initiator or a macromolecule of a thiol polyethylene glycol, for example:

Or PEGSH (mercapto polyethylene glycol, MW (relative molecular mass): 200, 400, 600, 800, 1000, 2000, 5000, 10000); 4-arm-PEGSH (4-arm-mercapto polyethylene glycol) or 8-arm-PEGSH (8-arm-mercaptopolyethylene glycol) (MW: 2000, 5000, 10000).

R2 is _:

In formula (2): B=O or N, Y=N, C or O, n ₃ = an integer between 0 and 20,

R ₄ is: H, COOH,

_R3 is:

or

Wherein in formula (3): X=O or N, n ₄ = an integer between 0 and 20, and R ₅ is:

In formula (4): R ₆ is: hydrogen, methoxy, amino or

n ₅ =integer between 0 and 5.

Further, in formula (2), when Y is oxygen, R ₄ is H,

When Y is a carbon element, R ₄ is a carboxyl group,

When Y is nitrogen, R ₄ is H,

In formula (3), X is oxygen element or nitrogen element, and R ₅ is:

Another object of the present invention is to provide a guanidine-containing disulfide backbone polymer composite, which is a nanoparticle formed by self-assembly of polydisulfide cation materials and biological macromolecules such as nucleotides or proteins, wherein Nucleotide chains include but are not limited to plasmids, mRNAs, and proteins include but are not limited to bovine serum albumin (BSA), β-galactosidase (β-gal), purpurin (R-Pe), ribonuclease A ( RNase A), Cas9 protein, etc. When the polydisulfide cation material forms a complex with nucleotides (plasmid, mRNA), the dosage of the nucleotide and the polydisulfide cation material is: every 400ng of nucleotides and 2μl (1mg/ml) of polydisulfide cation The materials were mixed thoroughly and the nanocomplexes were formed after 30 min of incubation. When the polydisulfide cation material forms a complex with the protein, the dosage of the protein and the polydisulfide cation material is as follows: every 500 ng of the protein is fully mixed with 2 μl of the polydisulfide cation material, and the polymer complex can be formed after incubation for 30 min.

Another object of the present invention is to provide the application of the guanidine group-containing disulfide backbone polymer complex as a carrier for intracellular delivery of plasmids, mRNAs, and proteins. Studies have shown that the polydisulfide cation material of the present invention acts as a carrier to form nanoparticles through self-assembly with biological macromolecules such as nucleotides and proteins, which can effectively deliver these biological macromolecules to the cytoplasm of cells without any Make any chemical modifications so as not to alter its structure nor affect its biological activity.

The present invention is used for intracellular CRISPR/Cas9 gene delivery by synthesizing a cationic macromolecular carrier with a guanidine group-bearing disulfide as the main chain. The positively charged guanidine functional group carried on the carrier can interact with negatively charged biological macromolecules to form stable nanoparticles and at the same time help the nanoparticles to pass through the barrier of the cell membrane and enter the cell. Compress biological macromolecules to form stable nanoparticles and promote the escape of complexes from intracellular endosomes and enter the cytoplasm. The disulfide-containing backbone helps nanoparticles through thiosulfhydryl exchange reactions with thiol groups carried by membrane proteins on the cell membrane surface. Through the cell membrane, after entering the cell, the nanoparticles can chemically react with the disulfide backbone under the action of GSH in the cytoplasm to degrade the biomacromolecule to achieve traceless release of biological macromolecules and reduce the toxicity of the carrier, thus solving the problem of macromolecular cellularity. The conundrum of internal delivery vehicles. The present invention obtains this type of cationic macromolecule through design, and further obtains an intracellular delivery carrier of biological macromolecules with high efficiency and low toxicity. Although many guanidine-containing cationic carriers are currently used for intracellular delivery such as cell-penetrating peptides (arginine-rich cell-penetrating peptides, CPPs), a major drawback is that they cannot be degraded intracellularly and have greater toxicity. On the other hand, these penetrating peptides must be covalently linked with the delivered functional biomacromolecules, which will affect their function. Due to the existence of these defects, the research and application of cell penetrating peptides are limited. The designed and synthesized carrier of the present invention has a brand-new chemical structure, belongs to a new delivery carrier and has a new application.

Utilize the present invention to realize respectively: (1), the intracellular delivery of CMV-Cas9-GFP-luciferase-Luciferase plasmid in cell lines such as 293T, Hela, A549, HepG2, etc., and realize the editing of specific gene sites; (2 ), the intracellular delivery of CMV-Cas9-GFP-luciferase mRNA in 293T cells, and the editing of specific gene loci; (3), the intracellular delivery of Cas9 protein in 293T cells, and the realization of specific gene loci Editing of genetic loci. (4), In HeLa and MDA-MB-231 cells, high-efficiency intracellular delivery of proteins such as bovine serum albumin, β-galactosidase, jujube, and ribonuclease A (RNase A) was achieved. The results show that the cationic material has the following characteristics: the biomacromolecule intracellular delivery vector proposed in the present invention has high intracellular delivery efficiency and expression efficiency, and for the intracellular delivery of plasmids, the efficiency is significantly better than the commercial transfection agent PEI 25K (gold standard) and Lipofectamine 2000; for the intracellular delivery of mRNA, the efficiency was significantly better than the commercial transfection agent PEI 25K and Lipofectamine 3000. For intracellular delivery of proteins, the efficiency is basically on par with the commercial delivery vehicle Lipofectamine CRISPR MAX (CMAX). The delivery efficiency of nanoparticles was characterized by the expression of a reporter gene labeled on the nucleotide chain or a Cas9-fused fluorescent protein, and quantitatively compared by flow cytometry. The cytotoxicity test (MTT) shows that the cationic disulfide polymer provided by the present invention has low toxicity. Under the delivery conditions of biological macromolecules, the survival rate of the experimental cells is higher than 90%, and it has a good biological phase. Capacitance. The cationic disulfide material provided by the invention has high efficiency in the intracellular delivery process, low production cost, low material toxicity, and can effectively deliver various biological macromolecules into cells without chemical modification, and does not require chemical modification. affect its biological activity.

Description of drawings

Fig. 1 is the quantitative result of EGFP expression of CMV-Cas9-GFP-luciferase plasmid containing part of disulfide cationic polymer material delivered to 293T cells in Example 2, and compared with the commercial formula PEI 25K, lipo2000.

Fig. 2 is the result of quantitative expression of green fluorescent protein of CMV-Cas9-GFP-luciferase plasmid delivered to 293T cells containing part of disulfide cationic polymer material in Example 2, and compared with commercial formula PEI 25K, lipo2000 .

3 shows the size and surface potential of the complex formed by the polycationic material DET-CPD-12 and CMV-Cas9-GFP-luciferase in Example 3.

Figure 4 shows the intracellular delivery efficiency of different N/P complexes formed by DET-CPD-12 and CMV-Cas9-GFP-luciferase plasmids in 293T cell line in Example 4.

Figure 5 shows the intracellular delivery efficiency of the complex formed by the cationic polymeric material DET-CPD-12 and CMV-Cas9-GFP-luciferase plasmid in four mammalian cell lines of 293T, Hela, HepG2 and A549 in Example 5.

