WO2022206802A1 - Système d'administration de plasmide d'arn pour le traitement du glioblastome - Google Patents

Système d'administration de plasmide d'arn pour le traitement du glioblastome Download PDF

Info

Publication number
WO2022206802A1
WO2022206802A1 PCT/CN2022/083933 CN2022083933W WO2022206802A1 WO 2022206802 A1 WO2022206802 A1 WO 2022206802A1 CN 2022083933 W CN2022083933 W CN 2022083933W WO 2022206802 A1 WO2022206802 A1 WO 2022206802A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
rna
targeting
plasmid
delivery system
Prior art date
Application number
PCT/CN2022/083933
Other languages
English (en)
Chinese (zh)
Inventor
张辰宇
陈熹
付正
李菁
张翔
周心妍
张丽
余梦超
郭宏源
Original Assignee
南京大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 南京大学 filed Critical 南京大学
Publication of WO2022206802A1 publication Critical patent/WO2022206802A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Definitions

  • the present application relates to the field of biomedical technology, in particular to an RNA plasmid delivery system for the treatment of glioblastoma.
  • Glioblastoma is the most malignant glioma of astrocytic tumors. Glioblastoma grows rapidly, 70% to 80% of patients have a disease course of 3 to 6 months, and only 10% have a disease course of more than 1 year. Those with a longer course may evolve from low-grade astrocytoma. Due to the rapid growth of the tumor, extensive cerebral edema, and obvious symptoms of increased intracranial pressure, all patients had symptoms of headache and vomiting. Optic disc edema has headache, mental changes, limb weakness, vomiting, disturbance of consciousness and speech disturbance. Tumor infiltrates and destroys brain tissue, resulting in a series of focal symptoms.
  • Patients have different degrees of hemiplegia, hemiparesis, aphasia, and hemianopia.
  • Neurological examination can detect hemiplegia, cranial nerve damage, hemisensory disturbance and hemianopia.
  • the incidence of epilepsy is less common than that of astrocytoma and oligodendroglioma.
  • Some patients have epileptic seizures, and some patients have mental symptoms such as apathy, dementia, and mental retardation.
  • RNA interference (RNAi) therapy has been considered a promising strategy for the treatment of human diseases since its invention, but many problems have been encountered during clinical practice, and the development of this therapy has lagged far behind expectations.
  • RNA cannot exist stably outside the cell for a long time, because RNA will be degraded into fragments by RNases rich in extracellular, so it is necessary to find a method that can make RNA stable outside the cell and can enter specific tissues in a targeted manner. Highlight the effect of RNAi therapy.
  • the Chinese Patent Publication No. CN108624590A discloses a siRNA capable of inhibiting the expression of DDR2 gene; the Chinese Patent Publication No. CN108624591A discloses a siRNA capable of silencing the ARPC4 gene, and the siRNA is modified with ⁇ -phosphorus-selenium;
  • the Chinese Patent Publication No. CN108546702A discloses a siRNA targeting long-chain non-coding RNA DDX11-AS1.
  • the Chinese Patent Publication No. CN106177990A discloses a siRNA precursor that can be used for various tumor treatments. These patents design specific siRNAs to target certain diseases caused by genetic changes.
  • Chinese Patent Publication No. CN108250267A discloses a polypeptide, polypeptide-siRNA induced co-assembly, using polypeptide as a carrier of siRNA.
  • the Chinese Patent Publication No. CN108117585A discloses a polypeptide for promoting apoptosis of breast cancer cells through targeted introduction of siRNA, and the polypeptide is also used as the carrier of siRNA.
  • the Chinese Patent Publication No. CN108096583A discloses a nanoparticle carrier, which can be loaded with siRNA with breast cancer curative effect while containing chemotherapeutic drugs.
  • exosomes can deliver miRNAs to recipient cells, which secrete miRNAs at relatively low concentrations , which can effectively block the expression of target genes.
  • Exosomes are biocompatible with the host immune system and possess the innate ability to protect and transport miRNAs across biological barriers in vivo, thus becoming a potential solution to overcome problems associated with siRNA delivery.
  • the Chinese Patent Publication No. CN110699382A discloses a method for preparing siRNA-delivering exosomes, and discloses the technology of separating exosomes from plasma and encapsulating siRNA into exosomes by electroporation .
  • the embodiments of the present application provide an RNA plasmid delivery system for the treatment of glioblastoma, so as to solve the technical defects existing in the prior art.
  • An invention of the present application is to provide an RNA plasmid delivery system for treating glioblastoma, the system comprising a plasmid carrying an RNA fragment capable of treating glioblastoma, and the plasmid can be used in the treatment of glioblastoma. It is enriched in the organ tissue of the host, and endogenously and spontaneously forms a complex structure containing the RNA fragment capable of sending the RNA fragment into the brain, which is endogenous and spontaneous in the host organ tissue. blast tumor treatment.
  • the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are siRNA, shRNA or shRNA with medical significance capable of inhibiting or hindering the development of glioblastoma. miRNA sequences.
  • Figures 14-17 show that the plasmids indeed have the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments.
  • the plasmid also includes a promoter and a targeting tag
  • the targeting tag can form the targeting structure of the composite structure in the organ tissue of the host, and the targeting structure is located on the surface of the composite structure, so The complex structure can seek and bind to the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.
  • the plasmid includes any one of the following circuits or a combination of several circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; in each of the plasmids, at least An RNA fragment and a targeting tag are included, the RNA fragment and targeting tag being in the same circuit or in different circuits.
  • Figures 18-19 show that plasmids containing multiple RNA fragments and multiple targeting tags have the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments.
  • the plasmid also includes a flanking sequence, a compensation sequence and a loop sequence that can fold the circuit into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence;
  • the plasmid includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag Or 5'-promoter-targeting tag-5'flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence.
  • the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence whose homology is greater than 80%;
  • the loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;
  • the 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence whose homology is greater than 80%;
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted.
  • the purpose of deleting bases 1-5 of the reverse complement of the RNA is to make the sequence unexpressed.
  • Figures 20-23 show that plasmids containing homologous sequences of different flanking sequences and loop sequences have in vivo enrichment, self-assembly and therapeutic effects.
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted.
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted.
  • the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted.
  • adjacent lines are connected by sequences composed of sequences 1-3;
  • sequence 1 is CAGATC
  • sequence 2 is a sequence consisting of 5-80 bases
  • sequence 3 is TGGATC.
  • Figures 24-25 show that when the plasmid carries four lines and sequence 2 is multiple bases, it has in vivo enrichment, self-assembly and therapeutic effects.
  • adjacent lines are connected by sequence 4 or a sequence with more than 80% homology to sequence 4;
  • sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
