TW202202167A - Medical use - Google Patents

Abstract

The present disclosure relates to a 3C-Like (3CL) protease inhibitor for use in the treatment or prevention of COVID-19. In particular embodiments, COVID-19 is associated with pneumonia or acute respiratory distress disorder. In other aspects, the patient is undergoing extra-corporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, receiving oxygen therapy or receiving antiviral or steroid treatment.

Description

medicinal use

The present invention relates to a 3C (3CL) protease inhibitor for treating or preventing COVID-19.

After COVID-19 emerged in China in December 2019, it was declared a Public Health Emergency of International Concern on January 30, 2020. At the time of writing, more than 21,689,800 cases and 770,273 deaths have been reported globally.

The infectious agent has been identified as a coronavirus (initially designated 2019-nCoV2, and more recently SARS-CoV-2 (also known as SARS-CoV2 or SARS-CoV-2), severe acute respiratory syndrome coronavirus-2) , which can spread from person to person. Other human pathogenic coronavirus lines are associated with mild clinical symptoms, with two notable exceptions: severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV, SARS-CoV1 or SARS-CoV-1) and Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV).

Coronaviruses consist of an enveloped single-stranded forward RNA genome of 26 to 32 kb in length. They are divided into four classes based on lineage similarity: α (eg, 229E and NL-63), β (eg, SARS-CoV-2, SARS-CoV, MERS-CoV, HKU1 and OC43), ɣ and δ. It has also been reported that SARS-CoV-2 shares 79% sequence identity with SARS-CoV-1, however specific regions of the SARS-CoV-2 genome are conserved to a greater or lesser degree than SARS-CoV-1.

Coronaviruses use membrane-bound spike proteins to bind to host cell surface receptors to enter cells. Upon entry into the host cell, the RNA genome is translated into two larger polypeptides by the host ribosomal system and several smaller polypeptides. The two larger polypeptides are processed by two proteases, the main coronavirus protease (3C-like) and papain-like, to generate proteins required for viral replication and packaging.

By mid-2020, 48,635 SARS-CoV-2 coronavirus genomes from around the world have been analyzed (Daniele Mercatelli, Federico M. Giorgi. Geographic and Genomic Distribution of SARS-CoV-2 Mutations. Frontiers in Microbiology, 2020; 11 DOI: 10.3389/fmicb.2020.01800). By early 2021, more than 400,000 genomes will be available from the Global Initiative on Sharing Avian Influenzae Data (GISAID), an open-access global collection of viral genetic data. All variants were analyzed and annotated with reference to the Wuhan genome (NC_045512.2) that had been designated as L strain or branch.

Several branches (strains) have been identified and their lines are designated L (original strain from Wuhan), S (named after the L to S amino acid change - ORF8:L84S mutation), G (named after the D to S in the spike protein to G amino acid change designation - S: D614G mutation), V (designated after G to V amino acid change - ORF3a: G251V mutation), and O (for other branches, which do not match any of these criteria sequence). Branch G contains two derived branches: GH (characterized by the ORF3a:Q57H mutation) and GR (with the N:RG203KR mutation). In general, clades G and GR are prevalent in Europe, and clades S and GH have been found primarily in the United States. The L branch is mainly represented by sequences from Asia. Today, clade G and its derived progeny clade GH and GR are most common in sequenced SAR-CoV-2 genomes, accounting for 74% of all sequences worldwide. The GR clade with the spike D614G and the nucleoprotein coat RG203KR mutation is the most common representative of the global SARS-CoV-2 genomic population. The original virus strain (branch L) still accounted for 7% of the sequenced genome, and branches S and V had similar frequencies of occurrence in the global sequence dataset. See Li, T., Liu, D., Yang, Y. et al. for a different analysis of SARS-CoV-2 clades. Lineage tree reveals detailed evolution of SARS-CoV-2. Sci Rep 10, 22366 (2020). https://doi.org/10.1038/s41598-020-79484-8.

