WO2022181858A1 - 분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도 - Google Patents

분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도 Download PDF

Info

Publication number
WO2022181858A1
WO2022181858A1 PCT/KR2021/002492 KR2021002492W WO2022181858A1 WO 2022181858 A1 WO2022181858 A1 WO 2022181858A1 KR 2021002492 W KR2021002492 W KR 2021002492W WO 2022181858 A1 WO2022181858 A1 WO 2022181858A1
Authority
WO
WIPO (PCT)
Prior art keywords
adapter
sequence
nucleic acid
barcode
dna fragment
Prior art date
Application number
PCT/KR2021/002492
Other languages
English (en)
French (fr)
Inventor
박동현
정종석
신승호
김솔이
임혜연
박형빈
Original Assignee
지니너스 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 지니너스 주식회사 filed Critical 지니너스 주식회사
Priority to PCT/KR2021/002492 priority Critical patent/WO2022181858A1/ko
Publication of WO2022181858A1 publication Critical patent/WO2022181858A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C12Q1/6855—Ligating adaptors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing

Definitions

  • compositions and uses thereof for improving molecular barcoding efficiency.
  • DNA sequence genes Various biometric information is expressed as DNA sequence genes, and complete DNA sequence information of an individual is very important for understanding life phenomena and obtaining disease-related information.
  • the key to deciphering DNA sequence information that is, genome sequencing, is to identify individual differences and ethnic characteristics, identify congenital causes including chromosomal abnormalities in diseases related to genetic abnormalities, and find genetic defects in complex diseases such as diabetes and hypertension. it is for
  • sequencing data is very important because information such as gene expression, gene diversity, and their interactions can be widely used in molecular diagnosis and treatment fields.
  • next-generation sequencing As a method for genome sequencing, Next Generation Sequencing (NGS) has been applied since 2007, and with the development of such NGS, analysis can be performed much easier and at low cost compared to traditional methods.
  • Representative examples of next-generation genome sequencers that implement next-generation sequencing methods include Roche/454, Illumina/Solexa, and SOLiD from Life Technologies (ABI). These next-generation sequencing devices can read more than 80 million sequences in 7 hours. With the development of this technology, the next-generation sequencing method, which was previously used only for research due to the enormous cost of testing, can be utilized in clinical clinical tests for medical use.
  • One aspect is to provide a method for preparing a DNA library for nucleic acid sequence analysis.
  • Another aspect is to provide a molecular barcoding method for nucleic acid sequence analysis.
  • Another aspect is to provide a composition for preparing a DNA library for nucleic acid sequence analysis.
  • One aspect is to ligate an adapter comprising a barcode sequence to both ends of the DNA fragment extracted and fragmented from the target sample; separating the ligated DNA fragment into single strands; and amplifying the single-stranded DNA fragment ligated with the adapter through a polymerase chain reaction using a primer recognizing the adapter, wherein the barcode sequence comprises: It provides a method for preparing a DNA library for nucleic acid sequencing, which has a length of 1 nt to 10 nt and is arranged to include the first nucleotide position in the adapter based on the terminal region of the adapter ligated with the DNA fragment.
  • another aspect is a molecular barcoding method for nucleic acid sequence analysis, comprising ligating an adapter comprising a barcode sequence to both ends of the DNA fragment extracted and fragmented from the target sample, wherein the barcode sequence is It provides a molecular barcoding method for nucleic acid sequencing, which has a length of 1 nt to 10 nt and is arranged to include the first nucleotide position in the adapter with respect to the terminal region of the adapter ligated with the DNA fragment.
  • DNA library refers to a product of DNA sample processing as a result of pretreatment for nucleic acid sequence analysis on a target sample.
  • the DNA library is prepared by ligating adapter oligonucleotides to both ends of the DNA fragment, and an amplified product thereof may also be included.
  • the DNA library may be prepared by, for example, 1) randomly cutting a DNA sample to obtain DNA fragments (DNA fragmentation); 2) reinforcing both ends of the two single-stranded DNAs to form a blunt end structure (end repair); 3) forming an overhang structure by conjugating adenine to the 3' end of the double-stranded DNA (adenine conjugation); 4) ligating the adenine-conjugated adapter to the double-stranded DNA end (adapter attachment); 5) separating the double-stranded DNA linked by an adapter into a single strand using a specific enzyme (single-strand separation); and 6) amplifying the DNA fragment attached to the adapter sequence through a polymerase chain reaction (PCR) (PCR amplification).
  • the DNA library can be interpreted as including not only the final product, but also the intermediate products in each of the above-mentioned steps.
  • T4 DNA ligase T7 DNA ligase, or a ligase capable of temperature cycling may be used, or the PCR amplification step is performed 4 to 12 times.
  • 4 to 10 times, 4 to 8 times, 4 to 6 times, 6 to 12 times, 6 to 10 times, 6 to 8 times, 8 to 12 times, 8 to 10 times, or 10 to 12 cycles may be performed, and other techniques widely used in the art may be used to analyze the nucleic acid sequence according to an embodiment.
  • the term "molecular barcode” refers to a nucleotide sequence unique to each DNA fragment present in the target sample, and enables discrimination of the DNA fragments present in the target sample.
  • an adapter having an incorrect barcode sequence or a unique identifier (UID) acts as a primer in a subsequent PCR reaction, an incorrect PCR copy is generated (molecular barcode replacement phenomenon).
  • UID unique identifier
  • the present inventors based on the end region of the adapter ligated with the DNA fragment, a barcode sequence arranged to include the first nucleotide position in the adapter, and aligning a specific base at a specific position in the end region. , it was confirmed that the above-mentioned conventional problems can be overcome, and based on this, the present invention was completed.
  • target sample may be derived from an individual or cell.
  • the subject may be a mammal, including humans, cattle, horses, pigs, sheep, goats, dogs, cats, and rodents.
  • the cell may be a cell or cell line derived from an individual.
  • the target sample may be a biological sample.
  • the biological sample may be obtained from, for example, blood, plasma, serum, urine, saliva, mucous membrane, secretion, sputum, feces, tears, or a combination thereof.
  • the biological sample may be a sample of eukaryotic cells, prokaryotic cells, viruses, bacteriophages, etc. derived from various species.
  • nucleic acid sequencing analysis may be next generation sequencing (NGS).
  • NGS next generation sequencing
  • Nucleic acid sequencing may be used interchangeably with base sequencing, sequencing, or sequencing.
  • the NGS may be used interchangeably with massive parallel sequencing or second-generation sequencing.
  • the NGS is a technique for simultaneous sequencing of nucleic acids of large fragments, fragmenting the entire genome in a chip-based and polymerase chain reaction (PCR)-based paired end format. , it may be to perform sequencing at high speed based on hybridization of the fragment.
  • PCR polymerase chain reaction
  • the NGS is, for example, 454 platform (Roche), GS FLX titanium, Illumina MiSeq, Illumina HiSeq, Illumina HiSeq 2500, Illumina Genome Analyzer, Solexa platform, SOLiD System (Applied Biosystems), Ion Proton (Life Technologies), Complete Genomics , Helicos Biosciences Heliscope, Pacific Biosciences' single molecule real-time (SMRTTM) technology, or a combination thereof.
  • the nucleic acid sequencing may be a nucleic acid sequencing method for analyzing only a region of interest.
  • the nucleic acid sequencing may include, for example, NGS-based targeted sequencing, targeted deep sequencing, or panel sequencing.
  • the nucleic acid may be a genome or a fragment thereof.
  • the term "genome” is a generic term for the whole of chromosomes, chromatin, or genes.
  • the genome or fragment thereof may be isolated DNA.
  • the method for extracting or isolating the nucleic acid from the cell may be performed by a method known to those skilled in the art.
  • fragment means physically, chemically, or enzymatically cleaving a genome, and may be to generate reads having various lengths through the above process.
  • the term "read” refers to sequence information of one or more nucleic acid fragments generated in nucleic acid sequencing, wherein the read is from about 10 bp to about 2000 bp, for example, from about 15 bp to about 1500 bp, It may be about 20 bp to about 1000 bp, about 20 bp to about 500 bp, about 20 bp to about 200 bp, about 20 bp to about 100 bp, but is not limited thereto.
  • the barcode sequence has a length of 1 nt to 10 nt, and is arranged to include the first nucleotide position in the adapter based on the terminal region of the adapter to be ligated with the DNA fragment. it could be
  • the term “adapter” refers to an oligonucleotide including a barcode sequence for distinguishing a plurality of DNA fragments, and may be in a Y-shaped (Forked) or U-shaped (Hairpin) form. have.
  • the adapter may be one in which the U-shaped adapter has a Y-shaped end using an enzyme such as uracil-specific excision reagent (USER), but is not limited thereto.
  • the 3' end of the double-stranded DNA fragment has an overhang structure by adenine conjugation.
  • the adapter not only consists of a double-stranded but also 3' of the adapter. Thymine may be conjugated to the terminal.
  • the length of the adapter sequence is 40nt to 100nt, 40nt to 90nt, 40nt to 80nt, 40nt to 70nt, 40nt to 60nt, 40nt to 50nt, 50nt to 100nt, 50nt to 90nt, 50nt to 80nt, 50nt to 70nt, 50nt to 60nt, 60nt to 100nt, 60nt to 90nt, 60nt to 80nt, 60nt to 70nt, 70nt to 100nt, 70nt to 90nt, 70nt to 80nt, 80nt to 100nt, or 80nt to 90nt, but is not limited thereto.
  • barcode can be used interchangeably with “index” or “unique identifier (UID)", and 1nt to for distinguishing a plurality of DNA fragments refers to an oligonucleotide of 10 nt in length.
  • the barcode sequence is included in the adapter, and thus may refer to a pair or a combination that forms a complementary bond.
  • the length of the barcode sequence is 1nt to 10nt, 1nt to 8nt, 1nt to 6nt, 1nt to 4nt, 1nt to 2nt, 3nt to 10nt, 3nt to 8nt, 3nt to 6nt, 1nt to 4nt, 5nt to 10nt, 5nt to 8nt, 5nt to 6nt, 7nt to 10nt, or 7nt to 8nt, but is not limited thereto.
  • the barcode sequence may be arranged to include the first nucleotide position in the adapter with respect to the terminal region of the adapter to be ligated with the DNA fragment.
  • the first nucleotide in the terminal region of the adapter is the most terminal nucleotide present at the position ligated with the DNA fragment, 1) adjacent to adenine present at the 3' end of the target DNA fragment, at the 5' end of the adapter sequence Nucleotide, 2) It may refer to a nucleotide of the adapter sequence adjacent (linked) to thymine at the 3' end of the adapter sequence, including a nucleotide sequence (thymine) complementary to adenine present at the 3' end of the DNA fragment.
  • the method targets a plurality of DNA fragments and includes a plurality of adapters, and thus, the adapters may include different barcode sequences depending on the type of DNA fragment.
  • the barcode sequence may be any one of A, T, C, and G as the first sequence in the adapter based on the terminal region of the adapter ligated with the DNA fragment, or the barcode sequence is 2nt to 10nt
  • the second sequence in the adapter may be any one of C and G based on the terminal region of the adapter ligated with the DNA fragment.
  • the first sequence in the adapter is fixed to any one of A, T, C, and G
  • the adapter My second sequence may be fixed to either C or G.
  • the barcode sequence having the above-mentioned arrangement and the adapter sequence including the same are DNA polymerase I when the adapter containing the wrong barcode sequence acts as a primer in the PCR amplification process.
  • the Proofreding process (3' ⁇ 5' Exonuclease activity)
