WO2022206778A1 - Système d'administration de plasmide d'arn pour le traitement de la fibrose pulmonaire - Google Patents

Système d'administration de plasmide d'arn pour le traitement de la fibrose pulmonaire Download PDF

Info

Publication number
WO2022206778A1
WO2022206778A1 PCT/CN2022/083797 CN2022083797W WO2022206778A1 WO 2022206778 A1 WO2022206778 A1 WO 2022206778A1 CN 2022083797 W CN2022083797 W CN 2022083797W WO 2022206778 A1 WO2022206778 A1 WO 2022206778A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
rna
pulmonary fibrosis
targeting
plasmid
Prior art date
Application number
PCT/CN2022/083797
Other languages
English (en)
Chinese (zh)
Inventor
张辰宇
陈熹
付正
李菁
张翔
周心妍
张丽
余梦超
郭宏源
Original Assignee
南京大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 南京大学 filed Critical 南京大学
Publication of WO2022206778A1 publication Critical patent/WO2022206778A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/46—Ingredients of undetermined constitution or reaction products thereof, e.g. skin, bone, milk, cotton fibre, eggshell, oxgall or plant extracts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Definitions

  • the present application relates to the field of biomedical technology, in particular to an RNA plasmid delivery system for the treatment of pulmonary fibrosis.
  • Pulmonary fibrosis is the end-stage change of a large class of lung diseases characterized by the proliferation of fibroblasts and the accumulation of a large amount of extracellular matrix accompanied by inflammatory damage and tissue structure destruction. Abnormal (scarring). Pulmonary fibrosis seriously affects the respiratory function of the human body, manifested as dry cough, progressive dyspnea (consciously insufficient air), and with the aggravation of the disease and lung damage, the patient's respiratory function continues to deteriorate. The morbidity and mortality of idiopathic pulmonary fibrosis increase year by year. The average survival time after diagnosis is only 2.8 years, and the mortality rate is higher than that of most tumors. It is called a "tumor-like disease".
  • RNA interference (RNAi) therapy has been considered a promising strategy for the treatment of human diseases since its invention, but many problems have been encountered during clinical practice, and the development of this therapy has lagged far behind expectations.
  • RNA cannot exist stably outside the cell for a long time, because RNA will be degraded into fragments by RNases rich in extracellular, so it is necessary to find a method that can make RNA stable outside the cell and can enter specific tissues in a targeted manner. Highlight the effect of RNAi therapy.
  • the Chinese Patent Publication No. CN108624590A discloses a siRNA capable of inhibiting the expression of DDR2 gene; the Chinese Patent Publication No. CN108624591A discloses a siRNA capable of silencing the ARPC4 gene, and the siRNA is modified with ⁇ -phosphorus-selenium;
  • the Chinese Patent Publication No. CN108546702A discloses a siRNA targeting long-chain non-coding RNA DDX11-AS1.
  • the Chinese Patent Publication No. CN106177990A discloses a siRNA precursor that can be used for various tumor treatments. These patents design specific siRNAs to target certain diseases caused by genetic changes.
  • Chinese Patent Publication No. CN108250267A discloses a polypeptide, polypeptide-siRNA induced co-assembly, using polypeptide as a carrier of siRNA.
  • the Chinese Patent Publication No. CN108117585A discloses a polypeptide for promoting apoptosis of breast cancer cells through targeted introduction of siRNA, and the polypeptide is also used as the carrier of siRNA.
  • the Chinese Patent Publication No. CN108096583A discloses a nanoparticle carrier, which can be loaded with siRNA with breast cancer curative effect while containing chemotherapeutic drugs.
  • exosomes can deliver miRNAs to recipient cells, which secrete miRNAs at relatively low concentrations , which can effectively block the expression of target genes.
  • Exosomes are biocompatible with the host immune system and possess the innate ability to protect and transport miRNAs across biological barriers in vivo, thus becoming a potential solution to overcome problems associated with siRNA delivery.
  • the Chinese Patent Publication No. CN110699382A discloses a method for preparing siRNA-delivering exosomes, and discloses the technology of separating exosomes from plasma and encapsulating siRNA into exosomes by electroporation .
  • the embodiments of the present application provide an RNA plasmid delivery system for the treatment of pulmonary fibrosis, so as to solve the technical defects existing in the prior art.
  • the present application provides an RNA plasmid delivery system for the treatment of pulmonary fibrosis, the system comprising a plasmid carrying an RNA fragment that can be used for the treatment of pulmonary fibrosis, and the plasmid can be enriched in the organ tissue of a host , and endogenously and spontaneously form a composite structure containing the RNA fragment in the host organ tissue, and the composite structure can deliver the RNA capable of inhibiting pulmonary fibrosis into the lung, so as to realize the treatment of pulmonary fibrosis.
  • the RNA fragments After the RNA fragments are sent into the lungs, they can inhibit the expression of matching genes, thereby inhibiting the development of pulmonary fibrosis and realizing the treatment of pulmonary fibrosis.
  • the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are siRNA, shRNA or miRNA sequences with medical significance that can inhibit or hinder the development of pulmonary fibrosis .
  • Figure 16 shows that when the plasmid delivery system alone carries 6 kinds of RNA sequences, carries RNA fragments composed of any two of them, and carries RNA fragments composed of any three kinds of them, it has in vivo enrichment, self-assembly and lung targeting. Therapeutic effects of fibrosis.
  • the plasmid also includes a promoter and a targeting tag
  • the targeting tag can form the targeting structure of the composite structure in the organ tissue of the host, and the targeting structure is located on the surface of the composite structure, so The complex structure can seek and bind to the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.
  • the plasmid includes any one of the following circuits or a combination of several circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; in each of the plasmids, at least An RNA fragment and a targeting tag are included, the RNA fragment and targeting tag being in the same circuit or in different circuits.
  • Figures 17-19 show that the plasmid delivery system constructed with 1-2 RNA fragments and 1-2 targeting tags has in vivo enrichment, self-assembly and therapeutic effects on pulmonary fibrosis.
  • the plasmid also includes a flanking sequence, a compensation sequence and a loop sequence that can fold the circuit into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence;
  • the plasmid includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag Or 5'-promoter-targeting tag-5'flanking sequence-RNA fragment-loop sequence-compensating sequence-3'flanking sequence.
  • the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence whose homology is greater than 80%;
  • the loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;
  • the 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence whose homology is greater than 80%;
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted.
  • the purpose of deleting bases 1-5 of the reverse complement of the RNA is to make the sequence unexpressed.