Although the relatively low variability of the SARS-CoV-2 genome has been identified by several groups, it has not been determined whether the different mortality rates or transmission rates observed in different countries are related to differences in transmissibility and virality between different branches related. Several new variants have recently appeared in the UK (201/501Y.V1/B.1.1.7), South Africa (20H/501Y.V2/B.1.351), Brazil (P.1/20J/501Y.V3/B. 1.1.248) and a novel variant passed down from branch 20C in California (defined by 5 mutants (ORF1a: I4205V, ORF1b: D1183Y, S: S13I, W152C, L452R) and designated CAL.20C (20C/S; 452R; B.1.429).

In a first aspect, the present invention provides a compound, which is N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof for use in the treatment or prevention of COVID-19.

The present invention also provides the following purposes: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1- (Butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methyl Butyl]aminocarbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof for use in the manufacture of a therapeutic or Medicines to prevent COVID-19.

In one embodiment, the individual is infected with SARS-CoV-2. Methods for identifying individuals infected with SARS-CoV-2 are known in the art and currently in clinical use, and include in vitro detection of viral proteins (antigens) using antibodies against SARS-CoV-2 and the use of antibodies for detection of SARS-CoV-2. Real-time reverse transcription polymerase chain reaction for the detection of SARS-CoV-2 genetic material. In one embodiment, individuals with active SARS-CoV-2 infection can be identified using high-throughput sequencing or real-time reverse transcription polymerase chain reaction (RT-PCR) analysis of samples such as nasal and pharyngeal swab samples . In one embodiment, SARS-CoV-2 antigens such as SARS-CoV-2 surface proteins are detected by collecting a mucus sample from the back of the throat or nose of an individual using a swab, or collecting a small drop from a patient blood, and a lateral flow immunoassay (LFIA) based rapid diagnostic test (RDT) was used to identify individuals with active SARS-CoV-2 infection.

The present invention also provides a method of treating an individual infected with COVID-19 using a therapeutically effective amount of a compound selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1- (Butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methyl Butyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof. In one embodiment, the system is human.

Furthermore, the present invention provides a method for identifying an individual to be treated according to the methods described herein, the method comprising the step of analyzing a sample from the individual for the presence of SARS-CoV-2 RNA. In some embodiments, the method is capable of identifying L-strain SARS-CoV-2 RNA, S-strain SARS-CoV-2 RNA, G-strain SARS-CoV-2 RNA, GH-strain SARS-CoV-2 RNA, GR-strain SARS-CoV-2 CoV-2 RNA, V-strain SARS-CoV-2 RNA, or O-strain SARS-CoV-2 RNA. In some embodiments, when SARS-CoV-2 RNA is detected, the method can further comprise a treatment step as described herein.

In certain embodiments, the present invention provides treatment for a specific population of patients infected with COVID-19, such as patients or individuals infected with SARS-CoV-2, i.e., patients or individuals who test positive for SARS-Co-2 , patients or individuals in high-risk categories and patients or individuals with secondary conditions. In certain embodiments, the patient or individual suffers from pneumonia or acute respiratory distress. In other embodiments, the patient or individual is additionally undergoing extracorporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, receiving oxygen therapy, or receiving antiviral or steroid therapy.

In one embodiment, the uses and methods described herein are for the treatment of patients infected with a strain (branch) of SARS-CoV-2 selected from: Strain (branch), Strain G (branch), Strain GH (branch), Strain GR (branch), Strain V (branch), or Strain O (branch).

In one embodiment, the uses and methods described herein are for the treatment of patients infected with an L strain (branch) of SARS-CoV-2 or a variant thereof. In another embodiment, the uses and methods described herein are for the treatment of patients infected with a S strain (branch) of SARS-CoV-2 or a variant thereof. In another embodiment, the uses and methods described herein are for the treatment of patients infected with a G strain (branch) of SARS-CoV-2 or a variant thereof. In another embodiment, the uses and methods described herein are for the treatment of patients infected with a GH strain (branch) of SARS-CoV-2 or a variant thereof. In another embodiment, the uses and methods described herein are for the treatment of patients infected with a GR strain (branch) of SARS-CoV-2 or a variant thereof. In another embodiment, the uses and methods described herein are for the treatment of patients infected with a V strain (branch) of SARS-CoV-2 or a variant thereof. In another embodiment, the uses and methods described herein are for the treatment of patients infected with strain O (branch) of SARS-CoV-2 or variants thereof. In a specific embodiment, the uses and methods described herein are for the treatment of individuals infected with variants of SARS-CoV-2, including British variants (201/501Y.V1/B.1.1. 7), the South African variant (20H/501Y.V2/B.1.351), the Brazilian variant (P.1/20J/501Y.V3/B.1.1.248) and the new California variant descended from branch 20C ( Defined by 5 mutants (ORF1a: I4205V, ORF1b: D1183Y, S: S13I, W152C, L452R) and assigned CAL.20C (20C/S;452R;B.1.429).

