CN113265050B - Degradable high polymer material, self-assembled nano composite and application - Google Patents

Degradable high polymer material, self-assembled nano composite and application Download PDF

Info

Publication number
CN113265050B
CN113265050B CN202110481787.8A CN202110481787A CN113265050B CN 113265050 B CN113265050 B CN 113265050B CN 202110481787 A CN202110481787 A CN 202110481787A CN 113265050 B CN113265050 B CN 113265050B
Authority
CN
China
Prior art keywords
cpd
det
cells
monomer
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110481787.8A
Other languages
Chinese (zh)
Other versions
CN113265050A (en
Inventor
平渊
郭家晶
万涛
辛虎虎
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN202110481787.8A priority Critical patent/CN113265050B/en
Publication of CN113265050A publication Critical patent/CN113265050A/en
Priority to PCT/CN2022/081850 priority patent/WO2022227927A1/en
Application granted granted Critical
Publication of CN113265050B publication Critical patent/CN113265050B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
    • C08G75/00—Macromolecular compounds obtained by reactions forming a linkage containing sulfur with or without nitrogen, oxygen, or carbon in the main chain of the macromolecule
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Preparation (AREA)
  • Polymers With Sulfur, Phosphorus Or Metals In The Main Chain (AREA)

Abstract

The invention provides a degradable high molecular material, a self-assembly nano composite and application thereof, wherein the high molecular material is a poly-disulfide cation material, and a high molecular composite containing guanidine-based disulfide main chain is formed by self-assembly of the poly-disulfide cation material and biological macromolecules of nucleotide and protein. After entering cells, the polymer compound can quickly degrade the main chain of the carrier under the action of GSH in cytoplasm to release the wrapped biomacromolecules to enter the cytoplasm, so that the material disclosed by the invention has low toxicity to cells and good cell compatibility. The macromolecular compound has high efficiency in the intracellular delivery process, low manufacturing cost and low material toxicity, can effectively deliver various biological macromolecules into cells, does not need chemical modification, and does not influence the biological activity of the biological macromolecules. The carrier can be used for delivering plasmids, mRNA and proteins in cells. The structure of the poly-di-sulfide cationic material is shown as the formula (1):