6 is the evaluation of the biodegradability of the cationic polymer material DET-CPD-12 in Example 6.

Figure 7 shows the complexes formed by the cationic polymer material DET-CPD-12 and the CMV-Cas9-GFP-luciferase plasmid in Example 7 in four types: 293T (A), Hela (B), HepG2 (C), and A549 (D). Mammalian cell toxicity assessment.

FIG. 8 shows the delivery efficiency of the nanocomplex formed by DET-CPD-12 and EGFP-plasmid (4.3kb) in 293T cells in Example 8. FIG.

Figure 9 shows the efficiency of the complex formed by DET-CPD-12 and CRISPR-Ca9 plasmid in Example 9 for CCNE1 gene knockout in 293T cells.

Figure 10 shows the knockout of EGFP gene in 293T-EGFP cells by DET-CPD-12 delivering CRISPR-Ca9 plasmid in Example 10.

11 shows the delivery efficiency of the complex formed by DET-CPD-12 and EGFP-mRNA in Example 11 in 293T cells.

12 shows the delivery efficiency of the complex formed by DET-CPD-12 and Cas9-GFP-mRNA in Example 12 in 293T cells.

13 is the size and surface potential of the complex formed by DET-CPD-12 and Cas9-GFP-mRNA in Example 13. FIG.

Figure 14 shows that DET-CPD-12 delivers Cas9-mRNA in 293T cells for knockout of CCNE-1 gene locus in Example 14.

Figure 15 shows that DET-CPD-12 delivers Cas9-mRNA in 293T-EGFP cells for knockout of the EGFP gene locus in Example 15.

FIG. 16 shows the intracellular delivery efficiency of the complex formed by DET-CPD-12 and rhodamine-labeled Cas9 protein in 293T cells in Example 16. FIG.

17 is the size and surface potential of the complex formed by DET-CPD-12 and the gene editing ribonucleic acid complex (CRISPR-Cas9) in Example 17.

Figure 18 shows that the complex formed by DET-CPD-12 and gene editing ribonucleoprotein complex (CRISPR-Cas9) in Example 18 is used for CCNE1 gene knockout in 293T cells.

Figure 19 shows that the complex formed by DET-CPD-12 and gene editing ribonucleoprotein complex (CRISPR-Cas9) in Example 19 is used for EGFP gene knockout in 293T-EGFP cells.

Figure 20 shows DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16, DET-CPD-17, DET-CPD-18, DET in Example 20 -CPD-19, DET-CPD-20 complexes formed by nine materials and phycoerythrin (R-PE) for intracellular delivery and efficiency evaluation in HeLa cells.

Figure 21 shows DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16, DET-CPD-17, DET-CPD-18, DET in Example 21 -Complexes of nine materials CPD-19, DET-CPD-20 and BSA-FITC were used for intracellular delivery and efficiency evaluation in HeLa cells.

Figure 22 shows the complexes formed by five materials DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16 and RNase-A in Example 22 for MDA - Evaluation of intracellular delivery and apoptosis in MB-231 cells.

Figure 23 shows that the complexes formed by DET-CPD-12, DET-CPD-13, DET-CPD-14 and β-Gal protein in Example 23 were used for intracellular delivery and activity evaluation in HeLa cells.

Figure 24 shows that the complexes formed by the three materials DET-CPD-12, DET-CPD-13 and DET-CPD-14 and HRP protein in Example 24 were used for intracellular delivery in HeLa cells.

Figure 25 shows the complexes formed by DET-CPD-12, DET-CPD-13, DET-CPD-14 and GFP protein in Example 25 for intracellular delivery and efficiency evaluation in HeLa cells.

Figure 26 shows that the complexes formed by the three materials DET-CPD-12, DET-CPD-13, DET-CPD-14 and Cyt C protein in Example 26 were used for intracellular delivery in HeLa cells.

Figure 27 shows the complexes formed by DET-CPD-12, DET-CPD-13, DET-CPD-14 and OVA protein in Example 27 for intracellular delivery and efficiency evaluation in HeLa cells.

Figure 28 shows the complexes formed by DET-CPD-12, DET-CPD-13, DET-CPD-14 and LGG protein in Example 28 for intracellular delivery and efficiency evaluation in HeLa cells.

Figure 29 shows the complexes formed by DET-CPD-12, DET-CPD-13, DET-CPD-14 and Lysozyme in Example 29 for intracellular delivery and efficiency evaluation in HeLa cells.

Detailed ways

The present invention will be further described in detail with reference to the following specific embodiments and accompanying drawings, and the protection content of the present invention is not limited to the following embodiments. Variations and advantages that can occur to those skilled in the art without departing from the spirit and scope of the inventive concept are included in the present invention, and the appended claims are the scope of protection. Except for the content specifically mentioned below, the processes, conditions, formulations, experimental methods, etc. for implementing the present invention are all common knowledge and common knowledge in the field, and the present invention is not particularly limited.

Example 1: Specific synthesis method of monomer and polydisulfide cationic polymer material CPD (Cell-penetrating poly(disulfide)s).

1. Synthesis of monomers for polymerization reaction. In Scheme 1, the monomers exemplified and synthesized in the present invention are M ₁ , M ₂ , M ₃ , M ₅ , M ₆ , and M ₇ . The specific structure is as follows:

Monomer synthesis:

In formula (5), lipoic acid 1 (2.06g, 10mmol) was dissolved in 40ml of anhydrous dichloromethane (DCM), carbonyldiimidazole (CDI, 2.43g, 15mmol) was added, stirred at room temperature, triethylenediamine 2 (8.24g, 80mmol) was dissolved in 10ml of anhydrous dichloromethane, stirred in an ice bath for 0.5h, and then the dichloromethane solution dissolved with lipoic acid and CDI was added dropwise. Extracted with saturated brine three times, dried over anhydrous sodium sulfate, and removed the solvent to obtain the crude product, which was separated and purified by silica gel column, and the mobile phase was methanol and dichloromethane system to obtain monomer M1.

Monomer M3 synthesis reference M1:

In formula (6), lipoic acid 1 (2.06 g, 10 mmol) was dissolved in 20 ml of anhydrous DMF, carbonyldiimidazole (CDI, 2.43 g, 15 mmol) was added, and the mixture was stirred at room temperature for 1 h. Arginine methyl ester hydrochloride 3 (1.05g, 5mmol) and DIEA (0.645g, 5mmol) were dissolved in 10ml of anhydrous DMF, and then the arginine hydrochloride solution was added dropwise to the lipoic acid solution and stirred at room temperature 4h, after the reaction is completed, the solvent is removed to obtain the crude product, which is separated and purified by a silica gel column, and the mobile phase is a methanol and dichloromethane system to obtain the monomer M2.

In formula (7), compound 5 refers to the synthesis method of monomer M1, compound 5 (1.68g, 5mmol) and 1H-pyrazole-1-carboxamidine hydrochloride (0.56g, 5mmol) are dissolved in anhydrous dichloromethane The mixture was stirred at room temperature for 4 h, the solvent was removed, and the silica gel column was separated and purified. The mobile phase was a methanol and dichloromethane system to obtain monomer M4.