  • Figure 26 shows that the plasmids constructed with sequence 4 and homologous sequences have enrichment and self-assembly effects.
  • the organ tissue is liver
  • the composite structure is exosome
  • the targeting tag is selected from targeting peptides or targeting proteins with targeting function.
  • Figures 27-28 show that plasmids containing targeting peptide tags or targeting protein tags have the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments.
  • the targeting peptides include RVG targeting peptides, GE11 targeting peptides, PTP targeting peptides, TCP-1 targeting peptides, and MSP targeting peptides;
  • the targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.
  • the targeting tag is preferably an RVG targeting peptide or an RVG-LAMP2B fusion protein.
  • the RNA sequence is 15-25 nucleotides in length.
  • the RNA capable of treating glioblastoma is selected from any one or more of the following RNAs: siRNA of EGFR gene, siRNA of TNC gene, or RNA with more than 80% homology to the above sequence sequence, or nucleic acid molecule encoding the above RNA.
  • EGFR gene siRNA includes UGUUGCUUCUCUUAAUUCCU, AAAUGAUCUUCAAAAGUGGCC, UCUUUAAGAAGGAAAGAUCAU, AAUAUUCGUAGCAUUUAUGGA, UAAAAAUCCUCACAUAUACUU, other sequences that inhibit EGFR gene expression and sequences with more than 80% homology to the above sequences.
  • the siRNA of TNC gene includes UAUGAAAUGUAAAAAAAGGGA, AAUAUAUCCUUAAAAUGGAA, UAAUCAUAUCCUUAAAAUGGA, UGAAAAAUCCUUAGUUUUCAU, AGAAGUAAAAAACUAUUGCGA, other sequences with inhibiting TNC gene expression and sequences with more than 80% homology to the above sequences.
  • sequences with more than 80% homology may be 85%, 88%, 90%, 95%, 98%, etc. homology.
  • Figures 29-30 show that the gene route of siRNA containing EGFR gene and siRNA of TNC gene has the effect of enriching in vivo and forming a complex structure containing RNA fragments spontaneously.
  • the RNA fragment includes an RNA sequence ontology and a modified RNA sequence obtained by modifying the RNA sequence ontology with ribose sugar. That is, the RNA fragment can be composed of only at least one RNA sequence ontology, or only at least one modified RNA sequence, and can also be composed of RNA sequence ontology and modified RNA sequence.
  • the isolated nucleic acid also includes its variants and derivatives.
  • the nucleic acid can be modified by one of ordinary skill in the art using general methods. Modification methods include (but are not limited to): methylation modification, hydrocarbyl modification, glycosylation modification (such as 2-methoxy-glycosyl modification, hydrocarbyl-glycosyl modification, sugar ring modification, etc.), nucleic acid modification, peptide modification Segment modification, lipid modification, halogen modification, nucleic acid modification (such as "TT" modification) and the like.
  • the modification is an internucleotide linkage, for example selected from: phosphorothioate, 2'-O methoxyethyl (MOE), 2'-fluoro, phosphine Acid alkyl esters, phosphorodithioates, alkyl phosphorothioates, phosphoramidates, carbamates, carbonates, phosphoric triesters, acetamidates, carboxymethyl esters, and combinations thereof.
  • phosphorothioate 2'-O methoxyethyl (MOE), 2'-fluoro
  • phosphine Acid alkyl esters phosphorodithioates, alkyl phosphorothioates, phosphoramidates, carbamates, carbonates, phosphoric triesters, acetamidates, carboxymethyl esters, and combinations thereof.
  • the modification is a modification of nucleotides, such as selected from: peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinose-nucleic acid (FANA), analogs, derivatives objects and their combinations.
  • the modification is a 2' fluoropyrimidine modification.
  • 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on RNA with 2'-F.
  • 2'-F can make RNA not easily recognized by RNase in vivo, thereby increasing the stability of RNA fragment transmission in vivo. sex.
  • Figure 31 shows that the delivery system containing ribose-modified RNA sequences has in vivo enrichment and self-assembly effects.
  • the delivery system is a delivery system for use in mammals, including humans.
  • the present application also provides an application of the RNA delivery system for treating glioblastoma in medicine.
  • the modes of administration of the drug include oral, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.
  • RNA delivery system for the treatment of glioblastoma uses plasmid as a carrier and plasmid as a mature injection, and its safety and reliability have been fully verified, and the drugability is very good.
  • the final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes.
  • the delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances.
  • RNA delivery system for the treatment of glioblastoma provided in this application can be tightly combined with AGO 2 and enriched into a complex structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation, but also maintain its Stability in circulation, and favorable for recipient cell uptake, intracytoplasmic release, and lysosomal escape at low doses.
  • RNA delivery system for the treatment of glioblastoma provided in this application is applied to medicine, that is, a drug delivery platform is provided, which can greatly improve the therapeutic effect of glioblastoma, and more RNA can be formed through the platform
  • a drug delivery platform is provided, which can greatly improve the therapeutic effect of glioblastoma, and more RNA can be formed through the platform
  • the research and development foundation of drug-like drugs will greatly promote the development and use of RNA-based drugs.
  • Fig. 1 is a comparison diagram of plasmid distribution and metabolism in mice provided by an embodiment of the present application
  • Fig. 2 is a comparison diagram of protein expression levels in mice provided by an embodiment of the present application.
  • FIG. 3 is a comparison diagram of related siRNA levels in mice provided by an embodiment of the present application.
  • FIG. 4 is a comparison diagram of absolute siRNA levels in various tissues of mice provided in an embodiment of the present application.
  • Figure 5 is a comparison diagram of the effect of plasmid doses on mouse siRNA levels provided by an embodiment of the present application.
  • Fig. 6 is the metabolic situation comparison diagram of the precursor and the mature body in the mouse liver after injecting the plasmid provided by an embodiment of the present application;
  • FIG. 7 is a comparison diagram of siRNA kinetics and distribution in different tissues of mice provided by an embodiment of the present application.
  • Figure 8 is a comparison diagram of the influence of different promoters on siRNA provided by an embodiment of the present application.
  • FIG. 9 is a comparison diagram of the fluorescence intensity of eGFP in different tissues of mice provided by an embodiment of the present application.
  • Figure 10 is a comparison diagram of mouse alanine aminotransferase, aspartate aminotransferase, total bilirubin, blood urea nitrogen, serum alkaline phosphatase, creatinine content, and thymus gland weight, spleen weight, and peripheral blood cell percentage provided by an embodiment of the present application;
  • Figure 11 is a comparison diagram of mouse siRNA-related expression provided by an embodiment of the present application.
  • Figure 12 is a comparison diagram of the treatment of glioblastoma in mice provided in an embodiment of the present application.
  • FIG. 13 is a comparison diagram of immunohistochemical staining of mouse brain provided in an example of the present application.
  • Figure 14 is a verification of the effect of in vivo enrichment and spontaneous formation of composite structures in the plasmid delivery system provided by an embodiment of the present application when carrying a single RNA fragment; wherein A is the in vivo enrichment of plasmids containing different RNA fragments The effect of aggregation, B is the in vivo self-assembly effect shown by the expression levels of different RNA fragments.