Description

Degradable high polymer material, self-assembled nano composite and application
Technical Field
The invention belongs to the fields of organic chemistry, polymer chemistry, molecular biology, cell biology, biotechnology and the like, and relates to a degradable polymer material, a self-assembled nano-composite and application thereof.
Technical Field
Gene delivery refers to the delivery of exogenous genetic material into cells, thereby achieving the regulation of cell biological functions, treatment of diseases, and the like. The term "nucleic acid" herein includes various types of nucleic acid polymers such as, but not limited to, plasmid dna (pdna), messenger rna (mrna), small interfering rna (sirna), or antisense oligonucleotides (ASO). Over the past few decades, a variety of nanoparticle gene delivery systems have been developed. Nucleic acid delivery systems can be divided into three distinct categories: (i) physical methods, (ii) viral delivery systems, and (iii) non-viral delivery systems. Due to the physical methods and virus delivery systems, there are many drawbacks, such as: the physical method can only be carried out at the cellular level, and a large amount of cell death and toxicity are caused in the treatment process; although the virus delivery system has high efficiency, the toxicity is high, the immunological rejection reaction of organisms is easily caused, the capacity of the packaging plasmid is small, and only small plasmids (<4.8kb) can be packaged, so that the wide application of the virus delivery system is limited. Non-viral DNA delivery systems, including lipid or liposome materials, inorganic materials, and organic polymeric materials, have significant advantages over physical methods and viral delivery systems: 1. the nano-vesicle has a hydrophilic end and a hydrophobic end, and can easily form small nano-vesicles or micelles; 2. the degradable and low-toxicity material is degradable; 3. no immunogenicity; 4. the surface can be subjected to targeted modification so as to improve the delivery efficiency of the drug; 5. the structure of the non-viral vector is various, and the non-viral vector can be specially designed for a specific medicament; 6. stable in property and easy for large-scale preparation; 7. can form stable nano-composite with biological macromolecules such as DNA and the like, and is easy to deliver.
Gene editing or genome engineering is a technique for the targeted insertion, replacement or deletion of specific DNA sequences in the genome of a host cell. This strategy has so far a total of four different nucleases available: meganucleases, Zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR/Cas9 systems. In the CRISPR-Cas9 system, a DNA vector can encode both a Cas9 protein and a target sequence-specific guide rna (gRNA), upon transcription of the gRNA and translation of Cas9 mRNA, Cas9 will combine with the gRNA to form a Ribonucleoprotein (RNP) complex, which under the guidance of a Nuclear Localization Sequence (NLS) can bring RNP into the nucleus, while the gRNA can pair with specific gene sequences in the Nuclear genome and direct the Cas9 protein to sequence-specific cleave, generate site-specific double strand breaks and insert the donor gene by a homology-directed repair (HDR) mechanism, or by non-homologous end joining (NHEJ), which can silence, delete or repair the gene of interest.
The CRISPR/Cas9 technology is a very promising method for treating various genetic diseases, in particular monogenic genetic diseases. However, since the Cas9 protein is relatively large (170kDa), the plasmid required for encoding the protein is relatively large (about 10.6kb), while viruses can only encapsulate plasmid of 4.7kb, and meanwhile, the viruses have the problems of risk of inserting DNA into host cell genes, relatively high immunogenicity, difficulty in large-scale preparation and the like, so that the development of an organic non-viral gene editing and delivery system becomes very critical.
Disclosure of Invention
In order to solve the problem that a macromolecular carrier in the prior art cannot well solve the intracellular delivery of biological macromolecules, the invention aims to provide a degradable macromolecular material, which is a poly-disulfide cationic material, in particular to a cationic macromolecular material of a disulfide main chain containing guanidyl.
The structure of the poly-di-thio-cationic material is shown as the formula (1):
Figure BDA0003049536520000021
wherein: a ═ S or Se;
x is O or N, N 1 、n 2 Is an integer between 0 and 20;
R 1 examples of small molecules which contain thiol groups and can be used as initiators (initiators) or macromolecules with thiol-polyethylene glycol are the following:
Figure BDA0003049536520000022
or PEGSH (mercaptopolyethylene glycol, MW (relative molecular mass): 200, 400, 600, 800, 1000, 2000, 5000, 10000); 4-arm-PEGSH (4-arm-mercaptopolyethylene glycol) or 8-arm-PEGSH (8-arm-mercaptopolyethylene glycol) (MW:2000, 5000, 10000).
R 2 Comprises the following steps:
Figure BDA0003049536520000023
formula (2), wherein: B-O or N, Y-N, C or O, N 3 An integer of 0 to 20,
R 4 comprises the following steps: H. COOH, COOH,
Figure BDA0003049536520000024
R 3 Comprises the following steps:
Figure BDA0003049536520000025
or
Figure BDA0003049536520000026
Wherein in formula (3): x is O or N, N 4 R is an integer of 0 to 20 5 Comprises the following steps:
Figure BDA0003049536520000031
Figure BDA0003049536520000032
in formula (4): r 6 Comprises the following steps: hydrogen, methoxy, amino or
Figure BDA0003049536520000033
n 5 And the integer is 0-5.
Further, in the formula (2), when Y is oxygen, R 4 Is H,
Figure BDA0003049536520000034
When Y is carbon, R 4 Is a carboxyl group,
Figure BDA0003049536520000035
When Y is nitrogen, R 4 Is H,
Figure BDA0003049536520000036
In the formula (3), X is oxygen or nitrogen, R 5 Comprises the following steps:
Figure BDA0003049536520000037
Figure BDA0003049536520000038
another objective of the present invention is to provide a macromolecular complex of disulfide backbone containing guanidino, which is a nanoparticle formed by self-assembly of poly-disulfide cationic material and biological macromolecules such as nucleotides or proteins, wherein the nucleotide chains include but are not limited to plasmids and mRNA, and the proteins include but are not limited to Bovine Serum Albumin (BSA), beta-galactosidase (beta-gal), date red protein (R-Pe), ribonuclease A (RNase A), Cas9 protein, etc. When the polydithio-cationic material forms a complex with a nucleotide (plasmid, mRNA), the amounts of nucleotide and polydithio-cationic material used are: each 400ng of the nucleotide was mixed well with 2. mu.l (1mg/ml) of the polydithio-cationic material and incubated for 30min to form a nanocomposite. When the polydithio-cationic material forms a complex with the protein, the amount of protein and polydithio-cationic material used is: each 500ng of the protein was mixed well with 2. mu.l of polydithio-cationic material and incubated for 30min to form a polymer complex.
The invention further aims to provide the application of the guanidino-containing disulfide backbone polymer complex as a carrier in intracellular delivery of plasmids, mRNA and proteins. Researches show that the poly-dithio-cationic material is used as a carrier, forms nano particles with biological macromolecules such as nucleotide and protein through self-assembly, can effectively deliver the biological macromolecules to cytoplasm of cells, does not need to carry out any chemical modification on the biological macromolecules, and does not change the structure and influence the biological activity of the biological macromolecules.
The invention is used for delivering the intracellular CRISPR/Cas9 gene by synthesizing a cationic high molecular vector with guanidino disulfide as a main chain. The guanidyl functional group of positive charge carried on the carrier can form stable nano particles through the interaction of positive and negative charges with biological macromolecules with negative charges, and can help the nano particles to penetrate through a cell membrane to block the biological macromolecules to enter into cells, the amino part is helpful for compressing the biological macromolecules to form stable nano particles and promoting a compound to escape from inclusion bodies in the cells and enter into cytoplasm, the disulfide-containing main chain helps the nano particles to pass through the cell membrane through a sulfhydryl exchange reaction with sulfhydryl carried by membrane protein on the surface of the cell membrane, and the nano particles can chemically react with the disulfide main chain under the action of GSH in the cytoplasm after entering the cells to degrade the disulfide main chain to realize traceless release of the biological macromolecules and reduce the toxicity of the carrier, so that the problem of transferring the carrier in the macromolecule cells is solved. The invention obtains the cationic polymer by design, and further obtains the high-efficiency and low-toxicity biomacromolecule intracellular delivery carrier. Although many current guanidinium-containing cationic carriers are used for intracellular delivery such as cell-penetrating peptides (CPPs), one of the major drawbacks is that the carriers cannot be degraded in cells and have high toxicity, and on the other hand, the cell-penetrating peptides must be combined with delivered functional biological macromolecules by means of covalent connection, so that the functions of the functional biological macromolecules are affected, and the research and application of the cell-penetrating peptides are limited due to the defects. The carrier designed and synthesized by the invention has a brand-new chemical structure, belongs to a new delivery carrier and is new in application.
The invention respectively realizes the intracellular delivery of CMV-Cas9-GFP-Luciferase plasmids in cell lines of 293T, Hela, A549, HepG2 and the like, and realizes the editing of specific gene loci; (2) intracellular delivery of CMV-Cas9-GFP-luciferase mRNA in 293T cells and the realization of the editing of specific gene loci; (3) intracellular delivery of Cas9 protein in 293T cells and the editing of specific genetic loci achieved. (4) The high-efficiency intracellular delivery of proteins such as bovine serum albumin, beta-galactosidase, date red protein, ribonuclease A (RNase A) and the like is realized in HeLa and MDA-MB-231 cells. The results show that the cationic material has the following characteristics: the biomacromolecule intracellular delivery carrier provided by the invention has very high intracellular delivery efficiency and expression efficiency, and for the intracellular delivery of plasmids, the efficiency is obviously superior to that of commercial transfection reagents PEI25K (gold standard) and Lipofectamine 2000; for intracellular delivery of mRNA, the efficiency was significantly better than commercial transfection reagent PEI25K, significantly better than Lipofectamine 3000. For intracellular delivery of proteins, the efficiency is essentially equal to that of the commercial delivery vehicle Lipofectamine CRISPR MAX (CMAX). The delivery efficiency of the nanoparticles was characterized by expression of the reporter gene labeled on the nucleotide chain or by the fluorescent protein of Cas9 fusion and quantitatively compared by flow cytometry. A cytotoxicity experiment (MTT) shows that the cationic dithio high molecular polymer provided by the invention has lower toxicity, and the survival rate of experimental cells is higher than 90% under the condition of delivery of biological macromolecules, so that the cationic dithio high molecular polymer has better biocompatibility. The cationic disulfide material provided by the invention has high efficiency in the intracellular delivery process, low manufacturing cost and low material toxicity, can effectively deliver various biological macromolecules into cells, does not need chemical modification, and does not influence the biological activity.