  • Figure 20 shows that plasmids containing multiple 5' flanking sequences, loop sequences, and homologous sequences of 3' flanking sequences have in vivo enrichment, self-assembly and therapeutic effects on pulmonary fibrosis.
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted.
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted.
  • the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted.
  • adjacent lines are connected by a sequence composed of sequences 1-3 (sequence 1-sequence 2-sequence 3);
  • sequence 1 is CAGATC
  • sequence 2 is a sequence consisting of 5-80 bases
  • sequence 3 is TGGATC.
  • Figure 21 shows that when the RNA plasmid delivery system carries multiple lines, the connecting sequence between adjacent lines, that is, sequence 2, can be composed of multiple bases, and the plasmid injection at this time also has an enrichment effect.
  • adjacent lines are connected by sequence 4 or a sequence with more than 80% homology to sequence 4;
  • sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
  • Figure 22 shows that when the connecting sequence is sequence 4 or at least three sequences with more than 80% homology to sequence 4, the constructed plasmid delivery system also has in vivo enrichment, self-assembly and pulmonary fibrosis therapeutic effects.
  • the organ tissue is liver
  • the composite structure is exosome
  • the targeting tag is selected from targeting peptides or targeting proteins with targeting function.
  • the targeting peptides include RVG targeting peptides, GE11 targeting peptides, PTP targeting peptides, TCP-1 targeting peptides, and MSP targeting peptides;
  • the targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.
  • the RNA sequence is 15-25 nucleotides in length.
  • the length of the RNA sequence can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides.
  • the RNA sequence is 18-22 nucleotides in length.
  • Figure 23 shows that when the lengths of RNA sequences in the plasmid delivery system are 18, 19, and 21, they all have in vivo enrichment, self-assembly and therapeutic effects on pulmonary fibrosis.
  • the RNA sequence is selected from any one or more of the following: the antisense strand of miRNA-21, the siRNA of the TGF- ⁇ 1 gene, or an RNA sequence with a homology of more than 80% to the above sequence, or encoding the above The nucleic acid molecule of RNA. It should be noted that the RNA sequences in the "nucleic acid molecules encoding the above RNA sequences" here also include RNA sequences with a homology of more than 80% of each RNA.
  • the siRNA of the TGF- ⁇ 1 gene includes ACGGAAAUAACCUAGAUGGGC, UGAACUUGUCAUAGAUUUCGU, UUGAAGAACAUAUAUAUGCUG, UCUAACUACAGUAGUGUUCCC, UCUCAGACUCUGGGGCCUCAG, other sequences that inhibit the expression of the TGF- ⁇ 1 gene, and sequences with more than 80% homology to the above sequences.
  • Fig. 24 shows that the gene circuit includes the antisense strand of miRNA-21 and the above-mentioned five TGF- ⁇ 1 gene siRNAs (siRNA-1, siRNA-2, siRNA-3, siRNA-4, siRNA-5) in the case of , all have in vivo enrichment, self-assembly and pulmonary fibrosis therapeutic effects.
  • the RNA fragment includes an RNA sequence ontology and a modified RNA sequence obtained by modifying the RNA sequence ontology with ribose sugar. That is, the RNA fragment can be composed of only at least one RNA sequence ontology, or only at least one modified RNA sequence, and can also be composed of RNA sequence ontology and modified RNA sequence.
  • the isolated nucleic acid also includes its variants and derivatives.
  • the nucleic acid can be modified by one of ordinary skill in the art using general methods. Modification methods include (but are not limited to): methylation modification, hydrocarbyl modification, glycosylation modification (such as 2-methoxy-glycosyl modification, hydrocarbyl-glycosyl modification, sugar ring modification, etc.), nucleic acid modification, peptide modification Segment modification, lipid modification, halogen modification, nucleic acid modification (such as "TT" modification) and the like.
  • the modification is an internucleotide linkage, for example selected from: phosphorothioate, 2'-O methoxyethyl (MOE), 2'-fluoro, phosphine Acid alkyl esters, phosphorodithioates, alkyl phosphorothioates, phosphoramidates, carbamates, carbonates, phosphoric triesters, acetamidates, carboxymethyl esters, and combinations thereof.
  • phosphorothioate 2'-O methoxyethyl (MOE), 2'-fluoro
  • phosphine Acid alkyl esters phosphorodithioates, alkyl phosphorothioates, phosphoramidates, carbamates, carbonates, phosphoric triesters, acetamidates, carboxymethyl esters, and combinations thereof.
  • the modification is a modification of nucleotides, such as selected from: peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinose-nucleic acid (FANA), analogs, derivatives objects and their combinations.
  • the modification is a 2' fluoropyrimidine modification.
  • 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on RNA with 2'-F.
  • 2'-F can make RNA not easily recognized by RNase in vivo, thereby increasing the stability of RNA fragment transmission in vivo. sex.
  • the delivery system is a delivery system for use in mammals, including humans.
  • the present application also provides the use of the above-mentioned RNA plasmid delivery system for treating pulmonary fibrosis in medicine.
  • the drug is a drug for the treatment of pulmonary fibrosis and its related diseases
  • the related diseases here refer to the associated diseases or complications, sequelae, etc. that occur during the formation or development of the above-mentioned pulmonary fibrosis, or related diseases. Fibrosis is associated with other diseases.
  • the medicine includes the above-mentioned plasmids, specifically, the plasmids here represent plasmids that carry RNA fragments, or carry RNA fragments and targeting tags, and can enter the host body and can be enriched in the liver, self-contained. Assembled to form a composite structure exosome, the composite structure can deliver RNA fragments to the lungs, so that the RNA fragments are expressed in the lungs, thereby inhibiting the expression of matching genes, and achieving the purpose of treating pulmonary fibrosis.
  • the plasmids here represent plasmids that carry RNA fragments, or carry RNA fragments and targeting tags, and can enter the host body and can be enriched in the liver, self-contained. Assembled to form a composite structure exosome, the composite structure can deliver RNA fragments to the lungs, so that the RNA fragments are expressed in the lungs, thereby inhibiting the expression of matching genes, and achieving the purpose of treating pulmonary fibrosis.
  • the dosage forms of the drug can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes and the like.
  • the modes of administration of the drug include oral, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection. Intravenous injection is preferred.
  • RNA delivery system for the treatment of pulmonary fibrosis uses plasmid as a carrier, and the plasmid is used as a mature injectable substance. Its safety and reliability have been fully verified, and the drugability is very good.
  • the final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes.
  • the delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances.
  • RNA delivery system provided in this application can be tightly combined with AGO 2 and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation and maintain its stability in circulation, but also facilitates Receptor cell uptake, intracytoplasmic release and lysosomal escape require low doses.