In formula (8), 4-guanidinobenzoic acid hydrochloride 6 (1.08g, 5mmol) and triethylamine (0.5g, 5mmol) were added to 20ml of dichloromethane and stirred at room temperature for 1h, then (1.24g, 5mmol) of M3, EDCI (0.96g, 5mmol) and DMAP (0.122g, 1mmol) were reacted at room temperature overnight, the solvent was removed after the reaction was completed, the silica gel column was separated and purified, and the mobile phase was methanol and dichloromethane system to obtain monomer M5 .

In formula (9), lipoic acid 1 (2.06g, 10mmol) was dissolved in 20ml DCM, followed by adding EDCI (2.3g, 12mmol), DMAP (0.244g, 2mmol) and 4-aminophenylboronic acid (1.6g, 12 mmol), stirred at room temperature overnight, stopped the reaction, extracted three times with saturated brine, dried over anhydrous sodium sulfate, removed the solvent, separated and purified on a silica gel column, and the mobile phase was a methanol and dichloromethane system to obtain monomer M6.

Monomer M7 is referenced to the synthesis of M6 and M4.

2. Synthesis of polydisulfide cationic polymer material CPD.

The preparation method of the polydisulfide cationic polymer material CPD is as follows: dissolving an appropriate amount of different monomers (the reaction concentration is 0.2M) in TEOA (triethanolamine) buffer solution (PH=7). Then, the initiator was dissolved in TEOA buffer and added to the reaction solution containing the monomers (the reaction concentration was 0.2M). After a period of reaction at room temperature, the reaction was added dropwise to the terminator. The terminator was ethyl iodide. Aqueous solution of amide (5 times the molar amount of monomer). Then fully dialysis and remove with deionized water (dialysis bag, MWCO: 3500) to obtain the target material.

The specific method is as follows:

In formula (10), an appropriate amount of monomer I (M ₁ ) (the reaction concentration is 0.2M) is dissolved in TEOA buffer (PH=7), and the initiator cysteine methyl ester is dissolved in TEOA buffer , the amount of monomer I is 80 times that of the initiator, the reaction at room temperature, the time is 0.5h, 1h, 1.5h, 2.0h, 2.5h, 3.0h, the reaction solution is taken out and added dropwise to dissolved iodoacetamide (equivalent to 5 times of the total monomer amount) in deionized water, the termination was completed after half an hour, and fully dialyzed to obtain diethylenetriamine block polydisulfide cationic polymer materials, named DET-1, DET- 2, DET-3, DET-4, DET-5, DET-6. Materials are stored in a refrigerator at 4 degrees Celsius.

In formula (11), an appropriate amount of monomer II (M ₂ ) (the reaction concentration is 0.2 M) is dissolved in TEOA buffer (PH=7), and the initiator cysteine methyl ester is dissolved in TEOA buffer , the amount of monomer II is 80 times that of the initiator, the reaction at room temperature, the time is 30min, 1.0h, 1.5h, 2.0h, 2.5h, 3.0h, the reaction solution is taken out and added dropwise to iodoacetamide (equivalent to 5 times of the total monomer amount) in deionized water, the termination was completed after half an hour, and fully dialyzed to obtain polydisulfide cation materials with arginine methyl ester blocks, which were named CPD-1 and CPD-2 respectively. , CPD-3, CPD-4, CPD-5, CPD-6. Materials are stored in a refrigerator at 4 degrees Celsius.

In formula (12), an appropriate amount of monomer I (M ₁ ) and monomer II (M ₂ ) (the reaction concentration is 0.2 M) is dissolved in TEOA buffer (PH=7), the initiator cysteine Methyl ester is dissolved in TEOA buffer (the sum of the molar amount of monomer I and monomer II is 80 times that of the initiator), added to the reaction solution in which the monomer is dissolved, and the molar ratio of monomer I and monomer II is added respectively. 1:1, 1:2, 2:1, react at room temperature for 1.5h, after the reaction is completed, the reaction solution is taken out and added dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate , and it was terminated after half an hour and fully dialyzed to obtain the materials DET-CPD-1, DET-CPD-2, DET-CPD-3. Store in a refrigerator at 4 degrees Celsius.

An appropriate amount of monomer I (M ₁ ) and monomer II (M ₂ ) (the reaction concentration is 0.2 M) was dissolved in TEOA buffer (PH=7), and the molar ratio of monomer I and monomer II was 1:2 , dissolve the initiator cysteine methyl ester in TEOA buffer (the sum of the molar amount of monomer I and monomer II is 80 times that of the initiator), add it to the reaction solution dissolved in the monomer, and react at room temperature, The time is: 30min, 1h, 2.0h, 2.5h, 3.0h, the reaction solution is taken out and added dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, half an hour later After the termination was completed, the materials were fully dialyzed to obtain materials, which were named as DET-CPD-4, DET-CPD-5, DET-CPD-6, DET-CPD-7, and DET-CPD-8, respectively, and were stored in a refrigerator at 4 degrees Celsius.

An appropriate amount of monomer I (M ₁ ) and monomer II (M ₂ ) (the reaction concentration is 0.2 M) was dissolved in TEOA buffer (PH=7), and the molar ratio of monomer I and monomer II was 1:2 , dissolve the initiator cysteine methyl ester in TEOA buffer (the sum of the molar weight of monomer I and monomer II is 20 times that of the initiator, add it to the reaction solution dissolved in the monomer, react at room temperature, 1.5 h, the reaction solution was taken out and added dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, and the termination was completed after half an hour, and fully dialyzed to obtain material DET-CPD-9.

The molar ratio of monomer I and monomer II is 1:2, and the initiator cysteine methyl ester is dissolved in TEOA buffer (the sum of the molar amount of monomer I and monomer II is 20 times that of the initiator, and added to In the reaction solution with monomers dissolved, react at room temperature for 1.5h, take out the reaction solution and add dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, and terminate after half an hour , and fully dialyzed to obtain the material DET-CPD-9.

The molar ratio of monomer I and monomer II is 1:2, and the initiator cysteine methyl ester is dissolved in TEOA buffer (the sum of the molar amount of monomer I and monomer II is 40 times that of the initiator, and added to In the reaction solution with monomers dissolved, react at room temperature for 1.5h, take out the reaction solution and add dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, and terminate after half an hour , and fully dialyzed to obtain the material DET-CPD-10.

The molar ratio of monomer I and monomer II is 1:2, and the initiator cysteine methyl ester is dissolved in TEOA buffer (the sum of the molar amounts of monomer I and monomer II is 160 times that of the initiator, and added to In the reaction solution with monomers dissolved, react at room temperature for 1.5h, take out the reaction solution and add dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, and terminate after half an hour , and fully dialyzed to obtain the material DET-CPD-11.

In formula (13), the molar ratio of monomer I and monomer II is 1:2, and the initiator PEGSH (MW: 2000) is dissolved in TEOA buffer (the sum of the molar amounts of monomer I and monomer II is the initiator. Add 80 times of the amount to the reaction solution dissolved in the monomer, react at room temperature for 1.5h, take out the reaction solution and add it dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, After half an hour, it was terminated and fully dialyzed to obtain the material DET-CPD-12.