  • A is the in vivo effect of plasmids containing different combinations of RNA fragments
  • B is the in vivo self-assembly effect shown by the expression levels of different combined RNA fragments.
  • Fig. 16 is the effect verification that the plasmid delivery system provided by an embodiment of the present application has in vivo enrichment and spontaneous formation of composite structures when carrying any three RNA fragments; wherein A is the in vivo effect of plasmids containing different combinations of RNA fragments The effect of enrichment, B is the in vivo self-assembly effect shown by the expression levels of different combined RNA fragments.
  • Fig. 17 is the effect verification that the plasmid delivery system provided by another embodiment of the present application has in vivo enrichment and spontaneous formation of composite structure in the case of carrying any two kinds of RNA fragments;
  • the effect of enrichment in vivo, B is the effect of self-assembly in vivo shown by the expression levels of different combinations of RNA fragments.
  • Figure 18 is a verification of the effect of in vivo enrichment of the plasmid delivery system provided in an embodiment of the present application when it carries random 1-2 RNA fragments and 1-2 targeting tags and the two are located in the same route.
  • Figure 19 is a verification of the effect of in vivo enrichment of the plasmid delivery system provided by another embodiment of the present application when it carries random 1-2 RNA fragments and 1-2 targeting tags and the two are located in different routes.
  • Figure 20 shows that the plasmid delivery system provided by an embodiment of the present application has in vivo enrichment and spontaneous formation of a composite structure under the condition that it carries a definite 5' flanking sequence and at least 2 definite sequences whose homology is greater than 80% The effect verification of ; where A is the enrichment effect of plasmids containing different 5' flanking sequences in vivo, and B is the in vivo self-assembly effect shown by the expression levels of RNA fragments of different 5' flanking sequences.
  • Figure 21 shows that the plasmid delivery system provided in an embodiment of the present application has the effect of in vivo enrichment and spontaneous formation of composite structures when it carries a defined loop sequence and at least two defined sequences with a homology greater than 80%. Verification; where A is the enrichment effect of plasmids containing different loop sequences in vivo, and B is the in vivo self-assembly effect shown by the expression levels of RNA fragments of different loop sequences.
  • Figure 22 shows that the plasmid delivery system provided by an embodiment of the present application has in vivo enrichment and spontaneous formation of a composite structure when it carries a definite 3' flanking sequence and at least 2 definite sequences with a homology greater than 80%.
  • A is the enrichment effect of plasmids containing different 3' flanking sequences in vivo
  • B is the in vivo self-assembly effect shown by the expression levels of RNA fragments with different 3' flanking sequences.
  • Figure 23 is an RNA sequence of the plasmid delivery system provided by an embodiment of the present application carrying the reverse complementary sequence after deletion of any of the 1, 2, 3, 4, and 5 bases, with in vivo enrichment and spontaneous formation of a composite structure The effect is verified; where A is the enrichment effect of plasmids containing different compensation sequences in vivo, and B is the in vivo self-assembly effect shown by the expression levels of RNA fragments of different compensation sequences.
  • Figure 24 is a verification of the effect of spontaneously forming a composite structure when the plasmid delivery system provided in an embodiment of the present application carries four of the lines, and adjacent lines are connected by sequence 1-sequence 2-sequence 3.
  • Figure 25 shows that the plasmid delivery system provided by an embodiment of the present application carries four said lines, and adjacent lines are connected by sequence 1-sequence 2-sequence 3, and sequence 2 is 5 bases and 10 bases respectively The effect of spontaneous formation of complex structure was verified when the composition of base, 20 bases, 30 bases, 40 bases, 50 bases and 80 bases.
  • Figure 26 is a verification of the effect of spontaneously forming a composite structure when the plasmid delivery system provided in an embodiment of the present application contains sequence 4 and at least two sequences with more than 80% homology to sequence 4.
  • FIG. 27 is a verification of the effect of in vivo enrichment when the plasmid delivery system provided in an embodiment of the present application only contains a targeting peptide tag.
  • FIG. 28 is a verification of the effect of in vivo enrichment when the plasmid delivery system provided in an embodiment of the present application only contains a targeting protein tag.
  • Figure 29 is the verification of the effect of in vivo enrichment and spontaneous formation of composite structure when the siRNA containing EGFR gene in the gene circuit provided in an embodiment of the present application; wherein A is the enrichment of different gene circuits containing EGFR gene siRNA sequences in vivo The effect of B is the in vivo self-assembly effect shown by different expression levels of EGFR gene-containing siRNA sequences.
  • Figure 30 is the verification of the effect of in vivo enrichment and spontaneous formation of complex structures when the siRNA containing TNC gene in the gene circuit provided by an embodiment of the present application; wherein A is the enrichment of different gene circuits containing TNC gene siRNA sequences in vivo The effect of B is the in vivo self-assembly effect shown by different expression levels of siRNA sequences containing TNC gene.
  • Figure 31 shows the effect verification of in vivo enrichment and spontaneous formation of composite structures when the delivery system provided by an example of the application contains two different ribose-modified RNA sequences; wherein A is the delivery system of different ribose-modified RNAs in In vivo enrichment effect, B is the in vivo self-assembly effect shown by the expression levels of different ribose-modified RNAs.
  • HE staining Hematoxylin-eosin staining, referred to as HE staining.
  • HE staining is one of the most basic and widely used technical methods in histology and pathology teaching and research.
  • the hematoxylin staining solution is alkaline and can stain the basophilic structure of the tissue (such as ribosome, nucleus and ribonucleic acid in the cytoplasm) into blue-violet; eosin is an acid dye, which can stain the eosinophilic structure of the tissue ( Such as intracellular and intercellular proteins, including Lewy bodies, alcohol bodies, and most of the cytoplasm) stained pink, making the morphology of the entire cell organization clearly visible.
  • the basophilic structure of the tissue such as ribosome, nucleus and ribonucleic acid in the cytoplasm
  • eosin is an acid dye, which can stain the eosinophilic structure of the tissue ( Such as intracellular and intercellular proteins, including Lewy bodies, alcohol bodies, and most of the cytoplasm) stained pink, making the morphology of the entire cell organization clearly visible.
  • HE staining include: sample tissue fixation and sectioning; tissue sample dewaxing; tissue sample hydration; tissue section hematoxylin staining, differentiation and anti-blue; tissue section eosin staining and dehydration; tissue sample section air-drying and sealing; Observe and photograph under the microscope.
  • Masson staining renders collagen fibers blue (stained by aniline blue) or green (stained by bright green) and muscle fibers red (stained by acid fuchsin and Ponceau), which is consistent with the size and organization of the anionic dye molecules of permeability.