  • RNA delivery system for the treatment of pulmonary fibrosis provided in this application is applied to medicines, that is, it provides a drug delivery platform, which can greatly improve the therapeutic effect of pulmonary fibrosis, and can also form the research and development of more RNA drugs through this platform. It will greatly promote the development and use of RNA drugs.
  • Fig. 1 is a comparison diagram of plasmid distribution and metabolism in mice provided by an embodiment of the present application
  • Fig. 2 is a comparison diagram of protein expression levels in mice provided by an embodiment of the present application.
  • FIG. 3 is a comparison diagram of related siRNA levels in mice provided by an embodiment of the present application.
  • FIG. 4 is a comparison diagram of absolute siRNA levels in various tissues of mice provided in an embodiment of the present application.
  • Figure 5 is a comparison diagram of the effect of plasmid doses on mouse siRNA levels provided by an embodiment of the present application.
  • Fig. 6 is the metabolic situation comparison diagram of the precursor and the mature body in the mouse liver after injecting the plasmid provided by an embodiment of the present application;
  • FIG. 7 is a comparison diagram of siRNA kinetics and distribution in different tissues of mice provided by an embodiment of the present application.
  • Figure 8 is a comparison diagram of the influence of different promoters on siRNA provided by an embodiment of the present application.
  • FIG. 9 is a comparison diagram of the fluorescence intensity of eGFP in different tissues of mice provided by an embodiment of the present application.
  • Figure 10 is a comparison diagram of mouse alanine aminotransferase, aspartate aminotransferase, total bilirubin, blood urea nitrogen, serum alkaline phosphatase, creatinine content, and thymus gland weight, spleen weight, and peripheral blood cell percentage provided by an embodiment of the present application;
  • FIG. 11 is a comparison diagram of the content of hydroxyproline in mice provided by an embodiment of the present application.
  • Figure 12 is a fluorescent staining diagram of the mouse lung provided by an embodiment of the present application.
  • Figure 13 is a Masson's trichrome staining diagram of the mouse lung provided by an embodiment of the present application.
  • Fig. 14 is the HE staining diagram of mouse lung provided by an embodiment of the present application.
  • FIG. 15 is a comparison diagram of partial protein and mRNA levels of mice provided in an example of the present application.
  • FIG. 16 is a data diagram of the treatment effect of pulmonary fibrosis of the plasmid delivery system containing RNA fragments provided by an embodiment of the present application, and A in the figure is an RNA fragment containing 6 kinds of RNA sequences, any two of the 6 kinds of RNA sequences, and 6 kinds of RNA sequences.
  • a in the figure is an RNA fragment containing 6 kinds of RNA sequences, any two of the 6 kinds of RNA sequences, and 6 kinds of RNA sequences.
  • Fig. 17 is the metabolic distribution result after intravenous injection of CMV-siRNA-1+2 provided in an example of the present application.
  • A is the enrichment effect in the lungs
  • B is the enrichment effect in the blood.
  • Figure 18 shows the metabolic distribution results after intravenous injection of CMV-GE11-siRNA-1+2 and (CMV-GE11-siRNA-1+CMV-GE11-siRNA-2) with targeting tag GE11 provided in an example of the present application
  • a and C are the enrichment effects of CMV-GE11-siRNA-1+2 in the lung and plasma, respectively
  • B and D are the enrichment effects of CMV-GE11-siRNA-1+CMV-GE11-siRNA-2 in the lung, respectively The enrichment effect in parts and plasma.
  • FIG. 19 shows CMV-GE11-siRNA-1, CMV-GE11-siRNA-1+2 and CMV-GE11-siRNA-1+CMV-GE11-siRNA-2 veins with targeting tag GE11 provided in an example of the present application
  • Pulmonary fibrosis treatment effect data chart after injection A and C in the figure are the results of the protein content and mRNA content of TGFb1 of CMV-GE11-siRNA-1 and CMV-GE11-siRNA-1+2, respectively, B and D are respectively The results of protein content and mRNA content of TGFb1 in CMV-GE11-siRNA-1 and CMV-GE11-siRNA-1+CMV-GE11-siRNA-2.
  • Figure 20 is a graph of the enrichment effect (represented as siRNA content) in blood after injection of a plasmid containing sequence fragments containing three different 5' flanking sequences, loop sequences and 3' flanking sequences provided in an example of the present application.
  • FIG. 21 is a graph of the enrichment effect (represented as siRNA content) in blood after injection of the plasmid delivery system containing multiple linker sequences (sequence 2) with different numbers of bases provided in an embodiment of the present application.
  • Fig. 22 is a graph showing the enrichment effect (indicated as siRNA content) in blood after injection of a plasmid delivery system containing multiple linker sequences (sequence 4) with a homology greater than 80% provided by an embodiment of the present application.
  • the abscissa sequence 4-1 is the basic sequence 4, and the sequences 4-2/4-3/4-4 are the homologous sequences with the homology of sequence 4-1 (sequence 4) greater than 80%, respectively.
  • Figure 23 shows the therapeutic effect of pulmonary fibrosis when the RNA sequence lengths in the plasmid delivery system provided in an embodiment of the present application are respectively 18, 19, and 21.
  • A is the result of the mRNA content of TGFb1
  • B is the result of the protein content of TGFb1 .
  • FIG. 24 is the result of the detected hydroxyproline content when the gene circuit provided in an embodiment of the present application includes the antisense strand of miRNA-21 and five TGF- ⁇ 1 gene siRNAs.
  • HE staining Hematoxylin-eosin staining, referred to as HE staining.
  • HE staining is one of the most basic and widely used technical methods in histology and pathology teaching and research.
  • the hematoxylin staining solution is alkaline and can stain the basophilic structure of the tissue (such as ribosome, nucleus and ribonucleic acid in the cytoplasm) into blue-violet; eosin is an acid dye, which can stain the eosinophilic structure of the tissue ( Such as intracellular and intercellular proteins, including Lewy bodies, alcohol bodies, and most of the cytoplasm) stained pink, making the morphology of the entire cell organization clearly visible.
  • the basophilic structure of the tissue such as ribosome, nucleus and ribonucleic acid in the cytoplasm
  • eosin is an acid dye, which can stain the eosinophilic structure of the tissue ( Such as intracellular and intercellular proteins, including Lewy bodies, alcohol bodies, and most of the cytoplasm) stained pink, making the morphology of the entire cell organization clearly visible.
  • HE staining include: sample tissue fixation and sectioning; tissue sample dewaxing; tissue sample hydration; tissue section hematoxylin staining, differentiation and anti-blue; tissue section eosin staining and dehydration; tissue sample section air-drying and sealing; Observe and photograph under the microscope.
  • Masson staining renders collagen fibers blue (stained by aniline blue) or green (stained by bright green) and muscle fibers red (stained by acid fuchsin and Ponceau), which is consistent with the size and organization of the anionic dye molecules of permeability.
  • the fixed tissue is stained sequentially or mixed with a series of anionic water-soluble dyes. It can be found that red blood cells are stained with the smallest molecular anionic dyes, muscle fibers and cytoplasm are stained with medium-sized anionic dyes, and collagen fibers are stained with macromolecular anionic dyes. Dyeing with anionic dyes.