Drawings
FIG. 1 shows the quantitative results of EGFP expression of the CMV-Cas9-GFP-luciferase plasmid delivered to 293T cells by the polymer material containing partial dithio cations in example 2, and the results are compared with the commercial formula PEI25K, lipo 2000.
FIG. 2 shows the quantitative results of the expression of green fluorescent protein in example 2, which shows the CMV-Cas9-GFP-luciferase plasmid delivered to 293T cells by the partially dithio-cation containing polymer material, and compares the result with the commercial formula PEI25K, lipo 2000.
FIG. 3 shows the size and surface potential of the complex formed by the polycationic material DET-CPD-12 and CMV-Cas9-GFP-luciferase in example 3.
FIG. 4 shows the intracellular delivery efficiency of the DET-CPD-12 complex with different N/P forms of CMV-Cas9-GFP-luciferase plasmid in 293T cell line in example 4.
FIG. 5 shows the intracellular delivery efficiency of the cationic polymeric material DET-CPD-12 complexed with CMV-Cas9-GFP-luciferase plasmid in 293T, Hela, HepG2, A549 four mammalian cell lines of example 5.
FIG. 6 is an evaluation of biodegradability of the cationic polymer material DET-CPD-12 of example 6.
FIG. 7 shows the toxicity evaluation of the cationic polymer DET-CPD-12 and CMV-Cas9-GFP-luciferase plasmid in 293T (A), Hela (B), HepG2(C) and A549(D) in example 7.
FIG. 8 shows the delivery efficiency of the nano-complex formed by DET-CPD-12 and EGFP-plasmid (4.3kb) in example 8 in 293T cells.
FIG. 9 shows the efficiency of the complex formed by DET-CPD-12 and CRISPR-Ca9 plasmid in example 9 for the CCNE1 gene knockout in 293T cells.
FIG. 10 is the knockout of the EGFP gene in 293T-EGFP cells by DET-CPD-12 delivering CRISPR-Ca9 plasmid in example 10.
FIG. 11 shows the delivery efficiency of the complex formed by DET-CPD-12 and EGFP-mRNA in 293T cells in example 11.
FIG. 12 shows the delivery efficiency of the complex formed by DET-CPD-12 and Cas9-GFP-mRNA in 293T cells in example 12.
FIG. 13 shows the size and surface potential of the complex formed by DET-CPD-12 with Cas9-GFP-mRNA in example 13.
FIG. 14 shows the delivery of Cas9-mRNA in 293T cells for CCNE-1 gene locus knock-out by DET-CPD-12 in example 14.
FIG. 15 shows that DET-CPD-12 delivers Cas9-mRNA in 293T-EGFP cells for EGFP gene site knock-out in example 15.
FIG. 16 shows intracellular delivery efficiency of DET-CPD-12 complex with rhodamine-labeled Cas9 protein for 293T cells in example 16.
FIG. 17 shows the size and surface potential of the complex formed by DET-CPD-12 and the gene editing ribonucleic acid complex (CRISPR-Cas9) in example 17.
FIG. 18 shows the complex formed by DET-CPD-12 and the gene-editing ribonucleoprotein complex (CRISPR-Cas9) in example 18 for CCNE1 gene knockout in 293T cells.
FIG. 19 shows the complex of DET-CPD-12 and the gene-editing ribonucleoprotein complex (CRISPR-Cas9) used for EGFP knock-out in 293T-EGFP cells in example 19.
FIG. 20 shows the intracellular delivery and efficiency evaluation in HeLa cells of complexes formed by the nine materials DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16, DET-CPD-17, DET-CPD-18, DET-CPD-19, DET-CPD-20 of example 20 with phycoerythrin (R-PE).
FIG. 21 shows complexes of nine materials, DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16, DET-CPD-17, DET-CPD-18, DET-CPD-19, DET-CPD-20, of example 21 with BSA-FITC for intracellular delivery and efficiency evaluation in HeLa cells.
FIG. 22 shows the intracellular delivery and apoptosis evaluation in HeLa cells of complexes formed between five materials DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15 and DET-CPD-16 of example 22 and RNase-A.
FIG. 23 shows the complexes formed by the three types of materials DET-CPD-12, DET-CPD-13 and DET-CPD-14 in example 23 and beta-Gal protein for intracellular delivery and activity evaluation in HeLa cells.
Detailed Description
The present invention will be described in further detail with reference to the following specific examples and drawings, but the present invention is not limited to the following examples. Variations and advantages that may occur to those skilled in the art are intended to be included within the invention without departing from the spirit and scope of the inventive concept, and the scope of the invention is to be determined by the appended claims. The procedures, conditions, formulations, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art, except for those specifically mentioned below, and the present invention is not particularly limited thereto.
Example 1: a specific synthesis method of monomer and poly-disulfide cationic polymer material CPD (Cell-crosslinking poly (disulfide) s).
1. Synthesis of polymerization monomers, Scheme 1 is a monomer exemplified in the present invention, and M is 1 ,M 2 ,M 3 ,M 5 ,M 6 ,M 7 . The specific structural formula is as follows:
Figure BDA0003049536520000061
and (3) synthesis of monomers:
Figure BDA0003049536520000071
in the formula (5), lipoic acid 1(2.06g and 10mmol) is dissolved in 40ml of anhydrous Dichloromethane (DCM), carbonyl diimidazole (CDI,2.43g and 15mmol) is added, stirring is carried out at room temperature, triethylene diamine 2(8.24g and 80mmol) is dissolved in 10ml of anhydrous dichloromethane, stirring is carried out in ice bath for 0.5h, then dichloromethane solution with lipoic acid and CDI is dropwise added, reaction is carried out at zero temperature for 1h after completion, reaction is carried out at room temperature for 1h, saturated saline is extracted for three times, anhydrous sodium sulfate is dried, a solvent is removed to obtain a crude product, a silica gel column is used for separation and purification, and a mobile phase is a methanol and dichloromethane system, so that a monomer M1 is obtained.
Monomer M3 synthesis reference M1:
Figure BDA0003049536520000072
in formula (6), lipoic acid 1(2.06g,10mmol) was dissolved in 20ml of anhydrous DMF, carbonyl diimidazole (CDI,2.43g,15mmol) was added, and the mixture was stirred at room temperature for 1 hour. Dissolving arginine methyl ester hydrochloride 3(1.05g,5mmol) and DIEA (0.645g,5mmol) in 10ml of anhydrous DMF, then dropwise adding the arginine hydrochloride solution into a lipoic acid solution, stirring at room temperature for 4h, removing the solvent after the reaction is finished to obtain a crude product, and separating and purifying by using a silica gel column, wherein the mobile phase is a methanol and dichloromethane system, thus obtaining a monomer M2.
Figure BDA0003049536520000073
In the formula (7), the compound 5 refers to a synthesis method of a monomer M1, the compound 5(1.68g,5mmol) and 1H-pyrazole-1-formamidine hydrochloride (0.56g,5mmol) are dissolved in anhydrous dichloromethane, the mixture is stirred for 4 hours at room temperature, the solvent is removed, and the mixture is separated and purified by a silica gel column, and the mobile phase is a methanol and dichloromethane system, so that the monomer M4 is obtained.
Figure BDA0003049536520000081
In the formula (8), 4-guanidinobenzoic acid hydrochloride 6(1.08g,5mmol) and triethylamine (0.5g,5mmol) are added into 20ml dichloromethane and stirred for 1h at room temperature, then M3 (1.24g,5mmol), EDCI (0.96g,5mmol) and DMAP (0.122g,1mmol) are added to react overnight at room temperature, after the reaction is finished, the solvent is removed, silica gel column separation and purification are carried out, and the mobile phase is a methanol and dichloromethane system, thus obtaining a monomer M5.
Figure BDA0003049536520000082
In the formula (9), lipoic acid 1(2.06g,10mmol) is dissolved in 20ml DCM, EDCI (2.3g,12mmol), DMAP (0.244g,2mmol) and 4-aminobenzeneboronic acid (1.6g,12mmol) are added in sequence, stirring is carried out at room temperature overnight, the reaction is stopped, saturated saline solution is extracted for three times, anhydrous sodium sulfate is dried, the solvent is removed, silica gel column separation and purification are carried out, and the mobile phase is a methanol and dichloromethane system, so that the monomer M6 is obtained.
Monomer M7 reference synthesis of M6 and M4.
2. And (3) synthesizing a poly-di-sulfur cationic polymer material CPD.
The preparation method of the poly-di-thio-cationic polymer material CPD comprises the following steps: appropriate amounts of the different monomers (reaction concentration 0.2M) were dissolved in TEOA (triethanolamine) buffer (PH 7). Then, the initiator is dissolved in TEOA buffer solution, added into the reaction solution dissolved with the monomer (the reaction concentration is 0.2M), after reacting for a period of time at room temperature, the reaction solution is dripped into a terminator, and the terminator is aqueous solution of iodoacetamide (the dosage is 5 times of the molar weight of the monomer). Then fully dialyzing with deionized water to remove (dialysis bag, MWCO:3500), and obtaining the target material.
The specific method comprises the following steps:
Figure BDA0003049536520000083
in the formula (10), an appropriate amount of the monomer I (M) 1 ) (reaction concentration 0.2M) was dissolved in TEOA buffer (pH 7), and initiator cysteine methyl ester was dissolved inIn TEOA buffer solution, the amount of the monomer I is 80 times of that of an initiator, the reaction is carried out at room temperature for 0.5h,1h, 1.5h,2.0h, 2.5h and 3.0h, the reaction solution is taken out and dripped into deionized water dissolved with iodoacetamide (equivalent is 5 times of the total monomer amount) for termination, the termination is completed after half an hour, and the full dialysis is carried out, thus obtaining the polydithio cationic polymer materials of diethylenetriamine block, which are respectively named as DET-1, DET-2, DET-3, DET-4, DET-5 and DET-6. The material was stored in a refrigerator at 4 ℃.
Figure BDA0003049536520000091
In the formula (11), an appropriate amount of the monomer II (M) 2 ) Dissolving (reaction concentration is 0.2M) in TEOA buffer solution (PH 7), dissolving initiator cysteine methyl ester in the TEOA buffer solution, taking out the reaction solution, dropwise adding the reaction solution into deionized water dissolved with iodoacetamide (equivalent is 5 times of the total monomer amount) for stopping reaction at room temperature for 30min,1.0h, 1.5h,2.0h, 2.5h and 3.0h, and fully dialyzing after half an hour to obtain the poly-disulfide-cationic materials of arginine methyl ester block, which are named as CPD-1, CPD-2, CPD-3, CPD-4, CPD-5 and CPD-6 respectively. The material was stored in a refrigerator at 4 ℃.
Figure BDA0003049536520000092
In the formula (12), an appropriate amount of the monomer I (M) 1 ) And monomer II (M) 2 ) (reaction concentration 0.2M) was dissolved in TEOA buffer (PH 7), initiator cysteine methyl ester was dissolved in TEOA buffer (the sum of the molar amounts of monomer I and monomer II was 80 times the amount of initiator), added to the reaction solution in which the monomer was dissolved, and added in a molar ratio of monomer I to monomer II of 1: 1. 1: 2. 2: 1, reacting at room temperature for 1.5h, taking out the reaction liquid after the reaction is finished, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (equivalent is 5 times of the total monomer amount), stopping after half an hour, and fully dialyzing to obtain the materials DET-CPD-1, DET-CPD-2 and DET-CPD-3. Stored in a refrigerator at 4 ℃.
An appropriate amount of monomer I (M) 1 ) And monomer II (M) 2 ) (reaction concentration 0.2M) was dissolved in TEOA buffer (PH 7) at a molar ratio of monomer I to monomer II of 1: 2, dissolving an initiator cysteine methyl ester in TEOA buffer (the sum of the molar amounts of the monomer I and the monomer II is 80 times of that of the initiator), adding the dissolved monomer into the reaction solution, and reacting at room temperature for the following time periods: taking out the reaction liquid and dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (equivalent is 5 times of the total monomer amount) for termination within 30min,1h, 2.0h, 2.5h and 3.0h, terminating after half an hour, and fully dialyzing to obtain the materials which are named as DET-CPD-4, DET-CPD-5, DET-CPD-6, DET-CPD-7 and DET-CPD-8 respectively, and storing in a refrigerator at 4 ℃.