  • the fixed tissue is stained sequentially or mixed with a series of anionic water-soluble dyes. It can be found that red blood cells are stained with the smallest molecular anionic dyes, muscle fibers and cytoplasm are stained with medium-sized anionic dyes, and collagen fibers are stained with macromolecular anionic dyes. Dyeing with anionic dyes.
  • red blood cells have the least permeability to anionic dyes, followed by muscle fibers and cytoplasm, and collagen fibers have the largest permeability.
  • Type I and III collagens are green (GBM, TBM, mesangial matrix and renal interstitium are green), and erythropoietin, tubular cytoplasm, and erythrocytes are red.
  • Masson staining The specific steps of Masson staining include:
  • Tissues were fixed in Bouin's solution, rinsed with running water overnight, and embedded in conventional dehydration; sections were deparaffinized to water (deparaffinized in xylene for 10 min ⁇ 3 times, and the liquid was blotted dry with absorbent paper; 100% ethanol 5 min ⁇ 2 times, with water absorbing Dry the liquid with paper; 95% ethanol for 5min ⁇ 2 times, blot the liquid with absorbent paper; run water for 2min, blot dry with absorbent paper); Weiger's iron hematoxylin staining for 5-10min; ; Rinse with running water for 3min; Stain with Ponceau red acid fuchsin solution for 8min; Rinse slightly with distilled water; Treat with 1% phosphomolybdic acid aqueous solution for about 5min; Do not wash with water, directly counterstain with aniline blue solution or bright green solution for 5min; Treat with 1% glacial acetic acid 1min; dehydrated in 95% ethanol for 5min ⁇ 2 times,
  • Western Blot (Western Blot) is to transfer the protein to the membrane, and then use the antibody for detection.
  • the corresponding antibody can be used as the primary antibody for detection, and the expression product of the new gene can be detected by the fusion part of the antibody. .
  • Western Blot uses polyacrylamide gel electrophoresis, the detected object is protein, the "probe” is an antibody, and the "color development” is a labeled secondary antibody.
  • the protein sample separated by PAGE is transferred to a solid phase carrier (such as nitrocellulose membrane), and the solid phase carrier adsorbs proteins in the form of non-covalent bonds, and can keep the types of polypeptides separated by electrophoresis and their biological activities unchanged.
  • the protein or polypeptide on the solid phase carrier is used as an antigen, which reacts with the corresponding antibody, and then reacts with the enzyme or isotope-labeled secondary antibody to detect the specific target gene separated by electrophoresis through substrate color development or autoradiography.
  • expressed protein components The steps mainly include: protein extraction, protein quantification, gel preparation and electrophoresis, membrane transfer, immunolabeling and development.
  • Immunohistochemistry using antigen-antibody reaction, that is, the principle of specific binding of antigen and antibody, determines the antigen (polypeptide) in tissue cells by developing the color of the chromogenic reagent (fluorescein, enzyme, metal ion, isotope) labeled antibody through chemical reaction. and protein), the localization, qualitative and relative quantitative research, called immunohistochemistry (immunohistochemistry) or immunocytochemistry (immunocytochemistry).
  • chromogenic reagent fluorescein, enzyme, metal ion, isotope
  • the main steps of immunohistochemistry include: section soaking, overnight drying, xylene dewaxing, gradient alcohol dewaxing (100%, 95%, 90%, 80%, 75%, 70%, 50%, 3min each time) , double-distilled water, dropwise addition of 3% hydrogen peroxide solution to remove catalase, water washing, antigen retrieval, dropwise addition of 5% BSA, blocking for 1 h, dilution of primary antibody, washing with PBS buffer, incubation with secondary antibody, washing with PBS buffer , color developing solution, washing with water, hematoxylin staining, dehydration with gradient ethanol, and sealing with neutral gum.
  • the detection of the siRNA level, the protein content and the mRNA content involved in the present invention is to establish the mouse stem cell in vitro model by injecting the RNA delivery system into the mouse.
  • the expression levels of mRNA and siRNA in cells and tissues were detected by qRT-PCR. Absolute quantification of siRNA was determined by plotting a standard curve using the standards.
  • the internal reference gene is U6snRNA (in tissue) or miR-16 (in serum, exosomes)
  • the gene is GAPDH or 18s RNA.
  • Western blotting was used to detect protein expression levels in cells and tissues, and ImageJ software was used for protein quantitative analysis.
  • the present embodiment provides an RNA plasmid delivery system for treating glioblastoma, the system comprising a plasmid carrying an RNA fragment capable of treating glioblastoma, and the plasmid can be delivered in a host's organ Tissue enriched, and endogenously spontaneously formed in the host organ tissue a complex structure containing the RNA fragment capable of delivering the RNA fragment into the brain, which is critical for glioblastoma Get treatment.
  • the plasmid also includes a promoter and a targeting tag.
  • the plasmid includes any one of the following circuits or a combination of several circuits: promoter-RNA sequence, promoter-targeting tag, promoter-RNA sequence-targeting tag, and each of the plasmids includes at least one RNA fragment and a targeting tag, the RNA fragment and targeting tag are located in the same line or in different lines.
  • the plasmid may only include a promoter-RNA sequence-targeting tag, or may include a combination of a promoter-RNA sequence, a promoter-targeting tag, or a promoter-targeting tag, a promoter- A combination of RNA-seq-targeting tags.
  • the present invention randomly adopts 1-2 RNA fragments and 1-2 targeting tags, and the RNA fragments and targeting tags are located at the same or different locations, respectively.
  • the enrichment and self-assembly effects of plasmids were verified by experiments, as shown in Figure 18-19. The groups are listed as follows:
  • RNA fragment 1+targeting tag 1 1) RNA fragment 1+targeting tag 1, RNA fragment 2+targeting tag 2, RNA fragment 1+targeting tag 2, RNA fragment 2+targeting tag 1;
  • RNA fragment 1+RNA fragment 2+targeting tag 1 RNA fragment 1+RNA fragment 2+targeting tag 2
  • RNA fragment 1+targeting tag 1+targeting tag 2 RNA fragment 2+targeting tag 1 + targeting tag 2;
  • RNA fragment 1+targeting tag 1 1) RNA fragment 1+targeting tag 1, RNA fragment 2+targeting tag 2, RNA fragment 1+targeting tag 2, RNA fragment 2+targeting tag 1;
  • RNA fragment 1+RNA fragment 2+targeting tag 1 RNA fragment 1+RNA fragment 2+targeting tag 2
  • RNA fragment 1+targeting tag 1+targeting tag 2 RNA fragment 2+targeting tag 1 + targeting tag 2;
  • the plasmid can also include a flanking sequence, a compensation sequence and a loop sequence that can make the circuit fold into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence; the plasmid includes the following Any one line or combination of several lines: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag, 5'-promoting sub-targeting tag-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence.
  • the present invention randomly provides 4 groups of plasmids containing different sequences, and the enrichment and self-assembly effects of plasmids are verified by experiments, as shown in Figure 20- 23 shown.
  • the groups are listed as follows:
  • RNA sequences From the above RNA sequences, select 2-3 kinds, and delete the reverse complementary sequence after any 1, 2, 3, 4, and 5 bases among them.
  • the 5' flanking sequence is preferably ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with ggatcctggaggcttgctgaaggctgtatgctgaattc, etc.
  • the loop sequence is preferably gttttggccactgactgac or a sequence with more than 80% homology thereto, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with gttttggccactgactgac, and the like.
  • the 3' flanking sequence is preferably accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, etc.
