WO2022213411A1 - Ad cell model established on the basis of crispr/cas9 gene editing technology, construction method therefor and application thereof - Google Patents

Abstract

Provided are an Alzheimer's disease (AD) cell model established on the basis of the CRISPR/Cas9 gene editing technology, a construction method therefor and an application thereof. In the AD cell model, an RNP complex consisting of crRNA, TracrRNA, and Cas9 protein that target an ADAM10 gene is electroporated to an SH-SY5Y cell, and a target gene ADAM10 is successfully knocked out from an SH-SY5Y cell strain. Compared with a normal cell, in the cell model, expressions of Aβ₄₂, Aβ₄₂/Aβ₄₀, and pTau/Tau are significantly increased; the NLRP3 inflammasome protein is significantly up-regulated; and the expression of a pro-inflammatory factor TNF-α is significantly increased. Moreover, a neural differentiation function of the cell is weakened; the length of neurons is shrunk; the growth speed of the cell is significantly slowed down; and connections of the neurons are significantly reduced, such that the neuronal necrosis symptom in the brain of an AD patient can be simulated.

Description

AD cell model based on CRISPR/Cas9 gene editing technology and its construction method and application technical field

The invention belongs to the field of biomedicine, and relates to an AD cell model established based on CRISPR/Cas 9 gene editing technology and a construction method and application thereof, in particular to using CRISPR/Cas 9 gene editing technology to knock out ADAM10 gene in SH-SY5Y cells to establish a target for A more comprehensive AD cellular model of neuronal necrosis.

Background technique

At present, there are more than 50 million people with AD in the world, which has a huge impact on people's quality of life and health. Due to the high cost of care and management of AD patients, it is rated as one of the most devastating diseases ^[1-3] . Despite decades of research and drug development efforts by scientists, there is still no drug that can slow the progression of AD ^[4] .

AD is a genetically heterogeneous disease with complex pathobiological properties. Accumulation of Aβ and intracellular hyperphosphorylated Tau protein is still the main neuropathological criteria for the diagnosis of AD ^[4-7] . Moreover, many anti-AD candidate compounds aimed at reducing Aβ in the clinic fail to substantially change the clinical symptoms of AD patients. The researchers found the formation of senile plaques in the brains of the elderly and elderly AD patients who died of normal aging in autopsy. These evidences suggest that plaque removal is not sufficient to improve impaired brain function and enhance cognitive memory function, nor is it sufficient to slow AD progression or cure AD. That is, the amyloid plaques have been removed from the patient's brain, and the symptoms of AD still exist ^[6] . The symptoms of AD patients are not only plaques in the brain, but also neural tangles and massive neuronal necrosis ^[1,7,8] .

Most AD transgenic animal models mainly simulate the accumulation of Aβ and intracellular hyperphosphorylated Tau protein, and their main limitation is that they cannot accurately simulate neuronal necrosis in the brain of AD patients. For nearly a hundred years, preclinical AD animal models have never convincingly demonstrated a critical point in AD progression that never focuses directly on the neurons themselves ^[1,9-21] . The most used AD cell model is iPSC, but the cultivation of pluripotent stem cells takes a long time, which increases the probability of contamination during the cultivation process, which greatly slows down the process of large-scale screening of anti-AD candidate compounds ^[22-25] .

The annihilating failure of AD drugs in clinical trials at this stage suggests that it may be related to the immaturity and incompleteness of preclinical AD models and their inability to well simulate the brain symptoms of AD patients. Therefore, it is crucial to develop comprehensive and more accurate new AD models. Therefore, the successful establishment of preclinical AD models is expected to become the premise for the development of new AD drugs and the study of AD pathology.

CRISPR/CAS 9 gene editing technology can complete genome modification in almost any type of cells and organisms ^[26-28] , which has revolutionized many disciplines such as biomedicine. And it has high practicability, simple operation and high editing efficiency. CRISPR/CAS 9 gene editing technology has now become a versatile platform that can not only edit individual genes, but also perform multiple gene editing operations. The development of this new biological method is more beneficial for scientists to study gene function and build preclinical disease models. In the establishment of disease models, this technology is most used in the field of cancer ^[29] , and its application in AD research is not yet widely used.

ADAM10 gene (Genbank accession number: NC_000015.10) exists in brain tissue, which can encode α-secretase and participate in the production of APP protein. Studies have shown that overexpression of ADAM10 can inhibit the production and aggregation of Aβ protein. But at this stage, there is no report on the relationship between ADAM10 gene and neurons.

[1] SCHELTENS P, BLENNOW K, BRETELER M M, et al.Alzheimer's disease[J].Lancet,2016,388(10043):505-17.

[2]2018Alzheimer's disease facts and figures[J].Alzheimers&Dementia,2018.

[3] RAJENDRAN L, PAOLICELLI R C. Microglia-Mediated Synapse Loss in Alzheimer's Disease[J]. Journal of Neuroscience the Official Journal of the Society for Neuroscience, 2018,38(12):2911.