In another embodiment, the individual is not infected with SARS-CoV-2 and thus the use is for the prevention of COVID-19. Individuals suitable for this prophylactic use include individuals in high-risk categories, health care professionals, and close contacts of individuals infected with SARS-CoV-2.

Definitions "SARS-CoV-2" is a betacoronavirus that has greater than 90% sequence at the RNA level with any of the sequences deposited at the China National Microbiological Data Centre under the accession number NMDC10013002 The same degree or at the RNA level as the SARS-CoV-2 Wuhan genome (Coronaviridae Study Group of the International Committee on Taxonomy of Viruses, 2020) under the number NC_045512.2 stored in the world Any of the Global Initiative on Sharing All Influenza Data (GISAID) sequences had greater than 90% sequence identity. In another embodiment, the SARS-CoV-2 coronavirus at the RNA level is identical to the sequence deposited in the National Center for Microbiology Data Center of China under the accession number NMDC10013002 or the SARS-CoV-2 Wuhan genome (GISAID) under the number NC_045512.2 Either has greater than 95% sequence identity. In other embodiments, the SARS-CoV-2 coronavirus is at the RNA level with any of the sequences deposited at the National Center for Microbiological Data of China under the accession number NMDC10013002 or the SARS-CoV-2 Wuhan genome (GISAID) under the number NC_045512.2 One has greater than 96% sequence identity, greater than 97% sequence identity, greater than 98% sequence identity, or greater than 99% sequence identity. The definition of SARS-CoV-2 is intended to cover all strains of SARS-CoV-2, including the L, S, G, GH, GR, V and O branches, as well as recent variants thereof, including the British variant (201/501Y.V1 /B.1.1.7), South African variant (20H/501Y.V2/B.1.351), Brazilian variant (P.1/20J/501Y.V3/B.1.1.248) and descended from branch 20C Novel California variant (defined by 5 mutants (ORF1a: I4205V, ORF1b: D1183Y, S: S13I, W152C, L452R) and designated CAL.20C (20C/S;452R;B.1.429). As defined, S Branch with T at position 8782 and C at position 28144; L branch with C at position 8782 and T at position 28144; G branch with G at position 23403 (A23403G); GH branch at Branch V has T at position 25563 (G25563T); GR branch has AAC at position 28881 for GGG start (GGG28881AAC); branch V has T at position 26144 (ORG2a:G251V); and O has unbranched L,S , G, GH, GR, or V-defined sequence changes and mutations with numbers associated with the reference genome of 2019-nCoV-2 (NC_045512). Notably, the actual RNA bases in the SARS-CoV-2 genome is U-uracil-, but is consistent with the original NCBI NC_045512.2 reference gene marker, where T is used to describe a genetic event. The definition of SARS-CoV-2 also covers targeting the following SARS-CoV- with amino acid changes- 2 branches: branch S (ORF8: L84S mutation), branch G (S: D614G mutation), branch GH (ORF3a: Q57H mutation), branch GR (S: D614G and N: RG203KR mutation), branch V (ORF3a:G251V mutation) and branch O (for other branches, sequences and mutations that do not match any of these criteria) and other emerging variants descended from branches as defined above.

"COVID-19" refers to the collection of symptoms exhibited by patients infected with any strain or branch of SARS-CoV-2 (eg, https://www.cdc.gov/coronavirus/2019-ncov/symptoms-testing/symptoms .html). Symptoms usually include cough, fever, and shortness of breath (dyspnea), but some patients are asymptomatic, with cases of COVID-19 referring only to SARS-CoV-2 infection.