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted.
  • the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-5 bases therein.
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted.
  • the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-3 bases therein.
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted.
  • the compensation sequence may be the reverse complementary sequence of the RNA sequence by deleting any 1-3 consecutively arranged bases.
  • the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted.
  • the compensation sequence may be the reverse complementary sequence of the 9th position and/or the 10th position in the deletion of the RNA sequence. Deleting bases 9 and 10 works best.
  • flanking sequences are not randomly selected, but are determined based on a large number of theoretical studies and experiments. increase the expression rate of RNA fragments.
  • sequence 1 is preferably CAGATC
  • sequence 2 can be composed of 5-80 bases
  • Sequences of composition such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases
  • Any sequence may be used, preferably a sequence consisting of 10-50 bases, more preferably a sequence consisting of 20-40 bases, and sequence 3 is preferably TGGATC.
  • the present invention randomly provides a set of plasmids carrying four of the lines, and adjacent lines are connected by sequence 1-sequence 2-sequence 3
  • sequence 1-sequence 2-sequence 3 The experimental data of , the enrichment and self-assembly effects of plasmids were verified by experiments, as shown in Figure 24.
  • the present invention randomly provides a set of plasmids carrying four of the lines, and the adjacent lines are separated by sequence 1-sequence 2- Sequence 3 is connected, and sequence 2 is the experimental data consisting of 5 bases, 10 bases, 20 bases, 30 bases, 40 bases, 50 bases and 80 bases respectively.
  • sequence 2 is the experimental data consisting of 5 bases, 10 bases, 20 bases, 30 bases, 40 bases, 50 bases and 80 bases respectively. The enrichment and self-assembly effects of the plasmids were verified, as shown in Figure 25.
  • sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
  • the present invention randomly provides a set of plasmids containing the connecting sequence as sequence 4 and at least two corresponding sequences with more than 80% homology to sequence 4.
  • Experimental data, and the enrichment and self-assembly effects of plasmids were verified by experiments, as shown in Figure 26.
  • RNA fragments comprise one, two or more specific RNA sequences of medical significance, the RNA sequences can be expressed in the target receptor, and the compensatory sequence cannot be expressed in the target receptor.
  • the RNA sequence can be an siRNA sequence, a shRNA sequence or a miRNA sequence, preferably an siRNA sequence.
  • the length of an RNA sequence is 15-25 nucleotides (nt), preferably 18-22nt, such as 18nt, 19nt, 20nt, 21nt, and 22nt. This range of sequence lengths was not chosen arbitrarily, but was determined through trial and error. A large number of experiments have proved that when the length of the RNA sequence is less than 18nt, especially less than 15nt, the RNA sequence is mostly invalid and will not play a role. The cost of the line is greatly increased, and the effect is not better than the RNA sequence with a length of 18-22nt, and the economic benefit is poor. Therefore, when the length of the RNA sequence is 15-25nt, especially 18-22nt, the cost and the effect can be taken into account, and the effect is the best.
  • nt nucleotides
  • RNA fragment capable of treating glioblastoma is selected from any one or more of the following: siRNA of EGFR gene, siRNA of TNC gene or nucleic acid molecules encoding the above RNAs.
  • the number of required delivery RNA effective sequences is one, two or more.
  • EGFR gene siRNA and TNC gene siRNA can be used in combination on the same plasmid vector, or EGFR gene siRNA or TNC gene siRNA can be used alone.
  • the functional structural region of the plasmid vector can be expressed as: (promoter-siRNA1)-connector sequence-(promoter-siRNA2)-connector sequence- (promoter-targeting tag), or (promoter-targeting tag-siRNA1)-linker-(promoter-targeting tag-siRNA2), or (promoter-siRNA1)-linker-(promoter- Targeting tag-siRNA2) etc.
  • the functional structural region of the plasmid vector can be expressed as: (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-connecting sequence-(5'-promoter - 5' flanking sequence - siRNA2-loop sequence - compensation sequence - 3' flanking sequence) - linking sequence - (5'-promoter-targeting tag), or (5'-promoter-targeting tag-5' flanking sequence-siRNA1-loop sequence-compensation sequence-3' flanking sequence)-linker sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence-compensating sequence-3'flanking sequence), or (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-linking sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence-compensating sequence-3'
  • the above RNA can also be obtained by ribose modification of the RNA sequence (siRNA, shRNA or miRNA) therein, preferably 2' fluoropyrimidine modification.
  • 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on siRNA, shRNA or miRNA with 2'-F.
  • 2'-F can make it difficult for RNase in the human body to recognize siRNA, shRNA or miRNA, so it can Increases the stability of RNA transport in vivo.
  • the present invention randomly provides experimental data of the delivery system containing ribose-modified RNA sequences, and experimentally verified the enrichment and self-regulation of the delivery system.
  • the assembly effect is shown in Figure 31.
  • the liver will phagocytose exogenous plasmids, and up to 99% of the exogenous plasmids will enter the liver. Therefore, when plasmids are used as vectors, they can be enriched in liver tissue without specific design.
  • the plasmid is opened to release RNA molecules (siRNA, shRNA, or miRNA), and liver tissue spontaneously wraps the above RNA molecules into exosomes, and these exosomes become RNA delivery mechanisms.
  • RNA delivery mechanism in order to make the RNA delivery mechanism (exosome) have the ability of "precision guidance”, we design a targeting tag in the plasmid injected into the body, and the targeting tag will also be assembled into exosomes by liver tissue , especially when certain specific targeting tags are selected, the targeting tags can be inserted into the surface of exosomes to become targeting structures that can guide exosomes, which greatly improves the RNA delivery mechanism of the present invention On the one hand, the amount of exogenous plasmids that need to be introduced can be greatly reduced, and on the other hand, the efficiency of potential drug delivery can be greatly improved.
  • the targeting tag is selected from one of the peptides, proteins or antibodies with targeting function.
  • the selection of the targeting tag is a process that requires creative work. On the one hand, it is necessary to select the available targeting tags according to the target tissue. It is ensured that the targeting label can stably appear on the surface of exosomes, so as to achieve the targeting function.
  • Targeting peptides that have been screened so far include but are not limited to RVG targeting peptide (nucleotide sequence shown in SEQ ID No: 1), GE11 targeting peptide (nucleotide sequence shown in SEQ ID No: 2), PTP targeting peptide (nucleotide sequence shown in SEQ ID No: 3), TCP-1 targeting peptide (nucleotide sequence shown in SEQ ID No: 4), MSP targeting peptide (nucleotide sequence shown in SEQ ID No: 4) SEQ ID No: 5); targeting proteins include but are not limited to RVG-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 6), GE11-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 6) : 7), PTP-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 8), TCP-1-LAMP2B fusion protein (nucleot
  • the present invention randomly provides a set of experimental data that plasmids only contain targeting peptide tags or targeting protein tags, and experimentally verified the enrichment of plasmids. Set and self-assembly effects, as shown in Figure 27-28.