[4] KARRAN E, MERCKEN M, STROOPER B D. The amyloid cascade hypothesis for Alzheimer's disease: an appraisal for the development of therapeutics[J].Nature Reviews Drug Discovery,2011,10(9):698.

[5]LONG J M,HOLTZMAN D M.Alzheimer Disease:An Update on Pathobiology and Treatment Strategies[J].Cell,2019,179(2):312-339.

[6]HERRUP K.The case for rejecting the amyloid cascade hypothesis[J].Nature Neuroscience,2015,18(6):794.

[7] ARNSTEN A F T, DATTA D, TREDICI K D, et al.Hypothesis:Tau pathology is an initiating factor in sporadic Alzheimer's disease[J].Alzheimer's&Dementia,2021.17(1):115-124

[8]PENNEY J,RALVENIUS W T, TSAI L H.Modeling Alzheimer's disease with iPSC-derived brain cells[J].NPG Open Access,2020,25(1):148-167

[9] HSIAO K, CHAPMAN P, NILSEN S, et al.Correlative Memory Deficits,AβElevation,and Amyloid Plaques in Transgenic Mice[J].Science,1996,274(5284):99-102.

[10] STURCHLER-PIERRAT C, ABRAMOWSKI D, DUKE M, et al. Sturchler-Pierrat, C, Abramowski, D, Duke, M, Wiederhold, KH, Mistl, C, Rothacher, S et al..Two amyloid precursor protein transgenic mouse models with Alzheimer disease-like pathology. Proc Natl Acad Sci USA 94:13287-13292[J].Proceedings of the National Academy of Sciences,1997,94(24):13287-92.

[11]ODDO S, CACCAMO A, SHEPHERD J D, et al.Triple-Transgenic Model of Alzheimer's Disease with Plaques and Tangles[J].Neuron,2003,39(3):409-21.

[12] GTZ J, ITTNER L M. Gotz J, Ittner LM. Animal models of Alzheimer's disease and frontotemporal dementia. Nat Rev Neurosci 9:532-544[J].Nature ReviewsNeuroscience,2008,9(7):532-44 .

[13] FJELL A M, WALHOVD K B. Neuroimaging Results Impose New Views on Alzheimer's Disease—the Role of Amyloid Revised [J]. Molecular Neurobiology, 2012, 45(1): 153-72.

[14] VINGTDEUX V, DAVIES P, DICKSON D W, et al. AMPK is abnormally activated in tangle-and pre-tangle-bearing neurons in Alzheimer's disease and other tauopathies [J]. Acta Neuropathologica, 2011, 121(3): 337.

[15]ROSSI G,CONCONID,PANZERI E,et al.Mutations in MAPT give rise to aneuploidy in animal models of tauopathy[J].Neurogenetics,2013,31–40.

[16] WEGENAST-BRAUN B M, MAISCH A F, EICKE D, et al. Independent effects of intra-and extracellular Abeta on learning-related gene expression[J]. American Journal of Pathology, 2009, 175(1):271 -82.

[17] GRUENINGER F, BOHRMANN B, CZECH C, et al. Phosphorylation of Tau at S422 is enhanced by Abeta in TauPS2APP triple transgenic mice[J].Neurobiology of Disease,2010,37(2):294-306.

[18]

E M,

M, PUIG B, et al. Accelerated amyloid deposition, neurofibrillary degeneration and neuronal loss in double mutant APP/tau transgenic mice[J]. Neurobiology of Disease, 2005, 20(3): 814-22.

[19]ODDO S, CACCAMO A, KITAZAWA M, et al. Oddo, S., Caccamo, A., Kitazawa, M., Tseng, B.P. & LaFerla, F.M. Amyloid deposition precedes tangle formation in a triple transgenic model of Alzheimer's disease. Neurobiol.Aging 24,1063-1070[J].Neurobiology of Aging,2003,24(8):1063-70.

[20]DAVIS J, XU F, DEANE R, et al. Early-onset and Robust Cerebral Microvascular Accumulation of Amyloidβ-Protein in Transgenic Mice Expressing Low Levels of a Vasculotropic Dutch/Iowa Mutant Form of Amyloidβ-Protein Precursor*[J] .Journal of Biological Chemistry, 2004, 279(19):20296-306.

[21] LI H, GUO Q, INOUE T, et al. Vascular and parenchymal amyloid pathology in an Alzheimer disease knock-in mouse model:interplay with cerebral blood flow[J].Molecular Neurodegeneration,2014,9(1):28 .

[22] ISRAEL M A, YUAN S H, BARDY C, et al.Probing sporadic and familial Alzheimer's disease using induced pluripotent stem cells[J].Nature,2012,482(7384):216-20.

[23]Modeling Alzheimer’s Disease with iPSCs Reveals Stress Phenotypes Associated with Intracellular Aβand Differential Drug Responsiveness[J].Cell Stem Cell,2013,12(4):487-96.

[24] MURATORE C R, RICE H C, PRIYA S, et al. The familial Alzheimer's disease APPV717I mutation alters APP processing and Tau expression in iPSC-derived neurons[J].Human Molecular Genetics,2014,13):3523-36 .