In formula (14), the molar ratio of monomer M3 and monomer M2 is 1:2, and the initiator PEGSH (MW: 2000) is dissolved in TEOA buffer (the sum of the molar amounts of monomer M2 and monomer M3 is the initiator. Add 80 times of the amount to the reaction solution dissolved in the monomer, react at room temperature for 1.5h, take out the reaction solution and add it dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, After half an hour, it was terminated and fully dialyzed to obtain the material DET-CPD-13.

In formula (15), the molar ratio of monomer M1 and monomer M5 is 1:1, and the initiator PEGSH (MW: 1000) is dissolved in TEOA buffer (the sum of the molar amounts of monomer M1 and monomer M5 is the initiator. Add 80 times of the amount to the reaction solution dissolved in the monomer, react at room temperature for 1.5h, take out the reaction solution and add it dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, After half an hour, it was terminated and fully dialyzed to obtain the material DET-CPD-14.

In formula (16), the molar ratio of monomer M4 and monomer M7 is 1:1, and the initiator PEGSH (MW: 5000) is dissolved in TEOA buffer (the sum of the molar amounts of monomer M4 and monomer M7 is the initiator. Add 80 times of the amount to the reaction solution dissolved in the monomer, react at room temperature for 1.5h, take out the reaction solution and add it dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, After half an hour, it was terminated and fully dialyzed to obtain the material DET-CPD-15.

In formula (17), the molar ratio of monomer M5 and monomer M6 is 1:1, and the initiator PEGSH (MW: 2000) is dissolved in TEOA buffer (the sum of the molar amounts of monomer M5 and monomer M6 is the initiator. Add 80 times of the amount to the reaction solution dissolved in the monomer, react at room temperature for 1.5h, take out the reaction solution and add it dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, After half an hour, it was terminated and fully dialyzed to obtain the material DET-CPD-16.

In formula (18), the molar ratio of monomer M1 and monomer M2 is 1:2, and the initiator I5 is dissolved in TEOA buffer solution (the sum of the molar amounts of monomer M1 and monomer M2 is 80 times that of the initiator, adding In the reaction solution with monomers dissolved, react at room temperature for 1.5h, take out the reaction solution and add dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, stop after half an hour Completed, fully dialyzed to obtain material DET-CPD-17.

In formula (19), the molar ratio of the monomer M1 and the monomer M2 is 1:2, and the initiator I4 is dissolved in the TEOA buffer (the sum of the molar amounts of the monomer M1 and the monomer M2 is 80 times that of the initiator, adding In the reaction solution with monomers dissolved, react at room temperature for 1.5 h, take out the reaction solution and add dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, and terminate after half an hour After completion, full dialysis, the material DET-CPD-18 is obtained.

In formula (20), the molar ratio of monomer M4 and monomer M7 is 1:1, and the initiator I3 is dissolved in the TEOA buffer (the sum of the molar amounts of monomer M4 and monomer M7 is 80 times that of the initiator, adding In the reaction solution with monomers dissolved, react at room temperature for 1.5h, take out the reaction solution and add dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, stop after half an hour After completion, full dialysis, the material DET-CPD-19 is obtained.

In formula (21), the molar ratio of monomer M1 and monomer M5 is 1:1, and the initiator I2 is dissolved in the TEOA buffer solution (the sum of the molar amounts of monomer M1 and monomer M5 is 80 times that of the initiator, adding In the reaction solution with monomers dissolved, react at room temperature for 1.5h, take out the reaction solution and add dropwise to deionized water dissolved in iodoacetamide (equivalent to 5 times the total monomer amount) to terminate, stop after half an hour After completion, full dialysis, the material DET-CPD-20 is obtained.

Example 2: Comparison of plasmid intracellular delivery efficiency of cationic polymer materials DETs, CPDs, and DET-CPDs series vectors

Using the CMV-Cas9-GFP-luciferase plasmid (10.6kb) as a model plasmid, the efficiency of intracellular delivery of the cationic polymer material was evaluated on 293T cells by photographing the brightness of intracellularly expressed green fluorescent protein and detecting the intracellular fluorescence. Screening best material.

The specific method is as follows: inoculate 293 T cells into a 48-well plate overnight, and start the cell transfection experiment when the cell density in the well reaches about 60%-80% on the second day. Dissolve 400ng CMV-Cas9-GFP-luciferase plasmid in 50ul ddH ₂ O, then add DETs, CPDs, DET-CPDs series cationic materials prepared in Example 1 of the invention, and the amount added is respectively 1ul, 2ul, 4ul, 8ul , 16ul, incubate for 30min, add an appropriate amount of serum-free medium to make the total volume 250uL, replace the medium in the original well, after incubating in the cell incubator for 6h, replace it with 250uL of medium containing 10% FBS, after 48h, pass Fluorescence microscopy was used to observe protein expression or directly collect cells for protein expression identification. PEI and Lipofectamine 2000 were used as positive controls.

Experimental results: Fig. 1 is the flow quantification result of the expression of green fluorescent protein in the cells of which the material obtained in Example 1 of the present invention was delivered with CMV-Cas9-GFP-luciferase plasmid on 293T cells. Fig. 2 is the quantitative result of luciferin expression by the material obtained in Example 1 of the present invention in 293T cells that deliver the CMV-Cas9-GFP-luciferase plasmid. It shows that the cationic polymer material can obtain higher delivery efficiency only when a certain reaction time and a certain proportion of monomers are used. Among them, DET-CPD-12 has the highest plasmid delivery efficiency, and is significantly better than the commercially available positive transfection reagents PEI25K and Lipofectamine 2000, indicating that this DET-CPD-12 material is a good intracellular delivery plasmid. vector.

Example 3: The cationic polymer material DET-CPD-12 was complexed with the CMV-Cas9-GFP-luciferase plasmid, and the size and surface potential of the complex were measured using dynamic light scattering (DLS).

The specific method is as follows: Dissolve 2ug CMV-Cas9-GFP-luciferase plasmid in 200ul ddH ₂ O, then add 10ul of cationic material, incubate for 30min, dilute the solution to 1ml, and use a laser nanoparticle analyzer to detect the size of nanoparticles in the solution The distribution and surface potential, and the size of the nanoparticles were measured using a transmission electron microscope.

Experimental results: Figure 3 shows the size distribution and surface potential of the complex formed by the DET-CPD-12 and CMV-Cas9-GFP-luciferase plasmid prepared by the present invention, characterized by DLS. The results show that the polycationic material DET-CPD-12 can form nanoparticles with a size of about 80 nm with the Cas9 plasmid, and the surface potential of the particles is positive.

Example 4: Screening the intracellular delivery efficiency of DET-CPD-12 and CMV-Cas9-GFP-luciferase plasmids different N/P-forming complexes in 293T cell line.

Specific implementation method Referring to Example 2, the N/P of the material DET-CPD-12 and the CMV-Cas9-GFP-luciferase plasmid were 3, 5, 7, 9, and 11, respectively, and PEI 25K and Lipofectamine 2000 were used as positive controls.

Experimental results: Figure 4 shows that when the N/P of the material and the plasmid is 5, the fluorescent expression of the cells is photographed by a fluorescence microscope, and the positive rate of the fluorescent protein expression of the cells is quantitatively counted by flow cytometry. The transfection efficiency is the highest, and the obvious Better than PEI 25K and Lipofectamine 2000.