The appropriate amount of monomer I (M) 1 ) And monomer II (M) 2 ) (reaction concentration 0.2M) was dissolved in TEOA buffer (PH 7) at a molar ratio of monomer I to monomer II of 1: 2, dissolving an initiator cysteine methyl ester in TEOA buffer solution (the sum of the molar weight of the monomer I and the molar weight of the monomer II is 20 times of that of the initiator, adding the mixture into reaction liquid dissolved with the monomers, reacting at room temperature for 1.5h, taking out the reaction liquid, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (the equivalent is 5 times of the total amount of the monomers), stopping the reaction after half an hour, and fully dialyzing to obtain the material DET-CPD-9.
The molar ratio of the monomer I to the monomer II is 1: 2, dissolving an initiator cysteine methyl ester in TEOA buffer solution (the sum of the molar weight of the monomer I and the molar weight of the monomer II is 20 times of that of the initiator, adding the mixture into reaction liquid dissolved with the monomers, reacting at room temperature for 1.5h, taking out the reaction liquid, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (the equivalent is 5 times of the total amount of the monomers), stopping the reaction after half an hour, and fully dialyzing to obtain the material DET-CPD-9.
The molar ratio of the monomer I to the monomer II is 1: 2, dissolving an initiator cysteine methyl ester in TEOA buffer solution (the sum of the molar weight of the monomer I and the monomer II is 40 times of that of the initiator, adding the initiator cysteine methyl ester into reaction liquid dissolved with the monomers, reacting at room temperature for 1.5h, taking out the reaction liquid, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (the equivalent is 5 times of the total amount of the monomers) to terminate, terminating after half an hour, and fully dialyzing to obtain the material DET-CPD-10.
The molar ratio of the monomer I to the monomer II is 1: 2, dissolving an initiator cysteine methyl ester in TEOA buffer solution (the sum of the molar weight of the monomer I and the molar weight of the monomer II is 160 times of that of the initiator, adding the mixture into reaction liquid dissolved with the monomers, reacting at room temperature for 1.5h, taking out the reaction liquid, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (the equivalent is 5 times of the total amount of the monomers), stopping the reaction after half an hour, and fully dialyzing to obtain the material DET-CPD-11.
Figure BDA0003049536520000101
In formula (13), the molar ratio of monomer I to monomer II is 1: 2, dissolving an initiator PEGSH (MW:2000) in TEOA buffer solution (the sum of the molar weight of the monomer I and the molar weight of the monomer II is 80 times of that of the initiator), adding the mixture into reaction liquid dissolved with the monomers, reacting at room temperature for 1.5h, taking out the reaction liquid, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (the equivalent is 5 times of the total monomer amount) to terminate, terminating after half an hour, and fully dialyzing to obtain the material DET-CPD-12.
Figure BDA0003049536520000111
In the formula (14), the molar ratio of the monomer M3 to the monomer M2 is 1: 2, dissolving an initiator PEGSH (MW:2000) in TEOA buffer solution (the sum of the molar amounts of the monomer M2 and the monomer M3 is 80 times of that of the initiator), adding the mixture into reaction liquid dissolved with the monomer, reacting at room temperature for 1.5h, taking out the reaction liquid, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (the equivalent is 5 times of the total monomer amount) for termination, terminating after half an hour, and fully dialyzing to obtain the DET-CPD-13 material.
Figure BDA0003049536520000112
In the formula (15), the molar ratio of the monomer M1 to the monomer M5 is 1: 1, dissolving an initiator PEGSH (MW:1000) in TEOA buffer solution (the sum of the molar amounts of a monomer M1 and a monomer M5 is 80 times of that of the initiator), adding the mixture into a reaction solution in which the monomers are dissolved, reacting at room temperature for 1.5h, taking out the reaction solution, dropwise adding the reaction solution into deionized water in which iodoacetamide (equivalent is 5 times of the total monomer amount) is dissolved, stopping the reaction after half an hour, and fully dialyzing to obtain the DET-CPD-14 material.
Figure BDA0003049536520000121
In the formula (16), the molar ratio of the monomer M4 to the monomer M7 is 1: 1, dissolving an initiator PEGSH (MW:5000) in TEOA buffer solution (the sum of the molar amounts of a monomer M4 and a monomer M7 is 80 times of that of the initiator), adding the mixture into a reaction solution in which the monomers are dissolved, reacting at room temperature for 1.5h, taking out the reaction solution, dropwise adding the reaction solution into deionized water in which iodoacetamide (equivalent is 5 times of the total monomer amount) is dissolved, stopping the reaction after half an hour, and fully dialyzing to obtain the DET-CPD-15 material.
Figure BDA0003049536520000122
In the formula (17), the molar ratio of the monomer M5 to the monomer M6 is 1: 1, dissolving an initiator PEGSH (MW:2000) in TEOA buffer solution (the sum of the molar amounts of a monomer M5 and a monomer M6 is 80 times of that of the initiator), adding the mixture into a reaction solution in which the monomers are dissolved, reacting at room temperature for 1.5h, taking out the reaction solution, dropwise adding the reaction solution into deionized water in which iodoacetamide (equivalent is 5 times of the total monomer amount) is dissolved, stopping the reaction after half an hour, and fully dialyzing to obtain the material DET-CPD-16.
Figure BDA0003049536520000131
In the formula (18), the molar ratio of the monomer M1 to the monomer M2 is 1: 2, dissolving an initiator I5 in TEOA buffer solution (the sum of the molar amounts of a monomer M1 and a monomer M2 is 80 times of that of the initiator, adding the mixture into reaction liquid dissolved with the monomer, reacting at room temperature for 1.5h, taking out the reaction liquid, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (the equivalent amount is 5 times of the total monomer amount) to terminate, terminating after half an hour, and fully dialyzing to obtain the material DET-CPD-17.
Figure BDA0003049536520000132
In the formula (19), the molar ratio of the monomer M1 to the monomer M2 is 1: 2, dissolving an initiator I4 in TEOA buffer solution (the sum of the molar amounts of a monomer M1 and a monomer M2 is 80 times of that of the initiator, adding the mixture into reaction liquid dissolved with the monomer, reacting at room temperature for 1.5h, taking out the reaction liquid, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (the equivalent amount is 5 times of the total monomer amount) to terminate, terminating after half an hour, and fully dialyzing to obtain the material DET-CPD-18.
Figure BDA0003049536520000133
In the formula (20), the molar ratio of the monomer M4 to the monomer M7 is 1: 1, dissolving an initiator I3 in TEOA buffer solution (the sum of the molar weight of a monomer M4 and the molar weight of a monomer M7 is 80 times of that of the initiator, adding the initiator into reaction liquid dissolved with the monomer, reacting at room temperature for 1.5h, taking out the reaction liquid, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (the equivalent weight is 5 times of the total monomer amount) to terminate, terminating after half an hour, and fully dialyzing to obtain the material DET-CPD-19.
Figure BDA0003049536520000141
In the formula (21), the molar ratio of the monomer M1 to the monomer M5 is 1: 1, dissolving an initiator I2 in TEOA buffer solution (the sum of the molar amounts of a monomer M1 and a monomer M5 is 80 times of that of the initiator, adding the mixture into reaction liquid dissolved with the monomer, reacting at room temperature for 1.5h, taking out the reaction liquid, dropwise adding the reaction liquid into deionized water dissolved with iodoacetamide (the equivalent amount is 5 times of the total monomer amount) to terminate, terminating after half an hour, and fully dialyzing to obtain the material DET-CPD-20.
Example 2 comparison of plasmid intracellular delivery efficiency of cationic Polymer materials DETs, CPDs, DET-CPDs series vectors
The CMV-Cas9-GFP-luciferase plasmid (10.6kb) was used as a model plasmid, and the efficiency of intracellular delivery of the plasmid of the cationic polymeric material was evaluated on 293T cells by measuring the brightness of green fluorescent protein expressed in the cells and detecting the fluorescence in the cells, and the optimal material was selected.
The specific method comprises the following steps: cell transfection experiments were started by seeding 293T cells into 48-well plates overnight to achieve a cell density of approximately 60% to 80% in wells the following day. 400ng of CMV-Cas9-GFP-luciferase plasmid was dissolved in 50ul of ddH 2 And O, adding the cationic materials of DETs, CPDs and DET-CPDs series prepared in the invention example 1, wherein the added amounts are 1uL, 2uL, 4uL, 8uL and 16uL respectively, incubating for 30min, adding a proper amount of serum-free culture medium to make the total volume be 250uL, replacing the culture medium in the original wells, incubating for 6h in a cell incubator, replacing the culture medium with 250uL containing 10% FBS, observing the protein expression by a fluorescence microscope or directly collecting cells for protein expression identification after 48h, and using PEI and Lipofectamine 2000 as positive controls.
The experimental results are as follows: FIG. 1 shows the flow quantification of green fluorescent protein expression by cells delivering CMV-Cas9-GFP-luciferase plasmid on 293T cells from the material obtained in example 1 of the present invention. FIG. 2 shows the quantification of luciferase expression by cells delivering CMV-Cas9-GFP-luciferase plasmid on 293T cells from the material obtained in example 1 of the present invention. Indicating that the cationic polymeric material can achieve higher delivery efficiency at a certain reaction time and a certain monomer ratio. The DET-CPD-12 has the highest plasmid delivery efficiency, and is simultaneously remarkably superior to commercial positive transfection reagents PEI25K and Lipofectamine 2000, so that the DET-CPD-12 material is a good carrier for intracellular plasmid delivery.
Example 3: the cationic polymer material DET-CPD-12 forms a complex with CMV-Cas9-GFP-luciferase plasmid, and the size and surface potential of the complex are measured using Dynamic Light Scattering (DLS).
The specific method comprises the following steps: 2ug CMV-Cas9-GFP-luciferase plasmid was dissolved in 200ul ddH 2 O, adding 10ul of cationic material, incubating for 30min, diluting the solution to 1ml, detecting the size distribution and surface potential of nanoparticles in the solution with laser nanometer particle sizer, and measuring the surface potential with a projection electron microscopeThe size of the rice grains.
The experimental results are as follows: FIG. 3 shows the size distribution, surface potential, characterized by the DLS complex formed by DET-CPD-12 prepared according to the invention and the CMV-Cas9-GFP-luciferase plasmid. The results show that the polycationic material DET-CPD-12 is able to form nanoparticles of about 80nm size with Cas9 plasmid, and the surface potential of the particles is positive.