  • Another aspect is a plurality of adapters having a length of 40 to 100 nt including a barcode sequence and a complementary sequence to a primer for polymerase chain reaction, wherein each of the plurality of adapters includes a different barcode sequence depending on the type of DNA fragment and the barcode sequence has a length of 1 nt to 10 nt, and is arranged to include the first nucleotide position in the adapter, based on the terminal region of the adapter ligated with the DNA fragment.
  • Composition for preparing a DNA library for nucleic acid sequence analysis provides
  • composition for preparing a DNA library for nucleic acid sequence analysis includes or uses the technical configuration used in the method for preparing the above-described DNA library or molecular barcoding method as it is, description of common content between the two will be omitted. .
  • composition for preparing a DNA library may be used interchangeably with a kit for preparing a DNA library or an adapter composition for preparing a DNA library.
  • the composition is for nucleic acid sequence analysis, and may target a plurality of DNA fragments. Accordingly, the composition includes a plurality of adapters, and accordingly, the adapter may include different barcode sequences depending on the type of DNA fragment.
  • the adapter may include a sequence complementary to a primer for polymerase chain reaction and a barcode sequence.
  • the sequence complementary to the primer is for initiating or performing a PCR amplification process, and a known or arbitrary primer and a sequence complementary thereto may be applied without limitation.
  • the barcode sequence may be arranged to include the first nucleotide position in the adapter with respect to the terminal region of the adapter ligated with the DNA fragment.
  • the first sequence in the adapter may be any one of A, T, C, and G, or the barcode sequence is 2nt to 2nt based on the terminal region of the adapter ligated with the DNA fragment.
  • the second sequence in the adapter may be either C or G based on the terminal region of the adapter ligated with the DNA fragment.
  • the first sequence in the adapter is fixed to any one of A, T, C, and G, and the adapter My second sequence may be fixed to either C or G.
  • a barcode sequence having a conventional arrangement or an adapter sequence comprising the same exhibited a molecular barcode replacement rate of about 6% to 50%, whereas the adapter sequence according to an embodiment has a molecular barcode replacement rate of less than 1%.
  • the error rate indicates an error rate
  • the sensitivity and specificity of mutation detection can be increased during the genetic mutation detection process, thereby greatly improving the accuracy of the treatment and diagnosis fields based on genome sequencing.
  • 1 is a diagram schematically showing the problems of the conventional molecular bar coding technology.
  • FIG. 2 is a diagram schematically showing an experimental process for inducing a molecular barcode replacement phenomenon and a result thereof.
  • FIG. 4 is a diagram schematically illustrating a series of processes for reducing molecular barcoding replacement in an adapter according to an embodiment and a PCR amplification process using the same.
  • FIG. 5 is a diagram schematically illustrating an experimental procedure for evaluating the level of molecular barcoding replacement in the PCR amplification process using an adapter in which a barcode sequence is fixed to an adapter terminal region according to an embodiment.
  • FIG. 6 is a result of confirming the molecular barcode replacement level in the PCR amplification process using an adapter in which the position of the barcode sequence is fixed to the adapter end region according to one embodiment.
  • FIG. 7 shows the results of confirming the molecular barcode replacement level when a specific position in the barcode sequence is fixed with adenine (A) in the PCR amplification process using an adapter in which the position of the barcode sequence is fixed to the adapter end region according to one embodiment; to be.
  • FIG. 11 is a diagram illustrating a case in which a specific position and a nucleotide sequence in a barcode sequence are fixed in a PCR amplification process using an adapter in which the position of the barcode sequence is fixed to the adapter end region according to an embodiment, according to the specific position and the fixed nucleotide sequence The level of molecular barcode replacement was confirmed.
  • an adapter containing an erroneous barcode sequence acts as a primer in a subsequent PCR reaction to generate an erroneous PCR copy, resulting in detection sensitivity and a bar that reduces specificity (molecular barcode replacement phenomenon), a situation in which technical limitations exist.
  • a nucleotide sequence into which an artificial mutation sequence is introduced in the target sequence was additionally synthesized, and in this example, it was synthesized by specific sequence synthesis. It was referred to as a fragment or spike-in fragment.
  • FIG. 2B a series of experiments including a PCR amplification process to which 50 ng of Input DNA, 1.8x SPRI ligation followed by purification conditions were applied, were performed, and through this, the spike among the entire amplified fragments The ratio of -in intercepts was calculated. Specifically, the ratio of the spike-in fragments was compared according to the number of purifications (one or two) and the concentration of the adapter (50 ng, or 5 ng).
  • 3 is a graph showing the replacement ratio of molecular barcodes according to the number of purifications and the concentration of adapters in the PCR amplification process to which the conventional molecular barcode technology is applied.
  • the spike-in fragment occupied about 6% to 50% of the total molecular barcode according to the experimental conditions, and in particular, as the number of purification decreased, and/or the barcode sequence was included.
  • the concentration of adapters increased, the ratio of spike-in fragments showed a tendency to increase.
  • the adapter was designed so that the barcode sequence is located in the terminal region of the adapter, where ligation with the DNA fragment is performed, and more specifically, the DNA fragment and ligation proceed.
  • end point 1 EP1
  • the 2nd, 3rd, 5th, or 10th position relative to the EP1 is set to EP2, EP3, EP5, or EP10, respectively, and then these regions are set to A , T, G or C fixed adapters were prepared.
  • specific sequence synthesis fragments or spike-in adapters were synthesized in which the corresponding sequence at a fixed position in the barcode sequence was changed (replaced) with another base. Then, as shown in FIG.
  • Molecular barcode replacement rate (%) Amount of DNA fragments immobilized on Spike-in adapters/Amount of DNA fragments immobilized on ligated adapters
  • FIG. 6 is a result of confirming the molecular barcode replacement level in the PCR amplification process using an adapter in which the position of the barcode sequence is fixed to the adapter end region according to one embodiment.
  • Table 2 and FIGS. 7 to 11 show that, in the PCR amplification process using an adapter in which the position of the barcode sequence is fixed to the adapter end region, a specific position in the barcode sequence and a specific position when the nucleotide sequence thereof is fixed, according to an embodiment. and the level of molecular barcode replacement according to the fixed base sequence.
  • the peak for A is indicated by a thick solid line
  • the peak for G is indicated by a solid line
  • the peak for T is indicated by a dotted chain line
  • the peak for C is indicated by a dotted line.
  • the peak for A is indicated by a thick solid line
  • the peak for G is indicated by a solid line
  • the peak for T is indicated by a dotted chain line
  • the peak for C is indicated by a dotted line.
  • nucleotide type detection sheep pitch ligation adpater spike-in adapter ligation adpater A
  • spike-in adapter B
  • Replacement rate %) (B/A*100) Average replacement rate (%)
  • the EP1 region was fixed to A, C, G, or T, respectively, and the EP2 region was set to C or G to synthesize and prepare a designed barcode sequence and an adapter sequence including the same. After performing , the ratio of adapters in which the barcode sequence did not change, that is, the ratio in which molecular barcode replacement did not occur, was calculated.
  • Table 3 shows the results when the EP1 position in the barcode sequence was fixed with adenine (A).
  • EP2 EP1 A (%) Read Pos 1 Read Pos 2 control Index 1 C A 99.62% Index 2 G A Spike-in 1 - - Spike-in 2 - - One Index 1 C A 99.53% Index 2 G A Spike-in 1 C C Spike-in 2 G C 2 Index 1 C A 99.44% Index 2 G A Spike-in 1 C T Spike-in 2 G T 3 Index 1 C A 98.28% Index 2 G A Spike-in 1 C G Spike-in 2 G G G
  • Table 4 shows the results when the EP1 position in the barcode sequence was fixed with cytosine (C).
  • EP2 EP1 C (%) Read Pos 1 Read Pos 2 control Index 1 C C 99.68% Index 2 G C Spike-in 1 - - Spike-in 2 - - One Index 1 C C 99.14% Index 2 G C Spike-in 1 C T Spike-in 2 G T 2 Index 1 C C 99.57% Index 2 G C Spike-in 1 C G Spike-in 2 G G 3 Index 1 C C 99.66% Index 2 G C Spike-in 1 C A Spike-in 2 G A
  • Table 5 shows the results when the EP1 region in the barcode sequence was fixed with guanine (G).
  • EP2 EP1 G (%) Read Pos 1 Read Pos 2 control Index 1 C G 99.64% Index 2 G G Spike-in 1 - - Spike-in 2 - - One Index 1 C G 99.67% Index 2 G G Spike-in 1 C C Spike-in 2 G C 2 Index 1 C G 99.53% Index 2 G G Spike-in 1 C T Spike-in 2 G T 3 Index 1 C G 99.50% Index 2 G G Spike-in 1 C A Spike-in 2 G A
  • Table 6 shows the results when the EP1 position in the barcode sequence was fixed with thymine (T).
  • FIG. 12 is a view illustrating the molecular barcoding replacement level according to the fixation of the first base sequence at the end of the adapter in the PCR amplification process using an adapter in which the position of the barcode sequence is fixed to the adapter end region according to one embodiment.
  • the barcode replacement rate that is, the error rate
  • a barcode sequence designed by fixing the EP2 region to A, C, G, or T, respectively, and setting the EP1 region to C, T, G, or A, and an adapter sequence including the same were synthesized and prepared, in Example 2 After performing the experiment in the same procedure as described above, the ratio of adapters in which the barcode sequence did not change and the ratio in which molecular barcode replacement did not occur were calculated.
  • Tables 7 and 8 show the results when the EP2 position in the barcode sequence was fixed with cytosine (C).
  • EP2 EP1 C (%) Read Pos 1 Read Pos 2 control Index 1 C C 99.787% Index 2 C T Index 3 C G Index 4 C A Spike-in 1 - - Spike-in 2 - - Spike-in 3 - - Spike-in 4 - - One Index 1 C C 99.044% Index 2 C T Index 3 C G Index 4 C A Spike-in 1 G C Spike-in 2 G T Spike-in 3 G G Spike-in 4 G A
  • EP2 EP1 C (%) Read Pos 1 Read Pos 2 control Index 1 C C 99.167% Index 2 C T Index 3 C G Index 4 C A Spike-in 1 - - Spike-in 2 - - Spike-in 3 - - Spike-in 4 - - One Index 1 C C 98.963% Index 2 C T Index 3 C G Index 4 C A Spike-in 1 G C Spike-in 2 G T Spike-in 3 G G Spike-in 4 G A
  • Tables 9 and 10 show the results when the EP2 position in the barcode sequence was fixed with guanine (G).
  • EP2 EP1 G (%) Read Pos 1 Read Pos 2 control Index 1 G C 99.262% Index 2 G T Index 3 G G Index 4 G A Spike-in 1 - - Spike-in 2 - - Spike-in 3 - - Spike-in 4 - - One Index 1 G C 99.234% Index 2 G T Index 3 G G Index 4 G A Spike-in 1 C C Spike-in 2 C T Spike-in 3 C G Spike-in 4 C A
  • EP2 EP1 G (%) Read Pos 1 Read Pos 2 control Index 1 G C 99.311% Index 2 G T Index 3 G G Index 4 G A Spike-in 1 - - Spike-in 2 - - Spike-in 3 - - Spike-in 4 - - One Index 1 G C 99.259% Index 2 G T Index 3 G G Index 4 G A Spike-in 1 C C Spike-in 2 C T Spike-in 3 C G Spike-in 4 C A
  • FIG. 13 is a view showing the molecular barcoding replacement level according to the fixation of the second base sequence at the end of the adapter in the PCR amplification process using the adapter in which the position of the barcode sequence is fixed to the adapter end region according to an embodiment.
  • the molecular barcode replacement rate that is, the error rate
  • the experimental results show that the adapter including the barcode sequence according to an embodiment can reduce molecular barcodes, and specifically, contribute to improving the sensitivity and specificity of mutation detection in the process of detecting genetic mutations through nucleotide sequence analysis. This indicates that it can be widely used in the field of diagnosis/treatment technology based on precision medicine.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도에 관한 것으로서, DNA 라이브러리를 제조하는 방법, 핵산 서열 분석을 위한 분자 바코딩 방법 및 DNA 라이브러리 제조용 조성물을 제공한다. 상기 방법 및 조성물에 따르면, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열되는 바코드 서열을 이용함으로써, 분자 바코딩 교체 현상을 감소시키고, 핵산 서열 분석의 정확도를 향상시킬 수 있다.