Example 5: Intracellular delivery efficiency of complexes between DET-CPD-12 and CMV-Cas9-GFP-luciferase plasmids in various mammalian cell lines, including 293T, Hela, HepG2, and A549 cell lines.

The specific method is as follows: (Take Hela cells as an example) cell culture (take a 48-well plate as an example, other culture dishes can refer to 48-well plates), one day (18-24 hours) before transfection, cells (the specific number of cells should be (depending on the type, size and growth rate of cells) were seeded into the wells and cultured so that the cell density on the second day could reach about 60%-80%. Begin the cell transfection experiment, dissolve 400ng of plasmid in 50ul ddH ₂ O, then add 2ul of DET-CPD-12 cationic material, incubate for 30min, add 200ul of serum-free medium, the total volume is 250ul, replace the original well After 6 hours of incubation in a cell incubator, replace with 250 ul of medium containing 10% FBS, and after 48 hours, observe the protein expression by fluorescence microscopy or directly collect cells for protein expression identification.

The results show that: Figure 5 shows that the complex formed by the DET-CPD-12 cationic material prepared by the present invention and the CMV-Cas9-GFP-luciferase plasmid was delivered to a variety of mammalian cell lines, and the cytofluorescent protein was quantitatively counted by flow cytometry positive rate of expression. Compared to the commercially available positive controls PEI 25K and Lipofectamine 2000, the material efficiency of DET-CPD-12 cation was significantly higher.

Example 6: Evaluation of the biodegradability of the cationic polymer material DET-CPD-12.

The specific method is as follows: add 10mM GSH (glutathione) to the DET-CPD-12 material, stir overnight at room temperature, measure the molecular weight of the material by GPC, and compare the GPC results of the material without GSH.

The results show that: Figure 6 shows that the molecular weight of the material without GSH measured by GPC is about 8640Da, while the GSH group has a very obvious degradation effect, and the molecular weight measured by GPC is about 655Da. It shows that DET-CPD-12 has good biodegradability, thus greatly reducing the toxicity to cells.

Example 7: Cytotoxicity evaluation of the complex formed by cationic polymeric material DET-CPD-12 and CMV-Cas9-GFP-luciferase plasmid

Toxicity of polymeric cationic material DET-CPD-12 and its complexes with plasmids to cells under normal cell transfection conditions by MTT method. Using CMV-Cas9-GFP-luciferase plasmid as a model plasmid, the cell viability was detected in 293T, Hela, HepG2, A549 and other animal cell lines respectively.

The specific operation is as follows: Take 293T as an example, inoculate an appropriate amount of 293T cells into a 96-well plate and culture overnight. Remove the medium, add 100ul DET-CPD-12/plasmid complex serum-free medium with different concentrations respectively, after incubation for 4 hours, remove the medium, add an equal amount of 10% serum-containing medium, and continue to culture for 20 hours . The cell viability was then determined according to the standard procedure of the MTT method.

Experimental results: In the case of co-culture of various concentrations of DET-CPD-12/plasmid complexes and cells as shown in Figure 7, the complexes of MTT detection materials and plasmids were compared with treated 293T (A), Hela (B), HepG2 ( C), A549 (D) cell viability was higher than 90%. The results show that the polymer cations prepared by the present invention have little toxicity to cells, and no obvious toxicity to cells during plasmid delivery. The material DET-CPD-12 prepared by the present invention has good biocompatibility.

Example 8: DET-CPD-12 cationic polymer complexed with EGFP-plasmid (4.3 kb) for intracellular delivery.

The specific method is as follows: inoculate the cells (take 293T cells as an example) into a 48-well plate overnight (take a 48-well plate as an example, other culture dishes can refer to the 48-well plate), so that the cell density in the wells on the second day reaches about 60 %～80%, start the cell transfection experiment, dissolve _400ng of plasmid in 50ul ddH2O, then add 2ul of DET-CPD-12 cationic material, incubate for 30min, add 200ul of serum-free medium, the total volume is 250ul, replace the medium in the original well, after 6h incubation in the cell incubator, replace it with 250ul of medium containing 10% FBS, after 48h, observe the protein expression by fluorescence microscope or directly collect the cells for protein expression identification.

The results show that: Figure 8 shows that the complex formed by the DET-CPD-12 cationic material prepared by the present invention and the EGFP-plasmid (4.3kb) was delivered to 293T cells, and the fluorescence expression of the cells was photographed by a fluorescence microscope. The positive rate of cytofluorescent protein expression was quantitatively calculated. Comparable to the commercially available positive controls PEI 25K and Lipofectamine 2000.

Example 9: DET-CPD-12 intracellular delivery of CRISPR-Ca9 plasmid for knockout of CCNE-1 locus.

The specific operation method is as follows: inoculate 293T cells into a 24-well plate overnight, and start the cell transfection experiment when the cell density in the well reaches about 60%-80% on the second day. Dissolve 800ng of the CRISPR-Cas9 plasmid knocking out the CCNE-1 gene in 100ul ddH ₂ O (sgCCNE1:TTTCAGTCCGCTCCAGAAAA), then add 4ul of the DET-CPD-12 cationic material prepared in Example 1 of the invention, incubate for 30min, add an appropriate amount of The total volume of serum medium was 500 ul, which replaced the medium in the original well. After 6 hours of incubation in the cell incubator, it was replaced with 500 ul of medium containing 10% FBS, and the culture was continued for 48 hours. The total genomic DNA was extracted with a commercial kit, the target fragment with the mutation site was amplified by PCR (CCNE1-FP: TCCAAGCCCAAGTCCTGAGCCA, CCNE1-RP: TGGCCTGCAGCTCTGTTTTGGG), denatured and annealed by heating, and finally 0.3 μl of T7E1 nucleic acid was added. Endonuclease, after 30 minutes of reaction at 37°C, run 2% agarose gel electrophoresis to detect and analyze the results of enzyme cleavage.

Experimental results: Figure 9 shows that the material DET-CPD-12 prepared by the present invention is used to detect the mutation rate of mutants by T7E1 endonuclease method after delivering CRISPR-Cas9 plasmid on 293T cells to edit the CCNE1 gene locus, using commercial PEI25K Compared with Lipofectamine 2000 as a positive control, it can be seen that the efficiency of DET-CPD-12 is significantly better than that of PEI 25K and Lipofectamine 2000.

Example 10: The cationic polymeric material DET-CPD-12 delivered the CRISPR-Cas9 plasmid into 293T-EGFP cells for knockout of the EGFP locus.

The specific operation method is as follows: Refer to Example 9 for the implementation method, inoculate 293T cells into a 24-well plate overnight, and start the cell transfection experiment when the cell density in the well reaches about 60%-80% the next day. 800ng of EGFP gene knockout CRISPR-Cas9 plasmid was dissolved in 100ul ddH2O (sgEGFP:GTGAACCGCATCGAGCTGAA, EGFP-FP:ATGGTGAGCAAGGGCGAG, EGFP-FP:TTACTTGTACAGCTCGTCCATGC). Then add 4 ul of the DET-CPD-12 cationic material prepared in Example 1 of the invention, incubate for 30 min, add an appropriate amount of serum-free medium to make the total volume 500 ul, replace the medium in the original well, and incubate in the cell incubator for 6 hours, use The medium containing 10% FBS was replaced by 500ul, and the culture was continued for 48h.