  • red blood cells have the least permeability to anionic dyes, followed by muscle fibers and cytoplasm, and collagen fibers have the largest permeability.
  • Type I and III collagens are green (GBM, TBM, mesangial matrix and renal interstitium are green), and erythropoietin, tubular cytoplasm, and erythrocytes are red.
  • Masson staining The specific steps of Masson staining include:
  • Tissues were fixed in Bouin's solution, rinsed with running water overnight, and embedded in conventional dehydration; sections were deparaffinized to water (deparaffinized in xylene for 10 min ⁇ 3 times, and the liquid was blotted dry with absorbent paper; 100% ethanol 5 min ⁇ 2 times, with water absorption Dry the liquid with paper; 95% ethanol for 5min ⁇ 2 times, blot the liquid with absorbent paper; run water for 2min, blot dry with absorbent paper); Weiger's iron hematoxylin staining for 5-10min; ; Rinse with running water for 3min; Stain with Ponceau red acid fuchsin solution for 8min; Rinse slightly with distilled water; Treat with 1% phosphomolybdic acid aqueous solution for about 5min; Do not wash with water, directly counterstain with aniline blue solution or bright green solution for 5min; Treat with 1% glacial acetic acid 1min; dehydrated in 95% ethanol for 5min ⁇ 2 times,
  • Western Blot (Western Blot) is to transfer the protein to the membrane, and then use the antibody for detection.
  • the corresponding antibody can be used as the primary antibody for detection, and the expression product of the new gene can be detected by the fusion part of the antibody. .
  • Western Blot uses polyacrylamide gel electrophoresis, the detected object is protein, the "probe” is an antibody, and the "color development” is a labeled secondary antibody.
  • the protein sample separated by PAGE is transferred to a solid phase carrier (such as nitrocellulose membrane), and the solid phase carrier adsorbs proteins in the form of non-covalent bonds, and can keep the types of polypeptides separated by electrophoresis and their biological activities unchanged.
  • the protein or polypeptide on the solid phase carrier is used as an antigen, which reacts with the corresponding antibody, and then reacts with the enzyme or isotope-labeled secondary antibody to detect the specific target gene separated by electrophoresis through substrate color development or autoradiography.
  • expressed protein components The steps mainly include: protein extraction, protein quantification, gel preparation and electrophoresis, membrane transfer, immunolabeling and development.
  • Immunohistochemistry using antigen-antibody reaction, that is, the principle of specific binding of antigen and antibody, determines the antigen (polypeptide) in tissue cells by developing the color of the chromogenic reagent (fluorescein, enzyme, metal ion, isotope) labeled antibody through chemical reaction. and protein), the localization, qualitative and relative quantitative research, called immunohistochemistry (immunohistochemistry) or immunocytochemistry (immunocytochem istry).
  • chromogenic reagent fluorescein, enzyme, metal ion, isotope
  • the main steps of immunohistochemistry include: section soaking, overnight drying, xylene dewaxing, gradient alcohol dewaxing (100%, 95%, 90%, 80%, 75%, 70%, 50%, 3min each time) , double-distilled water, dropwise addition of 3% hydrogen peroxide solution to remove catalase, water washing, antigen retrieval, dropwise addition of 5% BSA, blocking for 1 h, dilution of primary antibody, washing with PBS buffer, incubation with secondary antibody, washing with PBS buffer , color developing solution, washing with water, hematoxylin staining, dehydration with gradient ethanol, and sealing with neutral gum.
  • the detection of the siRNA level, the protein content and the mRNA content involved in the present invention is to establish the mouse stem cell in vitro model by injecting the RNA delivery system into the mouse.
  • the expression levels of mRNA and siRNA in cells and tissues were detected by qRT-PCR. Absolute quantification of siRNA was determined by plotting a standard curve using the standards.
  • the internal reference gene is U6snRNA (in tissue) or miR-16 (in serum, exosomes)
  • the gene is GAPDH or 18s RNA.
  • Western blotting was used to detect protein expression levels in cells and tissues, and ImageJ software was used for protein quantitative analysis.
  • This embodiment provides an RNA plasmid delivery system for treating pulmonary fibrosis.
  • the system includes a plasmid carrying an RNA fragment that can be used for treating pulmonary fibrosis, and the plasmid can be enriched in the organ tissue of a host. and endogenously and spontaneously form a complex structure containing the RNA fragment in the host organ tissue, and the complex structure can deliver the RNA capable of inhibiting pulmonary fibrosis into the lung, so as to realize the treatment of pulmonary fibrosis .
  • the plasmid also includes a promoter and a targeting tag.
  • the plasmid includes any one of the following circuits or a combination of several circuits: promoter-RNA sequence, promoter-targeting tag, promoter-RNA sequence-targeting tag, and each of the plasmids includes at least one RNA fragment and a targeting tag, the RNA fragment and targeting tag are located in the same line or in different lines.
  • the plasmid can include only a promoter-RNA sequence-targeting tag, or a combination of a promoter-RNA sequence, a promoter-targeting tag, or a promoter-targeting tag, a promoter- A combination of RNA-seq-targeting tags.
  • Figures 17-19 show the in vivo enrichment, self-assembly and pulmonary fibrosis therapeutic effects of the plasmid delivery system including 1-2 RNA fragments and 1-2 targeting tags, respectively.
  • the plasmid can also include a flanking sequence, a compensation sequence and a loop sequence that can make the circuit fold into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence; the plasmid includes the following Any one line or combination of several lines: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag, 5'-promoting sub-targeting tag-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence.
  • the plasmids containing the sequence fragments of 3 different 5' flanking sequences, loop sequences and 3' flanking sequences also have in vivo enrichment, self-assembly and therapeutic effects on pulmonary fibrosis.
  • the sequences are:
  • flanking sequence-2 CTGGAGGCTTGCTGAAGGCTGTATGCTGTTAACG 5' flanking sequence -3 CTGGAGGCTTGCTGAAGGCTGTATGCTGGCAACG loop-1 GTTTTGGCCACTGACTGAC loop-2 GTTAAGGCCACTGACTGAC loop-3 GAATTGGCCACTGACTGAC 3' flanking sequence -1 CACCGGTCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC 3' flanking sequence-2 CAGGCCTCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC 3' flanking sequence -3 CAGCGCTCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC 3' flanking sequence -3 CAGCGCTCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC
  • the 5' flanking sequence is preferably ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with ggatcctggaggcttgctgaaggctgtatgctgaattc, etc.
  • the loop sequence is preferably gttttggccactgactgac or a sequence with more than 80% homology thereto, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with gttttggccactgactgac, and the like.
  • the 3' flanking sequence is preferably accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, etc.
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted.
  • the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-5 bases therein.
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted.