Example 4: DET-CPD-12 was screened for its intracellular delivery efficiency of N/P-forming complexes in 293T cell lines, unlike the CMV-Cas9-GFP-luciferase plasmid.
Specific implementation method referring to example 2, N/P of materials DET-CPD-12 and CMV-Cas9-GFP-luciferase plasmid are 3, 5, 7, 9 and 11 respectively, and PEI25K and Lipofectamine 2000 are used as positive controls.
The experimental results are as follows: FIG. 4 shows that when the N/P of the material and the plasmid is 5, the fluorescence expression of the cells is photographed by a fluorescence microscope, and the transfection efficiency of the positive rate of the cell fluorescent protein expression is counted by a flow cytometer in a quantitative mode, and the transfection efficiency is the highest and is simultaneously obviously superior to PEI25K and Lipofectamine 2000.
Example 5: intracellular delivery efficiency of the complex formed by DET-CPD-12 and CMV-Cas9-GFP-luciferase plasmid in various mammalian cell lines including 293T, Hela, HepG2 and A549 four cell lines.
The specific method comprises the following steps: HeLa cells are taken as an example) and cell culture is carried out (48-well plates are taken as an example, other culture dishes can refer to 48-well plates), cells (the specific cell number is determined according to the type, the size and the growth speed of the cells) are inoculated into the wells for culture one day (18-24 hours) before transfection, and the cell density of the next day can reach about 60% -80%. To begin the cell transfection experiment, 400ng of plasmid was dissolved in 50ul of ddH 2 And O, then adding 2ul DET-CPD-12 cationic material, incubating for 30min, adding 200ul serum-free culture medium, replacing the culture medium in the original well with a total volume of 250ul, incubating in a cell incubator for 6h, replacing the culture medium with 250ul culture medium containing 10% FBS, and observing protein expression by a fluorescence microscope after 48h or directly collecting cells for protein expression identification.
The results show that: FIG. 5 shows the delivery of the complex of the DET-CPD-12 cationic material prepared by the present invention and CMV-Cas9-GFP-luciferase plasmid into various mammalian cell lines, and the positive rate of cellular fluorescent protein expression is quantified and counted by flow cytometry. The material efficiency of the DET-CPD-12 cation was significantly higher compared to the commercially available positive controls PEI25K and Lipofectamine 2000.
Example 6: evaluation of biodegradability of the cationic Polymer Material DET-CPD-12.
The specific method comprises the following steps: 10mM GSH (glutathione) was added to DET-CPD-12 material, stirred overnight at room temperature, and the molecular weight of the material was determined by GPC, compared to GPC results for material without GSH.
The results show that: FIG. 6 shows that the material without GSH added has a molecular weight of about 8640Da as measured by GPC, whereas the material degradation effect is quite significant with the addition of the GSH group, which has a molecular weight of about 655Da as measured by GPC. The DET-CPD-12 has good biodegradability, thereby greatly reducing the toxicity to cells.
Example 7: cytotoxicity evaluation of complexes formed by cationic polymeric materials DET-CPD-12 and CMV-Cas9-GFP-luciferase plasmids
The toxicity of the polymerized cationic material DET-CPD-12 and the complex formed by the polymerized cationic material DET-CPD-12 and the plasmid on cells is generated by utilizing an MTT method under normal cell transfection conditions. The CMV-Cas9-GFP-luciferase plasmid is used as a model plasmid, and the cell survival rate is detected on animal cell lines such as 293T, Hela, HepG2 and A549 respectively.
The specific operation is as follows: taking 293T as an example, an appropriate amount of 293T cells were seeded into a 96-well plate and cultured overnight. The medium was removed, 100ul of DET-CPD-12/plasmid complex serum-free medium at different concentrations was added, and after incubation for 4 hours, the medium was removed, and an equal amount of 10% serum-containing medium was added and the culture was continued for 20 hours. Cell viability was then measured according to standard procedures of the MTT method.
The experimental results are as follows: FIG. 7 shows that the cell survival rates of the MTT detection material and plasmid complexes and the treated 293T (A), Hela (B), HepG2(C) and A549(D) are all higher than 90% under the condition that the DET-CPD-12/plasmid complexes and the cells are cultured together at various concentrations. The result shows that the polymer cation prepared by the invention has little toxicity to cells, and does not generate obvious toxicity to cells in the plasmid delivery process, and the material DET-CPD-12 prepared by the invention has better biocompatibility.
Example 8: DET-CPD-12 cationic polymer forms a complex with EGFP-plasmid (4.3kb) for intracellular delivery.
The specific method comprises the following steps: cells (293T cells for example) were seeded overnight in 48-well plates (48-well plates for example, other plates can be referenced to 48-well plates) and the next day when cell density in the wells reached about 60% -80%, cell transfection experiments were started and 400ng of plasmid was dissolved in 50ul ddH 2 And O, then adding 2ul DET-CPD-12 cationic material, incubating for 30min, adding 200ul serum-free culture medium, replacing the culture medium in the original well with a total volume of 250ul, incubating in a cell incubator for 6h, replacing the culture medium with 250ul culture medium containing 10% FBS, and observing protein expression by a fluorescence microscope after 48h or directly collecting cells for protein expression identification.
The results show that: FIG. 8 shows that the complex formed by the DET-CPD-12 cationic material prepared by the invention and the EGFP-plasmid (4.3kb) is delivered to 293T cells, the fluorescence expression of the cells is photographed by a fluorescence microscope, and the positive rate of the cell fluorescence protein expression is quantitatively calculated by a flow cytometer. The efficiency was comparable to commercial positive controls PEI25K and Lipofectamine 2000.
Example 9 intracellular delivery of DET-CPD-12 CRISPR-Ca9 plasmid for CCNE-1 locus knock-out.
The specific operation method comprises the following steps: cell transfection experiments were started by seeding 293T cells into 24-well plates overnight to achieve a cell density of approximately 60% to 80% in wells the following day. Dissolving 800ng CRISPR-Cas9 plasmid with CCNE-1 gene knocked out in 100ul ddH 2 O (sgCCNE1: TTTCAGTCCGCTCCAGAAAA), then 4ul of DET-CPD-12 cationic material prepared in the invention example 1 is added, the incubation is carried out for 30min, a proper amount of serum-free medium is added to make the total volume be 500ul, the medium in the original well is replaced, after the incubation is carried out in a cell incubator for 6h, the medium is replaced by 500ul of medium containing 10% FBS, and the culture is continued for 48 h. Extraction of genomic Total DNA Using a commercial CartridgePCR amplifies the target fragment (CCNE1-FP: TCCAAGCCCAAGTCCTGAGCCA, CCNE 1-RP: TGGCCTGCAGCTCTGTTTTGGG) with mutation sites, heating for denaturation and annealing for renaturation, finally adding 0.3 microliter of T7E1 endonuclease, reacting for 30 minutes at 37 ℃, running 2% agarose gel electrophoresis for detecting and analyzing the restriction enzyme digestion results.
The experimental results are as follows: FIG. 9 shows that after the CRISPR-Cas9 plasmid is delivered on 293T cells to edit the CCNE1 gene locus by the material DET-CPD-12 prepared by the invention, the mutation rate of the mutant is detected by using a T7E1 endonuclease method, and commercial PEI25K and Lipofectamine 2000 are used as positive controls, so that the efficiency of the DET-CPD-12 is obviously superior to that of PEI25K and Lipofectamine 2000.
Example 10 delivery of CRISPR-Cas9 plasmid into 293T-EGFP cells by cationic polymeric Material DET-CPD-12 for the knockout of the EGFP genetic locus.
The specific operation method comprises the following steps: methods of implementation referring to example 9, cell transfection experiments were started by seeding 293T cells into 24-well plates overnight to a cell density of about 60% to 80% in wells the following day. 800ng of CRISPR-Cas9 plasmid knocked out of EGFP gene was dissolved in 100ul of ddH2O (sgEGFP: GTGAACCGCATCGAGCTGAA, EGFP-FP: ATGGTGAGCAAGGGCGAG, EGFP-FP: TTACTTGTACAGCTCGTCCATGC). Then 4ul of DET-CPD-12 cationic material prepared in the invention example 1 is added, the incubation is carried out for 30min, a proper amount of serum-free culture medium is added to ensure that the total volume is 500ul, the culture medium in the original hole is replaced, after the incubation is carried out in a cell culture box for 6h, the culture medium is replaced by 500ul of culture medium containing 10% FBS, and the culture is continued for 48 h.
The experimental results are as follows: FIG. 10 shows that after the material DET-CPD-12 prepared by the invention delivers CRISPR-Cas9 plasmid on 293T-EGFP cells to knock out EGFP gene sites, the expression of GFP in the cells is observed by using a fluorescence microscope, and the cells expressing GFP are quantified by using a flow cytometer. By using commercial PEI25K and Lipofectamine 2000 as positive controls, it can be seen that the knockout effect of the DET-CPD-12 delivered CRISPR-Cas9 plasmid on GFP gene locus is obviously better than PEI25K and Lipofectamine 2000.
Example 11: DET-CPD-12 cationic polymer forms complexes with EGFP-mRNA for intracellular delivery in 293T cell lines.
The specific implementation method refers to example 2.
The results show that: FIG. 11 shows that the complex formed by the DET-CPD-12 cationic material prepared by the invention and EGFP-mRNA is delivered to 293T cells, the fluorescence expression of the cells is photographed by a fluorescence microscope, and the positive rate of the cell fluorescent protein expression is quantitatively counted by a flow cytometer. DET-CPD-12 cationic material was significantly more efficient than the positive controls PEI25K and Lipofectamine 3000.
Example 12: DET-CPD-12 cationic polymer forms a complex with Cas9-GFP-mRNA for intracellular delivery in 293T cell lines.
The specific implementation method refers to example 2.
The results show that: FIG. 12 shows that the complex formed by the DET-CPD-12 cationic material prepared by the present invention and Cas9-GFP-mRNA is delivered to 293T cells, the fluorescence expression of the cells is photographed by a fluorescence microscope, and the positive rate of the cell fluorescent protein expression is quantitatively counted by a flow cytometer. Compared with positive controls PEI25K and Lipofectamine 3000, the efficiency of the DET-CPD-12 cationic material is significantly higher.
Example 13: the cationic polymer material DET-CPD-12 forms a complex with Cas9-GFP-mRNA, and the size and surface potential of the complex are measured using DLS, and the size of the nanoparticles is measured using TEM.
The specific method comprises the following steps: 2ug Cas9-GFP-mRNA was dissolved in 200ul ddH 2 O, then adding 10ul of cationic material, incubating for 30min, diluting the solution to 1ml, and detecting the size distribution and surface potential of the nanoparticles in the solution using a laser nanometer particle sizer.
The experimental results are as follows: FIG. 13 shows the size distribution, surface potential, of a DLS-characterized complex formed by DET-CPD-12 prepared in accordance with the present invention with Cas 9-GFP-mRNA. The results show that the polycationic material DET-CPD-12 can form nanoparticles with Cas9-mRNA of about 120nm in size, and the surface potential of the particles is positive.
Example 14 DET-CPD-12 intracellular delivery of Cas9-mRNA for CCNE-1 gene site knock-out.
Reference is made to example 9 for a specific method of implementation.