  • the plasmid vector can also be composed of multiple plasmids with different structures, one of which contains a promoter promoter and targeting tags, other plasmids contain promoters and RNA fragments. Loading the targeting tag and RNA fragment into different plasmid vectors, and injecting the two plasmid vectors into the body, the targeting effect is no worse than the targeting effect produced by loading the same targeting tag and RNA fragment into one plasmid vector .
  • the plasmid vector containing the RNA sequence can be injected first, and then the plasmid vector containing the targeting tag can be injected after 1-2 hours, so that a better target can be achieved. to the effect.
  • the delivery systems described above can all be used in mammals, including humans.
  • FIG. 1A in order to understand the distribution of plasmids in the body, we carried out a plate test on mice. 720h) sampling, using the plasmid extracted by spectinomycin for transformation, observing the number of clones in liver, plasma, lung, brain, kidney, spleen, the results are shown in Figure 1B, Figure 1C, Figure 1D, it can be seen that the plasmid It is most distributed in the liver of mice, and reaches the peak at about 3 hours after injection, and is basically metabolized at 12 hours after injection.
  • the CMV eGFP siRE circuit co-expressing eGFP protein and EGFR siRNA was injected intravenously into C57BL/6J mice. The results are shown in Figure 2.
  • the eGFP fluorescence in the mouse liver gradually increased over time, reaching a peak at about 12 hours. 48 After hours, it dropped to the background level, and no obvious eGFP signal was seen in other tissues.
  • CMV-scrR The control plasmid
  • CMV-siR E the plasmid expressing EGFR siRNA
  • Figure 3A The related siRNA levels in exosomes, the results are shown in Figure 3A, it can be seen that there is siRNA expression in the exosomes of mouse hepatocytes injected with CMV-siRNA.
  • FIG. 4A After intravenous injection of plasmids into mice, the distribution of mature siRNA in different tissues is shown in Figure 4. It can be seen from Figure 4A that the levels of EGFR-siRNA in plasma, exosomes, and exosome-free plasma show time-dependent changes; from Figure 4B, it can be seen that mouse EGFR-siRNAs in the liver, lung, pancreas, and spleen , The accumulation in the kidney is time-dependent.
  • mice were injected with control plasmid (CMV-scrR), 0.05mg/kg CMV-siR E plasmid, 0.5mg/kg CMV-siR E plasmid, 5mg/kg CMV-siR E plasmid, and detected the liver, Absolute siRNA (EGFR siRNA) levels in spleen, heart, lung, kidney, pancreas, brain, skeletal muscle, CD4 + cells, the results are shown in Figure 5A, it can be seen that there is no siRNA expression in the tissues of mice injected with the control plasmid , in each tissue of mice injected with CMV-siR E plasmid, the level of siRNA expression was positively correlated with the concentration of CMV-siR E plasmid.
  • CMV-scrR control plasmid
  • EGFR siRNA Absolute siRNA
  • fluorescence in situ hybridization assay FISH also confirmed that the level of siRNA expression was positively correlated with the concentration of CMV-siR E plasmid, that is, the tissue distribution of EGFR siRNA was dose-dependent.
  • the plasmid After the plasmid enters the body, it will express the precursor (Precursor) and then process it into the mature body (siRNA), so we tested the metabolism of the precursor (Precursor) and the mature body (siRNA) in the liver after the plasmid was injected into mice. , the results are shown in Figure 6. It can be seen that the expression levels of precursor (Precursor) and mature body (siRNA) in the mouse liver reached a peak at the time point of 6 hours after the injection of the plasmid. Metabolism of the precursor (siRNA) was complete, and the metabolism of the precursor (Precursor) in the mouse liver was complete 48 hours after the injection of the plasmid.
  • siRNA with albumin ALB as the promoter siRNA with CMV as the promoter
  • siRNA without any promoter were injected into mice intravenously.
  • the absolute siRNA levels in the mice were detected at 48 h, and the results are shown in Figure 8. It can be seen that the level of siRNA with CMV as the promoter in mice is the highest, that is, the effect of CMV as the promoter is the best.
  • mice were intravenously injected with PBS or 5 mg/kg CMV-siR G or CMV-RVG-siR G plasmid, and treated for 24 hours After the mice were sacrificed, their eGFP fluorescence levels were detected in cryosections.
  • Figure 9A shows a representative fluorescence microscope image, in which green indicates positive eGFP signal, blue indicates DAPI-stained nuclei, scale bar: 100 ⁇ m, CMV is visible - RVG-siR G plasmid has a more obvious inhibitory effect on mouse eGFP; eGFP transgenic mice were intravenously injected with PBS or CMV-scrR or CMV-siR E plasmid, and the mice were sacrificed after 24 hours of treatment, and they were detected in frozen sections.
  • the fluorescence level of eGFP is a bar graph of the fluorescence intensity (Fluorescence intensity) of the mouse heart, lung, kidney, pancreas, brain, and skeletal muscle injected with PBS, CMV- siRE , and CMV-RVG- siRE . It can be seen that, The contrast of fluorescence intensity in liver, spleen, lung and kidney of mice was more obvious.
  • mice injected with PBS, CMV-scrR, and CMV-siR E their alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), blood urea nitrogen (BUN), serum alkaline phosphatase (ALP), creatinine (CREA) content, thymus weight, spleen weight, and percentage of peripheral blood cells were detected.
  • ALT alanine aminotransferase
  • AST aspartate aminotransferase
  • TBIL total bilirubin
  • BUN blood urea nitrogen
  • ALP serum alkaline phosphatase
  • CREA creatinine
  • Figure 10G is a comparison chart of mouse liver, lung, spleen, and kidney tissue
  • Figure 10H -I is a comparison chart of mouse thymus and spleen tissue
  • FIG. 10J is a comparison chart of percentage in peripheral blood cells of mice.
  • mice injected with PBS, CMV- scrR , and CMV-siRE were almost the same.
  • the mice injected with CMV- siRE were similar to those injected with PBS.
  • the liver, lung, spleen, and kidney also had no tissue damage.
  • RNA delivery system for the treatment of glioblastoma uses a plasmid as a carrier and the plasmid as a mature injection. Its safety and reliability have been fully verified, and the drugability is very good.
  • the final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes.
  • the delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances.
  • RNA delivery system for the treatment of glioblastoma provided in this example can be tightly combined with AGO 2 and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation, but also maintain its Stability in circulation, and favorable for receptor cell uptake, intracytoplasmic release, and lysosomal escape, requiring low doses.
  • this embodiment provides a medicine.
  • the drug includes a plasmid carrying RNA capable of treating glioblastoma, and after the drug enters the human body, the plasmid can be enriched in the organ tissue of the host, and endogenous in the organ tissue of the host Spontaneous formation of a complex structure containing RNA capable of treating glioblastoma and having a targeting structure, the complex structure seeks and binds to the target tissue through the targeting structure, and delivers RNA capable of treating glioblastoma into the brain Department for the treatment of glioblastoma.
  • RNA capable of treating glioblastoma is one or more of siRNA, shRNA and miRNA with medical significance and capable of inhibiting or hindering the development of glioblastoma.
  • the present invention randomly adopted 2 kinds of siRNA, 2 kinds of shRNA, and 2 kinds of miRNA, and named them siRNA1, siRNA2, shRNA1, shRNA2, miRNA1, miRNA2 , in the case that the plasmid contains the above RNA alone or the plasmid contains any of the above RNAs, the enrichment and self-assembly effects of the plasmid are verified by experiments, as shown in Figure 14-17.