  • the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-3 bases therein.
  • the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted.
  • the compensation sequence may be the reverse complementary sequence of the RNA sequence by deleting any 1-3 consecutively arranged bases.
  • the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted.
  • the compensation sequence may be the reverse complementary sequence of the 9th position and/or the 10th position in the deletion of the RNA sequence. Deleting bases 9 and 10 works best.
  • flanking sequences are not randomly selected, but are determined based on a large number of theoretical studies and experiments. increase the expression rate of RNA fragments.
  • sequence 1 is preferably CAGATC
  • sequence 2 can be composed of 5-80 bases
  • Sequences of composition such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases
  • Any sequence may be used, preferably a sequence consisting of 10-50 bases, more preferably a sequence consisting of 20-40 bases, and sequence 3 is preferably TGGATC.
  • the connecting sequence between its adjacent lines that is, sequence 2
  • sequence 2 can be composed of multiple bases.
  • the plasmid also has an enrichment effect after injection, as shown in Figure 21.
  • Sequence 2 is specifically shown in Table 3 below.
  • sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
  • the constructed plasmid delivery system also has in vivo enrichment, self-assembly and pulmonary fibrosis therapeutic effects, as shown in Figure 22.
  • sequence 4-1 is the above-mentioned sequence 4
  • sequences 4-2/4-3/4-4 are the homologous sequences with the homology greater than 80% of the sequence 4-1, respectively.
  • Sequence 4-1 CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC Sequence 4-2 CAGATCTGGCCGCACTCGTAGAGGTGAGTCGACCAGTGGATC Sequence 4-3 CAGATCTGGCACCCGTCGAGGTAGTGAGTCGACCAGTGGATC
  • RNA fragments comprise one, two or more specific RNA sequences of medical significance, the RNA sequences can be expressed in the target receptor, and the compensatory sequence cannot be expressed in the target receptor.
  • the RNA sequence can be an siRNA sequence, a shRNA sequence or a miRNA sequence, preferably an siRNA sequence.
  • the length of an RNA sequence is 15-25 nucleotides (nt), preferably 18-22nt, such as 18nt, 19nt, 20nt, 21nt, and 22nt. This range of sequence lengths was not chosen arbitrarily, but was determined through trial and error. A large number of experiments have proved that when the length of the RNA sequence is less than 18nt, especially less than 15nt, the RNA sequence is mostly invalid and will not play a role. The cost of the line is greatly increased, and the effect is not better than the RNA sequence with a length of 18-22nt, and the economic benefit is poor. Therefore, when the length of the RNA sequence is 15-25nt, especially 18-22nt, the cost and the effect can be taken into consideration, and the effect is the best.
  • nt nucleotides
  • Figure 23 shows the in vivo enrichment, self-assembly and therapeutic effects on pulmonary fibrosis when the lengths of RNA sequences in the plasmid delivery system are 18, 19, and 21, respectively.
  • RNA sequence is selected from any one or more of the following: the antisense strand of miRNA-21, the siRNA of the TGF- ⁇ 1 gene, or an RNA sequence with more than 80% homology to the above-mentioned sequence, or a nucleic acid molecule encoding the above-mentioned RNA .
  • the siRNA of the TGF- ⁇ 1 gene includes ACGGAAAUAACCUAGAUGGGC, UGAACUUGUCAUAGAUUUCGU, UUGAAGAACAUAUAUAUGCUG, UCUAACUACAGUAGUGUUCCC, UCUCAGACUCUGGGGCCUCAG, other sequences that inhibit the expression of the TGF- ⁇ 1 gene, and sequences with more than 80% homology to the above sequences.
  • the number of RNA sequences in the RNA fragment is one, two or more.
  • only the antisense strand of miRNA-21 or the siRNA of the TGF- ⁇ 1 gene can be used on the same plasmid vector, or the antisense strand of miRNA-21 and the siRNA of the TGF- ⁇ 1 gene can be used in combination on the same plasmid vector.
  • the gene circuit includes the antisense strand of miRNA-21 and the above-mentioned five TGF- ⁇ 1 gene siRNAs (siRNA-1, siRNA-2, siRNA-3, siRNA-4, siRNA-5), the in vivo The enrichment, self-assembly and pulmonary fibrosis treatment effects are shown in Figure 24.
  • the functional structural region of the plasmid vector can be expressed as: (promoter-siRNA1)-connector sequence-(promoter-siRNA2)-connector sequence- (promoter-targeting tag), or (promoter-targeting tag-siRNA1)-linker-(promoter-targeting tag-siRNA2), or (promoter-siRNA1)-linker-(promoter- Targeting tag-siRNA2) etc.
  • the functional structural region of the plasmid vector can be expressed as: (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-connecting sequence-(5'-promoter - 5' flanking sequence - siRNA2-loop sequence - compensation sequence - 3' flanking sequence) - linking sequence - (5'-promoter-targeting tag), or (5'-promoter-targeting tag-5' flanking sequence-siRNA1-loop sequence-compensation sequence-3' flanking sequence)-linker sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence-compensating sequence-3'flanking sequence), or (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-linking sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence-compensating sequence-3'
  • the above RNA can also be obtained by ribose modification of the RNA sequence (siRNA, shRNA or miRNA) therein, preferably 2' fluoropyrimidine modification.
  • 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on siRNA, shRNA or miRNA with 2'-F.
  • 2'-F can make it difficult for RNase in the human body to recognize siRNA, shRNA or miRNA, so it can Increases the stability of RNA transport in vivo.
  • the liver will phagocytose exogenous plasmids, and up to 99% of the exogenous plasmids will enter the liver. Therefore, when plasmids are used as vectors, they can be enriched in liver tissue without specific design.
  • the plasmid is opened to release RNA molecules (siRNA, shRNA, or miRNA), and liver tissue spontaneously wraps the above RNA molecules into exosomes, and these exosomes become RNA delivery mechanisms.
  • RNA delivery mechanism in order to make the RNA delivery mechanism (exosome) have the ability of "precision guidance”, we design a targeting tag in the plasmid injected into the body, and the targeting tag will also be assembled into exosomes by liver tissue , especially when certain specific targeting tags are selected, the targeting tags can be inserted into the surface of exosomes to become targeting structures that can guide exosomes, which greatly improves the RNA delivery mechanism of the present invention On the one hand, the amount of exogenous plasmids that need to be introduced can be greatly reduced, and on the other hand, the efficiency of potential drug delivery can be greatly improved.
  • the targeting tag is selected from one of the peptides, proteins or antibodies with targeting function.
  • the selection of the targeting tag is a process that requires creative work. On the one hand, it is necessary to select the available targeting tags according to the target tissue. It is ensured that the targeting label can stably appear on the surface of exosomes, so as to achieve the targeting function.
  • Targeting peptides that have been screened so far include but are not limited to RVG targeting peptide (nucleotide sequence shown in SEQ ID No: 1), GE11 targeting peptide (nucleotide sequence shown in SEQ ID No: 2), PTP targeting peptide (nucleotide sequence shown in SEQ ID No: 3), TCP-1 targeting peptide (nucleotide sequence shown in SEQ ID No: 4), MSP targeting peptide (nucleotide sequence shown in SEQ ID No: 4) As shown in SEQ ID No: 5); targeting proteins include but are not limited to RVG-LAMP2B fusion protein (nucleotide sequence as shown in SEQ ID No: 6), GE11-LAMP2B fusion protein (nucleotide sequence as shown in SEQ ID No: 7), PTP-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 8), TCP-1-LAMP2B fusion protein (nucleo