The experimental results are as follows: FIG. 14 shows that after the material DET-CPD-12 prepared by the invention delivers Ca9-mRNA on 293T cells to edit a CCNE1 gene locus, the mutation rate of the mutant is detected by using a T7E1 endonuclease method, and commercial PEI25K and Lipofectamine 3000 are used as positive controls, so that the knockout efficiency of the DET-CPD-12 is obviously better than that of PEI25K and Lipofectamine 3000.
Example 15: the DET-CPD-12 cationic polymer delivers Cas9-mRNA into 293T-EGFP cells for knock-out of the EGFP gene locus.
Reference is made to example 9 for a specific method of implementation.
The experimental results are as follows: FIG. 15 shows that the material DET-CPD-12 prepared by the present invention delivers Cas9-mRNA on 293T-EGFP cells to knock out EGFP gene sites, then the expression of GFP in the cells is observed by using a fluorescence microscope, and the cells expressing GFP are quantified by using a flow cytometer. Using commercial PEI25K and Lipofectamine 3000 as positive controls, it can be seen that the knockout effect of the DET-CPD-12 delivery Cas9-mRNA plasmid on the EGFP gene locus is significantly better than that of PEI25K and Lipofectamine 3000.
Example 16 DET-CPD-12 intracellular delivery of rhodamine-labeled Cas9 protein.
The specific method comprises the following steps: cell transfection experiments were started by seeding 293T cells into 48-well plates overnight to achieve a cell density of approximately 60% to 80% in wells the following day. 0.5ug Rhodamine (Rhodamine) -labeled Cas9 was dissolved in 50ul ddH 2 And O, adding DET-CPD-124 ul prepared in the invention example 1, incubating for 30min, adding a proper amount of serum-free culture medium to make the total volume be 250ul, replacing the culture medium in the original hole, incubating for 6h in a cell incubator, observing protein uptake of the cells through a fluorescence microscope or directly collecting the cells, and detecting the fluorescence intensity in the cells by using a flow cytometer. Commercial formulations Lipofectamine CRISPRMAX (CMAX) and PEI25K were used as positive controls.
The experimental results are as follows: FIG. 16 is a fluorescent photograph and flow chart results of the DET-CPD-12 delivery Cas9 protein prepared in the present invention. The result shows that DET-CPD-12 has better protein transfer effect.
Example 17: complexes of DET-CPD-12 and the gene editing ribonucleic acid complex (CRISPR-Cas9) were prepared, and the size and surface potential of the complexes were characterized by DLS and the size of nanoparticles by TEM.
The specific operation method comprises the following steps: uniformly mixing a proper amount of CRISPR-Cas9 protein and sgRNA in a proper amount of PBS solution, incubating for 10min at 37 ℃ to form RNP, then adding a proper amount of DET-CPD-12 solution, uniformly mixing to form nanoparticles, incubating for 30min at room temperature, adding 1mL of deionized water for dilution, and detecting the size distribution and surface potential of the nanoparticles in the solution by using a laser nanometer particle size analyzer.
The experimental results are as follows: fig. 17 shows the size distribution and surface potential of DLS characterization of the complex formed by DET-CPD-12 and CRISPR-Cas9 protein prepared by the present invention. The results show that the polycationic material DET-CPD-12 can form nanoparticles with the CRISPR-Cas9 protein and the surface potential of the particles is positive, wherein the size of the nanoparticles is about 150 nm.
Example 18 delivery of DET-CPD-12 to intracellular Gene editing ribonucleoprotein complexes (CRISPR-Cas9) editing the CCNE1 gene.
The specific operation method comprises the following steps: cell transfection experiments were started by seeding 293T cells into 24-well plates overnight to achieve a cell density of approximately 60% to 80% in wells the following day. Mu.g of Cas9 protein was dissolved in 100ul of PBS, the synthesized gRNA (sgCCNE1: TTTCAGTCCGCTCCAGAAAA) was added, 300ng was incubated at 37 ℃ for 10min to form RNP, 4ul of DET-CPD-12 cationic material prepared in inventive example 1 was added, incubation was carried out for 30min, a serum-free medium was added in an amount appropriate to make the total volume 500ul, instead of the medium in the original well, and after incubation in a cell incubator for 4h, 500ul of medium containing 10% FBS was used instead, and the incubation was continued for 48 h. Extracting total DNA of cell genome by using a commercial chemical kit, amplifying a target fragment (CCNE1-FP: TCCAAGCCCAAGTCCTGAGCCA, CCNE 1-RP: TGGCCTGCAGCTCTGTTTTGGG) with a mutation site by PCR, heating, denaturing, annealing and renaturing, finally adding 0.3 mu l of T7E1 endonuclease, reacting at 37 ℃ for 30 minutes, and detecting and analyzing the enzyme digestion result by 2% agarose gel electrophoresis.
The experimental results are as follows: FIG. 18 shows that the material DET-CPD-12 prepared by the invention has better CCNE1 gene knockout effect by using a T7E1 endonuclease method to detect the mutation rate of the mutant after delivering a gene editing ribonucleoprotein complex (CRISPR-Cas9) to edit a CCNE1 gene locus on a 293T cell, and by using commercial PEI25K and CMAX as positive controls.
Example 19 DET-CPD-12 delivery of a Gene-editing ribonucleoprotein complex (CRISPR-Cas9) knockout EGFP gene into 293T-EGFP cells.
Reference is made to example 18 for a specific method of implementation.
The experimental results are as follows: FIG. 19 shows that the material DET-CPD-12 prepared by the invention delivers a gene-editing ribonucleoprotein complex (CRISPR-Cas9) on 293T-EGFP cells to knock out EGFP gene sites, then the expression of GFP in the cells is observed by using a fluorescence microscope, and the cells expressing GFP are quantified by using a flow cytometer. The result of using commercial PEI25K and CMAX as positive control shows that DET-CPD-12 has better EGFP gene knockout effect.
Example 20 delivery of phycoerythrin (R-PE) into HeLa cells by DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16, DET-CPD-17, DET-CPD-18, DET-CPD-19, DET-CPD-20.
The specific operation is as follows: HeLa cells were seeded overnight in 24-well plates to a cell density of about 60% -80% in the next day wells, the protein transfection experiment was started, the wells were now depleted of medium, the cells were washed three times with PBS, and 1. mu.g phycoerythrin was dissolved in 100ul dd H 2 And O, respectively adding 4ul DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15 and DET-CPD-16, uniformly mixing, incubating for 30min, adding a proper amount of serum-free culture medium to make the total volume be 500ul, replacing PBS (phosphate buffer solution) in a primary hole, incubating for 4h in a cell incubator, removing the culture medium, washing the cells for three times by PBS (phosphate buffer solution), preserving the cells in PBS, and observing the protein uptake of the cells by a fluorescence microscope or directly collecting the cells for quantitative characterization of protein uptake.
The results show that: FIG. 20 shows the uptake of the nanocomposites of the cationic DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, and DET-CPD-16 materials prepared by the present invention with phycoerythrin in HeLa cells, and the protein uptake of the cells was photographed by a fluorescence microscope, and the mean fluorescence intensity after the protein uptake by the cells was quantitatively calculated by a flow cytometer. The results showed that DET-CPD-12 has a very good ability to deliver phycoerythrin to HeLa cells.
Example 21 DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16, DET-CPD-17, DET-CPD-18, DET-CPD-19, DET-CPD-20 delivers bovine serum albumin (BSA-FITC) into HeLa cells.
Reference is made to example 21 for a specific method of implementation.
The results show that: FIG. 21 shows the uptake of the nano-complexes formed by the cationic materials DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15 and DET-CPD-16 prepared by the present invention and BSA-FITC into HeLa cells, and the protein uptake of the cells was photographed by a fluorescence microscope, and the average fluorescence intensity after the cells took up the protein was quantitatively calculated by a flow cytometer. The results showed that DET-CPD-12 has a very good ability to deliver bovine serum albumin to HeLa cells
Example 22 intracellular delivery of ribonuclease A (RNase A) to MDA-MB-231 by DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16.
The specific operation is as follows: the protein transfection experiment was started by inoculating MDA-MB-231 cells into 48-well plates overnight to a cell density of about 60% -80% in the wells the next day, now removing the medium from the wells, washing the cells three times with PBS, and then dissolving 500ng of RNase A in 50ul dd H 2 And O, respectively adding 2ul DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15 and DET-CPD-16, uniformly mixing, incubating for 30min, adding a proper amount of serum-free culture medium to make the total volume be 250ul, replacing PBS solution in the original hole, incubating for 6h in a cell incubator, replacing the culture medium in each hole with 250ul fresh DMEM containing 10% fetal calf serum, and continuously incubating for 42 h. HeLa cells were evaluated for toxicity using the CCK-8 kit.
The results show that: FIG. 22 shows the uptake of the cationic materials DET-CPD-12, DET-CPD-13, DET-CPD-14, DET-CPD-15, DET-CPD-16 prepared by the present invention into the MDA-MB-231 cells, and the survival efficiency of the cells was determined by the CCK-8 formula kit. The result shows that the MDA-MB-231 cells take up the DET-CPD-12/RNase A nano-complex, the cell activity is lower than 20%, and the cell toxicity is obvious, thereby indicating that the DET-CPD-12 has good capability of delivering ribonuclease A into cells.
Example 23 DET-CPD-12, DET-CPD-13, DET-CPD-14 delivered beta-galactosidase (. beta. -Gal) intracellularly to HeLa cells.
The specific operation is as follows: HeLa cells were seeded overnight in 24-well plates to a cell density of about 60% -80% in the next day wells, protein transfection experiments were started, the wells were now depleted of medium, the cells were washed twice with PBS, and 1. mu.g of beta-galactosidase was then dissolved in 100ul dd H 2 And O, respectively adding 4ul DET-CPD-12, DET-CPD-13 and DET-CPD-14, uniformly mixing, incubating for 30min, adding a proper amount of serum-free culture medium to make the total volume be 500ul, replacing PBS (phosphate buffer solution) solution in a primary hole, incubating for 4h in a cell incubator, removing the culture medium, washing the cells twice by PBS, fixing the cells for 10min, culturing the cells for 2h in the incubator at 37 ℃ by using an in-situ X-Gal staining kit, and observing an experimental result by using an optical microscope.
The results show that: fig. 23 is an uptake of nanocomplexes of DET-CPD-12, DET-CPD-13, DET-CPD-14 cationic materials prepared by the present invention and β -galactosidase in HeLa cells, indicating that DET-CPD-12 can deliver β -galactosidase to HeLa cells with higher efficiency.
Sequence listing
<110> Zhejiang university
<120> degradable high polymer material, self-assembled nano compound and application
<160> 6
<170> SIPOSequenceListing 1.0
<210> 2
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Unknow)
<400> 2
tttcagtccg ctccagaaaa 20
<210> 2
<211> 22
<212> DNA
<213> Artificial sequence (Unknow)
<400> 2
tccaagccca agtcctgagc ca 22
<210> 3
<211> 22
<212> DNA
<213> Artificial sequence (Unknow)
<400> 3
tggcctgcag ctctgttttg gg 22
<210> 4
<211> 20
<212> DNA/RNA
<213> Artificial sequence (Unknow)
<400> 4
gtgaaccgca tcgagctgaa 20
<210> 5
<211> 18
<212> DNA
<213> Artificial sequence (Unknow)
<400> 5
atggtgagca agggcgag 18
<210> 6
<211> 23
<212> DNA
<213> Artificial sequence (Unknow)
<400> 6
ttacttgtac agctcgtcca tgc 23