"secondary conditions associated with COVID-19" or "secondary conditions associated with COVID019" means any one or more of a number of symptoms associated with COVID-19, including (but not limited to) fever; Cold; cough; shortness of breath; difficulty breathing; fatigue; muscle aches; body aches; headache; chest pain; red eye (conjunctivitis); rash; loss of appetite, loss of smell; sore throat; congestion; runny nose; nausea; vomiting; diarrhea; palpitations ; rapid heartbeat; octopus pot cardiomyopathy; mild headache; feeling dizzy; brain fogging; numbness in fingers, hands, feet, limbs; body tingling; postural orthostatic tachycardia syndrome (POTS) ; less efficient pumping; inflammation of the heart; inflammation of the pericardial membrane; blood clots; and neurological symptoms.

"Treatment of COVID-19" means reducing the viral load of SARS-CoV-2 and/or reducing the viral titer of SARS-CoV-2, and/or reducing the severity or duration of symptoms of disease. Viral amounts can be measured by performing suitable quantitative RT-PCR analysis or suitable qualitative diagnostic tests (such as LFIA-based RDT) on samples from patients. In one embodiment, the sample may be from the upper or lower respiratory tract (such as nasopharyngeal or oropharyngeal swabs, sputum, lower airway aspiration, bronchoalveolar lavage, bronchial biopsies, transbronchial biopsies, and nasopharyngeal washes/ aspiration or nasal aspiration) saliva or plasma. In a specific embodiment, the sample is mucus. In a more specific embodiment, the sample is saliva. Protocols for many quantitative RT-PCR assays are published at https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory-guidance. In addition, Corman and colleagues have published primers and probes for such analyses (Corman et al., European communicable disease bulletin, 2020, DOI: 10.2807/1560-7917). In one embodiment, the COVID-19 RdRp/He1 assay is used. This has been demonstrated using clinical samples with the following limitations: detection of 1.8 TCID ₅₀ /mL and genetic RNA and 11.2 RNA copies/reaction with in vitro RNA transcripts (Chan et al., J Clin Microbiol., 2020, doi:10.1128/JCM .00310-20). Viral titers can be measured by assays well known in the art.

In one embodiment, treatment of COVID-19 refers to viral load (RNA copies/mL) as measured by the same analysis of homologous samples collected in a single patient before treatment (baseline) and at the end of the treatment period ) is reduced by at least a 5-fold, 10-fold, 50-fold, 100-fold, 500-fold or 1000-fold. In one embodiment, treatment of COVID-19 refers to a reduction in viral load greater than 0.5 log units. In another embodiment, treatment of COVID-19 refers to a situation wherein the mean viral load ( RNA copies/ml) reduced at least 5-fold, 10-fold, 50-fold, 100-fold, 500-fold or 1000-fold.

In one embodiment, treatment of COVID-19 refers to clinical improvement of signs and symptoms as evidenced by patient mortality, patient self-reports, and clinical observations.

In one embodiment, treatment of COVID-19 refers to a reduction in viral load below the detection limit of the19RdRp/He1 assay at the end of the treatment period.

"COVID-19 prevention" is interpreted according to the common meaning of the word "prevention".

"High-risk" individuals and "high-risk" categories include the following: individuals 60 years of age and older; individuals with a body-mass index (BMI) ≥ 35; smokers, those with conditions including heart disease, lung disease, diabetes, cancer or hypertensive chronic conditions; immunocompromised individuals, such as those undergoing treatment for cancer or autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis and inflammatory bowel disease, with transplantation individuals and HIV-positive individuals, including those living in communities such as dormitories, assisted living facilities, nursing homes, rehabilitation centers, and similar locations, who have attended 10, 25, 50, 100, 500, 1000 or more Gatherings of people who are not separated by ~6 feet (2 meters) or ~3 feet (1 meter) apart and/or not protected by face coverings or shields, and who have traveled to people with high levels of SARS-CoV-2 and COVID-19 - The area of 19 cases, people from or passing through the area.

"Close contacts" and "close contacts of individuals infected with SARS-CoV-2" are defined as (i) people who live in the same residence as the infected individual; (ii) those who have direct or physical contact with the infected individual; (iii) Persons who have remained within two meters of an infected individual for more than 15 minutes on or after the date the individual first reported symptoms, or for asymptomatic individuals, 2 days prior to collection of the test sample.