  • RNAs comprise one, two or more specific RNA sequences of medical significance, the RNA sequences can be expressed in the target receptor, and the compensatory sequence cannot be expressed in the target receptor.
  • the plasmid vector can also be composed of multiple plasmids with different structures, one of which contains a promoter promoter and targeting tags, other plasmids contain promoters and RNA fragments. Loading the targeting tag and RNA fragment into different plasmid vectors, and injecting the two plasmid vectors into the body, the targeting effect is no worse than the targeting effect produced by loading the same targeting tag and RNA fragment into one plasmid vector .
  • the plasmid vector containing the RNA sequence can be injected first, and then the plasmid vector containing the targeting tag can be injected after 1-2 hours, so that a better target can be achieved. to the effect.
  • the delivery systems described above can all be used in mammals, including humans.
  • FIG. 1A in order to understand the distribution of plasmids in the body, we carried out a plate test on mice. 720h) sampling, using the plasmid extracted by spectinomycin for transformation, observing the number of clones in liver, plasma, lung, brain, kidney, spleen, the results are shown in Figure 1B, Figure 1C, Figure 1D, it can be seen that the plasmid It is most distributed in the liver of mice, and reaches the peak at about 3 hours after injection, and is basically metabolized at 12 hours after injection.
  • the CMV eGFP siRNA E line co-expressing eGFP protein and EGFR siRNA was injected intravenously into C57BL/6J mice. The results are shown in Figure 2.
  • the eGFP fluorescence in the mouse liver gradually increased over time, reaching a peak at about 12 hours. After 48 hours, it decreased to the background level, and there was no obvious eGFP signal in other tissues.
  • CMV-scrR The control plasmid
  • CMV-siR E the plasmid expressing EGFR siRNA
  • Figure 3A The related siRNA levels in exosomes, the results are shown in Figure 3A, it can be seen that there is siRNA expression in the exosomes of mouse hepatocytes injected with CMV-siRNA.
  • FIG. 4A After intravenous injection of plasmids into mice, the distribution of mature siRNA in different tissues is shown in Figure 4. It can be seen from Figure 4A that the levels of EGFR-siRNA in plasma, exosomes, and exosome-free plasma show time-dependent changes; from Figure 4B, it can be seen that mouse EGFR-siRNAs in the liver, lung, pancreas, and spleen , The accumulation in the kidney is time-dependent.
  • mice were injected with control plasmid (CMV-scrR), 0.05mg/kg CMV-siR E plasmid, 0.5mg/kg CMV-siR E plasmid, 5mg/kg CMV-siR E plasmid, and detected the liver, Absolute siRNA (EGFR siRNA) levels in spleen, heart, lung, kidney, pancreas, brain, skeletal muscle, CD4 + cells, the results are shown in Figure 5A, it can be seen that there is no siRNA expression in the tissues of mice injected with the control plasmid , in each tissue of mice injected with CMV-siR E plasmid, the level of siRNA expression was positively correlated with the concentration of CMV-siR E plasmid.
  • CMV-scrR control plasmid
  • EGFR siRNA Absolute siRNA
  • fluorescence in situ hybridization assay FISH also confirmed that the level of siRNA expression was positively correlated with the concentration of CMV-siR E plasmid, that is, the tissue distribution of EGFR siRNA was dose-dependent.
  • the plasmid After the plasmid enters the body, it will express the precursor (Precursor) and then process it into the mature body (siRNA), so we tested the metabolism of the precursor (Precursor) and the mature body (siRNA) in the liver after the plasmid was injected into mice. , the results are shown in Figure 6. It can be seen that the expression levels of precursor (Precursor) and mature body (siRNA) in the mouse liver reached a peak at the time point of 6 hours after the injection of the plasmid. Metabolism of the precursor (siRNA) was complete, and the metabolism of the precursor (Precursor) in the mouse liver was complete 48 hours after the injection of the plasmid.
  • siRNA with albumin ALB as the promoter siRNA with CMV as the promoter
  • siRNA without any promoter were injected into mice intravenously.
  • the absolute siRNA levels in the mice were detected at 48 h, and the results are shown in Figure 8. It can be seen that the level of siRNA with CMV as the promoter in mice is the highest, that is, the effect of CMV as the promoter is the best.
  • mice were intravenously injected with PBS or 5 mg/kg CMV-siR G or CMV-RVG-siR G plasmid, and treated for 24 hours After the mice were sacrificed, their eGFP fluorescence levels were detected in cryosections.
  • Figure 9A shows a representative fluorescence microscope image, in which green indicates positive eGFP signal, blue indicates DAPI-stained nuclei, scale bar: 100 ⁇ m, CMV is visible - RVG-siR G plasmid has a more obvious inhibitory effect on mouse eGFP; eGFP transgenic mice were intravenously injected with PBS or CMV-scrR or CMV-siR E plasmid, and the mice were sacrificed after 24 hours of treatment, and they were detected in frozen sections.
  • the fluorescence level of eGFP is a bar graph of the fluorescence intensity (Fluorescence intensity) of the mouse heart, lung, kidney, pancreas, brain, and skeletal muscle injected with PBS, CMV- siRE , and CMV-RVG- siRE . It can be seen that, The contrast of fluorescence intensity in liver, spleen, lung and kidney of mice was more obvious.
  • mice injected with PBS, CMV-scrR, and CMV-siR E their alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), blood urea nitrogen (BUN), serum alkaline phosphatase (ALP), creatinine (CREA) content, thymus weight, spleen weight, and percentage of peripheral blood cells were detected.
  • ALT alanine aminotransferase
  • AST aspartate aminotransferase
  • TBIL total bilirubin
  • BUN blood urea nitrogen
  • ALP serum alkaline phosphatase
  • CREA creatinine
  • Figure 10G is a comparison chart of mouse liver, lung, spleen, and kidney tissue
  • Figure 10H -I is a comparison chart of mouse thymus and spleen tissue
  • FIG. 10J is a comparison chart of percentage in peripheral blood cells of mice.
  • mice injected with PBS, CMV- scrR , and CMV-siRE were almost the same.
  • the mice injected with CMV- siRE were similar to those injected with PBS.
  • the liver, lung, spleen, and kidney also had no tissue damage.
  • RNA delivery system uses plasmid as a carrier and plasmid as a mature injection, its safety and reliability have been fully verified, and its druggability is very good.
  • the final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes.
  • the delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances.
  • RNA delivery system provided in this application can be tightly combined with AGO 2 and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation and maintain its stability in circulation, but also facilitates Receptor cell uptake, intracytoplasmic release and lysosomal escape require low doses.
  • the medicament includes a plasmid carrying the RNA fragment to be delivered, the plasmid can be enriched in the organ tissue of the host, and endogenously and spontaneously form the RNA fragment containing the RNA fragment in the organ tissue of the host.
  • a complex structure capable of entering and binding to a target tissue to deliver the RNA fragment into the target tissue.