Claims (3)

1. A degradable high polymer material is characterized in that the high polymer material is a poly-disulfide cation material, and the structure of the poly-disulfide cation material is shown in a formula (1):
Figure 201783DEST_PATH_IMAGE002
wherein:
x = O or NH, n 1, n 2 Is between 1 and 20An integer number;
R 1 is the reaction residue of a sulfydryl-containing initiator, methoxy polyethylene glycol sulfydryl, four-arm polyethylene glycol sulfydryl or eight-arm polyethylene glycol sulfydryl, and the sulfydryl-containing initiator is selected from the following components:
Figure 803797DEST_PATH_IMAGE004
relative molecular mass of the methoxyl polyethylene glycol sulfydryl is 200, 400, 600, 800, 1000, 2000, 5000 and 10000, relative molecular mass of the methoxyl polyethylene glycol sulfydryl is 2000, 5000 and 10000;
R 2 comprises the following steps:
Figure 840498DEST_PATH_IMAGE006
，
in formula (2): d = O or NH, Y = NH, CH 2 Or O, n 3 An integer of 1 to 20;
when Y = NH, R 4 Is H,
Figure 957490DEST_PATH_IMAGE008
When Y = CH 2 When R is 4 Is COOH, COOH,
Figure 107980DEST_PATH_IMAGE010
，
When Y = O, R 4 Is composed of
Figure 892396DEST_PATH_IMAGE012
；
R 3 Comprises the following steps:
Figure 99999DEST_PATH_IMAGE014
formula (3) or
Figure 438708DEST_PATH_IMAGE016
The compound of the formula (4),
in formula (3): a = O or NH，n 4 An integer of 1 to 20 in number,
R 5 comprises the following steps:
Figure 392888DEST_PATH_IMAGE018
、
Figure 235074DEST_PATH_IMAGE020
、
Figure 879157DEST_PATH_IMAGE022
、
Figure 970741DEST_PATH_IMAGE024
，
in formula (4): r is 6 Comprises the following steps: hydrogen, amino or
Figure 56509DEST_PATH_IMAGE026
，n 5 And an integer of 0 to 5.
2. A macromolecular compound containing a guanidino-containing disulfide backbone, which is a nanoparticle formed by self-assembly of the degradable macromolecular material of claim 1 and a nucleotide or a protein, wherein the nucleotide is a plasmid or an mRNA; the protein is bovine serum albumin, beta-galactosidase, phycoerythrin, ribonuclease A or Cas9 protein; when the degradable high polymer material and the nucleotide form a compound, the dosage of the nucleotide and the poly-disulfide cation material is as follows: fully mixing every 400ng of nucleotide with 2 mu L of poly-dithio-cation material, and incubating for 30min to obtain the product;
when the degradable high molecular material and the protein form a compound, the dosage of the protein and the poly-disulfide cation material is as follows: mixing 500ng of protein with 2 μ L of polydithio-cationic material, and incubating for 30 min.
3. Use of a macromolecular compound comprising a guanidino-containing disulfide backbone of claim 2 in the preparation of a vector for intracellular delivery of plasmids, mrnas, proteins.
CN202110481787.8A 2021-04-30 2021-04-30 Degradable high polymer material, self-assembled nano composite and application Active CN113265050B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202110481787.8A CN113265050B (en) 2021-04-30 2021-04-30 Degradable high polymer material, self-assembled nano composite and application
PCT/CN2022/081850 WO2022227927A1 (en) 2021-04-30 2022-03-19 Degradable polymer material, and self-assembled nano-composite and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110481787.8A CN113265050B (en) 2021-04-30 2021-04-30 Degradable high polymer material, self-assembled nano composite and application