[25] YAGI T, ITO D, OKADA Y, et al. Modeling familial Alzheimer's disease with induced pluripotent stem cells[J]. Rinshōshinkeigaku Clinical neurology, 2011, 52(23): 1134-6.

[26] SHEN B, ZHANG J, WU H, et al.Generation of gene-modified mice via Cas9/RNA-mediated gene targeting[J].Cell Research,2013,23(5):720-3.

[27] SHAO Y, GUAN Y, WANG L, et al.CRISPR/Cas-mediated genome editing in the rat via direct injection of one-cell embryos[J].Nature Protocols,2014,9(10):2493.

[28]Generation of Gene-Modified Cynomolgus Monkey via Cas9/RNA-Mediated Gene Targeting in One-Cell Embryos[J].Cell,2014,156(4):836-43.

[29] RAUL, TORRES-RUIZ, SANDRA, et al. CRISPR-Cas9: A Revolutionary Tool for Cancer Modelling [J]. International Journal of Molecular Sciences, 2015, 16(9): 22151–22168.

SUMMARY OF THE INVENTION

The purpose of the present invention is to provide a cell model that simulates AD lesions more comprehensively than the existing preclinical AD models in view of the above deficiencies of the prior art.

Another object of the present invention is to provide a method for constructing the cell model simulating AD pathology.

Yet another object of the present invention is to provide RNP complexes and applications thereof used in constructing the model.

An RNP complex that includes crRNA, TracrRNA, and Cas9 protein targeting the ADAM10 gene.

As a preference of the present invention, the crRNA targeting ADAM10 gene is selected from any one or more of crRNA1, crRNA2 or crRNA3; the crRNA1 sequence is shown in SEQ ID NO.1, and the The crRNA2 sequence is shown in SEQ ID NO.2, and the crRNA3 sequence is shown in SEQ ID NO.3.

As a further preference of the present invention, the crRNA targeting ADAM10 gene is selected from the combination of crRNA1, crRNA2 and crRNA3.

The application of the RNP complex of the present invention in constructing ADAM10 gene knockout Alzheimer's disease cell model.

The application of the RNP complex of the present invention in constructing a model of necrotic neuron in the brain.

A method for constructing a cell model of Alzheimer's disease, comprising electro-transforming the RNP complex of the present invention into SH-SY5Y cells according to the CRISPR/Cas9 gene editing technology method, and successfully knocking out in the SH-SY5Y cell line The target gene ADAM10.

As a preferred method of the present invention, the method includes mixing the CrRNA1, CrRNA2 and CrRNA3, annealing the CrRNA mixture and TracrRNA to form gRNA, and the gRNA and Cas9 protein are mixed to form an RNP complex, according to CRISPR/Cas 9 Gene editing technology method, using Lonza-4D to electroporate the RNP complex into SH-SY5Y cells, successfully knock out the target gene ADAM10 in the SH-SY5Y cell line, and culture the single cell line through monoclonal cells. A single cell line knocking out the ADAM10 gene is the Alzheimer's disease cell model.

A preclinical Alzheimer's disease cell model is SH-SY5Y cells with ADAM10 gene knockout constructed according to the method of the present invention.

The application of the preclinical Alzheimer's disease cell model of the present invention in screening Alzheimer's disease therapeutic drugs. After incubating different concentrations of MK-8931 in AD model cells, the Aβ, Tau and NLRP3 proteins were verified according to Example 6. The results showed that after administration of MK-8931, the levels of Aβ, Tau and NLRP3 proteins could be significantly adjusted. The neuron after administration of MK-8931 was observed according to the method of Example 5, and it was found that MK-8931 could not improve the state of the neuron. The above results and the failure of MK-8931 to enter the clinical phase III trial suggest that it may be related to the fact that the existing models cannot accurately simulate the changes of neurons in the brains of AD patients, and further shows that the new AD cell model established by the present invention has Potential to provide researchers with a model tool for screening drugs.

The application of the preclinical Alzheimer's disease cell model in the screening of drugs for treating neuronal necrosis in the brain.

Beneficial effects:

Using CRISPR/Cas 9 gene editing technology, CrRNA mixture and TracrRNA were mixed and annealed to form gRNA, and gRNA was mixed with Cas9 protein to form RNP complex. According to the following CRISPR/Cas 9 gene editing technology method, Lonza-4D was used in SH-SY5Y cells. The target gene ADAM10 was successfully knocked out in the strain. After culturing the single cell line with monoclonal cells, the single cell line that completely knocked out the ADAM10 gene was screened by Sanger sequencing. The results showed that the expression of Aβ ₄₂ , Aβ ₄₂ /Aβ ₄₀ and pTau/Tau was significantly increased after ADAM10 knockout. Inflammasome NLRP3 protein was significantly up-regulated, and the expression of pro-inflammatory factor TNF-α was significantly increased. At the same time, the neural differentiation function of cells is weakened, the length of neurons shrinks, the growth rate of cells is significantly slowed down, and the connections of neurons are significantly reduced, which can simulate neuronal necrosis in the brain of AD patients.