Description

분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도
분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도에 관한 것이다.
다양한 생체 정보는 DNA 서열의 유전자로 표현되고, 개체의 완전한 DNA 서열 정보는 생명 현상을 이해하고 질병과 관련된 정보를 얻을 수 있어 매우 중요하다. DNA 서열 정보의 해독, 즉 게놈 시퀀싱(genome sequencing)의 핵심은 개인차 및 민족적 특성을 파악하거나 유전자 이상과 관련된 질환에서 염색체 이상을 포함한 선천성 원인의 규명과 당뇨병, 고혈압과 같은 복합 질병의 유전자 결함을 찾기 위한 것이다. 또한, 시퀀싱 데이터는 유전자 발현, 유전자 다양성 및 그 상호작용 등의 정보들을 분자 진단과 치료 영역에서 폭넓게 활용할 수 있어 매우 중요하다.
게놈 시퀀싱을 위한 방법으로는 차세대 염기서열 분석법(Next Generation Sequencing; NGS)이 2007년 이래로 적용되기 시작하였고, 이러한 NGS의 개발에 따라 전통적인 방법과 비교하여 훨씬 쉽고 저비용으로 분석할 수 있게 되었다. 차세대 염기서열 분석법을 구현하는 차세대 게놈 시퀀서(Next Generation Sequencer)로 대표적인 것으로는 로슈(Roche)/454, 일루미나(Illumina)/Solexa 및 라이프 테크놀로지스(ABI)의 SOLiD 등이 있다. 이러한 차세대 염기서열 분석기기들은 7시간에 8,000만개 이상의 서열 판독이 가능하다. 이러한 기술 발전으로 종래에 막대한 검사 비용으로 인해 연구용으로만 사용되던 차세대 염기서열 분석법을 의료용 임상 검사에서도 활용할 수 있게 되었다.
한편, 시퀀싱 기술의 발달로 인해 다양한 종류의 구조적 변이(structure variation)를 발굴하는 다양한 시도가 이루어지고 있으나, 분석 과정에서 상당한 수준의 위양성(false positive)나 위음성(false negative)이 발생하고 있어, 이러한 문제점을 해결하기 위한 다양한 시도가 이루어지고 있다. 이러한 문제점을 해결하기 위한 기술로서, 예를 들어, 분자 바코딩 기술이 널리 활용되고 있으나, 라이게이션 이후 정제 과정에서 제거되지 않은 어댑터가 PCR 증폭 단계에서 프라이머로 작용하여 샘플 정보에 대한 오류를 유발하는 바, 검출의 민감도 및 특이도 측면에서 기술적 한계가 존재한다.
오늘날 정밀 의료 기반의 진단/치료 기술 분야가 주목받기 시작하면서, 더욱 정밀하고 정확한 분석의 필요성이 대두되고 있으며, 이에 따라, 분자 바코딩 기술에 대한 연구가 활발하게 진행되고 있으나(한국등록특허 제10-1575457호), 아직은 미비한 실정이다.
일 양상은 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법을 제공하는 것이다.
다른 양상은 핵산 서열 분석을 위한 분자 바코딩 방법을 제공하는 것이다.
다른 양상은 핵산 서열 분석을 위한 DNA 라이브러리 제조용 조성물을 제공하는 것이다.
본 출원의 다른 목적 및 이점은 첨부한 청구범위와 함께 하기의 상세한 설명에 의해 보다 명확해질 것이다. 본 명세서에 기재되지 않은 내용은 본 출원의 기술 분야 또는 유사한 기술 분야 내 숙련된 자이면 충분히 인식하고 유추할 수 있는 것이므로 그 설명을 생략한다.
본 명세서에서 사용되는 용어는 각 기능을 고려하면서 가능한 현재 널리 사용되는 일반적인 용어들을 선택하였으나, 이는 당 기술분야에 종사하는 기술자의 의도 또는 판례, 새로운 기술의 출현 등에 따라 달라질 수 있다. 또한, 특정한 경우는 임의로 선정된 용어도 있으며, 이 경우 해당 설명 부분에서 상세히 그 의미를 기재할 것이다. 따라서, 본 명세서에서 사용되는 용어는 단순한 용어의 명칭이 아닌, 그 용어가 가지는 의미와 본 명세서 전반에 걸친 내용을 토대로 정의되어야 한다.
각 설명들에서, 어떤 부분이 다른 부분과 연결되어 있다고 할 때, 이는 직접적으로 연결되어 있는 경우 뿐만 아니라, 그 중간에 다른 구성요소를 사이에 두고 유기적으로 연결되어 있는 경우도 포함한다. 또한 어떤 부분이 어떤 구성요소를 포함한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성요소를 제외하는 것 이 아니라 다른 구성요소를 더 포함할 수 있는 것을 의미한다. 본 명세서에서 사용되는 "구성된다" 또는 "포함한다" 등의 용어는 명세서 상에 기재된 여러 구성 요소들, 도는 여러 단계들을 반드시 모두 포함하는 것으로 해석되지 않아야 하며, 그 중 일부 구성 요소들 또는 일부 단계들은 포함되지 않을 수도 있고, 또는 추가적인 구성 요소 또는 단계들을 더 포함할 수 있는 것으로 해석되어야 한다.
각 설명은 권리범위를 제한하는 것으로 해석되지 말아야 하며, 해당 기술분야의 통상의 기술자가 용이하게 유추할 수 있는 것은 권리범위에 속하는 것으로 해석되어야 할 것이다.
일 양상은 표적 시료에서 추출 및 절편화된 DNA 절편의 양말단에, 바코드 서열을 포함하는 어댑터를 라이게이션하는 단계; 상기 라이게이션된 DNA 절편을 단일 가닥으로 분리하는 단계; 및 상기 어댑터가 라이게이션된 단일 가닥 DNA 절편을 어댑터를 인식하는 프라이머를 사용하여 중합효소연쇄반응을 통해 증폭하는 단계를 포함하는, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법으로서, 상기 바코드 서열은 1nt 내지 10nt의 길이를 가지고, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열되는 것인, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법을 제공한다.
또한, 다른 양상은 표적 시료에서 추출 및 절편화된 DNA 절편의 양말단에, 바코드 서열을 포함하는 어댑터를 라이게이션하는 단계를 포함하는, 핵산 서열 분석을 위한 분자 바코딩 방법으로서, 상기 바코드 서열은 1nt 내지 10nt의 길이를 가지고, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열되는 것인, 핵산 서열 분석을 위한 분자 바코딩 방법을 제공한다.
본 명세서에서 사용된 용어, "DNA 라이브러리"는 표적 시료에 대한 핵산 서열 분석을 위한 전 처리의 결과물로서, DNA 샘플 가공의 산물을 지칭한다. 통상적으로, 상기 DNA 라이브러리는 DNA 절편의 양말단에 어댑터 올리고뉴클레오티드를 라이게이션시키는 단계를 포함하여 제조된 것으로, 이의 증폭된 산물 역시 포함될 수 있다. 상기 DNA 라이브러리는 예를 들어, 1) DNA 샘플을 무작위적으로 잘라 DNA 절편을 수득하는 단계 (DNA 절편화); 2) 두 개의 단일 가닥 DNA의 양쪽 말단 부분을 보강하여, 평활 말단(blunt end) 구조를 형성하는 단계 (말단 수선); 3) 이중 가닥 DNA의 3'말단에 아데닌을 접합시켜 Overhang 구조를 형성하는 단계 (아데닌 접합); 4) 상기 아데닌 접합된 어댑터를 이중 가닥 DNA 말단에 라이게이션시키는 단계 (어댑터 부착); 5) 특정 효소를 사용하여, 어댑터에 의해 연결되어 있는 이중 가닥 DNA를 단일 가닥으로 분리하는 단계 (단일 가닥 분리); 및 6) 중합효소연쇄반응(Polymerase Chain Reaction; PCR)을 통해 어댑터 서열과 부착된 DNA 절편을 증폭시키는 단계 (PCR 증폭)를 포함하는 일련의 과정을 통해 제조된 것일 수 있다. 상기 DNA 라이브러리는 최종 생성물 뿐만 아니라, 상기 언급한 각 단계에서의 중간 생성물까지 포함하는 것으로 해석될 수 있다.
상기 각 단계는 당업계에 알려진 공지된 기술이 비제한적으로 적용될 수 있다. 예를 들어, 상기 어댑터 부착단계에서 T4 DNA 라이게이즈, T7 DNA 라이게이즈, 또는 온도 순환시험(temperature cycling)이 가능한 라이게이즈가 사용될 수 있고, 또는 상기 PCR 증폭 단계는 4 회 내지 12 회, 4 회 내지 10 회, 4 회 내지 8 회, 4 회 내지 6 회, 6 회 내지 12 회, 6 회 내지 10 회, 6 회 내지 8 회, 8 회 내지 12 회, 8 회 내지 10 회, 또는 10 회 내지 12 회 사이클로 수행될 수 있으며, 그 외, 당업계에 널리 사용되는 기술이 일 실시예에 따른 핵산 서열을 분석하는데 사용될 수 있다.
본 명세서에서 사용된 용어, "분자 바코드(Molecular barcode)"는 표적 시료 내에 존재하는 각각의 DNA 절편에 대해 고유한 뉴클레오티드 서열을 지칭하는 것으로서, 표적 시료 내에 존재하는 DNA 절편을 구분 가능하게 한다. 종래의 분자 바코드 기술은 PCR 증폭 과정에서, 잘못된 바코드 서열 또는 고유 식별자(Unique identifier: UID)를 갖는 어댑터가 후속 PCR 반응에서 프라이머로 작용하는 경우, 잘못된 PCR 복제물을 생성하게 되며(분자 바코딩 교체 현상), 이에 따라, 유전체 분석 과정에서, 위양성의 리드(Read)가 증가될 뿐만 아니라, 정상 대조군 리드의 증가로 인한 양성 검출의 민감도가 감소되어, 높은 Depth를 갖는 유전 정보 분석 결과의 신뢰도를 감소시키는 요인으로 작용하고 있다. 이러한 기술적 배경 하에서, 본 발명자들은 상기 DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열되는 바코드 서열, 그리고, 상기 말단 영역 중 특정 위치에 특정 염기를 배열함으로써, 상기 언급한 종래의 문제점을 극복할 수 있음을 확인하고, 이에 기초하여 본 발명을 완성하였다.
본 명세서에서 사용된 용어, "표적 시료"는 개체 또는 세포로부터 유래할 수 있다. 상기 개체는 인간, 소, 말, 돼지, 양, 염소, 개, 고양이, 및 설치류를 포함한 포유류일 수 있다. 상기 세포는 개체로부터 유래된 세포 또는 세포주일 수 있다. 또한, 상기 표적 시료는 생물학적 시료일 수 있다. 상기 생물학적 시료는 예를 들어, 혈액, 혈장, 혈청, 소변, 타액, 점막, 분비물, 객담, 대변, 눈물, 또는 이들의 조합으로부터 획득된 것일 수 있다. 상기 생물학적 시료는 다양한 종으로부터 유래하는 진핵세포, 원핵세포, 바이러스, 박테리오파지 등의 시료일 수 있다.
본 명세서에서 사용된 용어, "핵산 서열 분석(nucleic acid sequencing analysis)"은 차세대 핵산 서열분석(next generation sequencing: NGS)인 것일 수 있다. 핵산 서열분석은 염기 서열분석, 서열분석 또는 시퀀싱 (sequencing)과 상호 교환적으로 사용되는 것일 수 있다. 상기 NGS는 대규모 병렬 서열분석(massive parallel sequencing) 또는 2세대 서열분석(second-generation sequencing)과 상호 교환적으로 사용되는 것일 수 있다. 상기 NGS는 대량의 단편의 핵산을 동시다발적으로 서열분석하는 기법으로서, 칩(chip) 기반 그리고 중합효소 연쇄 반응 (polymerase chain reaction: PCR) 기반 쌍 말단(paired end) 형식으로 전장 유전체를 조각내고, 상기 조각을 혼성화 반응(hybridization)에 기초하여 초고속으로 서열 분석을 수행하는 것일 수 있다. 상기 NGS는 예를 들면, 454 플랫폼(Roche), GS FLX 티타늄, Illumina MiSeq, Illumina HiSeq, Illumina HiSeq 2500, Illumina Genome Analyzer, Solexa platform, SOLiD System(Applied Biosystems), Ion Proton(Life Technologies), Complete Genomics, Helicos Biosciences Heliscope, Pacific Biosciences의 단일 분자 실시간(SMRT™) 기술, 또는 이들의 조합에 의해 수행되는 것일 수 있다. 상기 핵산 서열분석은 관심 영역만을 분석하기 위한 핵산 서열분석법인 것일 수 있다. 상기 핵산 서열분석은, 예를 들면, NGS 기반의 표적 서열분석(targeted sequencing), 표적 딥 서열분석(targeted deep sequencing), 또는 패널 서열분석(panel sequencing)을 포함하는 것일 수 있다. 여기서, 핵산은 유전체 또는 그의 절편일 수 있다. 본 명세서에서 사용된 용어, "유전체(genome)"는 염색체, 염색질, 또는 유전자의 전체를 총칭하는 용어이다. 상기 유전체 또는 그의 절편은 분리된 DNA일 수 있다. 상기 세포로부터 핵산을 추출 또는 분리하는 방법은 통상의 기술자에게 공지된 방법으로 수행될 수 있다. 여기서, 절편은 유전체를 물리적, 화학적, 또는 효소적으로 절단하는 것을 의미하며, 상기 과정을 통해 다양한 길이(length)를 갖는 리드를 생성하는 것일 수 있다. 본 명세서에서 사용된 용어, "리드(read)"는 핵산 서열 분석에서 생성된 하나 이상의 핵산 절편의 서열 정보를 의미하며, 상기 리드는 약 10bp 내지 약 2000bp, 예를 들어, 약 15bp 내지 약 1500bp, 약 20bp 내지 약 1000bp, 약 20bp 내지 약 500bp, 약 20bp 내지 약 200bp, 약 20bp 내지 약 100bp일 수 있으나, 이에 제한되는 것은 아니다.
상기 바코드 서열을 포함하는 어댑터를 라이게이션 하는 단계에서, 상기 바코드 서열은 1nt 내지 10nt의 길이를 가지고, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열되는 것일 수 있다.
본 명세서에서 사용된 용어, "어댑터(Adapter)"는 복수 개의 DNA 절편을 구분하기 위한 바코드 서열을 포함하는 올리고뉴클레오티드를 지칭하는 것으로서, Y자 형태(Forked) 또는 U자 형태(Hairpin) 형태일 수 있다. 예를 들어, 상기 어댑터는 우라실 특이 절제 시약(USER)과 같은 효소를 이용하여, 상기 U 자 모양의　어댑터를 Y 자 형태의 말단을 갖는　것으로 절단된 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 이중 가닥의 DNA 절편의 3'말단은 아데닌 접합에 의해 Overhang 구조를 지니고 있는 바, 상기 DNA 절편과의 라이게이션을 위하여, 상기 어댑터는 이중 가닥으로 이루져 있을 뿐만 아니라, 상기 어댑터의 3'말단에는 티민이 접합되어 있을 수 있다. 여기서, 상기 어댑터 서열의 길이는 40nt 내지 100nt, 40nt 내지 90nt, 40nt 내지 80nt, 40nt 내지 70nt, 40nt 내지 60nt, 40nt 내지 50nt, 50nt 내지 100nt, 50nt 내지 90nt, 50nt 내지 80nt, 50nt 내지 70nt, 50nt 내지 60nt, 60nt 내지 100nt, 60nt 내지 90nt, 60nt 내지 80nt, 60nt 내지 70nt, 70nt 내지 100nt, 70nt 내지 90nt, 70nt 내지 80nt, 80nt 내지 100nt, 또는 80nt 내지 90nt일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서 사용된 용어, "바코드(Barcode)"는 "인덱스(index)" 또는 "고유 식별자(Unique identifier: UID)"와 상호 교환적으로 사용할 수 있으며, 복수 개의 DNA 절편을 구분하기 위한 1nt 내지 10nt의 길이의 올리고뉴클레오티드를 지칭한다. 상기 바코드 서열은 어댑터 내 포함되어 있으며, 이에 따라, 상보적인 결합을 형성하는 하나의 쌍 또는 조합을 지칭하는 것일 수 있다. 여기서, 상기 바코드 서열의 길이는 1nt 내지 10nt, 1nt 내지 8nt, 1nt 내지 6nt, 1nt 내지 4nt, 1nt 내지 2nt, 3nt 내지 10nt, 3nt 내지 8nt, 3nt 내지 6nt, 1nt 내지 4nt, 5nt 내지 10nt, 5nt 내지 8nt, 5nt 내지 6nt, 7nt 내지 10nt, 또는 7nt 내지 8nt일 수 있으나, 이에 제한되는 것은 아니다.
일 구체예에서, 상기 바코드 서열은 DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열되는 것일 수 있다. 여기서, 상기 어댑터의 말단 영역 내 첫번째 뉴클레오티드는 DNA 절편과 라이게이션되는 위치에 존재하는 최말단의 뉴클레오티드로서, 1) 표적 DNA 절편의 3'말단에 존재하는 아데닌과 인접한, 어댑터 서열의 5'말단의 뉴클레오티드, 2) DNA 절편의 3'말단에 존재하는 아데닌과 상보적 염기서열(티민)을 포함하는, 어댑터 서열의 3'말단의 티민과 인접한(연결된) 어댑터 서열의 뉴클레오티드를 지칭하는 것일 수 있다.
일 구체예에서, 상기 방법은 복수 개의 DNA 절편을 대상으로 하는 것으로, 복수 개의 어댑터를 포함하고, 이에 따라, 상기 어댑터는 DNA 절편의 종류에 따라 상이한 바코드 서열을 포함하는 것일 수 있다.
일 구체예에서, 상기 바코드 서열은 DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 서열이 A, T, C, 및 G 중 어느 하나일 수 이거나, 상기 바코드 서열이 2nt 내지 10nt의 길이를 가지는 경우, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 두번째 서열이 C, 및 G 중 어느 하나일 수 있다. 또한, 상기 바코드 서열이 2nt 내지 10nt의 길이를 가지는 경우, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 서열이 A, T, C, 및 G 중 어느 하나로 고정되고, 및 어댑터 내 두번째 서열이 C, 및 G 중 어느 하나로 고정된 것일 수 있다.
일 실시예에 따르면, 상기 언급한 배열을 갖는 바코드 서열 및 이를 포함하는 어댑터 서열은 도 4에 도시한 바와 같이, 잘못된 바코드 서열을 포함하는 어댑터가 PCR 증폭 과정에서 프라이머로 작용하는 경우 DNA 중합효소 Ⅰ의 교정(Proofreding) 과정 (3'→ 5'Exonuclease 활성)을 통해, 자체적으로, 잘못된 복제 및 증폭 과정을 중단시켜, 종래의 분자 바코딩 교체 현상을 감소시킬 수 있다.
다른 양상은 중합효소연쇄반응을 위한 프라이머에 대한 상보적 서열 및 바코드 서열을 포함하는 40 내지 100nt의 길이를 갖는 복수 개의 어댑터로서, 상기 복수 개의 어댑터 각각은 DNA 절편의 종류에 따라 상이한 바코드 서열을 포함하고, 상기 바코드 서열은 1nt 내지 10nt의 길이를 가지고, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열된 것인, 핵산 서열 분석을 위한 DNA 라이브러리 제조용 조성물을 제공한다.
상기 핵산 서열 분석을 위한 DNA 라이브러리 제조용 조성물은 전술한 DNA 라이브러리를 제조하는 방법 또는 분자 바코딩 방법에 사용되는 기술적 구성을 그대로 포함하거나, 이를 이용하기 때문에, 이 둘 사이에 공통된 내용은 기재를 생략한다.
구체적으로, 본 명세서에서 사용된, "DNA 라이브러리 제조용 조성물"은 DNA 라이브러리 제조용 키트, 또는 DNA 라이브러리 제조를 위한 어댑터 조성물과 상호 교환적으로 사용될 수 있다.
일 구체예에서, 상기 조성물은 핵산 서열 분석을 위한 것으로, 복수 개의 DNA 절편을 대상으로 하는 것일 수 있다. 이에, 상기 조성물은 복수 개의 어댑터를 포함하고, 이에 따라, 상기 어댑터는 DNA 절편의 종류에 따라 상이한 바코드 서열을 포함하는 것일 수 있다
상기 어댑터는 중합효소연쇄반응을 위한 프라이머에 대한 상보적인 서열 및 바코드 서열을 포함하는 것일 수 있다. 여기서, 상기 프라이머에 대한 상보적인 서열은 PCR 증폭 과정을 개시 또는 수행하기 위한 것으로, 공지 또는 임의의 프라이머 및 이에 상보적인 서열이 비제한적으로 적용될 수 있다.
일 구체예에서, 상기 바코드 서열은, 전술한 바와 같이, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열된 것일 수 있다. 또한, 상기 바코드 서열은 상기 바코드 서열은 DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 서열이 A, T, C, 및 G 중 어느 하나일 수 있거나, 상기 바코드 서열이 2nt 내지 10nt의 길이를 가지는 경우, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 두번째 서열이 C, 및 G 중 어느 하나일 수 있다. 또한, 상기 바코드 서열이 2nt 내지 10nt의 길이를 가지는 경우, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 서열이 A, T, C, 및 G 중 어느 하나로 고정되고, 및 어댑터 내 두번째 서열이 C, 및 G 중 어느 하나로 고정된 것일 수 있다.
일 실시예에 따르면, 종래의 배열을 갖는 바코드 서열 또는 이를 포함하는 어댑터 서열은 약 6% 내지 50%의 분자 바코드 교체율을 나타내었던 반면, 일 실시예에 따른 어댑터 서열은 1% 미만의 분자 바코드 교체율, 즉 오류율을 나타냄을 확인하였는 바, 핵산 서열 분석, 예를 들어, 유전 변이 검출 과정에서 변이 검출의 민감도 및 특이도 높일 수 있으므로, 정밀 의료 기반의 진단/치료 기술 분야에 폭넓게 활용될 수 있다.
일 양상에 따른 방법 및 조성물에 따르면, 종래 기술의 문제점으로 지적되어 온 분자 바코딩 교체 현상을 감소시킬 수 있고, 이에 따라, 분자 바코딩 정확도 및 위양상 변이 제거율을 크게 향상시킬 수 있다.
일 양상에 따른 방법 및 조성물에 따르면, 유전 변이 검출 과정에서 변이 검출의 민감도 및 특이도 높일 수 있으므로, 게놈 시퀀싱에 기반한 치료 및 진단 분야의 정확성을 크게 향상시킬 수 있다.
도 1은 종래 분자 바코딩 기술의 문제점을 개략적으로 나타낸 도이다.
도 2는 분자 바코딩 교체 현상을 유도하기 위한 실험 과정 및 이에 따른 결과물을 개략적으로 나타낸 도이다.
도 3은 종래 분자 바코딩 기술이 적용된 PCR 증폭 과정에서, 분자 바코딩의 교체 비율을 정제 횟수 및 어댑터의 농도에 따라 확인한 결과이다.
도 4는 일 구체예에서 따른 어댑터 및 이를 이용한 PCR 증폭 과정에서, 분자 바코딩 교체 현상을 감소시키는 일련의 과정을 개략적으로 나타낸 도이다.
도 5는 일 구체예에 따른 바코드 서열을 어댑터 말단 영역으로 그 위치를 고정한 어댑터를 이용한 PCR 증폭 과정에서, 분자 바코딩 교체 현상 수준을 평가하기 위한 실험 과정을 개략적으로 나타낸 도이다.
도 6은 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 분자 바코딩 교체 수준을 확인한 결과이다.
도 7은 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 바코드 서열 내 특정 위치가 아데닌(A)으로 고정된 경우, 분자 바코딩 교체 수준을 확인한 결과이다.
도 8은 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 바코드 서열 내 특정 위치가 티민(T)으로 고정된 경우, 분자 바코딩 교체 수준을 확인한 결과이다.
도 9는 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 바코드 서열 내 특정 위치가 시토신(C)으로 고정된 경우, 분자 바코딩 교체 수준을 확인한 결과이다.
도 10은 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 바코드 서열 내 특정 위치가 구아닌(G)으로 고정된 경우, 분자 바코딩 교체 수준을 확인한 결과이다.
도 11은 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 바코드 서열 내 특정 위치 및 이의 염기서열이 고정된 경우, 특정 위치 및 고정된 염기서열에 따른 분자 바코딩 교체 수준을 확인한 것이다.
도 12는 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 어댑터 말단 첫번째 염기서열(EP1)의 고정에 따른 분자 바코딩 교체 수준을 확인한 결과이다.
도 13은 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 바코딩 서열에 따른 효능을 확인한 결과로서, 어댑터 말단 두번째 염기서열(EP2)의 고정에 따른 분자 바코딩 교체 수준을 확인한 결과이다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 분자 바코딩 교체에 따른 오류 가능성의 확인
본 실시예에서는 PCR 증폭 과정에서 발생할 수 있는, 분자 바코딩 교체 현상에 따른 오류 가능성을 확인하고자 하였다. 통상의 유전체 분석 기술은 무작위적인 DNA의 절편화 및 높은 Depth를 갖는 시퀀싱 과정을 필요로 하며, 이에 따라, 다량의 DNA 절편을 증폭 및 선별하는 과정에서 유효한 유전 정보를 상실할 우려가 존재한다. 따라서, 당업계에서는 특정 바코드 서열을 포함하는 어댑터를 DNA 절편에 라이게이션시키는 과정을 포함하는 분자 바코드 기술을 통해, 이러한 문제점으로부터 유발되는 오류를 최소화시키고 있다. 그러나, 이러한 종래 분자 바코딩 기술 역시, 도 1에 도시한 바와 같이, PCR 증폭 과정에서, 잘못된 바코드 서열을 포함하는 어댑터가 후속 PCR 반응에서 프라이머로 작용하여 잘못된 PCR 복제물을 생성하게 되어, 검출의 민감도 및 특이도를 감소시키는바 (분자 바코딩 교체 현상), 기술적 한계가 존재하는 실정이다.
본 실시예에서는 도 2의 A에 도시한 바와 같이, 이러한 종래 기술의 문제점을 실험적으로 확인하고자 하였다. 우선, 인간 참조 유전체 정보를 활용하여 5개의 유전자 KRAS, IDH1, BRCA1, ALK, ERBB2의 염기서열 일부를 확보한 후, 상기 서열의 말단에 'CTTC'서열을 추가하였다. 이후, 각 염기서열에 일루미나(IllUIDna) 시퀀서 활용 가능한 라이브러리 형태의 어댑터 서열을 추가하면서, 상기 어댑터 서열 내 바코드 서열 위치에 특정 시퀀스(AGTC)를 고정한 형태로, 어댑터가 부착된 DNA를 합성하였다. 상기 각 염기서열에 대한 정보는 하기 표 1에 나타낸 바와 같다.
유전자 Sequence (5' -> 3') UID
KRAS CTTCATCCTGAGAAGGGAGAAACACAGTCTGGATTATTACAGTGCACCTTTTACTTCAAAAAAGGTGTTATATACAACTCAACAACAAAAAATTCAATTTAAAAATGGGCAAAGGACTTGAAAAGACATTGTTCCTGCTCCAAAGACTTC AGTC
IDH1 CTTCAATGGCTTCTCTGAAGACCGTGCCACCCAGAATATTTCGTATGGTGCCATTTGGTGATTTCCACATTTGTTTCAACTTGAACTCCTCAACCCTCTTCTCATCAGGAGTGATAGTGGCACATTTGACGCCAACATTATGCTTCCTTC AGTC
BRCA1 CTTCTTCTGGCTTCTCCCTGCTCACACTTTCTTCCATTGCATTATACCCAGCAGTATCAGTAGTATGAGCAGCAGCTGGACTCTGGGCAGATTCTGCAACTTTCAACTTTCAATTGGGGAACTTTCAATGCAGAGGTTGAAGATGGCTTC AGTC
ALK CTTCACTGATGGAGGAGGTCTTGCCAGCAAAGCAGTAGTTGGGGTTGTAGTCGGTCATGATGGTCGAGGTGCGGAGCTTGCTCAGCTTGTACTCAGGGCTCTGCAGCTCCATCTGCATGGCTTGCAGCTCCTGGTGCTTCCGGCGGCTTC AGTC
ERBB2 CTTCGCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAACAATACCACCCCTGTCTTC AGTC
한편, 상기 언급된 잘못된 바코드 서열을 포함하는 어댑터가 PCR 증폭 과정에서 작용하는 과정을 모사하기 위하여, 표적 서열 내 인공 변이 서열이 도입된 염기서열을 추가로 합성하였으며, 본 실시예에서는 이를 specific sequence synthesis fragment 또는 spike-in 절편으로 지칭하였다. 이후, 도 2의 B에 도시한 바와 같이, 50ng의 Input DNA, 1.8x SPRI의 라이게이션 이후 정제 조건이 적용된 PCR 증폭 과정을 포함하는 일련의 실험을 수행하였으며, 이를 통해, 증폭된 전체 절편 중 spike-in 절편의 비율을 산출하였다. 구체적으로, 상기 spike-in 절편의 비율은 정제 횟수(1회 또는 2회), 및 어댑터의 농도(50ng, 또는 5ng)에 따라 비교하였다.
도 3은 종래 분자 바코딩 기술이 적용된 PCR 증폭 과정에서, 분자 바코딩의 교체 비율을 정제 횟수 및 어댑터의 농도에 따라 확인한 것이다.
그 결과, 도 3에 나타낸 바와 같이, spike-in 절편은 실험 조건에 따라, 전체 분자 바코드에서 약 6% 내지 50%를 차지하였으며, 특히, 정제 횟수가 감소할 수록, 및/또는 바코드 서열을 포함하는 어댑터의 농도가 증가할수록 spike-in 절편의 비율이 높아지는 경향을 보여주었다.
이러한 실험 결과는, 종래의 분자 바코딩 기술은 바코드 서열을 포함하는 어댑터가 정제 과정에서 완전하게 제거되지 않고, pre-PCR 시 프라이머로 작용할 경우, 분자 바코딩 교체 현상이 발생할 수 있으므로, 유전체 분석 결과의 오류를 유발할 수 있음을 나타내는 것이다.
실시예 2. 바코드 서열의 위치에 의한 분자 바코딩 교체 감소 효과 확인
본 실시예에서는 바코드 서열을 어댑터 말단 영역으로 그 위치를 고정한 어댑터 구조를 디자인하였으며, 이를 통해, 상기 실시예 1에서 언급한 종래 기술의 문제점을 해소할 수 있는지 여부를 확인하고자 하였다. 구체적으로, 도 4에 도시한 바와 같이, 본 실시예에서의 어댑터 서열이 적용된 PCR 증폭 과정에서는, 잘못된 바코드 서열을 포함하는 어댑터가 PCR 증폭 과정에 프라이머로 작용하는 경우, 3'→ 5'Exonuclease 활성에 의해 복제가 중단되는 DNA 중합효소 Ⅰ의 교정(Proofreding) 과정을 통해, 종래의 분자 바코딩 교체 현상을 감소시킬 수 있을지 여부에 대하여 확인하고자 하였다.
이를 위하여, 도 5의 A에 도시한 바와 같이, 우선, DNA 절편과 라이게이션이 진행되는, 어댑터의 말단 영역에 바코드 서열이 위치하도록 어댑터를 디자인하였고, 보다 구체적으로, DNA 절편과 라이게이션이 진행되는, 어댑터 최말단 염기 위치를 end point 1(EP1), 상기 EP1을 기준으로 2, 3, 5, 또는 10번째 위치를 각각 EP2, EP3, EP5, 또는 EP10으로 설정한 뒤, 이들 영역을 각각 A, T, G 또는 C 로 고정한 어댑터를 제조하였다. 또한, 바코드 서열 내 특정 서열로 고정된 위치의 해당 서열이 다른 염기로 변경(치환)된 specific sequence synthesis fragment 또는 spike-in 어댑터를 합성하였다. 이후, 도 5의 B에 도시한 바와 같이, 10ng의 Plasmid DNA 일부, 1.0 uM의 Index adaptor working concentration, 0.1uM의 Spike-in working concentration의 조건이 적용된 PCR 증폭 과정을 포함하는 일련의 실험을 수행하였으며, imageJ 프로그램을 사용하여 시퀀싱 피크를 확인한 뒤, 분자 바코드 교체율을 하기의 식 1에 따라 산출하였다. 한편, 본 실험에서 대조군은 변경된 서열이 도입된 spike-in 어댑터가 적용되지 않은 군으로 설정하였다.
[식 1]
분자 바코드 교체율(%)= Spike-in 어댑터에 고정된 DNA 절편의 양/ 라이게이션된 어댑터에 고정된 DNA 절편의 양
도 6은 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 분자 바코딩 교체 수준을 확인한 결과이다. 그 결과, 도 6에 나타낸 바와 같이, EP1 영역에서, 본래 디자인한 염기서열이외, 다른 3 종류의 염기서열 검출 수준은 매우 낮음을 확인하였다(A=0.058).
또한, 표 2 및 도 7 내지 11은 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 바코드 서열 내 특정 위치 및 이의 염기서열이 고정된 경우, 특정 위치 및 고정된 염기서열에 따른 분자 바코딩 교체 수준을 확인한 것이다. 참고로, 도 6 내지 도 11에서, A에 대한 피크는 굵은 실선은 G에 대한 피크는 실선, T에 대한 피크는 이점 쇄선, C에 대한 피크는 점선으로 표기하였다. 참고로, 도 6 내지 도 11에서, A에 대한 피크는 굵은 실선은 G에 대한 피크는 실선, T에 대한 피크는 이점 쇄선, C에 대한 피크는 점선으로 표기하였다.
뉴클레오타이드 타입 검측양 　
고정 위치 라이게이션
adpater		 spike-in
adapter		 라이게이션
adpater
(A)		 spike-in
adapter (B)		 교체율 (%)
(B/A*100)		 교체율 평균 (%)
Control 　 　 0.058 　 0 0
　 > LOD 　 0 0
　 > LOD 　 0 0
　 > LOD 　 0 0
EP1 A G 0.06 　 0% 0%
A T 0.054 　 0%
A C 0.082 　 0%
G A 0.067 　 0% 　
　
0%
G T 0.076 　 0%
G C 0.074 　 0%
T G 0.097 　 0% 　
　
0%
T A 0.081 　 0%
T C 0.087 　 0%
C G 0.083 　 0% 　
　
0%
C A 0.087 　 0%
C T 0.079 　 0%
EP2 A G 0.061 　 0% 　
　
0%
A T 0.081 　 0%
A C 0.074 　 0%
G A 0.061 　 0% 　
　
0%
G T 0.035 　 0%
G C 0.051 　 0%
T G 0.099 　 0% 　
　
0%
T A 0.096 　 0%
T C 0.092 　 0%
C G 0.082 　 0% 　
　
0%
C A 0.066 　 0%
C T 0.108 　 0%
EP3 A G 0.183 　 0% 　
　
6%
A T 0.142 0.024 17%
A C 0.116 　 0%
G A 0.196 0.016 8% 　
　
3%
G T 0.2 　 0%
G C 0.251 　 0%
T G 0.129 0.016 12% 　
　
16%
T A 0.067 0.024 36%
T C 0.156 　 0%
C G 0.102 0.008 8% 　
　
29%
C A 0.093 0.041 44%
C T 0.092 0.031 34%
EP5 A G 0.086 0.02 23% 　
　
28%
A T 0.092 0.021 23%
A C 0.1 0.038 38%
G A 0.138 0.042 30% 　
　
29%
G T 0.145 0.049 34%
G C 0.167 0.037 22%
T G 0.123 0.038 31% 　
　
29%
T A 0.123 0.045 37%
T C 0.124 0.023 19%
C G 0.074 0.032 43% 　
　
37%
C A 0.088 0.024 27%
C T 0.077 0.032 42%
EP10 A G 0.072 0.024 33% 　
　
25%
A T 0.079 0.018 23%
A C 0.125 0.024 19%
G A 0.107 0.028 26% 　
　
24%
G T 0.105 0.017 16%
G C 0.121 0.036 30%
T G 0.09 0.042 47% 　
　
35%
T A 0.099 0.028 28%
T C 0.08 0.023 29%
C G 0.065 0.028 43% 　
　
48%
C A 0.065 0.028 43%
C T 0.056 0.032 57%
그 결과, 표 2 및 도 7 내지 11에 나타낸 바와 같이, EP1 및 EP2 위치에서는 분자 바코드 교체 현상이 검출되지 않았던 반면, DNA 절편과 라이게이션이 진행되는 어댑터의 말단 영역에서 멀어질수록 분자 바코드 교체율이 높아지는 경향을 보여주었다. 특히, 이러한 경향은 EP3 위치에서부터 뚜렷하게 나타났으며, EP3 이후 위치에서, 시토신(C)이 도입될 경우 상대적으로 분자 바코드 교체율은 더욱 증가하였다.
이러한 실험 결과는 바코드 서열이 어댑터의 말단 영역, 예를 들어, EP1 및 EP2 위치를 포함하는 영역에 존재하는 경우, PCR 증폭 과정에서 발생하는 분자 바코딩 교체 현상을 감소시킬 수 있음을 나타내는 것이다.
실시예 3. 염기서열의 고정에 의한 분자 바코딩 교체 감소 효과 확인
본 실시예에서는, 실시예 2의 실험 결과에 기초하여, 바코드 서열을 DNA 절편과 라이게이션이 진행되는, 어댑터 말단 영역으로 그 위치를 고정한 어댑터 구조에서, EP1 또는 EP2 위치 염기서열의 고정이 분자 바코딩 교체 현상에 미치는 영향을 확인하고자 하였다.
3-1. 어댑터 말단 첫번째 위치(EP1)
EP1 영역을 A, C, G, 또는 T로 각각 고정하고, EP2 영역은 C 또는 G로 설정하여 디자인된 바코드 서열 및 이를 포함하 어댑터 서열을 합성 및 제조하였고, 상기 실시예 2와 동일한 과정으로 실험을 수행한 뒤, 바코드 서열이 변화하지 않은 어댑터의 비율, 즉, 분자 바코딩 교체가 발생하지 않은 비율을 산출하였다.
표 3은 바코드 서열 내 EP1 위치가 아데닌(A)으로 고정된 경우, 그 결과를 나타낸 것이다.
EP2 EP1 A(%)
Read Pos 1 Read Pos 2
control Index 1 C A 99.62%
Index 2 G A
Spike-in 1 - -
Spike-in 2 - -
1 Index 1 C A 99.53%
Index 2 G A
Spike-in 1 C C
Spike-in 2 G C
2 Index 1 C A 99.44%
Index 2 G A
Spike-in 1 C T
Spike-in 2 G T
3 Index 1 C A 98.28%
Index 2 G A
Spike-in 1 C G
Spike-in 2 G G
표 4는 바코드 서열 내 EP1 위치가 시토신(C)으로 고정된 경우, 그 결과를 나타낸 것이다.
EP2 EP1 C(%)
Read Pos 1 Read Pos 2
control Index 1 C C 99.68%
Index 2 G C
Spike-in 1 - -
Spike-in 2 - -
1 Index 1 C C 99.14%
Index 2 G C
Spike-in 1 C T
Spike-in 2 G T
2 Index 1 C C 99.57%
Index 2 G C
Spike-in 1 C G
Spike-in 2 G G
3 Index 1 C C 99.66%
Index 2 G C
Spike-in 1 C A
Spike-in 2 G A
표 5는 바코드 서열 내 EP1 영역이 구아닌(G)으로 고정된 경우, 그 결과를 나타낸 것이다.
EP2 EP1 G(%)
Read Pos 1 Read Pos 2
control Index 1 C G 99.64%
Index 2 G G
Spike-in 1 - -
Spike-in 2 - -
1 Index 1 C G 99.67%
Index 2 G G
Spike-in 1 C C
Spike-in 2 G C
2 Index 1 C G 99.53%
Index 2 G G
Spike-in 1 C T
Spike-in 2 G T
3 Index 1 C G 99.50%
Index 2 G G
Spike-in 1 C A
Spike-in 2 G A
표 6은 바코드 서열 내 EP1 위치가 티민(T)으로 고정된 경우, 그 결과를 나타낸 것이다.
EP2 EP1 T(%)
Read Pos 1 Read Pos 2
control Index 1 C T 99.56%
Index 2 G T
Spike-in 1 - -
Spike-in 2 - -
1 Index 1 C T 99.43%
Index 2 G T
Spike-in 1 C C
Spike-in 2 G C
2 Index 1 C T 99.50%
Index 2 G T
Spike-in 1 C G
Spike-in 2 G G
3 Index 1 C T 99.53%
Index 2 G T
Spike-in 1 C A
Spike-in 2 G A
도 12는 일 구체예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 어댑터 말단 첫번째 염기서열의 고정에 따른 분자 바코딩 교체 수준을 확인한 것이다. 그 결과, 도 12에 나타낸 바와 같이, EP1 영역에 고정된 염기서열의 종류와 관계없이 바코드 분자 바코드 교체율, 즉, 오류율이 1% 미만임을 확인하였다.
3-2. 어댑터 말단 두번째 위치(EP2)
EP2 영역을 A, C, G, 또는 T로 각각 고정하고, EP1 영역은 C, T, G, 또는 A로 설정하여 디자인된 바코드 서열 및 이를 포함하 어댑터 서열을 합성 및 제조하였고, 상기 실시예 2와 동일한 과정으로 실험을 수행한 뒤, 바코드 서열이 변화하지 않은 어댑터의 비율, 분자 바코딩 교체가 발생하지 않은 비율을 산출하였다.
표 7 및 표 8은 바코드 서열 내 EP2 위치가 시토신(C)으로 고정된 경우, 그 결과를 나타낸 것이다.
EP2 EP1 C(%)
Read Pos 1 Read Pos 2
control Index 1 C C 99.787%
Index 2 C T
Index 3 C G
Index 4 C A
Spike-in 1 - -
Spike-in 2 - -
Spike-in 3 - -
Spike-in 4 - -
1 Index 1 C C 99.044%
Index 2 C T
Index 3 C G
Index 4 C A
Spike-in 1 G C
Spike-in 2 G T
Spike-in 3 G G
Spike-in 4 G A
EP2 EP1 C(%)
Read Pos 1 Read Pos 2
control Index 1 C C 99.167%
Index 2 C T
Index 3 C G
Index 4 C A
Spike-in 1 - -
Spike-in 2 - -
Spike-in 3 - -
Spike-in 4 - -
1 Index 1 C C 98.963%
Index 2 C T
Index 3 C G
Index 4 C A
Spike-in 1 G C
Spike-in 2 G T
Spike-in 3 G G
Spike-in 4 G A
표 9 및 표 10은 바코드 서열 내 EP2 위치가 구아닌(G)으로 고정된 경우, 그 결과를 나타낸 것이다.
EP2 EP1 G(%)
Read Pos 1 Read Pos 2
control Index 1 G C 99.262%
Index 2 G T
Index 3 G G
Index 4 G A
Spike-in 1 - -
Spike-in 2 - -
Spike-in 3 - -
Spike-in 4 - -
1 Index 1 G C 99.234%
Index 2 G T
Index 3 G G
Index 4 G A
Spike-in 1 C C
Spike-in 2 C T
Spike-in 3 C G
Spike-in 4 C A
EP2 EP1 G(%)
Read Pos 1 Read Pos 2
control Index 1 G C 99.311%
Index 2 G T
Index 3 G G
Index 4 G A
Spike-in 1 - -
Spike-in 2 - -
Spike-in 3 - -
Spike-in 4 - -
1 Index 1 G C 99.259%
Index 2 G T
Index 3 G G
Index 4 G A
Spike-in 1 C C
Spike-in 2 C T
Spike-in 3 C G
Spike-in 4 C A
도 13는 일 실시예에 따른 바코드 서열의 위치가 어댑터 말단 영역으로 고정된 어댑터를 이용한 PCR 증폭 과정에서, 어댑터 말단 두번째 염기서열의 고정에 따른 분자 바코딩 교체 수준을 확인한 것이다. 그 결과, 도 13에 나타낸 바와 같이, EP2 영역에 고정된 염기서열이 C 또는 G인 경우, 분자 바코드 교체율, 즉, 오류율이 1% 미만임을 확인하였다.
이러한 실험 결과는 일 실시예에 따른 바코드 서열을 포함하는 어댑터는, 분자 바코딩 현상을 감소시킬 수 있고, 구체적으로, 염기서열 분석을 통한 유전 변이 검출 과정에서 변이 검출의 민감도 및 특이도 향상에 기여할 수 있는바, 정밀 의료 기반의 진단/치료 기술 분야에 폭넓게 활용될 수 있음을 나타내는 것이다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다.

Claims (19)

  1. 표적 시료에서 추출 및 절편화된 DNA 절편의 양말단에, 바코드 서열을 포함하는 어댑터를 라이게이션하는 단계;
    상기 라이게이션된 DNA 절편을 단일 가닥으로 분리하는 단계; 및
    상기 어댑터가 라이게이션된 단일 가닥 DNA 절편을 어댑터를 인식하는 프라이머를 사용하여 중합효소연쇄반응을 통해 증폭하는 단계를 포함하는, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법으로서,
    상기 바코드 서열은 1nt 내지 10nt의 길이를 가지고, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열되는 것인, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법.
  2. 청구항 1에 있어서, 상기 핵산 서열 분석은 차세대 염기서열 분석(next generation sequencing: NGS), 표적 염기서열 분석(targeted sequencing), 표적 딥 염기서열 분석(targeted deep sequencing), 또는 패널 염기서열 분석(panel sequenceing)인 것인, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법.
  3. 청구항 1에 있어서, 상기 핵산은 유전체(genome) 또는 그의 절편인 것인, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법.
  4. 청구항 1에 있어서, 상기 어댑터는 40nt 내지 100nt의 길이를 가지고, 1nt 내지 10nt의 길이를 가지는 바코드 서열을 포함하는 것인, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법.
  5. 청구항 1에 있어서, 상기 방법은 복수 개의 DNA 절편을 대상으로 하는 것으로, 복수 개의 어댑터를 포함하고, 상기 어댑터는 DNA 절편의 종류에 따라 상이한 바코드 서열을 포함하는 것인, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법.
  6. 청구항 5에 있어서, 상기 바코드 서열은 DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 서열이 A, T, C, 및 G 중 어느 하나인 것인, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법.
  7. 청구항 5에 있어서, 상기 바코드 서열은 2nt 내지 10nt의 길이를 가지며, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 두번째 서열이 C, 및 G 중 어느 하나인 것인, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법.
  8. 청구항 5에 있어서, 상기 바코드 서열은 2nt 내지 10nt의 길이를 가지며, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 서열이 A, T, C, 및 G 중 어느 하나로 고정되고, 및 어댑터 내 두번째 서열이 C, 및 G 중 어느 하나로 고정된 것인, 핵산 서열 분석을 위한 DNA 라이브러리를 제조하는 방법.
  9. 표적 시료에서 추출 및 절편화된 DNA 절편의 양말단에, 바코드 서열을 포함하는 어댑터를 라이게이션하는 단계를 포함하는, 핵산 서열 분석을 위한 분자 바코딩 방법으로서,
    상기 바코드 서열은 1nt 내지 10nt의 길이를 가지고, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열되는 것인, 핵산 서열 분석을 위한 분자 바코딩 방법.
  10. 청구항 9에 있어서, 상기 어댑터는 40nt 내지 100nt의 길이를 가지고, 1nt 내지 10nt의 길이를 가지는 바코드 서열을 포함하는 것인, 핵산 서열 분석을 위한 분자 바코딩 방법.
  11. 청구항 9에 있어서, 상기 방법은 복수 개의 DNA 절편을 대상으로 하는 것으로, 복수 개의 어댑터를 포함하고, 상기 어댑터는 DNA 절편의 종류에 따라 상이한 바코드 서열을 포함하는 것인, 핵산 서열 분석을 위한 분자 바코딩 방법.
  12. 청구항 11에 있어서, 상기 바코드 서열은 DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 서열이 A, T, C, 및 G 중 어느 하나인 것인, 핵산 서열 분석을 위한 분자 바코딩 방법.
  13. 청구항 11에 있어서, 상기 바코드 서열은 2nt 내지 10nt의 길이를 가지며, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 두번째 서열이 C, 및 G 중 어느 하나인 것인, 핵산 서열 분석을 위한 분자 바코딩 방법.
  14. 청구항 11에 있어서, 상기 바코드 서열은 2nt 내지 10nt의 길이를 가지며, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 서열이 A, T, C, 및 G 중 어느 하나로 고정되고, 및 어댑터 내 두번째 서열이 C, 및 G 중 어느 하나로 고정된 것인, 핵산 서열 분석을 위한 분자 바코딩 방법.
  15. 청구항 9에 있어서, 상기 어댑터를 라이게이션하는 단계 전, 표적 시료에서 추출 및 절편화된 DNA 절편의 말단을 수선(Repair)하는 단계; 및
    상기 말단이 수선된 DNA 절편의 3'말단에 아데닌을 결합시키는 단계를 추가로 포함하는 것인, 핵산 서열 분석을 위한 분자 바코딩 방법.
  16. 중합효소연쇄반응을 위한 프라이머에 대한 상보적인 서열 및 바코드 서열을 포함하는 40nt 내지 100nt의 길이를 갖는 복수 개의 어댑터로서,
    상기 복수 개의 어댑터 각각은 DNA 절편의 종류에 따라 상이한 바코드 서열을 포함하고,
    상기 바코드 서열은 1nt 내지 10nt의 길이를 가지고, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 뉴클레오티드 위치를 포함하도록 배열된 것인, 핵산 서열 분석을 위한 DNA 라이브러리 제조용 조성물.
  17. 청구항 16에 있어서, 상기 바코드 서열은 DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 서열이 A, T, C, 및 G 중 어느 하나인 것인, 핵산 서열 분석을 위한 DNA 라이브러리 제조용 조성물.
  18. 청구항 16에 있어서, 상기 바코드 서열은 2nt 내지 10nt의 길이를 가지며, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 두번째 서열이 C, 및 G 중 어느 하나인 것인, 핵산 서열 분석을 위한 DNA 라이브러리 제조용 조성물.
  19. 청구항 16에 있어서, 상기 바코드 서열은 2nt 내지 10nt의 길이를 가지며, DNA 절편과 라이게이션되는 어댑터의 말단 영역을 기준으로, 어댑터 내 첫번째 서열이 A, T, C, 및 G 중 어느 하나로 고정되고, 및 어댑터 내 두번째 서열이 C, 및 G 중 어느 하나로 고정된 것인, 핵산 서열 분석을 위한 DNA 라이브러리 제조용 조성물.
PCT/KR2021/002492 2021-02-26 2021-02-26 분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도 WO2022181858A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2021/002492 WO2022181858A1 (ko) 2021-02-26 2021-02-26 분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2021/002492 WO2022181858A1 (ko) 2021-02-26 2021-02-26 분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2022181858A1 true WO2022181858A1 (ko) 2022-09-01

Family

ID=83049378

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/002492 WO2022181858A1 (ko) 2021-02-26 2021-02-26 분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도

Country Status (1)

Country Link
WO (1) WO2022181858A1 (ko)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130018575A (ko) * 2011-08-01 2013-02-25 연세대학교 산학협력단 핵산분자의 제조방법
KR20140111224A (ko) * 2013-03-07 2014-09-18 서울대학교산학협력단 이종 dna 바코딩 방법
US20150284712A1 (en) * 2012-11-05 2015-10-08 Rubicon Genomics, Inc. Barcoding nucleic acids
KR20160141680A (ko) * 2015-06-01 2016-12-09 연세대학교 산학협력단 바코드 서열을 포함하는 어댑터를 이용한 차세대 염기서열 분석 방법
KR20170133270A (ko) * 2016-05-25 2017-12-05 주식회사 셀레믹스 분자 바코딩을 이용한 초병렬 시퀀싱을 위한 라이브러리 제조방법 및 그의 용도
US20200123538A1 (en) * 2017-04-19 2020-04-23 Singlera Genomics, Inc. Compositions and methods for library construction and sequence analysis

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130018575A (ko) * 2011-08-01 2013-02-25 연세대학교 산학협력단 핵산분자의 제조방법
US20150284712A1 (en) * 2012-11-05 2015-10-08 Rubicon Genomics, Inc. Barcoding nucleic acids
KR20140111224A (ko) * 2013-03-07 2014-09-18 서울대학교산학협력단 이종 dna 바코딩 방법
KR20160141680A (ko) * 2015-06-01 2016-12-09 연세대학교 산학협력단 바코드 서열을 포함하는 어댑터를 이용한 차세대 염기서열 분석 방법
KR20170133270A (ko) * 2016-05-25 2017-12-05 주식회사 셀레믹스 분자 바코딩을 이용한 초병렬 시퀀싱을 위한 라이브러리 제조방법 및 그의 용도
US20200123538A1 (en) * 2017-04-19 2020-04-23 Singlera Genomics, Inc. Compositions and methods for library construction and sequence analysis

Similar Documents

Publication Publication Date Title
US11453913B2 (en) Safe sequencing system
US20200181694A1 (en) High throughput detection of molecular markers based on aflp and high through-put sequencing
US9745614B2 (en) Reduced representation bisulfite sequencing with diversity adaptors
WO2016195382A1 (ko) 바코드 서열을 포함하는 어댑터를 이용한 차세대 염기서열 분석 방법
WO2017204572A1 (ko) 분자 바코딩을 이용한 초병렬 시퀀싱을 위한 라이브러리 제조방법 및 그의 용도
WO2014163225A1 (ko) 염기 특이 반응성 프라이머를 이용한 핵산 증폭방법
WO2019084245A1 (en) METHODS AND COMPOSITIONS FOR PREPARING NUCLEIC ACID LIBRARIES
WO2022181858A1 (ko) 분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도
WO2022199242A1 (zh) 一组条码接头以及中通量多重单细胞代表性dna甲基化建库和测序方法
WO2022114732A1 (ko) Pcr 과정 동안 생성되는 가닥들의 정보를 연결하여 하나의 클러스터를 만들고, 생성된 가닥들의 생성 순서를 추적할 수 있는 방법
WO2018110940A1 (ko) 차세대 핵산 서열 분석을 위한 라이브러리의 복잡성을 측정하는 방법
JP2023519979A (ja) ゲノム内の構造再編成の検出方法
KR20220122095A (ko) 분자 바코딩 효율을 향상시키기 위한 조성물 및 이의 용도
WO2024049276A1 (ko) 다중 표적 dna의 선택적 증폭용 조성물 및 이를 이용한 증폭 방법
WO2023018024A1 (ko) 현미부수체 지역의 서열 길이의 변화율을 이용한 현미부수체 불안정성 진단방법
WO2023018026A1 (ko) 현미부수체 지역의 서열 길이의 최대값과 최소값의 차이를 이용한 현미부수체 불안정성 진단방법
CN118215744A (zh) 利用等温线性扩增探针的靶标富集和定量

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21928155

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21928155

Country of ref document: EP

Kind code of ref document: A1