  • the RNA fragment to be delivered is an RNA fragment having a therapeutic effect on pulmonary fibrosis, and the target tissue is the lungs.
  • the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are siRNA, shRNA or miRNA with medical significance.
  • RNA fragments In the plasmid delivery system, in the case of carrying RNA fragments, it has in vivo enrichment, spontaneous formation of composite structures and therapeutic effects on pulmonary fibrosis. As shown in Figure 16, the grouping of RNA fragments includes but is not limited to:
  • RNA fragment that comprises any 2 kinds of RNA sequences
  • RNA fragment comprising any three kinds of RNA sequences.
  • the plasmid also includes a promoter and a targeting tag
  • the targeting tag can form the targeting structure of the composite structure in the organ tissue of the host, and the targeting structure is located on the surface of the composite structure, so The complex structure can seek and bind to the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.
  • RNA capable of treating pulmonary fibrosis is selected from any one or more of the following RNAs: antisense strand of miRNA-21, siRNA of TGF- ⁇ 1 gene, or nucleic acid molecules encoding the above RNAs.
  • the drug can be administered orally, inhaled, subcutaneously injected, intramuscularly injected or intravenously injected into the human body, it can be delivered to the target tissue through the RNA delivery system described in Example 1 to exert a therapeutic effect.
  • the medicine of this embodiment may also include a pharmaceutically acceptable carrier, which includes but is not limited to diluents, buffers, emulsions, encapsulation agents, excipients, fillers, adhesives, sprays, transdermal absorption Agents, wetting agents, disintegrating agents, absorption enhancers, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorption carriers, etc.
  • a pharmaceutically acceptable carrier includes but is not limited to diluents, buffers, emulsions, encapsulation agents, excipients, fillers, adhesives, sprays, transdermal absorption Agents, wetting agents, disintegrating agents, absorption enhancers, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorption carriers, etc.
  • the dosage forms of the medicine provided in this embodiment can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, and the like.
  • the drug can also be used in combination with other drugs for the treatment of pulmonary fibrosis to improve the therapeutic effect, such as: glucocorticoids, immunosuppressants, anticoagulants, etc.
  • the medicine provided in this example uses the plasmid as the carrier and the plasmid as the mature injection, and its safety and reliability have been fully verified, and the drugability is very good.
  • the final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes.
  • the drug can deliver various kinds of small molecule RNAs and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances.
  • the drug provided in this application can be closely combined with AGO 2 and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation and maintain its stability in circulation, but also benefit the receptor.
  • Cellular uptake, intracytoplasmic release and lysosomal escape require low doses.
  • this embodiment provides the application of the RNA plasmid delivery system for treating pulmonary fibrosis in medicine, and the medicine is a medicine for treating pulmonary fibrosis.
  • This example specifically illustrates the application of the RNA delivery system in the treatment of pulmonary fibrosis with the following experiments.
  • the experimental groups were Anti-miR-21(1mg/kg) group, Anti-miR-21(5mg/kg) group, Anti-miR-21(10mg/kg) group, TGF- ⁇ 1siRNA(1mg/kg) group, TGF- ⁇ 1siRNA (5mg/kg) group, TGF- ⁇ 1siRNA (10mg/kg) group, Anti-miR-21+TGF- ⁇ 1siRNA (10mg/kg) group, Pirfenidone (300mg/kg) group, the control group was Normal group , PBS group, scrRNA group.
  • Anti-miR-21 (1mg/kg) group, Anti-miR-21 (5mg/kg) group and Anti-miR-21 (10mg/kg) group were injected into the tail vein of mice with pulmonary fibrosis respectively 1mg/kg, 5mg/kg, 10mg/kg of miR-21siRNA plasmid, TGF- ⁇ 1siRNA (1mg/kg) group, TGF- ⁇ 1siRNA (5mg/kg) group, TGF- ⁇ 1siRNA (10mg/kg) group were given to patients with Mice with pulmonary fibrosis were injected with 1 mg/kg, 5 mg/kg, 10 mg/kg of TGF- ⁇ 1 siRNA plasmid, Anti-miR-21+TGF- ⁇ 1 siRNA (10 mg/kg) group was injected into mice with pulmonary fibrosis 10mg/kg Anti-miR-21 and TGF- ⁇ 1 siRNA plasmids were injected into the tail vein, Pirfenidone (300
  • mice in each group were detected respectively, and the results are shown in Figure 11 .
  • Hydroxyproline is the main component of collagen, and its content reflects the degree of pulmonary fibrosis.
  • TGF- ⁇ 1siRNA (10mg/kg) group and Anti-miR-21+TGF- ⁇ 1siRNA (10mg/kg) group had relatively lower hydroxyproline content, and their pulmonary fibrosis was inhibited.
  • H&E staining was performed on the lungs of mice in each group, and the results are shown in Figure 14. It can be seen that the alveolar space of the mice in the PBS group and the scrRNA group was widened, the inflammatory cells were infiltrated, and the alveolar structure was damaged, while the lung tissue in the experimental group was relatively normal.
  • TGF- ⁇ 1siRNA (1mg/kg) group TGF- ⁇ 1siRNA (5mg/kg) group
  • TGF- ⁇ 1siRNA (10mg/kg) group TGF- ⁇ 1siRNA (10mg/kg) group
  • Pirfenidone (300mg/kg) group were detected by western blot.
  • TGF- ⁇ 1 protein level and TGF- ⁇ 1 mRNA level of mice in the group the results are shown in Figure 15A- Figure 15C, it can be seen that the TGF- ⁇ 1 siRNA (10 mg/kg) group of mice has the lowest TGF- ⁇ 1 protein level and TGF- ⁇ 1 mRNA level. This indicated that TGF- ⁇ 1 could be successfully delivered to the lungs to function after the corresponding siRNA expression plasmid was injected into the tail vein.
  • mice in the Normal group, PBS group, scrRNA group, Anti-miR-21 (1mg/kg) group, Anti-miR-21 (5mg/kg) group and Anti-miR-21 (10mg/kg) group were detected respectively.
  • miR-21 level the results are shown in Figure 15D, it can be seen that the anti-miR-21 (10 mg/kg) group has the highest relative miR-21 level. This indicated that the antisense strand of miR-21 could be successfully delivered to the lungs to function after the corresponding antisense strand expression plasmid was injected into the tail vein.
  • liver-affinity plasmids to encapsulate the CMV-siR miR-21 , CMV-siR TGF- ⁇ 1 , CMV-siR miR-21+TGF- ⁇ 1 circuits can significantly alleviate the degree of pulmonary fibrosis, and has great potential for patent medicine. potential, and clinical research value.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Botany (AREA)
  • Virology (AREA)
  • Pulmonology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un système d'administration de plasmide d'ARN pour le traitement de la fibrose pulmonaire. Le système comprend un plasmide. Le plasmide porte un fragment d'ARN pouvant être utilisé pour traiter la fibrose pulmonaire. Le plasmide peut être enrichi dans un organe et un tissu d'un hôte, et forme de manière endogène et spontanée une structure composite contenant le fragment d'ARN dans l'organe et le tissu de l'hôte. La structure composite peut administrer l'ARN capable d'inhiber la fibrose pulmonaire dans les poumons pour obtenir le traitement de la fibrose pulmonaire.
PCT/CN2022/083797 2021-03-30 2022-03-29 Système d'administration de plasmide d'arn pour le traitement de la fibrose pulmonaire WO2022206778A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202110336987.4 2021-03-30
CN202110336987 2021-03-30