Experimental results: Figure 10 shows that the material DET-CPD-12 prepared in the present invention delivers the CRISPR-Cas9 plasmid on 293T-EGFP cells to knock out the EGFP gene locus, and the intracellular GFP expression was observed by a fluorescence microscope. GFP-expressing cells were quantified. Using commercial PEI 25K and Lipofectamine 2000 as positive controls, it can be seen that the knockout effect of DET-CPD-12 delivery CRISPR-Cas9 plasmid is significantly better than that of PEI 25K and Lipofectamine 2000.

Example 11: DET-CPD-12 cationic polymer complexed with EGFP-mRNA for intracellular delivery of 293T cell line.

For the specific implementation method, refer to Example 2.

The results show that: Figure 11 shows that the complex formed by the DET-CPD-12 cationic material prepared by the present invention and EGFP-mRNA was delivered to 293T cells, the fluorescence expression of the cells was photographed by a fluorescence microscope, and the cells were quantitatively counted by flow cytometry. Positive rate of fluorescent protein expression. Compared with the positive controls PEI 25K and Lipofectamine 3000, the DET-CPD-12 cationic material was significantly more efficient.

Example 12: DET-CPD-12 cationic polymer complexed with Cas9-GFP-mRNA for intracellular delivery of 293T cell line.

For the specific implementation method, refer to Example 2.

The results show that: Figure 12 shows that the complex formed by the DET-CPD-12 cationic material prepared by the present invention and Cas9-GFP-mRNA was delivered to 293T cells, and the fluorescence expression of the cells was photographed by a fluorescence microscope and quantified by flow cytometry The positive rate of cytofluorescent protein expression was counted. Compared with the positive controls PEI 25K and Lipofectamine 3000, the DET-CPD-12 cationic material was significantly more efficient.

Example 13: The cationic polymer material DET-CPD-12 formed a complex with Cas9-GFP-mRNA, and the size and surface potential of the complex were measured by DLS, and the size of nanoparticles was measured by TEM.

The specific method is as follows: Dissolve 2ug Cas9-GFP-mRNA in 200ul ddH ₂ O, then add 10ul cationic material, incubate for 30min, dilute the solution to 1ml, use a laser nanoparticle analyzer to detect the size distribution and surface of nanoparticles in the solution electric potential.

Experimental results: Figure 13 shows the size distribution and surface potential of the complex formed by DET-CPD-12 and Cas9-GFP-mRNA prepared by the present invention, characterized by DLS. The results show that the polycationic material DET-CPD-12 can form nanoparticles with a size of about 120 nm with Cas9-mRNA, and the surface potential of the particles is positive.

Example 14: DET-CPD-12 intracellular delivery of Cas9-mRNA for knockout of the CCNE-1 locus.

For the specific implementation method, refer to Example 9.

Experimental results: Figure 14 shows that the material DET-CPD-12 prepared by the present invention delivers Ca9-mRNA on 293T cells to edit the CCNE1 gene locus using the T7E1 endonuclease method to detect the mutation rate of the mutants, using commercial PEI 25K Compared with Lipofectamine 3000 as a positive control, it can be seen that the knockout efficiency of DET-CPD-12 is significantly better than that of PEI25K and Lipofectamine 3000.

Example 15: DET-CPD-12 cationic polymer delivers Cas9-mRNA into 293T-EGFP cells for knockout of the EGFP locus.

For the specific implementation method, refer to Example 9.

Experimental results: Figure 15 shows that the material DET-CPD-12 prepared by the present invention delivers Cas9-mRNA on 293T-EGFP cells to knock out the EGFP gene locus, using a fluorescence microscope to observe the intracellular GFP expression, and use a flow cytometer to measure the expression. GFP cells were quantified. Using commercial PEI 25K and Lipofectamine 3000 as positive controls, it can be seen that the knockout effect of DET-CPD-12 delivery Cas9-mRNA plasmid is significantly better than that of PEI 25K and Lipofectamine 3000 for EGFP gene locus.

Example 16: DET-CPD-12 delivers rhodamine-tagged Cas9 protein intracellularly.

The specific method is as follows: inoculate 293 T cells into a 48-well plate overnight, and start the cell transfection experiment when the cell density in the well reaches about 60%-80% on the second day. Dissolve 0.5ug of Rhodamine-labeled Cas9 in 50ul ddH ₂ O, then add 4ul of DET-CPD-12 prepared in Example 1 of the invention, incubate for 30min, add an appropriate amount of serum-free medium to make the total volume 250ul, Instead of the medium in the original well, after 6 hours of incubation in the cell incubator, the protein uptake by cells was observed by fluorescence microscopy or the cells were directly collected and the fluorescence intensity in the cells was detected by flow cytometry. The commercial formulations Lipofectamine CRISPRMAX (CMAX) and PEI 25K were used as positive controls.

Experimental results: FIG. 16 is the fluorescence photo and flow cytometry results of DET-CPD-12 prepared in the present invention delivering Cas9 protein. The results showed that DET-CPD-12 had better protein delivery effect.

Example 17: The complex of DET-CPD-12 and gene editing ribonucleic acid complex (CRISPR-Cas9) was prepared, and the size and surface potential of the complex were characterized by DLS, and the size of nanoparticles was characterized by TEM.

The specific operation method is as follows: mix an appropriate amount of CRISPR-Cas9 protein and sgRNA in an appropriate amount of PBS solution, incubate at 37°C for 10 minutes to form RNP, then add an appropriate amount of DET-CPD-12 solution and mix evenly to form nanoparticles, incubate at room temperature After 30 minutes, 1 mL of deionized water was added for dilution, and the size distribution and surface potential of the nanoparticles in the solution were detected using a laser nanoparticle analyzer.

Experimental results: Figure 17 shows the size distribution and surface potential of the complex formed by DET-CPD-12 and CRISPR-Cas9 protein prepared by the present invention, characterized by DLS. The results show that the polycationic material DET-CPD-12 can form nanoparticles with a size of about 150 nm with the CRISPR-Cas9 protein, and the surface potential of the particles is positive.

Example 18: Intracellular delivery of DET-CPD-12 gene editing ribonucleoprotein complex (CRISPR-Cas9) to edit the CCNE1 gene.

The specific operation method is as follows: inoculate 293 T cells into a 24-well plate overnight, and start the cell transfection experiment when the cell density in the well reaches about 60% to 80% on the second day. Dissolve 1 μg of Cas9 protein in 100ul of PBS, add the synthesized gRNA (sgCCNE1:TTTCAGTCCGCTCCAGAAAA), incubate at 300ng at 37°C for 10min to form RNP, then add 4ul of DET-CPD-12 cationic material prepared in Example 1 of the invention, and incubate 30min, add an appropriate amount of serum-free medium to make the total volume to 500ul, replace the medium in the original well, after incubating in the cell incubator for 4h, replace it with 500ul of medium containing 10% FBS, and continue to culture for 48h. Extract the total DNA of the cell genome using a commercial kit, amplify the target fragment with the mutation site by PCR (CCNE1-FP: TCCAAGCCCAAGTCCTGAGCCA, CCNE1-RP: TGGCCTGCAGCTCTGTTTTGGG), heat denaturation annealing and renaturation treatment, and finally add 0.3 μl of T7E1 endonuclease, after 30 minutes of reaction at 37°C, run 2% agarose gel electrophoresis to detect and analyze the results of enzyme cleavage.