In addition, the AD cell model established by the present invention has good application prospects, and the cryopreserved cell line can be permanently passaged as AD model cells for research use. In addition, the cell culture cycle is short and the operation is simple, and it can be used as a preclinical cell model for large-scale screening of anti-AD candidate compounds and screening of potential active ingredients of traditional Chinese medicine.

Description of drawings

Figure 1 Structural region of ADAM10

Among them, CrRNA1, CrRNA2, and CrRNA3 are the CrRNA sequences that knock out the ADAM10 gene, respectively.

Figure 2 Schematic diagram of CrRNA1

Wherein CrRNA1: UUUUUUUUUAUAGGUCAGUA (SEQ ID ON.1). Cutsite: 58,717,724; Exon: Exon2; On Target Score: 0.431.

Figure 3 Schematic diagram of CrRNA2

CrRNA2: UUUUUUUUAUAGGUCAGUAU (SEQ ID ON.2). Cutsite: 58,717,723; Exon: Exon 2; On Target Score: 0.523.

Figure 4 Schematic diagram of CrRNA3

CrRNA3: AAAUAUAUCAGACAUUAUGA (SEQ ID ON.3). Cutsite: 58,717,688; Exon: Exon 2; On Target Score: 0.581.

Figure 5 Gene knockout verified by Sanger sequencing

Figure A is a schematic diagram of the positions of CrRNA1, CrRNA2, and CrRNA3 in the ADAM10 gene sequence; Figure B is the sequencing map of gene mutation points. Compared with the blank control KO, ADAM10 knockout cell lines had point mutations. The sequencing results showed that a cell expansion line knocking out the ADAM10 gene had been initially screened. These cell lines were cultured and expanded, and cryopreserved for subsequent experimental research.

Figure 6 Changes of target proteins after knockout of ADAM10 gene

The protein level of ADAM10 in the knockout group was verified. As shown in Figure A, compared with the control KO in the blank group, the ADAM10 KO group had a very significant decrease in ADAM10 protein expression, which was consistent with the results of Sanger sequencing. The data further indicated that ADAM10 gene knockout was successful in SH-SY5Y cells using CRISPR/Cas 9 gene editing technology. Follow-up experimental studies can be carried out.

Accumulation of Aβ and intracellular hyperphosphorylated Tau protein are the main neuropathological criteria for the diagnosis of AD, and the ratio of Aβ42/Aβ40 in the plasma of AD patients can be used as a pre-screening index for AD clinically.

Therefore, we verified Aβ; Tau; S-199Tau; S-214Tau. As shown in Figure B-E, compared with the blank control KO group, the expression of Aβ protein in ADAM10 KO group was significantly increased, Tau protein, S-199Tau protein , the expression of S-214Tau protein was significantly up-regulated. As shown in Figures F-I, cell supernatants were taken for Aβ42, Aβ40, p-Tau and Tau detection. The data showed that compared with the blank control KO, ADAM10 KO group had no significant change in Aβ40 protein level, while the expression of Aβ42 protein level was significantly up-regulated, and the ratios of Aβ42/Aβ40 and pTau/Tau were significantly increased.

The above data indicated that both Aβ and hyperphosphorylated Tau protein were significantly overexpressed in ADAM10 knockout group. The current data preliminarily show that cells knocking out the ADAM10 gene can be used as AD cell models.

Figure 7 Changes of inflammatory factor TNF-α after knockout of ADAM10 gene

Among the inflammatory cytokines involved in the pathogenesis of AD, TNF-α plays a central role in the inflammatory state of the brain and is the only cytokine thought to be involved in AD. Therefore, we detected TNF-α in ADAM10 knockout cells. Compared with the blank group, the levels of inflammatory factors in the supernatant of ADAM10 knockout cells were significantly up-regulated. The results showed that the levels of inflammatory factors were significantly up-regulated in the knockout cells.

Figure 8 Changes of inflammasome NLRP3 after knockout of ADAM10 gene

Dysregulation of the NLRP3 inflammasome has been implicated in the progression of a variety of neurodegenerative diseases. Studies have shown that NLRP3 protein inhibitors may serve as targets for the future treatment of AD. Compared with the Control KO group, the ADAM10 KO group significantly increased NLRP3 and activated the expression of the inflammasome.

Figure 9 Changes in neuronal state after ADAM10 gene knockout

The growth rate, differentiation and changes of cell density of neuronal cells were observed after knocking out ADAM10 gene in SH-SY5Y cells. Compared with undifferentiated normal SH-SY5Y cells, after neuronal differentiation treatment, normal SH-SY5Y cells have significantly longer neuronal lengths and tighter intercellular connections. After knocking out the ADAM10 gene and then undergoing the same cell differentiation treatment, the length of neurons was significantly shortened, the cells tended to shrink, the connections between cells were significantly reduced, and the ability of nerve cells to transmit information was significantly weakened.