  • the groups are listed as follows:
  • the plasmid includes a promoter sequence and an RNA sequence capable of treating glioblastoma.
  • the plasmid also includes a targeting tag, and the targeting tag forms the targeting structure of the composite structure in the organ tissue of the host.
  • the functional structural regions of the plasmid are arranged in any of the following sequences: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter -targeting tag or 5'-promoter-targeting tag-5'flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence;
  • the RNA sequence includes one, two or more specific RNA sequences with medical significance, the RNA sequence can be expressed in the target receptor, and the compensation sequence cannot be expressed in the target receptor.
  • the plasmid is composed of multiple plasmids with different structures, wherein one plasmid contains a promoter and a targeting tag, and the other plasmids contain a promoter and an RNA sequence.
  • organ tissue is liver.
  • the composite structure is an exosome.
  • the targeting tag is selected from one of peptides, proteins or antibodies with targeting function, and the targeting structure is located on the surface of the composite structure.
  • the targeting tag is RVG-LAMP2B fusion protein, or GE11-LAMP2B fusion protein.
  • the required number of effective sequences for delivering RNA is 1, 2 or more.
  • the delivery system can be used in mammals including humans.
  • RNA capable of treating glioblastoma is selected from any one or more of the following RNAs: EGFR gene siRNA, TNC gene siRNA or nucleic acid molecules encoding the above RNAs.
  • the present invention randomly provides a set of experimental data of the gene circuit containing EGFR gene siRNA and TNC gene siRNA, and verified the gene circuit through experiments.
  • the enrichment and self-assembly effects are shown in Figure 29-30.
  • the drug can be administered orally, inhaled, subcutaneously injected, intramuscularly injected or intravenously injected into the human body, it can be delivered to the brain through the RNA delivery system for the treatment of glioblastoma described in Example 1 to exert a therapeutic effect.
  • the medicine provided in this example can also be used in combination with other medicines for the treatment of glioblastoma to enhance the therapeutic effect, such as temozolomide and the like.
  • the medicine provided in this example may also include a pharmaceutically acceptable carrier, which includes but is not limited to diluents, buffers, emulsions, encapsulation agents, excipients, fillers, adhesives, sprays, transdermal agents Absorbents, wetting agents, disintegrating agents, absorption accelerators, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorption carriers, etc.
  • a pharmaceutically acceptable carrier includes but is not limited to diluents, buffers, emulsions, encapsulation agents, excipients, fillers, adhesives, sprays, transdermal agents Absorbents, wetting agents, disintegrating agents, absorption accelerators, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorption carriers, etc.
  • the dosage forms of the medicine provided in this embodiment can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, and the like.
  • the medicine provided in this example uses the plasmid as the carrier and the plasmid as the mature injection, and its safety and reliability have been fully verified, and the drugability is very good.
  • the final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes.
  • the drug can deliver various kinds of small molecule RNAs and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances.
  • the drug provided in this application can be closely combined with AGO 2 and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation and maintain its stability in circulation, but also benefit the receptor.
  • Cellular uptake, intracytoplasmic release and lysosomal escape require low doses.
  • this embodiment provides an application of an RNA delivery system for treating glioblastoma in medicine, and the medicine is a medicine for treating glioblastoma.
  • the application of the RNA delivery system in the treatment of glioblastoma is specifically described in conjunction with the following two experiments.
  • the experimental groups are CMV-siR E group, CMV-siR T group, CMV-RVG-siR E+T group, CMV-siR E+T group, CMV-Flag-siR E+T group, where "E” stands for EGFR , "T” represent TNC, and the control groups are the PBS group, the CMV-scrR group, and the CMV-Flag-scrR group, respectively.
  • the specific experimental process is shown in FIG. 11A .
  • the experimental groups were CMV-RVG-siR E group and CMV-RVG-siR E+T group, respectively, and the control group were PBS group and CMV-scrR group, respectively.
  • mice were selected, and glioblastoma cells (U-87MG-Luc cells) were injected into the mice. From the 7th day to the 21st day, the mice were injected every two days. One treatment with PBS buffer/CMV-scrR/CMV-RVG-siR E /CMV-RVG-siR E+T (5 mg/kg), mice were subjected to survival analysis and tumor assessment, respectively. On the 7th, 14th, 28th, and 35th days, the mice were detected by BLI in vivo imaging, respectively.
  • this figure is a comparison chart of BLI in vivo imaging detection of mice on the 7th, 14th, 28th, and 35th days. It can be seen that the mice in the CMV-RVG-siR E+T group have glioblastoma The tumor inhibition effect was the most significant.
  • FIG. 12C which is a comparison chart of the survival rate of mice in each group, it can be seen that the mice in the CMV-RVG-siR E+T group have the longest survival time.
  • the graph is a fluorescence comparison graph of each group of mice, which is obtained by luciferase in vivo imaging, and the ordinate reflects the intensity of the lucifer fluorescence signal. Since the gene has been artificially integrated into the implanted tumor, the map reflects tumor progression. It can be seen that the tumors of the mice in the control group developed rapidly, while the tumors of the mice in the experimental group were suppressed to a great extent.
  • this figure is the relative siRNA comparison chart of each group of mice. It can be seen that the level of EGFR siRNA in CMV-RVG-siR E group is higher, and the level of EGFR siRNA in CMV-RVG-siR E+T group is higher. and TNC siRNA levels were higher.
  • CMV-RVG-siR E plasmid can inhibit the expression of EGFR and PCNA in the brain
  • CMV-RVG-siR E+T plasmid can inhibit the expression of EGFR, TNC and PCNA in the brain.
  • RNA plasmid delivery system of the present invention indeed has the actual effect of in vivo enrichment and spontaneous formation of composite structures (self-assembly), for the different RNAs that can be carried in the plasmid delivery system, the amount of RNA fragments carried ( Figure 14- Figure 17) , the number and line selection of RNA fragments and targeting tags (Fig. 18-Fig. 19), the possible flanking sequences, loop sequences, and compensating sequences of RNA (Fig. 20-Fig.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Dispersion Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un système d'administration de plasmide d'ARN pour le traitement du glioblastome. Le système comprend un plasmide. Le plasmide porte un fragment d'ARN pouvant traiter le glioblastome. Le plasmide peut venir enrichir les tissus organiques d'un hôte. Dans les tissus d'organe de l'hôte, le plasmide peut former de manière endogène et spontanée une structure composite contenant le fragment d'ARN. La structure composite peut insérer le fragment D'ARN dans le cerveau, de façon à traiter le glioblastome. La sécurité et la fiabilité du système d'administration d'ARN fourni ont été vérifiées, et le système possède une bonne pharmacopotentialité et une universalité élevée.
PCT/CN2022/083933 2021-03-30 2022-03-30 Système d'administration de plasmide d'arn pour le traitement du glioblastome WO2022206802A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202110336033 2021-03-30
CN202110336033.3 2021-03-30