Experimental results: Figure 18 shows that the material DET-CPD-12 prepared by the present invention delivers the gene editing ribonucleoprotein complex (CRISPR-Cas9) on 293T cells to edit the CCNE1 gene locus using the T7E1 endonuclease method to detect the mutants. Mutation rate, using commercial PEI 25K and CMAX as positive controls, the results showed that DET-CPD-12 has a better CCNE1 knockout effect.

Example 19: DET-CPD-12 delivers gene editing ribonucleoprotein complex (CRISPR-Cas9) into 293T-EGFP cells to knock out the EGFP gene.

For the specific implementation method, refer to Example 18.

Experimental results: Figure 19 shows that the material DET-CPD-12 prepared by the present invention delivers the gene editing ribonucleoprotein complex (CRISPR-Cas9) on 293T-EGFP cells to knock out the EGFP gene locus using a fluorescence microscope to observe intracellular GFP expression Quantification of GFP-expressing cells was performed using flow cytometry. Using commercialized PEI 25K and CMAX as positive controls, the results showed that DET-CPD-12 had a good EGFP knockout effect.

Example 20: DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16, DET-CPD-17, DET-CPD-18, DET-CPD- 19. DET-CPD-20 delivers phycoerythrin (R-PE) into HeLa cells.

The specific operations are as follows: inoculate HeLa cells into a 24-well plate overnight, and when the cell density in the well reaches about 60% to 80% on the second day, start the protein transfection experiment, now remove the medium in the well, and use PBS The cells were washed three times, then 1 μg of phycoerythrin was dissolved in 100 ul dd H ₂ O, and 4 ul of DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15 were added to each. , DET-CPD-16, incubate for 30min after mixing, then add an appropriate amount of serum-free medium to make the total volume 500ul, instead of the PBS solution in the original well, after incubating in the cell incubator for 4h, remove the medium and then use PBS to The cells were washed three times, and the cells were stored in PBS, and then the uptake of proteins by cells was observed by fluorescence microscopy or directly collected for quantitative characterization of protein uptake.

The results show that: Figure 20 shows the nanocomposite formed by DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16 cationic materials and phycoerythrin prepared by the present invention The uptake of the protein in HeLa cells was measured, the protein uptake of the cells was photographed by a fluorescence microscope, and the mean fluorescence intensity of the cells after the uptake of the protein was quantitatively calculated by flow cytometry. The results show that DET-CPD-12 has a good ability to deliver phycoerythrin to HeLa cells.

Example 21: DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16, DET-CPD-17, DET-CPD-18, DET-CPD- 19. DET-CPD-20 delivers bovine serum albumin (BSA-FITC) into HeLa cells.

The specific operations are as follows: inoculate HeLa cells into a 24-well plate overnight, and when the cell density in the well reaches about 60% to 80% on the second day, start the protein transfection experiment, now remove the medium in the well, and use PBS The cells were washed twice, then 1 μg of BSA-FITC was dissolved in 100ul dd H ₂ O, and 4ul of DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15 were added to each. , DET-CPD-16, DET-CPD-17, DET-CPD-18, DET-CPD-19, DET-CPD-20, incubate for 30min after mixing, and then add an appropriate amount of serum-free medium to make the total volume 500ul , After continuing to incubate for 4 h, the culture medium was removed and the cells were washed three times with PBS. The cells were stored in PBS, and then the uptake of proteins by the cells was observed by fluorescence microscopy or the cells were directly collected for quantitative characterization of protein uptake.

The results show that: Figure 21 shows the nanocomposite formed by the DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16 cationic materials prepared by the present invention and BSA-FITC The uptake of the protein in HeLa cells was measured, the protein uptake of the cells was photographed by a fluorescence microscope, and the mean fluorescence intensity of the cells after the uptake of the protein was quantitatively calculated by flow cytometry. The results show that DET-CPD-12 has a good ability to deliver bovine serum albumin to HeLa cells

Example 22: Intracellular delivery of ribonuclease A (RNase A) by DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16 into MDA-MB-231 cells .

The specific operations are as follows: Inoculate MDA-MB-231 cells into a 48-well plate overnight, and when the cell density in the well reaches about 60% to 80% on the second day, start the protein transfection experiment. Remove, wash the cells three times with PBS, then dissolve 500ng of RNase A in 50ul dd _H2O , add 2ul of DET-CPD-12, DET-CPD-13, DET-CPD-14, DET- CPD-15, DET-CPD-16, incubate for 30min after mixing, then add an appropriate amount of serum-free medium to make the total volume 250ul, instead of the PBS solution in the original well, after incubating in the cell incubator for 6h, use 250ul containing 10 The medium in each well was replaced by fresh DMEM with % fetal bovine serum, and the incubation was continued for 42 h. The toxicity of MDA-MB-231 cells was evaluated with CCK-8 formula kit.

The results show that: Figure 22 shows the nanocomplexes formed by DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16 cationic materials and RNase A prepared by the present invention Uptake in MDA-MB-231 cells, cell survival efficiency was determined by CCK-8 kit. The results showed that after the DET-CPD-12/RNase A nanocomplex was taken up by MDA-MB-231 cells, the cell activity was lower than 20%, and it had obvious cytotoxicity, indicating that DET-CPD-12 has a good ability to convert RNA. The ability of enzyme A to be delivered intracellularly.

Example 23: DET-CPD-12, DET-CPD-13, DET-CPD-14 deliver β-galactosidase (β-Gal) into HeLa cells.

The specific operations are as follows: inoculate HeLa cells into a 24-well plate overnight, and when the cell density in the well reaches about 60% to 80% on the second day, start the protein transfection experiment, now remove the medium in the well, and use PBS Wash the cells twice, then dissolve 1 μg of β-galactosidase in 100 ul dd H ₂ O, add 4 ul of DET-CPD-12, DET-CPD-13, DET-CPD-14 to each, and mix well. After incubation for 30min, add an appropriate amount of serum-free medium to make the total volume 500ul, instead of the PBS solution in the original well, after 4h incubation in the cell incubator, remove the medium, then wash the cells twice with PBS, and fix the cells for 10min After that, the cells were cultured in a 37 ℃ incubator for 2 h with an in situ X-Gal staining kit, and then the experimental results were observed with an optical microscope.

The results show that: Figure 23 shows the uptake of the nanocomplexes formed by the DET-CPD-12, DET-CPD-13, DET-CPD-14 cationic materials and β-galactosidase prepared by the present invention in HeLa cells, This indicated that DET-CPD-12 could deliver β-galactosidase into HeLa cells with high efficiency.

Example 24: DET-CPD-12, DET-CPD-13, DET-CPD-14 deliver horseradish peroxidase (HRP) into HeLa cells.