Identification of Individuals Infected with SARS-CoV-2 Individuals infected with SARS-CoV-2 can be identified by detection of SARS-CoV-2 viral RNA from samples obtained from the individual. Without intending to be limiting, the sample may be from the upper or lower respiratory tract (such as nasopharyngeal or oropharyngeal swabs, sputum, lower respiratory tract aspiration, bronchoalveolar lavage and nasopharyngeal wash/aspirate or nasal aspiration ) samples. Any known RNA detection method can be used, such as high-throughput sequencing or real-time reverse transcriptase polymerase chain reaction (RT-PCR) analysis. In one embodiment, the method comprises the steps of: a) isolating RNA from the sample; b) reverse transcribing the RNA; c) amplifying using forward and reverse primers in the presence of a probe; and d) detecting the probe Needle; wherein if the cycle threshold growth curve breaks the threshold within 40 cycles, the existence of SARS-CoV-2 is determined.

In a more specific embodiment, step c) uses the following: Fwd primer 5' GACCCCAAAAATCAGCGAAAT 3' (SEQ ID NO: 1) Rev primer 5' TCTGGTTACTGCCAGTTGAATCTG 3' (SEQ ID NO: 2) probe 5' FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ-1 3' (SEQ ID NO: 3)

In an alternative embodiment, step c) uses the following: Fwd primer 5' TTACAAACATTGGCCGCAAA 3' (SEQ ID NO: 4) Rev primer 5' GCGCGACATTCCGAAGAA 3' (SEQ ID NO: 5) probe 5' FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ-1 3' (SEQ ID NO: 6)

Such primers and probes are commercially available from Integrated DNA Technologies (Catalogue No. 10006606) and BioSearch Technologies (Catalogue No. KIT-nCoV-PP1-1000). A detailed description of real-time reverse transcriptase polymerase chain reaction (RT-PCR) analysis using these primers has been published by CDC (https://www.cdc.gov/coronavirus/2019-nCoV/lab/index.html) .

Accordingly, in one embodiment, the present invention includes a method for treating COVID-19 in an individual comprising a method of detecting viral RNA of SARS-CoV-2 from a sample obtained from the individual, wherein the virus RNA detected; a step in the treatment of COVID-19 as described herein.

In one aspect, the present invention provides a method for testing SARS-CoV-2 in an individual and treating SARS-CoV-2 infection in an individual, the method comprising the steps of: a) isolation of RNA from a sample derived from an individual; b) reverse transcription of RNA; c) amplification using forward and reverse primers in the presence of a probe; and d) a detection probe; wherein if the cycle threshold growth curve Breaking the threshold within 40 cycles defines an individual as infected with SARS-CoV-2; and e) treating a subject infected with SARS-CoV-2 with a therapeutically effective amount of a compound selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1- (Butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methyl Butyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof. In particular embodiments of this method, the individual is a human, and the sample and/or primers and probes are as described above. Treatment can also be performed as described herein.

In some embodiments, the method of identifying an individual infected with SARS-CoV-2 can identify whether the individual is infected with L-strain SARS-CoV-2 RNA, S-strain SARS-CoV-2 RNA, G-strain SARS-CoV-2 RNA, GH strain SARS-CoV-2 RNA, GR strain SARS-CoV-2 RNA, V strain SARS-CoV-2 RNA, or O strain SARS-CoV-2 RNA. The methods described herein can include the further step of sequencing the amplified cDNA to identify whether the individual is infected with S, L, G, GH, GR, V, or O strains, and identifying whether the individual is infected Another step of its variant, variants include British variant (201/501Y.V1/B.1.1.7), South African variant (20H/501Y.V2/B.1.351), Brazilian variant (P.1 /20J/501Y.V3/B.1.1.248) and a novel California variant descended from branch 20C (defined by 5 mutants (ORF1a:I4205V, ORF1b:D1183Y, S:S13I, W152C, L452R) and designated of CAL.20C (20C/S;452R;B.1.429).

In an alternative embodiment, an individual infected with SARS-CoV-2 can be identified by detecting SARS-CoV-2 antigen or individual antibody against SARS-CoV-2 in blood or mucus samples collected from the individual. In one embodiment, an individual infected with SARS-CoV-2 can be identified by detecting SARS-CoV-2 antigen in blood or mucus samples collected from the individual. Any suitable assay can be used. Kits for performing such serological assays are commercially available, for example, from Biomerica and Pharmact. Details of conducting authorized serology tests are available at https://www.fda.gov/medical-devices/coronavirus-disease-2019-covid-19-emergency-use-authorizations-medical-devices/eua-authorized-serology- test-performance.

In one embodiment, the assay to identify individuals infected with SARS-CoV-2 comprises: a) contacting at least one immobilized antigen from SARS-CoV-2 with blood from the individual; and b) detecting complexes formed between individual antibodies directed against the immobilized antigen and the immobilized antigen; Wherein, if the complex is detected in step b), the individual is identified as infected with SARS-CoV-2.

In a specific embodiment of this assay, the antigens from SARS-CoV-2 are selected from the group consisting of N and S proteins or fragments thereof. In a more specific embodiment, the antigen from SARS-CoV-2 is selected from the group consisting of the N protein, the S1 domain of the S protein, and the S2 domain of the S protein. In one embodiment, the assay comprises more than one immobilized antigen.

In one embodiment, there is a step of washing the immobilized antigen after step a) and before step b).

In one embodiment, the detection step b) comprises contacting the formed complex with one or more labeled antibodies recognizing the same one or more antigens, followed by detecting the label. In a more specific embodiment, the complex is washed after adding the labeled one or more antibodies, and the label is then detected.

In one embodiment, the label can produce a colored product for visual detection of the label.

In one embodiment, the analysis is a lateral flow analysis. In more specific embodiments, lateral flow assays have immobilized antigens on a scale.

In one embodiment, the present invention provides a method for testing SARS-CoV-2 in an individual and treating SARS-CoV-2 infection in an individual, the method comprising the steps of: a) contacting at least one immobilized antigen from SARS-CoV-2 with blood from the individual; and b) detecting complexes formed between individual antibodies directed against the immobilized antigen and the immobilized antigen; wherein if the complex is detected in step b), the individual is identified as infected with SARS-CoV-2; and c) treating a subject infected with SARS-CoV-2 with a therapeutically effective amount of a compound selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1- (Butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methyl Butyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof. In a specific embodiment of this method, the individual system is human, and the analysis is performed as described above. Treatment can also be performed as described herein.

In one embodiment, the assay to identify individuals infected with SARS-CoV-2 comprises: a) contacting immobilized antibodies recognizing antigens from SARS-CoV-2 with blood from the individual; and b) detection of complexes formed between an antigen from SARS-CoV-2 and an immobilized antibody recognizing the antigen; Wherein, if the complex is detected in step b), the individual is identified as infected with SARS-CoV-2. In a specific embodiment of this assay, the antigens from SARS-CoV-2 are selected from the group consisting of N and S proteins or fragments thereof. In a more specific embodiment, the antigen from SARS-CoV-2 is selected from the group consisting of the N protein, the S1 domain of the S protein, and the S2 domain of the S protein. In one embodiment, the assay comprises more than one immobilized antigen, each antibody recognizing a different antigen.

In one embodiment, there is a step of washing the immobilized antibody after step a) and before step b).

In one embodiment, detecting step b) comprises contacting the complex formed in step a) with a labeled antibody that recognizes the same one or more antigens, followed by detecting the label. In a more specific embodiment, step b) comprises the step of washing prior to detecting the label.

In one embodiment, the label can produce a colored product for visual detection of the label.

In one embodiment, the analysis is a lateral flow analysis. In more specific embodiments, lateral flow assays have one or more immobilized antibodies on a scale.

In one embodiment, the present invention provides a method for testing and treating SARS-CoV-2 infection, the method comprising the steps of: a) contacting immobilized antibodies recognizing antigens from SARS-CoV-2 with blood from the individual; and b) detection of complexes formed between an antigen from SARS-CoV-2 and an immobilized antibody recognizing the antigen; Wherein if the complex is detected in step b), the individual is identified as infected with SARS-CoV-2, and the individual infected with SARS-CoV-2 is treated with a therapeutically effective amount of a compound selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1- (Butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methyl Butyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof. In a specific embodiment of this method, the individual system is human, and the analysis is performed as described above. Treatment can also be performed as described herein.