Publications (1)

Publication Number Publication Date
WO2022206802A1 true WO2022206802A1 (fr) 2022-10-06

Family

ID=83406346

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/083933 WO2022206802A1 (fr) 2021-03-30 2022-03-30 Système d'administration de plasmide d'arn pour le traitement du glioblastome

Country Status (2)

Country Link
CN (1) CN115137834A (fr)
WO (1) WO2022206802A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150079631A1 (en) * 2012-03-16 2015-03-19 The General Hospital Corporation Microvesicle-mediated delivery of therapeutic molecules
US20190153409A1 (en) * 2017-11-17 2019-05-23 Aviv MedTech Ltd. Compositions comprising particles and methods for treating cancer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150079631A1 (en) * 2012-03-16 2015-03-19 The General Hospital Corporation Microvesicle-mediated delivery of therapeutic molecules
US20190153409A1 (en) * 2017-11-17 2019-05-23 Aviv MedTech Ltd. Compositions comprising particles and methods for treating cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CASEY A MAGUIRE, ET AL.: "Microvesicle-associated AAV Vector as a Novel Gene Delivery System", MOLECULAR THERAPY, ELSEVIER INC., US, vol. 20, no. 5, 1 May 2012 (2012-05-01), US , pages 960 - 971, XP055405355, ISSN: 1525-0016, DOI: 10.1038/mt.2011.303 *
FU ZHENG; ZHANG XIANG; ZHOU XINYAN; UR-REHMAN UZAIR; YU MENGCHAO; LIANG HONGWEI; GUO HONGYUAN; GUO XU; KONG YAN; SU YUANYUAN; YE Y: "In vivo self-assembled small RNAs as a new generation of RNAi therapeutics", CELL RESEARCH, SPRINGER SINGAPORE, SINGAPORE, vol. 31, no. 6, 29 March 2021 (2021-03-29), Singapore , pages 631 - 648, XP037469825, ISSN: 1001-0602, DOI: 10.1038/s41422-021-00491-z *
GYÖRGY BENCE; FITZPATRICK ZACHARY; CROMMENTUIJN MATHEUS H.W.; MU DAKAI; MAGUIRE CASEY A. : "Naturally enveloped AAV vectors for shielding neutralizing antibodies and robust gene deliveryin vivo ", BIOMATERIALS, ELSEVIER, AMSTERDAM, NL, vol. 35, no. 26, 7 June 2014 (2014-06-07), AMSTERDAM, NL , pages 7598 - 7609, XP028874881, ISSN: 0142-9612, DOI: 10.1016/j.biomaterials.2014.05.032 *
PAN XINGHAO, LIU MINGBIN;ZHANG XIAOYAN;XU JIANQING;SHANGHAI: "Advances in research of exosomes as targeted therapeutic vectors", ZHONGGUO AI ZHENG ZA ZHI = CLINICAL ONCOLOGY, FUDAN UNIVERSITY CANCER HOSPITAL, CN, vol. 30, no. 9, 30 September 2020 (2020-09-30), CN, pages 701 - 706, XP055927249, ISSN: 1007-3639, DOI: 10.19401/j.cnki.1007-3639.2020.09.010 *

Also Published As

Publication number Publication date
CN115137834A (zh) 2022-10-04

Similar Documents

Publication Publication Date Title
JP2022008404A (ja) Ｃ／ＥＢＰα小分子活性化ＲＮＡ組成物
KR102599712B1 (ko) C/EBP 알파 saRNA 조성물 및 사용 방법
Rengaswamy et al. RGD liposome-protamine-siRNA (LPR) nanoparticles targeting PAX3-FOXO1 for alveolar rhabdomyosarcoma therapy
US20240141361A1 (en) Gene circuit, rna delivery system and use thereof
EP4219715A2 (fr) Compositions stabilisées de saarn cebpa et procédés d'utilisation
US20240141344A1 (en) Rna plasmid delivery system and application thereof
US20240141380A1 (en) Viral vector-based rna delivery system and use thereof
WO2022206802A1 (fr) Système d'administration de plasmide d'arn pour le traitement du glioblastome
WO2022206816A1 (fr) Système d'administration de plasmide d'arn pour le traitement de la maladie de parkinson
WO2022206778A1 (fr) Système d'administration de plasmide d'arn pour le traitement de la fibrose pulmonaire
WO2022206805A1 (fr) Système d'administration de plasmide d'arn pour le traitement du cancer pulmonaire
WO2022206821A1 (fr) Système d'administration d'arn pour le traitement de la maladie de parkinson
WO2022206812A1 (fr) Système d'administration d'arn pour le traitement du cancer
WO2022206814A1 (fr) Système d'administration d'arn pour le traitement du glioblastome
WO2022206784A1 (fr) Système d'administration d'arn pour le traitement de la fibrose pulmonaire
WO2022206781A1 (fr) Système d'administration d'arn pour le traitement de la colite
US20240229027A1 (en) Nucleic acid delivery system and application thereof
EP4317434A1 (fr) Système d'administration d'arn pour le traitement de la maladie de huntington
EP4317433A1 (fr) Système d'administration d'acide nucléique et son application
JP2023015297A (ja) Ｃ／ＥＢＰα小分子活性化ＲＮＡ組成物
CN115137739A (zh) 一种用于治疗肺癌的rna递送系统
WO2012155328A1 (fr) Composition comprenant de l'endostatine et des molécules d'arni et utilisation associée

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22778984

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22778984

Country of ref document: EP

Kind code of ref document: A1