Publications (2)

Publication Number Publication Date
CN113265050A CN113265050A (en) 2021-08-17
CN113265050B true CN113265050B (en) 2022-08-23

Family

ID=77229793

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110481787.8A Active CN113265050B (en) 2021-04-30 2021-04-30 Degradable high polymer material, self-assembled nano composite and application

Country Status (2)

Country Link
CN (1) CN113265050B (en)
WO (1) WO2022227927A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113265050B (en) * 2021-04-30 2022-08-23 浙江大学 Degradable high polymer material, self-assembled nano composite and application

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6277957B1 (en) * 2000-03-23 2001-08-21 Derek Hudson Method for production of acylthio derivatives
CN109438707A (en) * 2018-08-29 2019-03-08 中山大学 A kind of poly- dithiothreitol (DTT) nanometer system and its preparation method and application for anti-tumor drug delivering
CN111393696A (en) * 2020-04-08 2020-07-10 福州大学 Guanidine-based functionalized anion exchange membrane with cross-linked network structure and preparation method thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU7870694A (en) * 1994-09-06 1996-03-27 Ekagen Corporation Polymeric resin for disulfide bond synthesis
US9211358B2 (en) * 2007-04-24 2015-12-15 Rutgers, The State University Of New Jersey Dressing compositions and methods
CN106750376B (en) * 2016-12-26 2018-09-28 江南大学 A kind of preparation method of the turnover reduction sensitivity reversible crosslink nano-micelle of charge
CN113121826B (en) * 2020-01-10 2024-07-05 北京大学 Frozen synthesis and application of polydisulfide conjugate
CN113265050B (en) * 2021-04-30 2022-08-23 浙江大学 Degradable high polymer material, self-assembled nano composite and application

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6277957B1 (en) * 2000-03-23 2001-08-21 Derek Hudson Method for production of acylthio derivatives
CN109438707A (en) * 2018-08-29 2019-03-08 中山大学 A kind of poly- dithiothreitol (DTT) nanometer system and its preparation method and application for anti-tumor drug delivering
CN111393696A (en) * 2020-04-08 2020-07-10 福州大学 Guanidine-based functionalized anion exchange membrane with cross-linked network structure and preparation method thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Cell-penetrating poly(disulfide)s: focus on substrate-initiated co-polymerization;Eun-Kyoung Bang，et al.;《POLYMER CHEMISTRY》;20140123;第5卷(第7期);第2433-2441页 *
Eun-Kyoung Bang，et al..Substrate-Initiated Synthesis of Cell-Penetrating Poly(disulfide)s.《JOURNAL OF THE AMERICAN CHEMICAL SOCIETY》.2013,第35卷(第6期),第2088-2091页. *
Substrate-Initiated Synthesis of Cell-Penetrating Poly(disulfide)s;Eun-Kyoung Bang，et al.;《JOURNAL OF THE AMERICAN CHEMICAL SOCIETY》;20130130;第35卷(第6期);第2088-2091页 *
聚二硫聚合物的合成及其生物应用探讨;杨文化;《中国优秀硕士学位论文全文数据库 (工程科技Ⅰ辑)》;20190115(第12期);B016-129 *

Also Published As

Publication number Publication date
CN113265050A (en) 2021-08-17
WO2022227927A1 (en) 2022-11-03

Similar Documents

Publication Publication Date Title
CN103255174B (en) With liquid and application that the hyaluronic acid of polyoxyethylene glycol grafting is outer field ternary complex and ternary complex
He et al. Cationic polymer-derived carbon dots for enhanced gene delivery and cell imaging
CN109758588B (en) Preparation method and application of nucleic acid spherical nanoparticle medicine
CN106893054B (en) Cationic polymer gene vector and preparation method and application thereof
CN106890343B (en) Targeting polypeptide nano gene vector compound
Xun et al. Low molecular weight PEI-based polycationic gene vectors via Michael addition polymerization with improved serum-tolerance
CN108531513B (en) Star-shaped multi-target functional gene vector based on POSS and application thereof
CN114904003B (en) Use of ionizable cationic lipid analog materials as nucleic acid drug delivery vehicles or transfection reagents
RU2617059C2 (en) Method for production of amphiphilic block copolymers n, n-dimethylaminoethyl methacrylate for nucleic acid delivery to living cells
CN113265050B (en) Degradable high polymer material, self-assembled nano composite and application
JP2024505744A (en) Ionizable cationic lipid analog materials and their application as drug delivery carriers
CN112142972A (en) Modified polyethyleneimine derivative and synthesis method and application thereof
US20240189338A1 (en) Polymer nanoparticle and dna nanostructure compositions and methods for non-viral delivery
CN107937443B (en) Self-assembly nano preparation suitable for nucleic acid transfection and preparation and application thereof
CN116284759A (en) Polypeptide gene vector and preparation method and application thereof
CN113101376A (en) Composite gene vector for gene therapy and preparation method and application thereof
CN115715186A (en) Nanoparticle containing compound of nucleic acid and cationic copolymer, preparation method thereof and application of nanoparticle in gene transfer to cells
CN113683780B (en) Antiserum and low-cytotoxicity polyamino acid gene delivery carrier material with membrane penetrating activity and nucleus positioning function
CN111454991A (en) Application and application method of cationic magnetic nano material as nucleic acid delivery carrier
Mishra et al. Combinatorial library of biodegradable polyesters enables delivery of plasmid DNA to polarized human RPE monolayers for retinal gene therapy
CN112717140B (en) Preparation and application of HP1 gamma-containing guanidinated polyaminoamine polymer gene vector compound
US9290779B1 (en) Transfection compositions using amphipathic compounds
CN112843246B (en) Preparation method and application of CBX 3-containing L-argininated polyamine polymer gene vector
CN113082001B (en) Nucleic acid delivery system and preparation method and application thereof
CN118121721A (en) Application of poly (beta-amino ester) in preparation of reagent for improving transfection efficiency of gene medicine to cells

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant