WO2022179967A1

WO2022179967A1 - Vadadustat for treating covid-19 in a hospitalized subject

Info

Publication number: WO2022179967A1
Application number: PCT/EP2022/054200
Authority: WO
Inventors: Erding Hu; Janet VAN ADELSBERG
Original assignee: Glaxosmithkline Intellectual Property (No.2) Limited
Priority date: 2021-02-23
Filing date: 2022-02-21
Publication date: 2022-09-01

Abstract

The present disclosure relates to the use of a HIF prolyl hydroxylase inhibitor in various methods of treating of COVID-19 in a subject infected with SARS-CoV-2, including treatment of hospitalised subjects, and treatment of infected patients to reduce hospitalisation and/or viral shedding. Uses of a HIF prolyl hydroxylase inhibitor include to prevent COVID-19 in a close contact of a subject infected with SARS-CoV-2 and to prevent COVID-19 in a subject at risk of infection with SARS-CoV-2 employing intermittent oral administration or inhaled administration are also disclosed.

Description

VADADUSTAT FOR TREATING COVID-19 IN A HOSPITALIZED SUBJECT

FIELD OF THE INVENTION

BACKGROUND TO THE INVENTION

COVID-19 was declared a Public Health Emergency of International Concern on 30 January 2020, following its emergence in China in November 2019.

The infectious agent was rapidly identified to be a coronavirus (initially designated 2019- nCoV2 and more recently designated SARS-CoV-2, Severe Acute Respiratory Syndrome CoronaVirus- 2) capable of spreading by human to human transmission.

The SARS-CoV-2 coronavirus utilises a membrane bound spike (S) protein to bind to a host cell surface receptor, ACE2, to gain cellular entry. The trimeric S protein contains two subunits, SI and S2. The SI subunit contains a fragment called the receptor-binding domain (RED) that is able to bind ACE2.

Diverse SARS-CoV-2 vaccines are available. The majority of vaccines comprise or encode a portion or the whole of the S protein. There is significant concern however, that these vaccines may not provide adequate protection against newly arising variants of SARS-CoV-2 including mutations in the S protein.

Alternative agents that reduce viral entry and replication will have potential to reduce the magnitude of viral infection and may provide benefits in this rapid evolving pandemic.

SUMMARY OF THE INVENTION

In a first aspect, the invention provides a HIF prolyl hydroxylase inhibitor for use in the treatment of COVID-19 in a subject infected with SARS-CoV-2, wherein the subject with COVID-19 is hospitalised. The invention also provides use of a HIF prolyl hydroxylase inhibitor in the manufacture of a medicament for the treatment of COVID-19 in a subject infected with SARS-CoV-2, wherein the subject with COVID-19 is hospitalised.

The invention also provides a method of treatment of a subject with COVID-19 in a subject infected with SARS-CoV-2, with a therapeutically effective amount of a HIF prolyl hydroxylase inhibitor wherein the subject with COVID-19 is hospitalised. In one embodiment, the subject is a human.

In another aspect, the invention provides a HIF prolyl hydroxylase inhibitor for use in preventing hospitalisation of a subject infected with SARS-CoV-2.

The invention also provides use of a HIF prolyl hydroxylase inhibitor in the manufacture of a medicament for use in preventing hospitalisation of a subject infected with SARS-CoV-2.

The invention also provides a method of preventing hospitalisation of a subject infected with SARS- CoV-2, comprising administering a therapeutically effective amount of a HIF prolyl hydroxylase inhibitor to the subject infected with SARS-CoV-2. In one embodiment, the subject is a human.

In another aspect, the invention provides a HIF prolyl hydroxylase inhibitor for use in a method of reduction of viral shedding in a subject infected with SARS-CoV-2.

The invention also provides use of a HIF prolyl hydroxylase inhibitor in the manufacture of a medicament for use in a method of reduction of viral shedding in a subject infected with SARS-CoV- 2.

The invention also provides a method of reduction of viral shedding in a subject infected with SARS- CoV-2, comprising administering a therapeutically effective amount of a HIF prolyl hydroxylase inhibitor to the subject infected with SARS-CoV-2. In one embodiment, the subject is a human.

In particular embodiments, the subject is infected with SARS-CoV-2. Methods for identifying subjects infected with SARS-CoV-2 are known in the art and are in current clinical use. In one embodiment, high-throughput sequencing or real-time reverse-transcriptase polymerase-chain- reaction (RT-PCR) assay of specimens, for example, nasal and pharyngeal swab specimens, may be used to identify subjects with active SARS-CoV-2 infection. In another embodiment, SARS-CoV-2 antigen or subject antibodies directed to SARS-CoV-2 are detected in a sample taken from the subject. In one embodiment, the sample is from nasal and pharyngeal swab specimens or a sample of blood. In addition, the invention provides a method for identifying subjects to be treated in accordance with the methods described herein, the method comprising a step of assaying a specimen from a subject for the presence of SARS-CoV-2 RNA, SARS-CoV-2 antigen or subject antibodies directed to SARS-CoV-2. In some embodiments, where SARS-CoV-2 RNA, SARS-CoV-2 antigen or subject antibodies directed to SARS-CoV-2 is detected, the method may further comprise a treatment step as described herein.

In another aspect, the invention provides a HIF prolyl hydroxylase inhibitor for use in the prevention of COVID-19 in a close contact of a subject infected with SARS-CoV-2.

The invention also provides use of a HIF prolyl hydroxylase inhibitor in the manufacture of a medicament for use in the prevention of COVID-19 in a close contact of a subject infected with SARS-CoV-2.

The invention also provides a method of preventing COVID-19 in a close contact of a subject infected with SARS-CoV-2, comprising administering a therapeutically effective amount of a HIF prolyl hydroxylase inhibitor to the close contact of a subject infected with SARS-CoV-2. In one embodiment, the close contact of a subject is a human.

In another aspect, the invention provides a HIF prolyl hydroxylase inhibitor for use in the prevention of COVID-19 in a subject at risk of infection with SARS-CoV-2, wherein the HIF prolyl hydroxylase is administered by inhalation.

The invention also provides use of a HIF prolyl hydroxylase inhibitor in the manufacture of a medicament for use in the prevention of COVID-19 in a subject at risk of infection with SARS-CoV-2, wherein the HIF prolyl hydroxylase is administered by inhalation.

The invention also provides a method of preventing COVID-19 in a subject at risk of infection with SARS-CoV-2, comprising administering a therapeutically effective amount of a HIF prolyl hydroxylase inhibitor to subject at risk of infection with SARS-CoV-2, wherein the HIF prolyl hydroxylase is administered by inhalation. In one embodiment, the subject is a human.

In another aspect, the invention provides a HIF prolyl hydroxylase inhibitor for use in the prevention of COVID-19 in a subject at risk of infection with SARS-CoV-2, wherein the HIF prolyl hydroxylase is administered intermittently orally. The invention also provides use of a HIF prolyl hydroxylase inhibitor in the manufacture of a medicament for use in the prevention of COVID-19 in a subject at risk of infection with SARS-CoV-2, wherein the HIF prolyl hydroxylase is administered intermittently orally.

The invention also provides a method of preventing COVID-19 in a subject at risk of infection with SARS-CoV-2, comprising administering a therapeutically effective amount of a HIF prolyl hydroxylase inhibitor to subject at risk of infection with SARS-CoV-2, wherein the HIF prolyl hydroxylase is administered intermittently orally. In one embodiment, the subject is a human.

DESCRIPTION OF DRAWINGS/ FIGURES

FIGURE 1 shows haemoglobin concentrations in g/dL in rats following administration of various dosage regimens (A = daily dosing, B = 3X weekly; C = IX weekly) of (2-(4-bromo-2-fluorobenzyl)- 5-hydroxy-6-isopropyl-3-oxo-pyridazine-4-carbonyl)glycine free acid by oral gavage over a 4 week period.

FIGURE 2 is a graph showing mean haemoglobin concentrations in g/L in healthy male subjects following oral dosing with N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]- glycine for 14 days at various dosage regimens.

FIGURE 3 is an overlay of Figure 2A of Provenzano et al., (J. Clin. Pharmacol., 2020, 60 (11): 1432-1440) with the IC50 and IC80 figures for SARS-CoV-2 inhibition by N-[(4-hydroxy-l-methyl- 7-phenoxyisoquinolin-3-yl) carbonyljglycine.

DETAILED DESCRIPTION OF THE INVENTION

A HIF prolyl hydroxylase inhibitor is a compound capable of inhibiting one or more of the human HIF prolyl hydroxylase enzymes PHD 1, 2 and 3. A HIF prolyl hydroxylase inhibitor mimics hypoxia and prevents hydroxylation of one or more proline residues in HIF-l/2a, leading to stabilization of HIF- l/2a protein and activation of FIIF-mediated signalling.

Administration of HIF prolyl hydroxylase inhibitors or exposure to hypoxia result in FIIF-dependent transcription. A large number of target genes are transcribed that contribute to the hypoxic response. Certain genes involved in erythropoiesis, iron metabolism and glycolysis have been confirmed to be genes transcribed by the HIF transcription factor. ACE2 demonstrates bi-phasic regulation in response to hypoxia. Initially, induction is observed, followed by reduction at about 48 hours. The downregulation of ACE2 is mediated, at least in part, by Let7b, which reduces the translation of ACE2 through miRNA-mediated inhibition. Let7b is a HIF target genes and is inducible by hypoxia and HIF prolyl hydroxylase inhibitor treatment. Applicants postulate that administration of HIF prolyl hydroxylase inhibitors could result in a downregulation of ACE2 indirectly via the induction of Let7b. Given ACE2 is the host protein used to gain viral entry, administration of a HIF prolyl hydroxylase inhibitor could reduce levels of viral infection by SARS-CoV-2, and decrease viral infection efficacy and subsequent disease progression Advantageously, unlike most of the vaccines in development, this therapeutic approach is independent of mutational changes in the S protein of SARS-CoV-2.

As mentioned above, HIF prolyl hydroxylases result in a broad transcriptional response, including transcription of erythropoietin, which stimulates erythropoiesis. This underpins the current clinical use of HIF prolyl hydroxylase inhibitors to increase (and subsequently maintain) haemoglobin levels in anemic patients. Whilst some subjects infected with SARS-CoV-2 or at risk for SARS-CoV-2 infection may be anemic, the majority will have haemoglobin levels within normal ranges (Adult male: 13 - 18 g/dL; Adult female: 11.5 - 16.5 g/d L) . The thromboembolism risk when haemoglobin levels exceed 18 g/dLmust be managed in the methods for treatment and prevention of COVID-19.

Healthy volunteers would appear to exhibit a more modest erythropoietic response to HIF prolyl hydroxylase inhibitors compared to patients with anemia of chronic kidney disease. Example 2 shows that healthy subjects treated once daily with doses of up to 100 mg N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine did not result in the haemoglobin levels of the subjects exceeding the upper limit of the normal range. Accordingly, short term use in COVID-19 patients is acceptable. In fact, it has been reported that approximately 51% of COVID-19 patients admitted to hospital (Chen et al,. Lancet, 2020, 395: 507-513) have haemoglobin levels below the normal range, such that modest increases in haemoglobin may be beneficial. For hospitalised patients, monitoring of haemoglobin levels could be routinely accommodated, permitting down-titration of the dose where appropriate and potentially allowing longer term treatment. For infected patients who are not hospitalised, short term use without haemoglobin monitoring could be envisioned to reduce viral load. This is expected to reduce incidence of hospitalisation and reduce viral shedding and infectivity.

Prophylactic use is also envisaged. In some embodiments, short term use could be effective in prophylaxis, for example for close contacts of infected individuals. Longer term use of a dosing regimen capable of preventing SARS-CoV2 infection are also provided employing intermittent oral dosing or inhaled administration. These dosing regimen minimise haemoglobin rises. Example 1 demonstrates that intermittent oral dosing with HIF prolyl hydroxylase inhibitors can reduce erythropoietic response. Example 3 shows a model to predict a suitable inhaled dose of N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine. Due to subject variability, monitoring of haemoglobin levels during prolonged use remains advisable. Monitoring of haemoglobin levels could be done routinely in certain at risk populations, such as healthcare professionals or hospitalised subjects.

DEFINITIONS

SARS-CoV-2 is a beta coronavirus having greater than 90% sequence identity at the RNA level with any one of the sequences deposited in the China National Microbiological Data Centre under accession number NMDC10013002, or greater than 90% sequence identity at the RNA level with any one of the sequences deposited in the Global Initiative on Sharing All Influenza Data (GISAID) under reference NC_045512.2 SARS-CoV-3 Wuhan genome (Coronaviridae Study Group of the International Committee on Taxonomy of Viruses, 2020). In another embodiment, the SARS-CoV-2 coronavirus has greater than 95% sequence identity at the RNA level with any one of the sequences deposited in the China National Microbiological Data Centre under accession number NMDC10013002 or with reference NCJD45512.2 SARS-CoV-3 Wuhan genome (GISAID). In other embodiments, the SARS- CoV-2 coronavirus has greater than 96% sequence identity, greater than 97% sequence identity, greater than 98% sequence identity or greater than 99% sequence identity at the RNA level with any one of the sequences deposited in the China National Microbiological Data Centre under accession number NMDC10013002 or with reference NCJD45512.2 SARS-CoV-3 Wuhan genome (GISAID). The definition is intended to cover all strains of SARS-CoV-2 currently in circulation including strains in the L, S, G, GH, GR, GV, V and O clades (S clade has a T at position 8782 and a C at position 28144; L clade has a C at position 8782 and a T at position 28144; G clade has a G at position 23403 (A23403G); GH clade has a T at position 25563 (G25563T); GR clade has a AAC for GGG starting at position 28881 (GGG28881AAC); clade V has a T at position 26144 (ORG2a:G251V); and O has sequence variations and mutations not defined by clades L, S, G, GH, GR or V), with numbering relating to the reference genome of SARS-CoV-2 (NCJD45512)) as well as future arising strains. The definition encompasses SARS-CoV-2 variants of particular clinical concern, including the Bl.1.7 variant (Alpha), the P.l. variant (Gamma), the B.1.351 variant (Beta), the B.1.617.2 variant (Delta) and the B 1.1.529 variant (Omicron).

COVID-19 refers to the collection of symptoms exhibited by patients infected with SARS-CoV-2 . Symptoms typically include cough, fever and shortness of breath (dyspnoea) although some patients are asymptomatic, in which case COVID19 refers to SARS-CoV-2 infection alone.

Treatment of COVID-19 refers to a reduction in the viral load of SARS-CoV-2 and/or to a reduction in the viral titre of SARS-CoV-2 , and/or to a reduction in the severity or duration of the symptoms of the disease. Viral load may be measured by a suitable quantitative RT-PCR assay from a specimen from the patient. In one embodiment, the specimen may be a specimen from the upper or lower respiratory tract (such as a nasopharyneal or oropharyngeal swab, sputum, lower respiratory tract aspirates, bronchoalveolar lavage, bronchial biopsy, transbronchial biopsy and nasopharyngeal wash/spirate or nasal aspirate) saliva or plasma. In a more particular embodiment, the specimen is saliva. The protocols of a number of quantitative RT-PCR assays are published on https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory- guidance. In addition, Corman and colleagues have published primers and probes for use in such assays (Corman et al., European communicable disease bulletin, 2020, DOI: 10.2807/1560-7917).

In one embodiment, the COVID-19 RdRp/Hel assay is used. This has been validated with clinical specimens and has a limit of detection of 1.8 TCIDso/ml with genomic RNA and 11.2 RNA copies/ reaction with in vitro RNA transcripts. (Chan et al., J Clin Microbiol., 2020, doi:10.1128/JCM.00310-20). Viral titre may be measured by assays well known in the art.

In one embodiment, treatment of COVID-19 refers to at least a 5 fold, 10 fold, 50 fold, 100 fold, 500 fold or 1000 fold reduction in the viral load (RNA copies/ml) measured by the same assay from a specimen from the same origin taken prior to treatment (baseline) and the end of the treatment period in a single patient. In another embodiment, treatment of COVID-19 refers to the situation where the mean viral load (RNA copies/ml) from specimens of the same origin from 30 patients measured in the same assay being reduced by at least 5 fold, 10 fold, 50 fold, 100 fold, 500 fold or 1000 fold at the end of the treatment period compared to baseline.

In one embodiment, treatment of COVID-19 refers to the viral load being decreased to below the limit of detection of the 19 RdRp/Hel assay at the end of the treatment period.

In embodiments where COVID-19 is associated with pneumonia or Acute Respiratory Disorder Syndrome (ARDS), treatment of COVID-19 can refer to an improvement in the symptoms of pneumonia or ARDS.

In embodiments where COVID-19 is associated with Acute Respiratory Disorder Syndrome (ARDS), treatment of COVID-19 can refer to an improvement in the symptoms of ARDS. In particular embodiments, treatment of COVID-19 associated with ARDS can refer to a reduction in the duration of mechanical ventilation or a reduction in mortality over the treatment period. In particular embodiments, the treatment period is 7 days, 14 days, 21 days or 28 days. In one embodiment, the treatment period is 7 days. In one embodiment, the treatment period is 14 days. In this embodiment, the duration of mechanical ventilation may be defined as the time elapsed from the initiation of ventilatory support to the onset of weaning.The onset of weaning is the time that the physician in charge considered the patient likely to resume and sustain spontaneous breathing. Weaning may be performed by either a reduction in the level of ventilator support or a trial of spontaneous breathing. In one embodiment, treatment of COVID-19 associated with ARDS refers to a mean reduction of at least 1 day in the duration of mechanical ventilation.

Viral shedding can be measured by any suitable method. In one embodiment, viral shedding is measured by measuring viral load in a specimen from the upper or lower respiratory tract. A reduction in viral shedding refers to the situation where the mean viral load is reduced in a population of subjects treated with a HIF prolyl hydroxylase inhibitor compared to a population of untreated subjects. The comparison requires that both samples are from the same origin (upper or lower respiratory tract) and that they are measured at a comparable time. In one embodiment, where the subjects were asymptomatic at the time SARS-CoV-2 infection was identified, the measurement may be taken at a time period based upon the date of the test (for example, 1 week,

2 weeks, 3 weeks or 4 weeks). In one embodiment, where the subjects were symptomatic when SARS-CoV-2 infection was identified, the measurement may be taken at a time period based upon the date of first symptoms (for example, 1 week, 2 weeks, 3 weeks or 4 weeks). In one embodiment, the reduction in mean viral load is statistically significant at P < 0.05.

Preventing hospitalisation is achieved when the numbers of subjects infected with SARS-CoV-2 that are subsequently hospitalised are reduced in those subjects receiving treatment with a HIF prolyl hydroxylase inhibitor compared to untreated subjects. In one embodiment, the difference in numbers is statistically significant at P < 0.05.

Prevention of COVID-19 is interpreted in accordance with the usual meaning of the word "prevent".

High risk categories include the following: subjects of 60 years of age and over; subjects having a body mass index [BMI] >35, smokers, subjects having a chronic medical condition including heart disease, lung disease, diabetes, cancer or high blood pressure; immunocompromised subjects such as subjects undergoing treatment for cancer or autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis and inflammatory bowel disease, subjects having a transplant and HIV positive individuals. In a particular embodiment, high risk categories includes subjects over 65 years of age or subjects having a BMI > 35. In another embodiment, high risk categories include subjects in hospital.

Close contacts of a subject infected with SARS-CoV-2 are defined as subjects meeting one or more of the following criteria: a) Subjects who were within 2 metres of the subject infected with SARS-CoV-2 for a cumulative total of 15 minutes or more, over a 24-hour period starting from 2 days before illness onset (or, for asymptomatic patients, 2 days prior to test specimen collection) until the time the subject infected with SRS-CoV-2 is isolated; b) Subjects who were within one metre of the subject infected with SARS-CoV-2 for one minute or longer in the period from 2 days before illness onset (or, for asymptomatic patients, 2 days prior to test specimen collection) until the time the subject infected with SRS-CoV-2 is isolated; c) Subjects having had face-to-face contact with the subject infected with SARS-CoV-2 in the period starting from 2 days before illness onset (or, for asymptomatic patients, 2 days prior to test specimen collection) until the time the subject infected with SRS-CoV-2 is isolated, including being coughed on or having a face-to-face conversation within one metre; d) Subjects who travelled in the same vehicle or a plane as the subject infected with SARS-CoV-2 in the period starting from 2 days before illness onset (or, for asymptomatic patients, 2 days prior to test specimen collection) until the time the subject infected with SRS-CoV-2 is isolated.

IDENTIFICATION OF SUBJECTS INFECTED WITH SARS-CoV-2

Subjects infected with SARS-CoV-2 may be identified by detection of viral RNA from SARS-CoV-2 from a specimen obtained from the subject. Without intending to be limiting, the specimen may be a specimen from the upper or lower respiratory tract (such as a nasopharyneal or oropharyngeal swab, sputum, lower respiratory tract aspirates, bronchoalveolar lavage and nasopharyngeal wash/spirate or nasal aspirate). Any known methods of RNA detection may be used, such as high- throughput sequencing or real-time reverse-transcriptase polymerase-chain-reaction (RT-PCR) assay. In one embodiment, the method comprises the following steps: a) Isolating RNA from a specimen; b) Reverse transcription of the RNA; c) Amplification with forward and reverse primers in the presence of a probe; and d) Detection of the probe; wherein the presence of SARS-CoV-2 is confirmed if the cycle threshold growth curves cross the threshold within 40 cycles.

In a more particular embodiment, step c) utilises the following:

Fwd Primer 5' GACCCCAAAATCAGCGAAAT 3'

Rev Primer 5' TCTGGTTACTGCCAGTTGAATCTG 3'

Probe 5' FAM -ACCCCGCATT ACGTTTGGTGG ACC-BHQ- 1 3'

In an alternative embodiment, step c) utilises the following:

Fwd Primer 5' TTACAAACATTGGCCGCAAA 3' Rev Primer 5' GCGCGACATTCCGAAGAA 3' Probe 5' FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ-1 3'

These primers and probes are commercially available from Integrated DNA Technologies (Catalogue No. 10006606) and BioSearch Technologies (Catalogue No. KGT-nCoV-PPl-lOOO). Detailed instructions for performing real-time reverse-transcriptase polymerase-chain-reaction (RT-PCR) assay using these primers has been published by the CDC (https://www.cdc.gov/coronavirus/2019- nCoV/lab/index.html).

Accordingly, in one embodiment, the invention comprises a method for treating COVID-19 in a subject comprising a method of detecting viral RNA from SARS-CoV-2 from a specimen obtained from the subject and, where viral RNA is detected, a step of treating COVID-19 as described herein.

In one aspect, the invention provides a method for testing for SARS-CoV-2 in a subject and treating SARS-CoV-2 infection in the subject, which method comprises the following steps: a) Isolating RNA from a specimen derived from a subject; b) Reverse transcription of the RNA; c) Amplification with forward and reverse primers in the presence of a probe; and d) Detection of the probe; wherein the subject is defined as having SARS-CoV-2 infection if the cycle threshold growth curves cross the threshold within 40 cycles; and e) treating the subject having SARS-CoV-2 infection as described herein.

In specific embodiments of this method, the subject is human, and the specimen and/or the primers and probe are as described above. The treatment may also be conducted as described herein.

In some embodiments, the method of identification of subjects infected with SARS-CoV-2 is capable of identifying the strain of SARS-CoV-2 or mutations in the SARS-CoV-2 coronavirus with which the subject is infected. In one embodiment, the method described herein could include a further step of sequencing amplified cDNA.

In an alternative embodiment, subjects infected with SARS-CoV-2 may be identified by detection of an SARS-CoV-2 antigen or subject antibodies directed to SARS-CoV-2 in a sample of blood taken from the subject. In one embodiment, subjects infected with SARS-CoV-2 may be identified by detection of an SARS-CoV-2 antigens in a sample of blood taken from the subject. Any suitable assay may be used. Kits for conducting such serological assays are already commercially available, e.g. from Biomerica and Pharmact. Details of performance of authorised serology tests is available on https://www.fda.gov/medical-devices/coronavirus-disease-2019-covid-19-emergency-use- authorizations-medical-devices/eua-authorized-serology-test-performance.

In one embodiment, the assay to identify subjects infected with SARS-CoV-2 comprises: a) contacting at least one immobilised antigen from SARS-CoV-2 with blood from the subject; and b) detection of a complex formed between subject antibodies directed to the immobilised antigen and the immobilised antigen; where the the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b).

In a particular embodiment of this assay, the antigen from SARS-CoV-2 is selected from the N-protein and the S protein or fragments thereof. In a more particular embodiment, the the antigen from SARS- CoV-2 is selected from the N-protein, the SI domain of the S protein and the S2 domain of the S protein. In one embodiment, the assay comprises more than one immobilised antigen.

In one embodiment, there is a step of washing the immobilised antigen after step a) and before step b).

In one embodiment, the detection step b) comprises contacting the complex formed with a labelled antibody or antibodies recognising the same antigen or antigens followed by detection of the label. In a more particular embodiment, the complex is washed after addition of labelled antibody(ies) prior to detection of the label.

In one embodiment, the label is capable of producing a coloured product, enabling visual detection of the label.

In one embodiment, the assay is a lateral flow assay. In more particular embodiment, the lateral flow assay has the immobilised antigen(s) on a dipstick.

In one embodiment, the invention provides a method for testing for SARS-CoV-2 in a subject and treating SARS-CoV-2 infection in the subject, which method comprises the following steps: a) contacting at least one immobilised antigen from SARS-CoV-2 with blood from the subject; and b) detecting a complex formed between subject antibodies directed to the immobilised antigen and the immobilised antigen; where the the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b); and treating the subject having SARS-CoV-2 infection with a therapeutically effective of a HIF prolyl hydroxylase inhibitor. In specific embodiments of this method, the subject is human, and the assay is conducted as as described above. The treatment may also be conducted as described herein.

In one embodiment, the assay to identify subjects infected with SARS-CoV-2 comprises: a) contacting an immobilised antibody recognising an antigen from SARS-CoV-2 with blood from the subject; and b) detection of a complex formed between an antigen from SARS-CoV-2 and the immobilised antibody recognising said antigen; where the the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b).

In a particular embodiment of this assay, the antigen from SARS-CoV-2 is selected from the N-protein and the S protein or fragments thereof. In a more particular embodiment, the the antigen from SARS- CoV-2 is selected from the N-protein, the SI domain of the S protein and the S2 domain of the S protein. In one embodiment, the assay comprises more than one immobilised antibody, each antibody recognising a different antigen.

In one embodiment, there is a step of washing the immobilised antibody after step a) and before step b).

In one embodiment, the detection step b) comprises contacting the complex formed in step a) with labelled antibodies recognising the same antigen or antigens followed by detection of the label. In a more particular embodiment, step b) comprises a step of washing prior to detection of the label.

In one embodiment, the assay is a lateral flow assay. In more particular embodiment, the lateral flow assay has the immobilised antibod(ies) on a dipstick. In one embodiment, the invention provides a method for testing for and treating SARS-CoV-2 infection, which method comprises the following steps: a) contacting an immobilised antibody recognising an antigen from SARS-CoV-2 with blood from the subject; and b) detecting of a complex formed between an antigen from SARS-CoV-2 and the immobilised antibody recognising said antigen; where the the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b), and treating the subject having SARS-CoV-2 infection with a therapeutically effective amount of a compound selected from:

In specific embodiments of this method, the subject is human, and the assay is conducted as described above. The treatment may also be conducted as described herein.

THERAPEUTIC USE

In one aspect of the invention, the invention provides a HIF prolyl hydroxylase inhibitor for use in the treatment of COVID-19 in a subject infected with SARS-CoV-2, wherein the subject with COVID- 19 is hospitalised.

In one embodiment, treatment is initiated upon hospitalisation for COVID-19, for example, within 24 hours of hospital admission or within 36 hours of hospital admission.

In one embodiment, the subject is hospitalised and has blood IL-6 levels greater than 35 pg/mL on admission. In more particular embodiments, the subject is hospitalised and has blood IL-6 levels greater than 50 pg/mL, greater than 65 pg/mL, greater than 80- pg/mL or greater than 210 pg/mL on admission.

In one embodiment, the subject is hospitalised and has blood CRP levels greater than 32.5 mg/L on admission. In more particular embodiments, the subject is hospitalised and has blood CRP levels greater than 40 mg/mL or greater than 97 mg/mL on admission.

In one embodiment, the subject infected with SARS-CoV-2 is associated with pneumonia. In a more particular embodiment, the subject infected with SARS-CoV-2 has one or more of a MuLBSTA score of >12, a CURB-65 score of >2 and a PSI score > 70. In other embodiments, the subject infected with SARS-CoV-2 meets one or more of the following criteria: pulse > 125/minute, respiratory rate >30/minute, blood oxygen saturation <93%, PaCh/FiCb ratio <300 mmHg, peripheral blood lymphocyte count <0.8*10^9/L, systolic blood pressure <90 mmHg, temperature <35 or >40°C, arterial pH < 7.35, blood urea nitrogen > 30 mg/dl, partial pressure of arterial O2 < 60 mmHg, pleural effusion, lung infiltrates >50% of the lung field within 24-48 hours. In one embodiment, the subject infected with SARS-CoV-2 has a blood oxygen saturation <93%. For the avoidance of doubt, blood oxygen saturation measurements refer to blood oxygen saturation while breathing air prior to the onset of treatment. Blood oxygen saturation may be measured by methods known in the art e.g. pulse oximetry.

In one embodiment, the COVID-19 in the subject infected with SARS-CoV-2 is associated with Acute Respiratory Distress Syndrome (ARDS). In a more particular embodiment, the subject infected with SARS-CoV-2 has a Murray Score of >2. In another embodiment, the subject infected with SARS-CoV- 2 has a PaCte/FiCte ratio < 200 mmFIg. In a more particular embodiment, the subject infected with SARS-CoV-2 has a PaCte/FiCte ratio < 100 mmFIg. In another embodiment, the patient has a corrected expired volume per minute >10 L/min. In another embodiment, the subject infected with SARS-CoV- 2 has respiratory system compliance <40 ml_/cm FhO, In another embodiment, the subject infected with SARS-CoV-2 has positive end-expiratory pressure >10 cm FhO. In one embodiment, the subject infected with SARS-CoV-2 has a blood oxygen saturation <93%. For the avoidance of doubt, blood oxygen saturation measurements refer to blood oxygen saturation while breathing air prior to the onset of treatment. Blood oxygen saturation may be measured by methods known in the art e.g. pulse oximetry.

In one embodiment, the subject infected with SARS-CoV-2 is undergoing extra-corporeal membrane oxygenation or mechanical ventilation, non-invasive ventilation, or receiving oxygen therapy (for example, via nasal cannula or simple mask). Where mechanical ventilation is used, this includes use of low tidal volumes (<6 ml/kg ideal body weight) and airway pressures (plateau pressure <30 cmFhO). Where oxygen supplementation is via a nasal cannula, this may be delivered as 2 to 6 l/minute. Where oxygen supplementation is by a simple mask, this may be delivered at 5 to 10 l/minute.

Dosing regimen for use in hospitalised patients are expected to be short term. In one embodiment, dosing is continued for no longer than 4 weeks. In more particular embodiments, dosing is continued for 3 weeks, 2 weeks or 1 week. If dosing is continued beyond 4 weeks, it is recommended that haemoglobin concentrations are determined periodically (for example, weekly) during the treatment period by methods known in the art e.g., FlemoCue. Where haemoglobin levels exceed the upper limit of the normal haemoglobin range, therapy can be ceased until haemoglobin levels are within normal ranges, before re-commencing at a lower dose.

In one embodiment, the FHIF prolyl hydroxylase inhibitor is administered orally. In one embodiment, the invention provides a dosing regimen for oral administration of N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceuticaly acceptable salt thereof for use in hospitalised patients. In one embodiment, N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 100 mg (based on the weight of the free acid) daily.

In a more particular embodiment, N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5- pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 1, 2, 4, 6, 10 and 16 and 24 mg (based on the weight of the free acid).

In one embodiment, the invention provides a dosing regimen for oral administration of N-[(4-hydroxy- l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine or a pharmaceutically acceptable salt thereof for use in hospitalised patients. In one embodiment, the N-[(4-hydroxy-l-methyl-7- phenoxyisoquinolin-3-yl) carbonyl]glycine or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 100 mg (based on the weight of the free acid) daily. Evidence supporting this dosing is provided in Example 4.

In a more particular embodiment, N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 20, 50 and 100 mg (based on the weight of the free acid).

In one embodiment, the invention provides a dosing regimen for oral administration of 2-{[5-(3- chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid (this compound may alternatively be named {[5-(3-ch!orophenyl)-3-hydroxypyridine-2-carbonyl]amino}acetic acid or vadadustat) or a pharmaceutically acceptable salt thereof for use in hospitalised patients. In one embodiment, the 2- {[5-(3-chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof is administered orally at a dose of from 150 mg to 1800 mg (based on the weight of the free acid) daily. In one embodiment, the 2-{[5-(3-chlorophenyl)-3-hydroxypyridin-2- yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof is administered orally at a dose of from 900 mg to 1800 mg (based on the weight of the free acid) daily. In one embodiment, the 2-{[5-(3-chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof is administered orally at a dose of 900 mg (based on the weight of the free acid) daily. In another embodiment, the 2-{[5-(3-chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof is administered orally at a dose of 600 mg (based on the weight of the free acid) daily.

In one embodiment, 2-{[5-(3-chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 300 mg or 600 mg (based on the weight of the free acid).

In one embodiment, the invention provides a dosing regimen for oral administration of N-[[l- (cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3-quinolinyl]carbonyl]-glycine or a pharmaceutically acceptable salt thereof for use in hospitalised patients. In one embodiment, the N-[[l-(cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3-quinolinyl]carbonyl]-glycine or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 200 mg (based on the weight of the free acid) daily.

In a more particular embodiment, N-[[l-(cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3- quinolinyl]carbonyl]-glycine or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 100, 150 and 200 mg (based on the weight of the free acid).

In one embodiment, the invention provides a dosing regimen for oral administration of 2-{[7-hydroxy- 5-(2-phenylethyl)-[l,2,4]triazolo[l,5-a]pyridin-8-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use in hospitalised patients. In one embodiment, the 2-{[7-hydroxy-5- (2-phenylethyl)-[l,2,4]triazolo[l,5-a]pyridin-8-yl]formamido}acetic acidor a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 8 mg (based on the weight of the free acid) daily.

In a more particular embodiment, 2-{[7-hydroxy-5-(2-phenylethyl)-[l,2,4]triazolo[l,5-a]pyridin-8- yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 2, 4, 6 and 8 mg (based on the weight of the free acid).

In one embodiment, the invention provides a dosing regimen for oral administration of 2-[6- (morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof for use in hospitalised patients. In one embodiment, the 2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 200 mg (based on the weight of the free acid) daily. In a more particular embodiment, 2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3- dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 5, 12.5, 25, 50, 75, 100, 150 and 200 mg (based on the weight of the free acid).

In one embodiment, the subject infected with SARS-CoV-2 is receiving anti-viral treatment. In a more particular embodiment, the anti-viral agent is selected from olsetemivir, remdesivir, ganciclovir, lopinavir, ritonavir, zanamivir, nirmatrelvir and molnupiravir. In a more particular embodiment, the anti-viral agent is selected from olsetemivir, remdesivir, ganciclovir, lopinavir, ritonavir and zanamivir. In one embodiment, the patient is receiving oseltamivir (75 mg every 12 h orally). In another embodiment, the subject infected with SARS-CoV-2 is receiving ganciclovir (0.25 g every 12 h intravenously). In another embodiment, the subject infected with SARS-CoV-2 is receiving lopinavir/ ritonavir (400/100 mg twice daily orally). In a further embodiment, the subject infected with SARS-CoV-2 is receiving remdesivir (100 mg daily intravenously). In one embodiment, the subject infected with SARS-CoV-2 is receiving remdesivir (100 mg daily intravenously) and dexamethasone (6 mg once daily, orally or intravenously). In one embodiment, the subject infected with SARS-CoV-2 is receiving nirmatrelvir (300 mg daily orally) and ritonivir (100 mg once daily orally). In one embodiment, the subject infected with SARS-CoV-2 is receiving molnupiravir (800 mg twice daily orally).

In one embodiment, the subject infected with SARS-CoV-2 is receiving treatment with steroids. In a more particular embodiment, the steroid is selected from dexamethasone, prednisone, methylprednisone and hydrocortisone. In one embodiment, the subject infected with SARS-CoV-2 is receiving dexamethasone (6 mg once daily, orally or intravenously). In one embodiment, the subject infected with SARS-CoV-2 is receiving prednisone (40 mg daily, in two divided doses). In one embodiment, the subject infected with SARS-CoV-2 is receiving methylprednisone (32 mg daily, in two divided doses). In one embodiment, the subject infected with SARS-CoV-2 is receiving hydrocortisone (160 mg daily, in two to four divided doses). In one embodiment, the subject receiving treatment with any of the above steroids is a subject receiving mechanical ventilation or supplemental oxygen.

In one embodiment, the subject infected with SARS-CoV-2 is receiving treatment with baracitinib. The dose of baracitinib recommended depends upon the eGFR as follows:

• eGFR >60 mL/min/1.73 m²: Baricitinib 4 mg PO once daily

• eGFR 30 to <60 mL/min/1.73 m²: Baricitinib 2 mg PO once daily

• eGFR 15 to <30 mL/min/1.73 m²: Baricitinib 1 mg PO once daily eGFR <15 mL/min/1.73 m²: Baricitinib is not recommended.

In one embodiment, the subject infected with SARS-CoV-2 is receiving treatment with tocilizumab (8 mg/kg intravenously), or tocilizumab (8 mg/kg intravenously) in combination with dexamethasone (6 mg once daily, orally or intravenously).

In one embodiment, the subject infected with SARS-CoV-2 is receiving treatment with a SARS-CoV-2 neutralizing antibody. In a more particular embodiment, the subject infected with SARS-CoV-2 is receiving bamlanivimab (for example at a dose of 700 mg, 2800 mg or 7000 mg by iv infusion). In another embodiment, the subject infected with SARS-CoV-2 is receiving casirivimab and imdevimab, for example, at a dose of either 1200 mg for each antibody or at a dose of 4000 mg for each antibody.

In one embodiment, the subject infected with SARS-CoV-2 is receiving convalescent plasma therapy. Blood is collected from an ABO compatible donor after at least 3 weeks post onset of illness and 4 days post discharge and plasma is prepared by apheresis. In one embodiment, the plasma has a neutralizing antibody titer of 1:640 or above, as measured by the plaque reduction neutralization test using SARS-CoV-2 virus. In one embodiment, the dose of convalescent plasma is 200 ml.

In one embodiment, the subject infected with SARS-CoV-2 is infected with a variant of SARS-CoV-2 selected from the group consisting of: the Bl.1.7 variant, the P.l. variant, the B.1.351 variant, the B.l.617.2 variant and the B.1.1.529 variant. In another embodiment, the subject infected with SARS-CoV-2 is infected with a variant of SARS-CoV-2 selected from the group consisting of: the Bl.1.7 variant, the P.l. variant, and the B.1.351 variant.

In one embodiment, the SARS-CoV-2 coronavirus comprises one or more mutations in the S-protein selected from the group consisting of: 69-70del, P681H, P681R, L452R, T478K, Y453F, K417N, K417T, N440K, S477N, D614G, E484K and N501Y (numbering based on the Wuhan genome (NC_045512.2)). In a more particular embodiment, the SARS-CoV-2 coronavirus comprises one or more mutations in the S-protein selected from the group consisting of: 69-71del, P681H, Y453F, K417N, D614G, E484K and N501Y (numbering based on the Wuhan genome (NC_045512.2)). In one embodiment, the SARS-CoV-2 coronavirus comprises the N501Y mutation in the S protein (numbering based on the Wuhan genome (NC_045512.2)). In one embodiment, the SARS-CoV-2 coronavirus comprises the E484K mutation in the S protein (numbering based on the Wuhan genome (NC_045512.2)). In one embodiment, the SARS-CoV-2 coronavirus comprises the D614G mutation in the S protein (numbering based on the Wuhan genome (NC_045512.2)). In other aspects, the invention provides a HIF prolyl hydroxylase inhibitor for use in preventing hospitalisation of a patient infected with SARS-CoV-2 and a HIF prolyl hydroxylase inhibitor for use in a method of reduction of viral shedding in a patient infected with SARS-CoV-2.

In particular embodiments, treatment is initated within 24 hours of the onset of symptoms, or within 24 hours of being tested positive for SARS-CoV-2 infection, using for example, a method defined herein. In one embodiment, the subject infected with SARS-CoV-2 is in a high risk category, as defined above.

Dosing regimen for use in these subjects are expected to be short term, given the difficulties associated with monitoring haemoglobin levels. In one embodiment, dosing is continued for no longer than 4 weeks. In more particular embodiments, dosing is continued for 3 weeks, 2 weeks or 1 week.

In one embodiment, the invention provides a dosing regimen for oral administration of N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceuticaly acceptable salt thereof for use in preventing hospitalisation or reducing viral shedding. In one embodiment, N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 100 mg (based on the weight of the free acid) daily.

In one embodiment, the invention provides a dosing regimen for oral administration of N-[(4-hydroxy- l-methyl-7-phenoxyisoquinolin-3-yl) carbonyljglycine or a pharmaceutically acceptable salt thereof for use in preventing hospitalisation or reducing viral shedding. In one embodiment, the N-[(4- hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyljglycine or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 100 mg (based on the weight of the free acid) daily.

In a more particular embodiment, N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyljglycine or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 20, 50 and 100 mg (based on the weight of the free acid). In one embodiment, the invention provides a dosing regimen for oral administration of 2-{[5-(3- chlorophenyl)-3-hydroxypyridin-2-yi]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use in preventing hospitalisation or reducing viral shedding. In one embodiment, the 2- {[5-(3-chlorophenyi)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 600 mg (based on the weight of the free acid) daily.

In a more particular embodiment, 2-{[5-(3-chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 300 mg or 600 mg (based on the weight of the free acid).

In one embodiment, the invention provides a dosing regimen for oral administration of N-[[l- (cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3-quinolinyl]carbonyl]-glycine or a pharmaceutically acceptable salt thereof for use in preventing hospitalisation or reducing viral shedding. In one embodiment, the N-[[l-(cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3- quinolinyl]carbonyl]-glycine or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 200 mg (based on the weight of the free acid) daily.

In one embodiment, the invention provides a dosing regimen for oral administration of 2-{[7-hydroxy- 5-(2-phenylethyl)-[l,2,4]triazolo[l,5-a]pyridin-8-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use in preventing hospitalisation or reducing viral shedding. In one embodiment, the 2-{[7-hydroxy-5-(2-phenylethyl)-[l,2,4]triazolo[l,5-a]pyridin-8- yl]formamido}acetic acidor a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 8 mg (based on the weight of the free acid) daily.

In one embodiment, the invention provides a dosing regimen for oral administration of 2-[6- (morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof for use in preventing hospitalisation or reducing viral shedding. In one embodiment, the 2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3- dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 200 mg (based on the weight of the free acid) daily.

In a more particular embodiment, 2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3- dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 5, 12.5, 25, 50, 75, 100, 150 and 200 mg (based on the weight of the free acid).

In one embodiment, the HIF prolyl hydroxylase inhibitor is administered by inhalation. In a more particular embodiment, the HIF prolyl hydroxylase inhibitor is administered by inhalation in the range of 2-6 mg once or twice daily. In a particular embodiment, the HIF prolyl hydroxylase inhibitor is N- [(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof, N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine or a pharmaceutically acceptable salt thereof or 2-[6-(morpho!in-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol- 1 -yi)-2,3-d ihyd ro-1 H-pyrazol-3-one or a pharmaceutically acceptable salt thereof.

In a particular embodiment, the dose of N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5- pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof (based on the weight of the free acid) administered by inhalation is in the range of 2-6 mg once or twice daily. In one embodiment N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof is administered by inhalation at a dose of between 2 -6 mg (based on the weight of the free acid) once daily. In another embodiment, N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof is administered by inhalation at a dose of between 2-6 mg (based on the weight of the free acid) twice daily.

In one embodiment, the SARS-CoV-2 coronavirus comprises one or more mutations in the S-protein selected from the group consisting of: 69-70del, P681H, P681R, L452R, T478K, Y453F, K417N, K417T, N440K, S477N, D614G, E484K and N501Y (numbering based on the Wuhan genome (NC_045512.2)). In a more particular embodiment, the SARS-CoV-2 coronavirus comprises one or more mutations in the S-protein selected from the group consisting of: 69-71del, P681H, Y453F, K417N, D614G, E484K and N501Y (numbering based on the Wuhan genome (NC_045512.2)). In one embodiment, the SARS-CoV-2 coronavirus comprises the N501Y mutation in the S protein (numbering based on the Wuhan genome (NC_045512.2)). In one embodiment, the SARS-CoV-2 coronavirus comprises the E484K mutation in the S protein (numbering based on the Wuhan genome (NC_045512.2)). In one embodiment, the SARS-CoV-2 coronavirus comprises the D614G mutation in the S protein (numbering based on the Wuhan genome (NC_045512.2)).

PROPHYLACTIC USE

In one aspect of the invention, the invention provides a HIF prolyl hydroxylase inhibitor for use in the prevention of COVID-19 in a close contact of a subject infected with SARS-CoV-2.

In particular embodiments, treatment is initated within 24 hours after the subject infected with SARS- CoV-2 being tested positive for SARS-CoV-2 infection, using for example, the method defined herein.

In one embodiment, the subject infected with SARS-CoV-2 is in a high risk category, as defined above.

Dosing regimen for use in close contacts are expected to be short term, given the difficulties associated with monitoring haemoglobin levels. In one embodiment, dosing is continued for no longer than 4 weeks. In more particular embodiments, dosing is continued for 3 weeks, 2 weeks or 1 week.

In one embodiment, the invention provides a dosing regimen for oral administration of N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceuticaly acceptable salt thereof for use in the prevention of COVID-19 in a close contact. In one embodiment, N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 100 mg (based on the weight of the free acid) daily.

In one embodiment, the invention provides a dosing regimen for oral administration of N-[(4-hydroxy- l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine or a pharmaceutically acceptable salt thereof for use in the prevention of COVID-19 in a close contact. In one embodiment, the N-[(4-hydroxy-l- methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 100 mg (based on the weight of the free acid) daily.

In one embodiment, the invention provides a dosing regimen for oral administration of 2-{[5-(3- chlorophenyl)-3-hydroxypyridin-2-yi]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use in the prevention of COVID-19 in a close contact. In one embodiment, the 2-{[5-(3- chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 600 mg (based on the weight of the free acid) daily.

In one embodiment, the invention provides a dosing regimen for oral administration of N-[[l- (cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3-quinolinyl]carbonyl]-glycine or a pharmaceutically acceptable salt thereof for use in the prevention of COVID-19 in a close contact. In one embodiment, the N-[[l-(cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3- quinolinyl]carbonyl]-glycine or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 200 mg (based on the weight of the free acid) daily.

In a more particular embodiment, N-[[l-(cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3- quinolinyljcarbony!J-glycine or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 100, 150 and 200 mg (based on the weight of the free acid).

In one embodiment, the invention provides a dosing regimen for oral administration of 2-{[7-hydroxy- 5-(2-phenylethyl)-[l,2,4]triazolo[l,5-a]pyridin-8-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use in the prevention of COVID-19 in a close contact. In one embodiment, the 2-{[7-hydroxy-5-(2-phenylethyl)-[l,2,4]triazolo[l,5-a]pyridin-8-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 8 mg (based on the weight of the free acid) daily. In a more particular embodiment, 2-{[7-hydroxy-5-(2-phenylethyl)-[l,2,4]triazolo[l,5-a]pyridin-8- yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof can be administered orally once daily at one of the following dose levels: 2, 4, 6 and 8 mg (based on the weight of the free acid).

In one embodiment, the invention provides a dosing regimen for oral administration of 2-[6- (morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof for use in the prevention of COVID-19 in a close contact. In one embodiment, the 2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l, 2, 3-triazol-l-yl)-2, 3-dihydro- lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof is administered orally at a maximum dose of 200 mg (based on the weight of the free acid) daily.

In one embodiment, the HIF prolyl hydroxylase inhibitor is administered by inhalation. In a more particular embodiment, the HIF prolyl hydroxylase inhibitor is administered by inhalation in the range of 2-6 mg once or twice daily. In a particular embodiment, the HIF prolyl hydroxylase inhibitor is N- [(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof, N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine or a pharmaceutically acceptable salt thereof or 2-[6-(morpho!in-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol- 1 -yl)-2,3-d ihyd ro-1 H-pyrazol-3-one or a pharmaceutically acceptable salt thereof.

In another aspect of the invention, the invention provides a HIF prolyl hydroxylase inhibitor for use in the prevention of COVID-19 in a subject at risk of infection with SARS-CoV-2, wherein said prevention does not result in the haemoglobin levels of the subject exceeding the upper limit of the normal range.

In one embodiment, a specimen from the subject has been tested for SARS-CoV-2 RNA and no SARS-CoV-2 RNA was detected. In another embodiment, a specimen from the subject has not been tested for SARS-CoV-2 RNA.

In more particular embodiments, the subject is in a high risk category (as defined herein), a health care professional or is a close contact of a patient infected with SARS-CoV-2 (as defined herein).

In one embodiment, the HIF prolyl hydroxylase inhibitor is administered orally. This may be achieved by intermittent dosing with doses that induce haematopoiesis when administered daily.

The dose and dosing interval is selected to result in HIF activated transcription without stimulating erythropoeisis. In one embodiment, the HIF prolyl hydroxylase is administered orally thrice weekly. In another embodiment, the HIF prolyl hydroxylase is administered orally once weekly.

In one embodiment, the maximum dose of N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5- pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof (based on the weight of the free acid) administered orally is 100 mg three times a week, more particularly, 80 mg, 70 mg, 60 mg, 50 mg, 40 mg, or 30 mg three times a week. In one embodiment, the maximum dose of N- [(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof (based on the weight of the free acid) is 30 mg orally three times a week. In a more particular embodiment, N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5- pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof can be administered orally at one of the following dose levels: 1, 2, 4, 6, 10 and 16 and 24 mg (based on the weight of the free acid) three times a week..

In one embodiment, the HIF prolyl hydroxylase is administered together with a compound to counteract the unwanted haemoglobin increase. In one embodiment, the HIF prolyl hydroxylase is administered together with a JAK1/2 inhibitor, for example ruxolitinib. Ruxolitinib may be administered orally at a maximum dose of 25 mg.

In one embodiment, the HIF prolyl hydroxylase inhibitor is administered by inhalation. Haematopoeisis is stimulated by erythropoietin which is produced by the kidney and liver. Inhaled administration is expected to minimise systemic exposure and the induction of erythropoiesis. In one embodiment, the HIF prolyl hydroxylase is administered by inhalation. In a more particular embodiment, the HIF prolyl hydroxylase inhibitor is administered by inhalation in the range of 2-6 mg once or twice daily. In a particular embodiment, the HIF prolyl hydroxylase inhibitor is N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof, N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine or a pharmaceutically acceptable salt thereof or 2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol- 1 -yl)-2,3-d ihyd ro-1 H-pyrazol-3-one or a pharmaceutically acceptable salt thereof.

In one embodiment, the dose of N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5- pyrimidinyl)carbonyl]-glycine (based on the weight of the free acid) or a pharmaceutically acceptable salt thereof administered by inhalation is in the range of 2-6 mg once or twice daily. In one embodiment N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof is administered by inhalation at a dose of between 2 -6 mg (based on the weight of the free acid) once daily. In another embodiment, N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof is administered by inhalation at a dose of between 2-6 mg (based on the weight of the free acid) twice daily.

Naturally occurring variability in the population may require the dose to be modified (down titrated) during the treatment period. Accordingly, in one embodiment, haemoglobin concentrations are determined periodically (for example, weekly) during the treatment period by methods known in the art e.g HemoCue. Where haemoglobin levels exceed the upper limit of the normal haemoglobin range, therapy is ceased until haemoglobin levels are within normal ranges, and therapy is recommenced at a lower dose.

In another aspect, the invention provides a HIF prolyl hydroxylase inhibitor for use in the prevention of COVID-19 in a subject at risk of infection with SARS-CoV-2, wherein the HIF prolyl hydroxylase is administered intermittently orally. In particular embodiments, the HIF prolyl hydroxylase is administered orally three times per week or once per week. In a more particular embodiment, the HIF prolyl hydroxylase is administered orally once weekly.

In another aspect, the invention provides a HIF prolyl hydroxylase inhibitor for use in the prevention of COVID-19 in a subject at risk of infection with SARS-CoV-2, wherein the HIF prolyl hydroxylase is administered by inhalation. In one embodiment, a specimen from the subject has been tested for SARS-CoV-2 RNA and no SARS-CoV-2 RNA was detected. In another embodiment, a specimen from the subject has not been tested for SARS-CoV-2 RNA.

In a more particular embodiment, the HIF prolyl hydroxylase inhibitor is administered by inhalation in the range of 2-6 mg once or twice daily. In a particular embodiment, the HIF prolyl hydroxylase inhibitor is N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof, N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyljglycine or a pharmaceutically acceptable salt thereof or 2-[6-(morpholin-4-yl)pyrimidin-4-yl]- 4-(lH-l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof.

Naturally occurring variability in the population may require the dose to be modified (down titrated) during the treatment period. Accordingly, in one embodiment, haemoglobin concentrations are determined periodicially (for example, weekly) during the treatment period by methods known in the art e.g FlemoCue. Where haemoglobin levels exceed the upper limit of the normal haemoglobin range, therapy is ceased until haemoglobin levels are within normal ranges, and therapy is recommenced at a lower dose.

HIF PROLYL HYDROXYLASE INHIBITORS

A HIF prolyl hydroxylase inhibitor is a compound capable of inhibiting one or more of the human HIF prolyl hydroxylase enzymes PHD 1, 2 and 3. A HIF prolyl hydroxylase inhibitor mimics hypoxia and prevents hydroxylation of one or more proline residues in FIIF-la. HIF prolyl hydroxylase inhibitors are well known in the art. Any HIF prolyl hydroxylase inhibitor is suitable for use in the present invention.

In one embodiment, the HIF prolyl hydroxylase inhibitor is a compound or a pharmaceutical salt thereof having the general formula (I), as set out below:

R¹ and R² are each independently selected from the group consisting of: hydrogen, Ci-Cioalkyl, C2- Cioalkenyl, C2-Cioalkynyl, Cs-Cscycloalkyl, Cs-Cscycloalkyl-Ci-Cioalkyl, Cs-Cscycloalkenyl, C5- C₈cycloalkenyl-Ci-Cioalkyl, C3-C8heterocycloalkyl, C3-C8heterocycloalkyl-Ci-Cioalkyl, aryl, aryl-Ci- Cioalkyl, heteroaryl and heteroaryl-Ci-Cioalkyl; where any carbon or heteroatom of R¹ or R² is unsubstituted or, where possible, is substituted with 1 to 3 substituents, independently selected from Ci-Cealkyl, Ci-C6haloalkyl, Ci-C6alkoxyl, halogen, oxo, cyano, nitro and -CO2H-.

In another embodiment, the HIF prolyl hydroxylase inhibitor is selected from the group consisting of: N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof;

N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine or a pharmaceutically acceptable salt thereof;

2-{[7-hydroxy-5-(2-phenylethyl)-[l,2,4]triazolo[l,5-a]pyridin-8-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof;

2-{[5-(3-chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof;

N-[[l-(cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3-quinolinyl]carbonyl]-glycine or a pharmaceutically acceptable salt thereof;

2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof; and (2-(4-bromo-2-fIuorobenzyl)-5-hydroxy-6-isopropyl-3-oxo-pyridazine-4-carbonyl)glycine or a pharmaceutically acceptable salt thereof

The HIF prolyl hydroxylase inhibitors:

N-[[l-(cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3-quinolinyl]carbonyl]-glycine or a pharmaceutically acceptable salt thereof; and

2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof; are commercially available.

In one embodiment, the HIF prolyl hydroxylase inhibitor is N-[(l,2-dicyclohexylhexahydro-2,4,6- trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof. Methods of synthesising N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof are known in the art and are described in W02007/150011. In a more particular embodiment, the HIF prolyl hydroxylase inhibitor is N- [(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine free acid. In one embodiment, the HIF prolyl hydroxylase inhibitor is a crystalline form of N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine free acid having X-ray powder diffraction peaks at 2theta values of 6.4°±0.2°, 7.5°±0.2°, and 7.9°±0.2° using CuKa radiation. In a more particular embodiment, the crystalline form of N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine free acid additionally has X-ray powder diffraction peaks at 2theta values of 17.2°±0.2°, 21.0°±0.2°, 24.0°±0.2°, and 19.3°±0.2° using CuKa radiation. Methods of synthesising this crystalline form of N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine are known in the art and are described in WO2019052133.

In one embodiment, the HIF prolyl hydroxylase inhibitor is N-[(4-hydroxy-l-methyl-7- phenoxyisoquinolin-3-yl) carbonyl]glycine or a pharmaceutically acceptable salt thereof. In a more particular embodiment, the HIF prolyl hydroxylase inhibitor is N-[(4-Hydroxy-l-methyl-7- phenoxyisoquinolin-3-yl) carbonyl]glycine free acid. In one embodiment, the HIF prolyl hydroxylase inhibitor is

2-{[7-hydroxy-5-(2-phenylethyl)-[l,2,4]triazolo[l,5-a]pyridin-8-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof. In a more particular embodiment, the HIF prolyl hydroxylase inhibitor is 2-{[7-hydroxy-5-(2-pheny!ethyl)-[l,2,4]triazolo[l,5-a]pyridin-8-yl]formamido}acetic acid free acid.

In one embodiment, the HIF prolyl hydroxylase inhibitor is

2-{[5-(3-chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof. In a more particular embodiment, the HIF prolyl hydroxylase inhibitor is 2-{[5-(3- chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid free acid which is also known as vadadustat.

In one embodiment, vadadustat is present as Form A, an anhydrous and unsolvated crystalline form. Form A has an X-ray powder diffraction pattern comprising peaks at 18.1, 20.3, 22.9, 24.0, 26.3, 26.8 and 35.2 +/- 0.2 °20. . Methods of producing Form A are described in WO2015073779. Anhydrous and unsolvated.

In one embodiment, vadadustat is present as Form B, an anhydrous crystalline form. Form B has an X-ray powder diffraction pattern comprising peaks at one, two three or four the following positions 8.1, 15.3, 22.7 and 28.1 +/- 0.2 °20. Methods of producing Form B are described in WO2015073779. n one embodiment, vadadustat is present as Form C. Form C has an X-ray powder diffraction pattern comprising peaks at 17.4, 22.3 and 22.4+/- 0.2 °20. In certain embodiments, Form C has an X-ray powder diffraction pattern further comprising peaks at 7.2, 28.9, 33.7 and 33.8 +/- 0.2 °20. Methods of producing Form C are described in WO2015073779.

In one embodiment, vadadustat is present as Form D, an anhydrous and unsolvated crystalline form. Form D has an X-ray powder diffraction pattern comprising peaks at 2.2, 6.6, 7.9, 14.8 and 26.0 +/- 0.2 °20. Alternatively, Form D may be characterised as having an X ray powder diffraction pattern comprising peaks at 7.9, 14.4, 14.8, 15.9 and 23.9+/- 0.2 °20. Alternatively, Form D may be characterised as having an X ray powder diffraction pattern comprising peaks at 6.6, 7.9, 13.4, 15.9, 20.1 and 24.5 +/- 0.2 °20. Methods of producing Form D are described in US202017095998.

In one embodiment, vadadustat is present as Form E, an anhydrous and unsolvated crystalline form. Form E has an X ray powder diffraction pattern comprising peaks at 21.3, 22.8, 23.7, 27.0 and 27.7 +/- 0.2 °2Q. Alternatively, Form E may be characterised as having an X ray powder diffraction pattern comprising peaks at 16.4, 22.8, 23.7, 27.0 and 27.7 +/- 0.2 °20. Methods of producing Form E are described in US202017095998.

In one embodiment, vadadustat is present as Form F, an anhydrous and unsolvated crystalline form. Form F has an X ray powder diffraction pattern comprising peaks at 8.5, 15.3, 18.5, 21.2 and 22.5 +/- 0.2 °20. Alternatively, Form F may be characterised as having an X ray powder diffraction pattern comprising peaks at 4.2, 12.7, 19.5, 25.9 and 29.9 +/- 0.2 °20. Alternatively, Form F may be characterised as having an X ray powder diffraction pattern comprising peaks at 4.2, 8.5 15.3, 18.5, 21.3 and 22.5 +/- 0.2 °20. Methods of producing Form F are described in US202017095998.

In one embodiment, vadadustat is present as Form HB, a hydrated crystalline form. Form HB has an X ray powder diffraction pattern comprising peaks at 14.6, 15.3, 18.5, 20.4 and 28.1 +/- 0.2 °20. Alternatively, Form HB may be characterised as having an X ray powder diffraction pattern comprising peaks at 16.0, 20.4, 26.8, 28.1 and 29.6 +/- 0.2 °20. Alternatively, Form HB may be characterised as having an X ray powder diffraction pattern comprising peaks at 7.9, 14.6, 16.0, 17.6 and 28.1 +/- 0.2 °20. Methods of producing Form HB are described in US202017095998.

In one embodiment, vadadustat is present as Form SA, a crystalline form of a 1,4-dioxane solvate. Form S_A has an X ray powder diffraction pattern comprising peaks at 13.1, 17.5, 19.1, 22.7 and 24.6 +/- 0.2 °20. Alternatively, Form SA may be characterised as having an X ray powder diffraction pattern comprising peaks at 13.1, 17.5, 19.1, 32.0 and 35.3 +/- 0.2 °20. Alternatively, Form SA may be characterised as having an X ray powder diffraction pattern comprising peaks at 13.1, 17.5, 19.1, 24.6 and 32.0 +/- 0.2 °20. Methods of producing Form SA are described in US202017095998.

In one embodiment, vadadustat is present as Form SB, a crystalline form of a 1,4-dioxane solvate. Form SB has an X ray powder diffraction pattern comprising peaks at 14.0, 19.6, 20.0, 22.0 and 28.5 +/- 0.2 °20. Alternatively, Form SB may be characterised as having an X ray powder diffraction pattern comprising peaks at 14.0, 19.6, 20.0, 31.5 and 33.6 +/- 0.2 °20. Alternatively, Form SB may be characterised as having an X ray powder diffraction pattern comprising peaks at 6.8, 14.0, 17.3, 19.6, 20.0 and 28.5 +/- 0.2 °20. Methods of producing Form SB are described in US202017095998.

In one embodiment, vadadustat is present as Form Sc, a crystalline form of a 1,4-dioxane solvate. Form Sc has an X ray powder diffraction pattern comprising peaks at 11.1, 15.1, 18.6, 22.1 and 26.4 +/- 0.2 °20. Alternatively, Form Sc may be characterised as having an X ray powder diffraction pattern comprising peaks at 4.8, 9.5, 11.1, 21.8 and 34.8 +/- 0.2 °20. Alternatively, Form Sc may be characterised as having an X ray powder diffraction pattern comprising peaks at 4.8, 7.9, 14.3, 18.6, 21.1 and 22.1 +/- 0.2 °20. Methods of producing Form Sc are described in US202017095998.

In one embodiment, vadadustat is present as Form So, a crystalline form of an anisole solvate. Form SD has an X ray powder diffraction pattern comprising peaks at 17.0, 24.0, 25.5, 26.2 and 28.4 +/- 0.2 °20. Alternatively, Form SD may be characterised as having an X ray powder diffraction pattern comprising peaks at 12.1, 17.0, 24.0, 25.5 and 26.2 +/- 0.2 °20. Alternatively, Form SD may be characterised as having an X ray powder diffraction pattern comprising peaks at 12.1, 14.5, 25.5, 29.2 and 36.2 +/- 0.2 °20. Methods of producing Form SD are described in US202017095998.

In one embodiment, vadadustat is present as Form SE, a crystalline form of a dimethylacetamide solvate. Form SE has an X ray powder diffraction pattern comprising peaks at 15.8, 17.0, 24.6, 26.5 and 27.2 +/- 0.2 °20. Alternatively, Form SE may be characterised as having an X ray powder diffraction pattern comprising peaks at 14.5, 17.0, 25.1, 26.5 and 27.2 +/- 0.2 °20. Alternatively, Form SE may be characterised as having an X ray powder diffraction pattern comprising peaks at 14.5,

15.8, 22.4, 24.6, 26.5 and 27.2 +/- 0.2 °20. Methods of producing Form SE are described in US202017095998.

In one embodiment, vadadustat is present as Form SF, a crystalline form of a dimethylacetamide solvate. Form SF has an X ray powder diffraction pattern comprising peaks at 5.9, 11.8, 24.1, 24.3 and 26.2 +/- 0.2 °20. Alternatively, Form SF may be characterised as having an X ray powder diffraction pattern comprising peaks at 5.9, 11.8, 16.8, 24.1 and 26.9 +/- 0.2 °20. Alternatively, Form SF may be characterised as having an X ray powder diffraction pattern comprising peaks at 5.9, 11.8,

16.8, 24.3, 26.2 and 26.9 +/- 0.2 °20. Methods of producing Form SF are described in US202017095998.

In one embodiment, the HIF prolyl hydroxylase inhibitor is

N-[[l-(cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3-quinolinyl]carbonyl]-g!ycine or a pharmaceutically acceptable salt thereof. In a more particular embodiment, the HIF prolyl hydroxylase inhibitor is N-[[l-(cyclopropylmethoxy)-l,2-dihydro-4-hydroxy-2-oxo-3-quinolinyl]carbonyl]-glycine free acid.

In one embodiment, the HIF prolyl hydroxylase inhibitor is

2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof. In a more particular embodiment, the HIF prolyl hydroxylase inhibitor is 2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3- one free acid.

In one embodiment, the HIF prolyl hydroxylase inhibitor is (2-(4-bromo-2-fluorobenzyl)-5-hydroxy-6- isopropyl-3-oxo-pyridazine-4-carbonyl)glycine or a pharmaceutically acceptable salt thereof. In a more particular embodiment, the HIF prolyl hydroxylase is (2-(4-bromo-2-fluorobenzyl)-5-hydroxy-6- isopropyl-3-oxo-pyridazine-4-carbonyl)glycine free acid. Methods of synthesising (2-(4-bromo-2- fluorobenzyl)-5-hydroxy-6-isopropyl-3-oxo-pyridazine-4-carbonyl)glycine or a pharmaceutically acceptable salt thereof are known in the art and are described in WO 2008089052.

PHARMACEUTICAL COMPOSITIONS/ROUTES OF ADMINISTRATION/DOSAGES

The HIF prolyl hydroxylase inhibitor may be administered by any convenient route. In particular embodiments, the compound or pharmaceutically acceptable salt thereof may be administered by inhalation, orally, parenterally or intranasally. In one embodiment, the compound or pharmaceutically acceptable salt is administered in a pharmaceutical composition containing the compound or pharmaceutically acceptable salt and a pharmaceutically acceptable excipient.

Inhalation

In one embodiment, the pharmaceutical composition is adapted for administration to a patient by inhalation, for example, as a dry powder, an aerosol, a suspension or a solution formulation. Inhalable formulations may be inhaled orally (via the mouth) or nasally (via the nose), but most typically orally.

The proportion of the compound or pharmaceutically acceptable salt thereof in the inhalable formulations according to the invention depends on the precise type of formulation to be prepared but will generally be within the range of from 0.01 to 10% by weight. Generally, for most types of preparations, the proportion used will be within the range of from 0.05 to 1%, for example from 0.1 to 0.5%.

Inhalation of inhalable formulations is typically through use of an inhalation device, having an outlet (typically a mouthpiece or nosepiece) out of which the formulation is delivered on operation of the inhalation device. Examples of inhalation devices may include those intended for unit dose or multidose delivery of formulation, including all of the devices set forth herein. The inhalation formulation, and the inhalation device therefor, may take a variety of different forms, as is known in the art. For instance, pressurised metered dose inhalers (pMDIs) use an aerosol formulation. In pMDIs, the formulation is typically stored as a bulk reservoir (e.g. in a closed container sy stem) and the pMDI has metering means (e.g. a metering valve of the closed container system) adapted to meter a dose from the bulk reservoir for dispensing from the pMDI. The closed container system may be replaceable.

Aerosols may be formed by suspending or dissolving a compound of the invention in a liquified propellant. In the case of suspension aerosol formulations, the particle size of the particulate (e.g., micronised) drug should be such as to permit inhalation of substantially all the drug into the lungs upon administration of the aerosol formulation and will thus be less than 100 microns, desirably less than 20 microns, and in particular in the range of from 1 to 10 microns, such as from 1 to 5 microns, more preferably from 2 to 3 microns.

Suitable propellants include halocarbons, hydrocarbons, and other liquified gases. Representative propellants include: trichlorofluoromethane (propellant 11), dichlorofluoromethane (propellant 12), dichlorotetrafluoroethane (propellant 114), tetrafluoroethane (HFA-134a), 1,1-difluoroethane (HFA- 152a), difluoromethane (FIFA-32), pentafluoroethane (FIFA-12), heptafluoropropane (FIFA-227a), perfluoropropane, perfluorobutane, perfluoropentane, butane, isobutane, and pentane.

The aerosol may contain additional pharmaceutically-acceptable excipients typically used with pMDIs such as surfactants, lubricants, cosolvents and other excipients to improve the physical stability of the formulation, to improve valve performance, to improve solubility, or to improve taste.

According to a further aspect there is provided use of a pharmaceutical aerosol formulation comprising the compound or a pharmaceutically acceptable salt thereof and a fluorocarbon or hydrogen- containing chlorofluorocarbon as propellant, optionally in combination with a surfactant and/or a cosolvent.

According to an embodiment, the propellant is selected from 1,1,1,2-tetrafluoroethane, 1, 1,1, 2, 3,3,3- heptafluoro-n-propane and mixtures thereof.

The formulations for use in the invention may be buffered by the addition of suitable buffering agents.

MDI canisters generally comprise a container capable of withstanding the vapour pressure of the propellant used such as a plastic or plastic-coated glass bottle or preferably a metal can, for example, aluminium or an alloy thereof which may optionally be anodised, lacquer-coated and/or plastic-coated (for example incorporated herein by reference WO 96/32099 wherein part or all of the internal surfaces are coated with one or more fluorocarbon polymers optionally in combination with one or more nonfluorocarbon polymers), which container is closed with a metering valve. The cap may be secured onto the can via ultrasonic welding, screw fitting or crimping. MDIs taught herein may be prepared by methods of the art (e.g. see Byron, above and WO 96/32099). Preferably the canister is fitted with a cap assembly, wherein a drug-metering valve is situated in the cap, and said cap is crimped in place.

In one embodiment, the metallic internal surface of the can is coated with a fluoropolymer, more preferably blended with a non-fluoropolymer. In another embodiment, the metallic internal surface of the can is coated with a polymer blend of polytetrafluoroethylene (PTFE) and polyethersulfone (PES). In a further embodiment, the whole of the metallic internal surface of the can is coated with a polymer blend of polytetrafluoroethylene (PTFE) and polyethersulfone (PES).

The metering valves are designed to deliver a metered amount of the formulation per actuation and incorporate a gasket to prevent leakage of propellant through the valve. The gasket may comprise any suitable elastomeric material such as, for example, low density polyethylene, chlorobutyl, bromobutyl, EPDM, black and white butadiene-acrylonitrile rubbers, butyl rubber and neoprene. Suitable valves are commercially available from manufacturers well known in the aerosol industry, for example, from Valois, France (e.g. DF10, DF30, DF60), Bespak pic, UK (e.g. BK300, BK357) and 3M- Neotechnic Ltd, UK (e.g. SPRAYMISER).

In various embodiments, the MDIs may also be used in conjunction with other structures such as, without limitation, overwrap packages for storing and containing the MDIs, including those described in U.S. Patent Nos. 6,119,853; 6,179,118; 6,315,112; 6,352,152; 6,390,291; and 6,679,374, as well as dose counter units such as, but not limited to, those described in U.S. Patent Nos. 6,360,739 and 6,431,168.

Non-limiting examples of pMDIs are those sold by the GlaxoSmithKline (GSK) and AstraZeneca (AZ) group of companies (e.g. those used under the trade name "EVOFIALER" by GSK for its SERETIDE/ADVAIR, FLIXOTIDE/FLOVENT. VENTOLIN and SEREVENT pMDI products and those used by AZ for its SYMBICORT pMDI product). Aerosol formulations are preferably arranged so that each metered dose or 'puff' of aerosol contains from 20pg to lOmg, preferably from 2( g to 5mg, more preferably from about 2( g to 0.5mg of a compound of the invention. Administration may be once daily or several times daily, for example 2, 3, 4 or 8 times, giving for example 1, 2 or 3 doses each time. The overall daily dose with an aerosol will be within the range from 1.0 mg to 6.0 mg, for example from 1.0 mg to 3.0 mg.

The aerosol formulations for use in the invention may be prepared by dispersal or dissolution of the compound or pharmaceutically acceptable salt in the selected propellant in an appropriate container, for example, with the aid of sonication or a high-shear mixer. The process is desirably carried out under controlled humidity conditions.

The chemical and physical stability and the pharmaceutical acceptability of the aerosol formulations for use according to the invention may be determined by techniques well known to those skilled in the art. Thus, for example, the chemical stability of the components may be determined by HPLC assay, for example, after prolonged storage of the product. Physical stability data may be gained from other conventional analytical techniques such as, for example, by leak testing, by valve delivery assay (average shot weights per actuation), by dose reproducibility assay (active ingredient per actuation), spray distribution analysis, and flocculation size distribution using a back light scattering instrument or by measuring particle size distribution by cascade impaction or by the 'twin impinger' analytical process. As used herein reference to the 'twin impinger' assay means 'Determination of the deposition of the emitted dose in pressurised inhalations using apparatus A' as defined in British Pharmacopaeia 1988, pages A204-207, Appendix XVII C. Such techniques enable the 'respirable fraction' of the aerosol formulations to be calculated. One method used to calculate the 'respirable fraction' is by reference to 'fine particle fraction' which is the amount of active ingredient collected in the lower impingement chamber per actuation expressed as a percentage of the total amount of active ingredient delivered per actuation using the twin impinger method described above.

Conventional bulk manufacturing methods and machinery well known to those skilled in the art of pharmaceutical aerosol manufacture may be employed for the preparation of large-scale batches for the commercial production of filled canisters. Thus, for example, in one bulk manufacturing method for preparing suspension aerosol formulations a metering valve is crimped onto an aluminium can to form an empty canister. The particulate medicament is added to a charge vessel and liquefied propellant together with the optional excipients is pressure filled through the charge vessel into a manufacturing vessel. The drug suspension is mixed before recirculation to a filling machine and an aliquot of the drug suspension is then filled through the metering valve into the canister. In one example bulk manufacturing method for preparing solution aerosol formulations a metering valve is crimped onto an aluminium can to form an empty canister. The liquefied propellant together with the optional excipients and the dissolved medicament is pressure filled through the charge vessel into a manufacturing vessel.

In an alternative process, an aliquot of the liquefied formulation is added to an open canister under conditions which are sufficiently cold to ensure the formulation does not vaporise, and then a metering valve crimped onto the canister. Each filled canister is check-weighed, coded with a batch number and packed into a tray for storage before release testing.

In dry powder inhalers (DPIs) the formulation is a dry powder formulation comprising the drug substance as a finely divided powder and optionally one or more pharmaceutically acceptable excipients as finely divided powders and/or ternary agent (such as magnesium stearate). Pharmaceutically-acceptable excipients particularly suited for use in dry powders are known to those skilled in the art and include lactose, starch, mannitol, and mono-, di-, and polysaccharides.

The finely divided powder may be prepared by, for example, micronisation and milling. Generally, the size-reduced (eg micronised) compound can be defined by a D50 value of about 1 to about 10 microns (for example as measured using laser diffraction).

DPIs come in a variety of forms, typically either unit-dose inhalers (UDIs) or multiple-dose inhalers (where "dose" means metered dose).

UDIs may be either single-use or multiple use inhalers. UDIs may be pre-loaded with a single metered dose, particularly (but not exclusively) if of the single-use variety. Multiple-use UDIs are of the reloadable variety (i.e. a new metered dose can be loaded). UDIs typically use containers in which the metered dose is stored, with the UDIs having means to open (e.g. pierce, puncture, rupture, peel, split or separate) the container so the metered dose therein can be dispensed. A traditional form of UDI container is a capsule, but other containers may be used, such as a cartridge or unit-dose blister pack. Non-limiting example UDIs are the ROTAHALER device (GSK), MONODOSE device (Plastiape), HANDIHALER device (Boehringer Ingelheim) and ELPEN HALER device (Elpen). For ROTAHALER, reference may be had to GB 2064336.

Multiple-dose inhalers generally fall into two categories, either a reservoir DPI (rDPI) or a pre-metered multiple-dose DPI (mDPI). rDPIs contain the dry powder formulation in a bulk reservoir and have metering means for metering a dose from the reservoir in use of the rDPI (in-device metering). For example, the metering means may comprise a metering cup, which is movable from a first position where the cup may be filled with medicament from the reservoir to a second position where the metered medicament dose is made available to the patient for inhalation. mDPIs, by contrast, comprise a store of a plurality of pre-metered (i.e. factory metered) doses of the dry powder formulation; in other words, the mDPI does not have to include metering means, but instead some means for dispensing the pre-metered doses. rDPIs can hold more metered doses than mDPIs, but generally mDPIs avoid issues with metering accuracy (as this is done in the factory, under more controlled conditions) and the long-term stability of the formulation (e.g. it is easier to avoid moisture ingress into the storage means for the pre- metered doses than it is for a bulk reservoir due to the need to incorporate metering means and hence potential moisture ingress pathways).

Non-limiting examples of rDPI are the TURBULAHER (AZ) and TWISTHALER (Merck). For TURBUHALER, reference may be had to EP 69715.

In mDPIs, the pre-metered multiple doses can be stored in a variety of different ways (e.g. in or on a container or carrier), such as a tape or cartridge (e.g. of blister pack form), with the opening means depending on the container type (e.g. piercing, puncturing, splitting, rupturing, separating or peeling means). When the dry powder is presented as a blister pack, it comprises multiple blisters for containment of the medicament in dry powder form. The blisters are typically arranged in regular fashion for ease of release of the medicament therefrom. For example, the blisters may be arranged in a generally circular fashion on a disc-form blister pack, or the blisters may be elongate in form, for example comprising a strip or a tape.

Non-limiting examples of mDPIs are the DISKUS and ELLIPTA devices (GSK; has one or more peelable blister pack strips), the DISKFIALER device (GSK; has a reloadable piercable/puncturable blister pack diskette), the GYROFIALER device (Vectura; has a piercable/puncturable blister pack strip) and the INHUB device (Mylan; has a solid cartridge diskette with prodder means for opening). For the DISKUS device reference can be made to GB2242134, U.S. Patent Nos. 6,032,666, 5,860,419, 5,873,360, 5,590,645, 6,378,519 and 6,536,427 and for the DISKHALER device see GB 2178965, 2129691 and 2169265, US Pat. Nos. 4,778,054, 4,811,731, 5,035,237

The DISKUS inhalation device comprises an elongate strip formed from a base sheet having a plurality of recesses spaced along its length and a lid sheet peelably sealed thereto to define a plurality of containers, each container having therein an inhalable formulation containing the compound optionally with other excipients and additive taught herein. The peelable seal is preferably a hermetic seal. An inhalable formulation may also be presented in an inhalation device which permits separate containment of two different components of the formulation, such as in the ELLIPTA dry powder inhalation device (see the BREO, ANORO and TRELEGY ELLIPTA inhalation products of GSK). Thus, for example, these components are administrable simultaneously but are stored separately, e.g. in separate pharmaceutical formulations, for example as described in WO 03/061743 A1 WO 2007/012871 Al, W02007/068896, as well as U.S. Patent Nos. 8,113,199, 8,161,968, 8,511,304, 8,534,281, 8,746,242 and 9,333,310.

In one embodiment an inhalation device permitting separate containment of components is an inhaler device having two peelable blister strips, each strip containing pre-metered doses in blister pockets arranged along its length, e.g., multiple containers within each blister strip, e.g., ELLIPTA. Said device has an internal indexing mechanism which, each time the device is actuated, peels opens a pocket of each strip and positions the blisters so that each newly exposed dose of each strip is adjacent to the manifold which communicates with the mouthpiece of the device. When the patient inhales at the mouthpiece, each dose is simultaneously drawn out of its associated pocket into the manifold and entrained via the mouthpiece into the patient's respiratory tract.

A further device that permits separate containment of different components is DUOHALER of Innovata. In addition, various structures of inhalation devices provide for the sequential or separate delivery of the pharmaceutical formulation(s) from the device, in addition to simultaneous delivery.

The capsules and cartridges for inhalation devices may be of, for example, gelatin, while blisters or blister packs may be of, for example, laminated aluminum foil, as is well-known in the art. In various embodiments, each capsule, cartridge or blister/blister pack may contain at least one dose of formulation according to the teachings presented herein. Each capsule, cartridge, or blister may, for example, contain between 20(Vg-10mg of the compound or a pharmaceutically acceptable salt thereof. More particularly, each capsule, cartridge, or blister may contain between 1 and 3 mg of the compound or a pharmaceutically acceptable salt thereof.

Suspensions and solutions comprising the compound or pharmaceutically acceptable salt thereof may also be administered to a patient via a nebuliser. The solvent or suspension agent utilized for nebulization may be any pharmaceutically-acceptable liquid such as water, aqueous saline, alcohols or glycols, e.g., ethanol, isopropylalcohol, glycerol, propylene glycol, polyethylene glycol, etc. or mixtures thereof. Saline solutions utilize salts which display little or no pharmacological activity after administration. Both organic salts, such as alkali metal or ammonium halogen salts, e.g., sodium chloride, potassium chloride or organic salts, such as potassium, sodium and ammonium salts or organic acids, e.g., ascorbic acid, citric acid, acetic acid, tartaric acid, etc. may be used for this purpose.

Other pharmaceutically-acceptable excipients may be added to the suspension or solution. The compound of the invention may be stabilized by the addition of an inorganic acid, e.g., hydrochloric acid, nitric acid, sulfuric acid and/or phosphoric acid; an organic acid, e.g., ascorbic acid, citric acid, acetic acid, and tartaric acid, etc., a complexing agent such as EDTA or citric acid and salts thereof; or an antioxidant such as antioxidant such as vitamin E or ascorbic acid. These may be used alone or together to stabilize the compound of formula (I) or pharmaceutically acceptable salt thereof. Preservatives may be added such as benzalkonium chloride or benzoic acid and salts thereof. Surfactant may be added particularly to improve the physical stability of suspensions. These include lecithin, disodium dioctylsulfosuccinate, oleic acid and sorbitan esters.

Formulations for administration to the nose may include pressurised aerosol formulations and aqueous formulations administered to the nose by pressurised pump. Formulations which are non-pressurised and adapted to be administered topically to the nasal cavity are of particular interest. Suitable formulations contain water as the diluent or carrier for this purpose. Aqueous formulations for administration to the lung or nose may be provided with conventional excipients such as buffering agents, tonicity modifying agents and the like. Aqueous formulations may also be administered to the nose by nebulisation.

The compound or pharmaceutically acceptable salt thereof may be formulated as a fluid formulation for delivery from a fluid dispenser, for example a fluid dispenser having a dispensing nozzle or dispensing orifice through which a metered dose of the fluid formulation is dispensed upon the application of a user-applied force to a pump mechanism of the fluid dispenser. Such fluid dispensers are generally provided with a reservoir of multiple metered doses of the fluid formulation, the doses being dispensable upon sequential pump actuations. The dispensing nozzle or orifice may be configured for insertion into the nostrils of the user for spray dispensing of the fluid formulation into the nasal cavity. A fluid dispenser of the aforementioned type is described and illustrated in WO 05/044354, the entire content of which is hereby incorporated herein by reference. The dispenser has a housing which houses a fluid discharge device having a compression pump mounted on a container for containing a fluid formulation. The housing has at least one finger-operable side lever which is movable inwardly with respect to the housing to cam the container upwardly in the housing to cause the pump to compress and pump a metered dose of the formulation out of a pump stem through a nasal nozzle of the housing. In one embodiment, the fluid dispenser is of the general type illustrated in Figures 30-40 of WO 05/044354.

Oral

In one embodiment, the HIF prolyl hydroxylase inhibitor is formulated in a pharmaceutical composition adapted for oral administration. Pharmaceutical formulations adapted for oral administration may be presented as discrete units such as capsules or tablets; powders or granules; solutions or suspensions in aqueous or non-aqueous liquids; edible foams or whips; or oil-in-water liquid emulsions or water- in-oil liquid emulsions.

Where the HIF prolyl hydroxylases inhibitor is 2-{[5-(3-chlorophenyl)-3-hydroxypyridin-2- yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof (i.e. vadadustat), it is noted that 150 mg and 300 mg tablets suitable for oral administration are commercially available in Japan, where the product VAFSEO™ has received regulatory approval. The tablets are white to off-white, round, bi-convex film-coated tablets (8.0 mm diameter) containing vadadustat and the following inactive ingredients: microcrystalline cellulose (MCC), sodium starch glycolate, hydroxypropyl methylcellulose (FIPMC), colloidal silicon dioxide, and magnesium stearate, and a film coating. This oral formulation would be suitable for the methods and uses described herein.

Parenteral

In one embodiment, the HIF prolyl hydroxylase inhibitor is administered parenterally.

Accordingly, in one embodiment, the HIF prolyl hydroxylase inhibitor is formulated in a pharmaceutical composition adapted for parenteral administration. Pharmaceutical formulations adapted for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets.

Combination Pharmaceutical Compositions

The present invention also provides unitary pharmaceutical compositions in which a HIF prolyl hydroxylase inhibitor and one or more other pharmaceutically active agent(s) may be administered together or separately. In one embodiment, the pharmaceutical composition contains or a pharmaceutically acceptable salt thereof and one or more antiviral agents. In one embodiment, the anti-viral agents are selected from the group consisting of: olsetemivir, remdesivir, ganciclovir, lopinavir, ritonavir and zanamivir. In a more particular embodiment, the single anti-viral agent is remdesivir. In one embodiment, the unitary pharmaceutical composition is adapted for oral administration.

In one embodiment, the pharmaceutical composition contains a compound selected from: and one or more steroids. In one embodiment, one or more steroids are selected from the group consisting of: dexamethasone, prednisone, methylprednisone and hydrocortisone. In one embodiment, the pharmaceutical composition contains a single steroid. In a more particular embodiment, the single steroid is dexamethasone. In one embodiment, the unitary pharmaceutical composition is adapted for oral administration.

In one embodiment, the invention provides uses of HIF prolyl hydroxylase inhibitors, as set out in the following numbered paragraphs:

1. A HIF prolyl hydroxylase inhibitor for use in the treatment of COVID-19 in a subject infected with SARS-CoV-2, wherein the subject with COVID-19 is hospitalised.

2. A HIF prolyl hydroxylase inhibitor for use according to paragraph 1, wherein COVID-19 in the subject infected with SARS-CoV-2 is associated with pneumonia.

3. A HIF prolyl hydroxylase inhibitor for use according to paragraph 1, wherein COVID-19 in the subject infected with SARS-CoV-2 is associated with Acute Respiratory Distress Syndrome.

4. A HIF prolyl hydroxylase inhibitor for use according to any one of paragraphs 1 to 3, wherein the subject infected with SARS-CoV-2 is undergoing extra-corporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, or receiving oxygen therapy.

5. A HIF prolyl hydroxylase inhibitor for use in preventing hospitalisation of a subject infected with SARS-CoV-2.

6. A HIF prolyl hydroxylase inhibitor for use in a method of reduction of viral shedding in a subject infected with SARS-CoV-2.

7. A HIF prolyl hydroxylase inhibitor for use in the prevention of COVID-19 in a close contact of a subject infected with SARS-CoV-2.

8. A HIF prolyl hydroxylase inhibitor for use according to any preceding paragraph where the HIF prolyl hydroxylase is dosed orally for a period not exceeding 4 weeks.

9. A HIF prolyl hydroxylase inhibitor for use in the prevention of COVID-19 in a subject at risk of infection with SARS-CoV-2, wherein the HIF prolyl hydroxylase is administered by inhalation. 10. A HIF prolyl hydroxylase inhibitor for use in the prevention of COVID-19 in a subject at risk of infection with SARS-CoV-2, wherein the HIF prolyl hydroxylase is administered intermittently orally.

11. A HIF prolyl hydroxylase inhibitor according to paragraph 10, wherein the HIF prolyl hydroxylase is administered three times per week or once per week.

12. A HIF prolyl hydroxylase inhibitor for use according to any one of paragraphs 9 to 11, wherein the subject is: a close contact of a patient infected with SARS-CoV-2; in a high risk category; or a healthcare professional.

13. A HIF prolyl hydroxylase inhibitor for use according to any preceding paragraph, wherein the HIF prolyl hydroxylase inhibitor is selected from the group consisting of: N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine or a pharmaceutically acceptable salt thereof;

N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyljglycine or a pharmaceutically acceptable salt thereof;

2-[6-(morpholin-4-yl)pyrimidin-4-yl]-4-(lH-l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3-one or a pharmaceutically acceptable salt thereof; and

(2-(4-bromo-2-fluorobenzyl)-5-hydroxy-6-isopropyl-3-oxo-pyridazine-4-carbonyl)glycine or a pharmaceutically acceptable salt thereof.

BIOLOGICAL DATA

Activity of HIF prolyl hydroxylase inhibitors in preventing SARS-CoV-2 infection may be assessed using the following method:

Protocol for SARS-CoV-2 Coronavirus Cellular Assay

Compound is tested via cellular assays utilizing expression of coronavirus N protein and cell nuclei as aft end points for imaging (indicators of efficacy and toxicity respectively). Calu3 cells (ATCC, HTB- 55) are infected with SARS-CoV-2 coronavirus (pCoV/KOR/KCDC03/2020). Compounds with antiviral activity reduce the expression of N protein as measured immunologically. In preparation for the assay, ten-point, three-fold dose-response curves (DRCs) are generated for the test compound in DMSO with compound concentrations ranging from 0.0025 to 50 mM.

Calu-3 cells are seeded at 2.0 x 10⁴ cells per well in Eagle's Minimum Essential Medium (EMEM, ATCC) supplemented with 20% heat-inactivated fetal bovine serum (FBS), 1% MEM-Non-Essential Amino Acid solution (Gibco) and IX Antibiotic-Antimycotic solution (Gibco) in black , 384-well, pCIear plates (Greiner Bio-One) 24 hours before the experiment. The cells are maintained at 37°C with 5% CO2.

The cells are treated with test compound at concentrations ranging from 0.0025 to 50 pM for 1 to 48 hours prior to infection with SARS-CoV-2 at an MOI of 0.03. DMSO is normalized in reaction wells to a final concentration of 0.5%. The plates are incubated at 37°C for 24 hours before fixing with 4% paraformaldehyde (PFA), 0.25% tritonX-100 solution.

Anti -SARS-CoV-2 Nucleocapsid (N) primary antibody, 488-conjugated goat anti-rabbit IgG secondary antibody and Floechst 33342 is added prior to immunofluorescence. Images are acquired with an Operetta high-throughput imaging device (Perkin Elmer) and analyzed using the Columbus software (Perkin Elmer) to quantify cell numbers and infection ratios. Antiviral activity is normalized to infection control (1% DMSO) in each assay plate. Cell viability was measured by counting nucleus in each wells and normalizing it to the infection control. IC50 values are calculated using nonlinear regression analysis - log[inhibitor] vs. response - Variable slope (four parameters). All IC50 values are measured in duplicate.

Results

Table 1 summarises the

values for N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine and N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine. Table 1:

Table 2 shows the HillSIope values for N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine and N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine. Table 2

EXAMPLE 1

(2-(4-Bromo-2-fluorobenzyl)-5-hydroxy-6-isopropyl-3-oxo-pyridazine-4-carbonyl)glycine free acid in 1% methylcellulose vehicle was administered to male Sprague Dawley rats by oral gavage over a 4 week period according to the dosing regimen in Table 3. Blood samples from study animals were collected via tail vein on days 0, 8, 15, 22, 29, placed into EDTA tubes and haemoglobin concentration was assessed.

Table 3

This model can be used to simulate intermittent dosing in humans and may be used for other HIF prolyl hydroxylase inhibitors. The results for (2-(4-bromo-2-fluorobenzyl)-5-hydroxy-6-isopropyl-3- oxo-pyridazine-4-carbonyl)glycine free acid are shown in Figure 1A-C. It can be seen that that the 10 mg/kg dose is associated with haemoglobin increases following daily dosing, but does not result in haemoglobin increases when dosed 3X/week. Similarly, it can be seen that the 30 mg/kg dose is associated with haemoglobin increases when dosed 3X/week, but does not result in haemoglobin increases when dosed IC/week. This demonstrates that the dosing interval can affect the haemoglobin effect of a HIF prolyl hydroxylase inhibitor over the study period. EXAMPLE 2

A single-blind, randomized, placebo-controlled, dose-escalation clinical trial was conducted in healthy adult males. N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine was dosed orally for 14 days following the regimen in Table 4. Blood samples were collected for haematology at baseline and on days 1, 2, 3, 5, 7, 9, 11, 14, 15, 16, 17, 18, 21, 25 and 28. Table 4

Figure 2 shows the mean haemoglobin concentration in g/L for each dosing regimen. It can be seen that, even at the highest dose tested (100 mg daily), the haemoglobin concentration did not exceed the upper limit of the normal range for adult males.

EXAMPLE 3

Preliminary in vitro data obtained in a cellular assay similar to the SARS-CoV-2 Coronavirus cellular assay described herein indicates that the IC80 for N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5- pyrimidinyl)carbonyl]-glycine in vitro equates to 2.45 pg/ml (6.25 mM) and the IC50 ~0.6 pg/mL. N-[(l,2-Dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine is a moderately permeable (Papp =20nm/s) and poorly soluble drug (<8ug/mL) making it amenable for targeted inhaled delivery.

Two possible methods can be applied for an initial approximate inhaled clinical dose range likely to be associated with relevant significant SARS-Cov-2 inhibition in lung.

Method 1 (based on lung epithelial targeting for SARS-Cov-2 in upper respiratory tract)

The volume of the lung epithelial lining (VL) is known to be 30 mL (range: 15-60 mL; Rennard et al 1986, J. Applied Physiol. ,60(2): 532-538). Device lung deposition (Dep) is typically 20% of dose. The molecular weight of N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]- glycine is 393 g/mol. For an inhaled dose (D) of 2 mg, the lung initial epithelial loading concentration can be calculated as follows:

Dep* D /VL/MWT = 33 mM

33 pM is approximately 5 fold the IC80 for SARS-Cov-2 inhibition. Accordingly, a dose of 2 mg could potentially provide 5 fold IC80 cover.

The time course of daprodustat lung concentration can be modelled once lung ti/2 is estimated from allometrically scaled animal to human lung.

Method 2 (based on drug equilibration in total intracellular volume (Vint ) in human lung reflecting an intracellular mechanism of action for SARS-Cov-2 inhibition^')·

The total intracellular volume of human lung is 0.54 L (Davies et al., 1993, Pharmaceutical research, 10:1093-95). The total amount of daprodustat to delivered in lung is based on the following calculation:

IC80 * Vint * MWT

Vint = 0.54L (46% of total intracellular volume of human lung volume - (Davies et al, 1993). The molecular weight of N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]- glycine is 393 g/mol.

6.25uM * 0.54 L* MWT 393 g/mol= 1.33 mg

Adjusting for 20% deposition (Dep), would require to total dose in the device to be 5 * 1.33mg = 6.6 mg.

A number of assumptions have been made in these models as follows:

• The dose is deposited in the upper respiratory tract epithelial lining and/or intracellularly. • Negligible metabolism of the drug in the lung & no impact of metabolites.

• Sufficient lung residency for a once daily or twice daily regimen.

Whilst this inhaled dose range estimation for N-[(l,2-dicyclohexylhexahydro-2,4,6-trioxo-5- pyrimidinyl)carbonyl]-glycine is mainly theoretical given the lack of enabling lung PK data in appropriate animal species and information on the pharmaceutical properties (particle size, in vitro e-lung deposition, stability, device etc..), the model supports an inhaled dose N-[(l,2- dicyclohexylhexahydro-2,4,6-trioxo-5-pyrimidinyl)carbonyl]-glycine (based on the weight of the free acid) in the range of 2-6 mg once or twice daily. 2-[6-(Morpholin-4-yl)pyrimidin-4-yl]-4-(lH- l,2,3-triazol-l-yl)-2,3-dihydro-lH-pyrazol-3-one and N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin- 3-yl) carbonyl]glycine have a similar inhibitory profile to N-[(l,2-dicyclohexylhexahydro-2,4,6- trioxo-5-pyrimidinyl)carbonyl]-glycine in vitro, so this dosing regimen may also be applicable to these drugs. EXAMPLE 4

The pharmacokinetics of doses of 1 mg/kg and 2 mg/kg N-[(4-hydroxy-l-methyl-7- phenoxyisoquinolin-3-yl) carbonyl]glycine (corresponding to doses of 70-100 mg) is disclosed in Provenzano and colleagues (J. Clin. Pharmacol., 2020, 60 (11): 1432-1440). Figure 3 is an overlay of Figure 2A of the Provenzano article with the IC50 and IC80 figures for SARS-CoV-2 inhibition by N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine. This demonstrates that oral doses of up to 100 mg N-[(4-hydroxy-l-methyl-7-phenoxyisoquinolin-3-yl) carbonyl]glycine would be suitable for use in the treatment and prophylactic methods disclosed herein.

SEQUENCE LISTING

SEQ ID N0:1: N1 forward primer

5' GACCCCAAAATCAGCGAAAT 3'

SEQ ID NO:2: N1 reverse primer 5' TCTGGTT ACTGCCAGTTGAATCTG 3'

SEQ ID NO: 3: N1 Probe Sequence 5' FAM -ACCCCGCATT ACGTTTGGTGGACC- BHQ- 1 3' SEQ ID NO: 4: N2 forward primer 5' TT ACAAACATTGGCCGCAAA 3' SEQ ID NO: 5: N2 reverse primer 5' GCGCGACATTCCGAAGAA 3'

SEQ ID NO: 6 N2 Probe Sequence 5' FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ-1 3'

Claims

1. 2-{[5-(3-Chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof; for use in the treatment of COVID-19 in a subject infected with SARS- CoV-2, wherein the subject with COVID-19 is hospitalised.

2. Use of 2-{[5-(3-chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the treatment treatment of COVID-19 in a subject infected with SARS-CoV-2, wherein the subject with COVID-19 is hospitalised.

3. A method of treatment of COVID-19 in a subject infected with SARS-CoV-2 which comprises administering a subject in need thereof a therapeutically acceptable amount of 2-{[5-(3- chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof, wherein the subject with COVID-19 is hospitalised.

4. A method according to claim 3, wherein the subject is human.

5. 2-{[5-(3-Chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use according to claim 1, use according to claim 2 or a method according to claims 3 or 4, wherein COVID-19 in the subject infected with SARS-CoV-2 is associated with pneumonia.

6. 2-{[5-(3-Chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use according to claim 1, use according to claim 2 or a method according to claims 3 or 4, wherein COVID-19 in the subject infected with SARS-CoV-2 is associated with Acute Respiratory Distress Syndrome.

7. 2-{[5-(3-Chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use, use, or a method according to claims 5 or 6, wherein the subject infected with SARS-CoV-2 has a blood oxygen saturation <93%.

8. 2-{[5-(3-Chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use, use, or a method according to any one of claims 5 to 7, wherein the subject infected with SARS-CoV-2 has a Pa02/Fi02 ratio < 100 mmHg.

9. 2-{[5-(3-Chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use, use, or a method according to any preceding claim, wherein the subject infected with SARS-CoV-2 has blood IL-6 levels greater than 50 pg/mL on admission.

10. 2-{[5-(3-Chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use, use, or a method according to any preceding claim, wherein the subject infected with SARS-CoV-2 has blood CRP levels greater than 32.5 mg/L on admission.

11. 2-{[5-(3-Chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use, use, or a method according to any preceding claim,, wherein the subject infected with SARS-CoV-2 is undergoing extra-corporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, or receiving oxygen therapy.

12. 2-{[5-(3-Chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof for use, use, or a method according to any preceding claim, where the 2-{[5-(3-Chlorophenyl)-3-hydroxypyridin-2-yl]formamido}acetic acid or a pharmaceutically acceptable salt thereof is dosed orally for a period not exceeding 4 weeks.