Publications (1)

Publication Number Publication Date
WO2022206778A1 true WO2022206778A1 (fr) 2022-10-06

Family

ID=83406330

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/083797 WO2022206778A1 (fr) 2021-03-30 2022-03-29 Système d'administration de plasmide d'arn pour le traitement de la fibrose pulmonaire

Country Status (2)

Country Link
CN (1) CN115137743A (fr)
WO (1) WO2022206778A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109893657A (zh) * 2019-02-28 2019-06-18 中国人民解放军军事科学院军事医学研究院 基因递送载体、药物复合物、抗肺纤维化药物及应用
CN110885789A (zh) * 2018-09-05 2020-03-17 中国科学院生物物理研究所 高效可控包装內源核酸的工程化外泌体制备及其应用
WO2021041473A1 (fr) * 2019-08-27 2021-03-04 The Trustees Of Columbia University In The City Of New York Exosomes modifiés pour une administration ciblée

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110885789A (zh) * 2018-09-05 2020-03-17 中国科学院生物物理研究所 高效可控包装內源核酸的工程化外泌体制备及其应用
CN109893657A (zh) * 2019-02-28 2019-06-18 中国人民解放军军事科学院军事医学研究院 基因递送载体、药物复合物、抗肺纤维化药物及应用
WO2021041473A1 (fr) * 2019-08-27 2021-03-04 The Trustees Of Columbia University In The City Of New York Exosomes modifiés pour une administration ciblée

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FU ZHENG; ZHANG XIANG; ZHOU XINYAN; UR-REHMAN UZAIR; YU MENGCHAO; LIANG HONGWEI; GUO HONGYUAN; GUO XU; KONG YAN; SU YUANYUAN; YE Y: "In vivo self-assembled small RNAs as a new generation of RNAi therapeutics", CELL RESEARCH, SPRINGER SINGAPORE, SINGAPORE, vol. 31, no. 6, 29 March 2021 (2021-03-29), Singapore , pages 631 - 648, XP037469825, ISSN: 1001-0602, DOI: 10.1038/s41422-021-00491-z *
SUN WU ·, FENG-JUAN CAO, NAN WANG, YU ZHOU, YI BA, ZHANG CHEN-YU: "Exosome-Mediated Small ＲNA Delivery For Gene Therapy ", PROGRESS IN PHYSIOLOGICAL SCIENCES, XX, CN, vol. 47, no. 3, 25 June 2016 (2016-06-25), CN , pages 162 - 167, XP055971739, ISSN: 0559-7765 *

Also Published As

Publication number Publication date
CN115137743A (zh) 2022-10-04

Similar Documents

Publication Publication Date Title
AU2014351482B2 (en) C/EBP alpha short activating RNA compositions and methods of use
WO2022206734A1 (fr) Circuit génétique, système d'administration d'arn et son utilisation
WO2018193902A1 (fr) Procédé d'activité antivirale contre le virus de l'hépatite b au moyen de micro-arn
US20240141380A1 (en) Viral vector-based rna delivery system and use thereof
US20240141344A1 (en) Rna plasmid delivery system and application thereof
WO2022206778A1 (fr) Système d'administration de plasmide d'arn pour le traitement de la fibrose pulmonaire
WO2022206779A1 (fr) Système d'administration d'arn pour le traitement de l'obésité
WO2022206816A1 (fr) Système d'administration de plasmide d'arn pour le traitement de la maladie de parkinson
WO2022206805A1 (fr) Système d'administration de plasmide d'arn pour le traitement du cancer pulmonaire
WO2022206802A1 (fr) Système d'administration de plasmide d'arn pour le traitement du glioblastome
WO2022206784A1 (fr) Système d'administration d'arn pour le traitement de la fibrose pulmonaire
WO2022206821A1 (fr) Système d'administration d'arn pour le traitement de la maladie de parkinson
WO2022206812A1 (fr) Système d'administration d'arn pour le traitement du cancer
EP4317434A1 (fr) Système d'administration d'arn pour le traitement de la maladie de huntington
WO2022206781A1 (fr) Système d'administration d'arn pour le traitement de la colite
WO2022206809A1 (fr) Système d'administration d'arn pour le traitement du cancer pulmonaire
WO2022206788A1 (fr) Système d'administration d'acide nucléique et son application
JP2023015297A (ja) Ｃ／ＥＢＰα小分子活性化ＲＮＡ組成物
WO2012155328A1 (fr) Composition comprenant de l'endostatine et des molécules d'arni et utilisation associée

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22778960

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22778960

Country of ref document: EP

Kind code of ref document: A1