Figure 10 Validation of the application value of the new AD cell model

As shown in Figure A, Aβ protein expression was significantly increased in ADAM10 KO group compared with Control KO group. After administration of 1 μM of MK-8931, MK-8931 significantly reduced the expression of Aβ protein. As shown in Figure B, the expression of Tau protein was significantly increased in ADAM10 KO group compared with Control KO group. After administration of MK-8931 at 0.1 μM, MK-8931 significantly reduced the expression of Tau protein. As shown in Figure C, the expression of inflammasome NLRP3 was significantly increased in ADAM10 KO group compared with Control KO group, and the expression of inflammasome NLRP3 was significantly down-regulated after administration of 100 nM MK-8931. As shown in Figure D, the neuronal status was not improved after administration of 1 μM of MK-8931 compared to the ADAM10 KO group.

Detailed ways

The present invention is explained in detail by the following examples, but it is not meant that the present invention is limited thereto.

Example 1

(1) Construction of CRISPR/CAS9 gene editing method

The following processes are all operated under aseptic conditions in the aseptic operation table:

①Construct RNP complex: Take 0.33μl of crRNA1 (100μM), 0.33μl of crRNA2 (100μM), 0.33μl of crRNA3 (100μM) and 1μl of Alt-R.CRISPR-Cas9 tracrRNA (100μM), mix well and use without The nuclease buffer was diluted to a concentration of 20-80 μM to obtain the RNA mixture. The RNA mixture was heated at 95°C for 5 min and cooled at room temperature for 10 min to obtain an annealed RNA mixture. Take 2.9 μl of the annealed RNA mixture and 1 μl of Cas 9 protein, mix thoroughly at a ratio of 1.2:1-2:1, and place at room temperature for 10 min. After adding 0.6 μl of electroporation enhancement solution, the reaction was performed at room temperature for 5 min to obtain the RNP complex.

② Electroporation of the RNP complex into SH-SY5Y cells to be knocked out: preheat the medium containing 15% FBS, take the cells with a density of 80%, and discard the medium. Wash the cells gently with an appropriate amount of PBS solution. After discarding the solution, add an appropriate amount of trypsin to digest the cells at 37°C. After 80% of the cells are detached for a few minutes, the digestion is terminated with a medium containing 15% FBS, 1100rpm. Centrifuge for 10 min and discard the supernatant. Resuspend the cells with 10 ml of PBS solution, mix the cells well, and count 10 μl of the cell solution. 250,000 cells were centrifuged at 1100 rpm for 10 min, the PBS supernatant was discarded, and cells were resuspended in 15.5 μl of P3 solution. 4.5 μl of RNP complex was added to obtain 20 μl of systemic cell solution. Add 20 μl of the system's cell solution to a 16-well electroporation plate, put the plate into a Lonza-4D electroporator, and select the SH-SY5Y program for electroporation.

(2) Construction of single cell cloning technology method

The electroporated cells were gradually diluted to 1 cell/10 μl, added to a 96-well plate, and supplemented with 200 μl of medium containing 15% FBS. After stabilizing for 12 hours and waiting for the cells to adhere, the wells containing one cell in the 96-well plate were recorded and screened under a microscope. After screening, continue to wait for these single cells to grow and expand. After the single cells are expanded to a cell density of 80% in a 96-well plate, the cells are transferred to a 12-well plate. After the single cells are expanded to cells in a 12-well plate After the cell density reached 80%, the cells were transferred to a 6-well plate. After the cell density reached 80%, a part of the cells were taken for Sanger sequencing to screen the single cell line that was successfully knocked out. The remaining cells were cultured and replaced every 48 hours. cell culture medium once.

(3) Sanger sequencing

①Extraction of cell DNA samples

Take the cells and discard the medium, add an appropriate amount of PBS solution to rinse the cells, then discard the solution, add an appropriate amount of Trpsin to digest the cells for a few minutes, add 15% FBS-containing medium to terminate the digestion, and centrifuge the PBS solution at 1100 rpm for 10 min to fully resuspend and remove a small amount of cells. Count, take 500,000 cells strictly. Cell DNA was extracted according to the instructions of the genomic DNA mini-extraction kit (spin column; D00D0063).

②Polymerase chain reaction (PCR)

As shown in Table 1, the primers of the target gene ADAM10 are designed as follows:

Table 1 Primers of target gene ADAM10

③ The reaction system is as follows

Table 2 PCR reaction system

④ PCR reaction conditions

Table 3 PCR reaction program

⑤ PCR product purification

According to the electrophoresis results of the PCR products, the desired DNA bands were cut, and the purification steps were strictly in accordance with the instructions for SK8131 gel recovery.

⑥ Sanger sequencing stage

The sequencing reaction system is shown in the following table:

Table 4 Sanger sequencing reaction system

Reaction conditions:

Table 5 Sanger sequencing reaction conditions

After removing the PCR reaction plate from the PCR machine, add 4μl EDTA Mix (0.5mol/L) EDTA, 3mol/L sodium acetate, sterile deionized water and 60μl 95% ethanol to each well, and react in an ice-water bath for 30min .