The specific operations are as follows: inoculate HeLa cells into a 24-well plate overnight, and when the cell density in the well reaches about 60% to 80% on the second day, start the protein transfection experiment, now remove the medium in the well, and use PBS Wash the cells twice, then dissolve 1μg of HRP in 100ul dd H2O, add 4ul of DET-CPD-12, DET-CPD-13, DET-CPD-14 to each, mix well and incubate for 30min, then add an appropriate amount The total volume of serum-free medium was 500 μl, and the PBS solution in the original well was replaced. After 4 h of incubation in the cell incubator, the medium was removed, and the cells were washed three times with PBS, and then washed with prepared Amplex Red (50 μm) and filtered. Hydrogen oxide (500 μm) was replaced with PBS solution, incubated at room temperature for 30 min, continued to wash with PBS solution three times, and the experimental results were observed with a fluorescence microscope.

The results show that: Figure 24 shows the nanocomplexes formed by the DET-CPD-12, DET-CPD-13, DET-CPD-14 cationic materials prepared by the present invention and horseradish peroxidase (HRP) in HeLa cells. The uptake situation indicated that DET-CPD-12 could deliver HRP into HeLa cells with high efficiency.

Example 25: DET-CPD-12, DET-CPD-13, DET-CPD-14 deliver green fluorescent protein (GFP) into HeLa cells.

The specific operations are as follows: Refer to Example 21 for the specific operations.

The results show that: Figure 25 shows the uptake of the nanocomplexes formed by the DET-CPD-12, DET-CPD-13, DET-CPD-14 cationic materials and GFP prepared by the present invention in HeLa cells, and the cells were photographed by a fluorescence microscope The protein uptake was quantified by flow cytometry, and the mean fluorescence intensity after cell uptake of the protein was calculated. The results showed that DET-CPD-12 had a good ability to deliver green fluorescent protein to HeLa cells.

Example 26: DET-CPD-12, DET-CPD-13, DET-CPD-14 deliver cytochrome C protein (Cyt C-FITC) into HeLa cells.

The results show that: Figure 26 shows the uptake of the nanocomplexes formed by DET-CPD-12, DET-CPD-13, DET-CPD-14 cationic materials and cytochrome C protein prepared by the present invention in HeLa cells. Microscopic images of protein uptake by cells. The results show that DET-CPD-12 has a good ability to deliver Cyt C-FITC to HeLa cells.

Example 27: DET-CPD-12, DET-CPD-13, DET-CPD-14 deliver chicken ovalbumin (OVA-FITC) into HeLa cells.

The results show that: Figure 27 shows the uptake of the nanocomplexes formed by DET-CPD-12, DET-CPD-13, DET-CPD-14 cationic materials and chicken ovalbumin prepared by the present invention in HeLa cells. The protein uptake of cells was photographed by microscope, and the mean fluorescence intensity after cell uptake of protein was quantified by flow cytometry. The results showed that DET-CPD-12 had a good ability to deliver OVA-FITC to HeLa cells.

Example 28: DET-CPD-12, DET-CPD-13, DET-CPD-14 deliver murine immunoglobulin (IgG-FITC) into HeLa cells.

The results show that: Figure 28 shows the uptake of the nanocomplexes formed by the DET-CPD-12, DET-CPD-13, DET-CPD-14 cationic materials and IgG-FITC prepared by the present invention in HeLa cells, by fluorescence microscope The protein uptake of the cells was photographed, and the mean fluorescence intensity after the cell uptake of the protein was quantified by flow cytometry. The results show that DET-CPD-12 has a good ability to deliver murine-derived immunoglobulins to HeLa cells.

Example 29: DET-CPD-12, DET-CPD-13, DET-CPD-14 delivery of lysozyme to HeLa cells (Lysozyme-RBITC)

The results show that: Figure 29 shows the uptake of the nanocomplexes formed by the DET-CPD-12, DET-CPD-13, DET-CPD-14 cationic materials and lysozyme prepared by the present invention in HeLa cells, photographed by a fluorescence microscope The protein uptake of cells was quantified by flow cytometry to calculate the mean fluorescence intensity of cells after protein uptake. The results showed that DET-CPD-12 had a good ability to deliver lysozyme to HeLa cells.

Claims

A degradable polymer material, characterized in that the polymer material is a polydisulfide cation material, and the structure of the polydisulfide cation material is shown in formula (1):

in:

A=S or Se;

X=O or N, n 1 , n 2 are integers between 0 and 20;

R 1 is a thiol-containing small molecule or a thiol polyethylene glycol, and the thiol-containing small molecule is selected from:

Sulfhydryl polyethylene glycol, its relative molecular mass: 200, 400, 600, 800, 1000, 2000, 5000, 10000, 4-arm-mercapto polyethylene glycol or 8-arm-mercapto polyethylene glycol, 8-arm -mercaptopolyethylene glycol relative molecular mass: 2000, 5000, 10000);

R2 is :

In formula (2): B=O or N, Y=N, C or O, n 3 = an integer between 0 and 20;

R 4 is: H, COOH,

R3 is:
or

In formula (3): X=O or N, n 4 = an integer between 0 and 20,

R5 is:
In formula (4): R 6 is: hydrogen, methoxy, amino or
n 5 =integer between 0 and 5.
A degradable polymer material according to claim 1, characterized in that, the polymer material has the structures shown in formula (1) to formula (4), wherein X is O or N, Y It is O, C or N, n 1 , n 2 are integers between 0 and 20, n 3 , n 4 are integers between 0 and 20, n 5 is an integer between 0 and 5, and R 1 is an integer between 0 and 5. A small molecule of thiol that can be used as an initiator; in formula (2), when Y is oxygen, R 4 is H,
When Y is a carbon element, R 4 is a carboxyl group,
When Y is nitrogen, R 4 is H,

In formula (3), X is oxygen element or nitrogen element, and R 5 is:

In formula (4), R 6 is: H, methoxy, amino,
n 5 is an integer between 0 and 5.
A guanidine-containing disulfide backbone polymer complex, characterized in that it is a nanoparticle formed by self-assembly of the polydisulfide cation material according to claim 1 and biological macromolecules of nucleotides and proteins. , wherein the nucleotide chain includes but is not limited to plasmid, mRNA, and the protein includes but is not limited to bovine serum albumin, β-galactosidase, jujube protein, ribonuclease A, and Cas9 protein.
A kind of macromolecule complex of guanidine-containing disulfide main chain according to claim 3, is characterized in that, when polydisulfide cation material and nucleotide form complex, nucleotide and polydisulfide cation form a complex. The amount of the material is as follows: every 400ng of nucleotides is fully mixed with 2μl of polydisulfide cation material, and it is obtained after incubation for 30min.
A guanidine group-containing disulfide backbone polymer composite according to claim 3, wherein when the polydisulfide cation material forms a complex with the protein, the amount of the protein and the polydisulfide cation material is : Mix 500ng of protein with 2μl of polydisulfide material, and incubate for 30min.
Application of the guanidine group-containing disulfide backbone polymer complex as claimed in claim 3 as a carrier for intracellular delivery of plasmids, mRNAs and proteins.