Centrifuge the solution at 4000g for 20min, gently invert the plate, spin dry at 600rmp/min, add 150 μl of 70% ethanol to each well, and centrifuge at 4000g for 5min. The plate was inverted at 600 rmp/min and dried, dried on a clean table for 5 min, added with 10 μl Hidi Formamide, and shaken on a vortex for 1 min.

Place the reaction plate on the PCR machine at 96°C, quickly remove the reaction plate for 3 minutes, and place it in an ice bath to cool, and wait for sample loading.

The 96-well plate was placed in ABI 3730XL sequencer for electrophoresis analysis. The operation of the sequencing electrophoresis instrument is strictly carried out in accordance with the ABI Prism 3730 manual.

Compared with the blank control KO, ADAM10 knockout cell lines had point mutations. The sequencing results (Fig. 5) showed that a cell expansion line knocking out the ADAM10 gene had been initially screened. These cell lines were cultured and expanded, and cryopreserved for subsequent experimental research.

Example 2 Determination of ADAM10 target protein in AD cell model

The ADAM10 in the knockout group was verified at the protein level by Western. As shown in Figure 6A, compared with the control KO in the blank group, the expression of ADAM10 protein in the ADAM10 KO group was significantly reduced, which was consistent with the results of Sanger sequencing. The data further indicated that ADAM10 gene knockout was successful in SH-SY5Y cells using CRISPR/Cas 9 gene editing technology. Follow-up experimental studies can be carried out.

Example 3 Determination of Aβ and Tau protein in AD cell model

Accumulation of Aβ and intracellular hyperphosphorylated Tau protein are the main neuropathological criteria for the diagnosis of AD, and the ratio of Aβ42/Aβ40 in the plasma of AD patients can be used as a pre-screening index for AD clinically. Therefore, we verify Aβ; Tau; S-199Tau; S-214Tau:

Take the cells and discard the medium, add an appropriate amount of PBS solution to rinse the cells and discard the solution, add an appropriate amount of Trpsin to digest the cells for a few minutes, add 15% FBS medium to terminate the digestion, and centrifuge at 1100 rpm for 10 min. After the PBS solution was fully resuspended, a small amount of cells were counted, and 2,000,000 cells were taken in strict accordance with the operation steps of the ELISA kit instructions. The total protein of each sample was determined by the BCA kit. After correcting the total protein, Aβ40 was determined; Aβ42; p-Tau and Tau content were counted. As shown in Figure 6B-E, compared with the control KO in the blank group, the expression of Aβ protein in ADAM10 KO group was significantly increased, and the expression of Tau protein, S-199Tau protein, and S-214Tau protein were significantly up-regulated. As shown in Figure 6F-I, the cell supernatant was taken for Aβ42, Aβ40, p-Tau and Tau detection. The data showed that compared with the blank control KO, ADAM10 KO group had no significant change in Aβ40 protein level, while the expression of Aβ42 protein level was significantly up-regulated, and the ratios of Aβ42/Aβ40 and pTau/Tau were significantly increased.

The above data indicated that both Aβ and hyperphosphorylated Tau protein were significantly overexpressed in ADAM10 knockout group. The current data preliminarily show that cells knocking out the ADAM10 gene can be used as AD cell models.

Example 4 Determination of inflammatory factors in AD cell model

Among the inflammatory cytokines involved in the pathogenesis of AD, TNF-α plays a central role in the inflammatory state of the brain and is the only cytokine thought to be involved in AD. Therefore, we detected TNF-α in ADAM10 knockout cells. Take ADAM10 knockout cells and discard the medium, add an appropriate amount of PBS solution to rinse the cells and discard the solution, add an appropriate amount of Trpsin to digest the cells for a few minutes, add 15% FBS medium to terminate the digestion, and centrifuge at 1100 rpm for 10 min. After the PBS solution was fully resuspended, a small amount of cells were counted, and 2,000,000 cells were taken in strict accordance with the instructions of the ELISA kit. The total protein of each sample was determined by the BCA kit. After correcting the total protein, the TNF- Data statistics were performed after the content of α inflammatory factors. The results are shown in Figure 7. Compared with the blank group, the levels of inflammatory factors in the supernatant of ADAM10 knockout cells were significantly up-regulated. The results showed that the levels of inflammatory factors were significantly up-regulated in the knockout cells.

Example 5

(1) Cell neuron differentiation culture

SH-SY5Y cells were sequentially cultured in different types of media as shown in Table 6 below. First, the cells were cultured in Growth Media medium to reach a cell density of 70%. The medium formula was then changed to Differentiation media 1 for 7-10 days, during which time the culture medium was changed every 48 hours. The cells were passaged at a ratio of 1:1 in fresh medium Differentiation media 2 for 4-7 days, during which time the medium was changed every 48 hours. The medium was changed to Differentiation media 3 for 7-10 days, during which time the medium was changed every 48 hours. At this stage, cells differentiate into neurons for subsequent detection and analysis.

Table 6 Composition of medium for neural differentiation of SH-SY5Y cells

(2) Confocal microscopy to observe the growth of neurons

Differentiated SH-SY5Y neurons were fixed with 4% PFA for 20 min at room temperature. After discarding the solution, the cells were gently rinsed 3 times with 0.1% PBS-T solution for 2 min each time. After fixation, cells were incubated in 5% NGS-T blocking solution for 2 hours at room temperature. Add the primary antibody anti-tubulin III primary antibody (#ab179513, Abcam plc.) at 4°C at a dilution of 1:1000, and incubate overnight. After removing the primary antibody, the cells were gently washed 3 times with 0.1% PBS-T solution. The secondary antibody Alexa Fluor 488 (ab150113, Abcam) was added at room temperature at a dilution of 1:2000, and incubated at room temperature for 1 h. After removing the secondary antibody, cells were fixed on glass slides, and the samples were imaged and detected by confocal microscopy within 24 h.

All neuronal differentiation pictures were acquired using a Zeiss 880 confocal microscope. Laser power is set to 4%; gain is set to 650; Digital offset is set to 350; Acquiring speed is set to 1.03s; Z-stack images is set to 5μm; an average of 2 shots per film.

Images acquired by confocal microscopy were analyzed using the Image J plugin Neuron J. Greater than 3 regions in each image were selected for analysis, and axonal lengths were subsequently measured, and Neuron J was used to measure distances between coordinates.

As shown in Figure 9, compared with the normal SH-SY5Y cells without neural cell differentiation, after the neural cell differentiation treatment, the normal SH-SY5Y cells have significantly longer neuronal lengths and tighter intercellular connections . After knocking out the ADAM10 gene and then undergoing the same cell differentiation treatment, the length of neurons was significantly shortened, the cells tended to shrink, the connections between cells were significantly reduced, and the ability of nerve cells to transmit information was significantly weakened.

Example 6

①Extraction of total cell protein:

After discarding the culture medium, 2 ml of pre-cooled PBS was added to rinse the cells, and the PBS washing solution was discarded. This operation is repeated 2 times. Put the culture flask on ice, take 1,000,000 cells after cell counting, add 100 μl of PMSF-containing lysis solution, mix well, and lyse on ice for 30 min. Shake the cell flask at intervals to fully lyse the cells. The lysed cells were quickly scraped off with a scraper, and the cell debris and lysate were transferred to a 1.5ml centrifuge tube with a pipette. Centrifuge at 13000g for 20min at 4°C. Take the supernatant and reserve 5 μl for protein content determination. An appropriate amount of supernatant was added to the loading buffer at a volume of 4:1, and boiled in boiling water for 10 min. The samples were stored at -20°C.

②Preparation of separating gel and stacking gel

Separating gel (15%): ultrapure water 2.3mL; 30% acrylamide 5.0mL; 1.5M Tris-HCl (pH 8.8) 2.5mL; 10% SDS 0.1mL; 10% APS (ammonium persulfate) 0.1mL; TEMED 4 μl.

Separating gel (8%): ultrapure water 4.6mL; 30% acrylamide 2.7mL; 1.5M Tris-HCl (pH 8.8) 2.5mL; 10% SDS 0.1mL; 10% APS (ammonium persulfate) 0.1mL; TEMED 8 μl.

Separating gel (6%): ultrapure water 5.3mL; 30% acrylamide 2.0mL; 1.5M Tris-HCl (pH 8.8) 2.5mL; 10% SDS 0.1mL; 10% APS (ammonium persulfate) 0.1mL; TEMED 8 μl.

Stacking gel (5%): ultrapure water 2.7 mL; 30% acrylamide 0.4 mL; 1M Tris-HCl solution (pH 6.8) 0.5 mL; 10% SDS 40 μl; 10% APS 40 μl; TEMED 4 μl.

Ammonium persulfate and TEMED are coagulants, and they should be mixed immediately after adding the solution and then poured. After filling the separation gel, gently add ultrapure water, move the pipette when adding ultrapure water, and ensure that the water is on the same level. Let stand until you see a clear line between the separating gel and the water. After the separation gel is solidified, tilt the water to pour out, drain the water, pour in the stacking gel, insert the comb teeth, wait for the stacking gel to solidify and then load the sample.

③ Protein sample loading

Pull out the comb teeth slowly in a vertical direction. Use a 50μl micro-sampler to take an appropriate amount of sample, and the total protein to be loaded is generally 20μg. Slowly insert the sampler into the bottom of the comb teeth, and inject the protein sample at an appropriate speed.

④ Electrophoresis

The first stage: 75V, 40-60min until the target protein appears a line at the boundary between the separating gel and the stacking gel.

The second stage: 115V, 60-90min until the target protein migrates to about 1/3 of the bottom of the separation gel.

⑤ Transfer film

Cut a PVDF membrane that matches the size of the strip in advance, soak it in methanol for 15-20 s, then transfer it to ultrapure water for 2 min, and soak the PVDF membrane in transfer buffer for 10 min. Take out the transfer filter paper and soak it in transfer buffer for 10 min. Wait until the end of electrophoresis to cut the strips within the desired molecular weight range. The order of membrane transfer device from top to bottom is cathode carbon plate, membrane transfer filter paper, glue, PVDF membrane, filter paper. According to the smooth placement, precise alignment, and no air bubbles should be ensured at each step. Turn on the power supply, 1.5mm glue constant current 0.3A transfer film time 2h, 1mm glue constant current 0.18A transfer film time 1.5h. Place the transfer chamber in an ice bath to prevent overheating of the transfer.

⑥ closed

After the transfer stage, disconnect the power and take out the PVDF membrane. Block in 5% nonfat milk powder at 4°C overnight, or at 37°C for 1 h.

⑦ Incubation antibody

a. Use 5% nonfat milk or 5% BSA solution to dilute the primary antibody in an appropriate ratio according to the antibody instructions, incubate at 4°C overnight and then incubate at 37°C for 1 h.

b. Discard the primary antibody, wash the membrane with TBST solution for 30min, and change the solution every 5min.

c. Use 5% skimmed milk or 5% BSA solution to dilute the secondary antibody in an appropriate ratio according to the antibody instructions, and incubate at 37°C for 1 h.

d. Discard the secondary antibody, wash the membrane with TBST solution for 30min, and change the solution every 5min.

⑧Gel image analysis

Add 100-200ul of developer solution to each film evenly according to the area of the film, and put the strip into a gel imager to avoid light and develop color. The strips were scanned and photographed. The molecular weight and net optical density values of the bands were processed and analyzed by a gel image processing system. The exposure time is appropriately adjusted according to the exposure difficulty of the strip. The initial exposure time is 5-20s, and the total exposure time is adjusted appropriately for each strip.

As shown in Figure 8, compared with the Control KO group, the ADAM10 KO group significantly increased NLRP3 and activated the expression of the inflammasome.

Example 7

Weigh an appropriate amount of compound AP1 and dissolve it in DMSO solution to prepare final concentrations of 100 nM, 1 μM, and 10 μM, respectively.

homogeneous solution. The cells were incubated in ADAM10 knockout cell lines for 24 hours, and the Aβ, Tau and NLRP3 proteins were verified by extracting proteins according to Example 6 and using Western blot. Observations of neurons were performed as in Example 5. As shown in Figure 10A-C, compared with ADAM10 KO group, MK-8931 could significantly reduce the expression of Aβ, Tau and inflammasome NLRP3 protein, as shown in Figure 10D, but MK-8931 did not improve neuronal status. The results show that the failure of MK-8931 in the clinical phase III experiment may be related to the inability of its preclinical AD model to simulate neuronal damage, further indicating that the established AD cell model is relatively comprehensive.

Claims (10)

1. An RNP complex is characterized in that it comprises crRNA, TracrRNA and Cas9 protein targeting ADAM10 gene.
2. RNP complex according to claim 1, is characterized in that, the crRNA of described targeting ADAM10 gene is selected from any one or more in crRNA1, crRNA2 or crRNA3; Described crRNA1 sequence is such as SEQ ID NO. 1, the crRNA2 sequence is shown in SEQ ID NO.2, and the crRNA3 sequence is shown in SEQ ID NO.3.
3. The RNP complex according to claim 2, wherein the crRNA targeting ADAM10 gene is selected from the combination of crRNA1, crRNA2 and crRNA3.
4. The application of the RNP complex described in any one of claim 1-3 in constructing ADAM10 gene knockout Alzheimer's disease cell model.
5. The application of the RNP complex according to any one of claims 1-3 in constructing a cell model simulating neuronal necrosis in the brain.
6. A method for constructing a cell model of Alzheimer's disease, comprising electroporating the RNP complex described in any one of claims 1-3 into SH-SY5Y according to the CRISPR/Cas 9 gene editing technology method The target gene ADAM10 was successfully knocked out in SH-SY5Y cell line.
7. The method according to claim 6, wherein after mixing the CrRNA1, CrRNA2 and CrRNA3, the CrRNA mixture and TracrRNA are mixed and annealed to form gRNA, and the gRNA is mixed with Cas 9 protein to form an RNP complex, according to CRISPR/Cas 9Gene editing technology, using Lonza-4D to electroporate the RNP complex into SH-SY5Y cells, and successfully knock out the target gene ADAM10 in the SH-SY5Y cell line. A single cell line with a complete knockout of the ADAM10 gene is the Alzheimer's disease cell model.
8. A preclinical Alzheimer's disease cell model, characterized in that it is an ADAM10 gene knockout SH-SY5Y cell constructed according to the method of claim 6 or 7.
9. Application of the preclinical Alzheimer's disease cell model according to claim 8 in screening Alzheimer's disease therapeutic drugs.
10. The application of the preclinical Alzheimer's disease cell model according to claim 8 in screening drugs for treating neuronal necrosis in the brain.

Images