Prophylactic Use In one aspect of the present invention, the present invention provides a compound selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)- 1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarboxy]propan-2-yl]aminocarboxy [ (1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrole Perid-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl] Benzyl carbamate or a pharmaceutically acceptable salt thereof for the prevention of COVID-19.

In one embodiment, a sample from an individual has been tested for SARS-CoV-2 RNA and no SARS-CoV-2 RNA was detected. In another embodiment, samples from individuals are not tested for SARS-CoV-2 RNA. In more specific embodiments, a system is in a high risk category (as defined herein), is a healthcare professional or is a close contact (as defined herein) of a patient infected with SARS-CoV-2.

In one aspect of the invention, there is provided a method of preventing COVID-19 in an individual at risk of contracting SARS-Co-V-2, the method comprising: A therapeutically effective amount of a compound selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof. In more specific embodiments, the system is in a high-risk category (as defined herein), the system is a healthcare professional, or a close contact of an individual whose system is infected with SARS-CoV-2 (as defined herein).

Therapeutic Uses In one aspect of the present invention, the present invention provides a compound selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1 -Pendant oxy-3-[(3S)-2-Pendant oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]aminocarbamoyl }butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof; or N-[( 1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidine -3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]aminocarbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]amine Benzyl formate or a pharmaceutically acceptable salt thereof for use in the treatment of COVID-19.

In one embodiment, treatment is initiated in an individual within 5 to 7 days of onset of symptoms or within 72 hours of testing positive for SARS-CoV-2 infection, eg, using the methods defined herein.

In one embodiment, treatment is initiated in an individual within 2 days of onset of symptoms or within 48 hours of testing positive for SARS-CoV-2 infection, eg, using the methods defined herein.

In one embodiment, treatment is initiated in an individual within 24 hours of onset of symptoms or within 24 hours of testing positive for SARS-CoV-2 infection, eg, using the methods defined herein.

In one embodiment, the individual is a SARS-CoV-2 infected individual who tests positive for SARS-CoV-2.

In one embodiment, the individual is a SARS-CoV-2 infected individual who has previously been vaccinated against SARS-CoV-2 and tested positive for SARS-CoV-2.

In one embodiment, an individual infected with SARS-CoV-2 has a secondary condition associated with COVID-19.

In one embodiment, the individual system infected with SARS-CoV-2 is in a high risk category as defined above.

In one embodiment, COVID-19 in individuals infected with SARS-CoV-2 is associated with pneumonia. In more specific embodiments, an individual infected with SARS-CoV-2 has a MuLBSTA score of > 12 or a CURB-65 score of > 2 or a PSI score of > 70. In other embodiments, an individual infected with SARS-CoV-2 meets one or more of the following criteria: pulse ≥ 125 beats/min, respiratory rate > 30 beats/min, blood oxygen saturation ≤ 93%, PaO ₂ / FiO ₂ ratio < 300 mmHg, peripheral blood lymphocyte count < 0.8 ^* 10 ^9/ L, systolic blood pressure < 90 mmHg, temperature < 35 or ≥ 40°C, arterial pH < 7.35, blood urea nitrogen ≥ 30 mg/dl, arterial O Partial pressure of ₂ < 60 mmHg, pleural effusion, > 50% pulmonary infiltrates in the lung field within 24-48 hours.

In one embodiment, COVID-19 in individuals infected with SARS-CoV-2 is associated with acute respiratory distress. In a more specific embodiment, an individual infected with SARS-CoV-2 has a Murray score of > 2. In another embodiment, an individual infected with SARS-CoV- ₂ has a PaO2/FiO2 ratio of ≤ ₂₀₀ mmHg. In a more specific embodiment, an individual infected with SARS-CoV _{- 2} has a PaO2/FiO2 ratio of ≤ 100 mmHg. In another embodiment, the patient has a modified expiratory volume per minute of > 10 liters/minute. In another embodiment, an individual infected with SARS-CoV-2 has a respiratory compliance of < 40 mL/cm _H2O . In another embodiment, an individual infected with SARS-CoV-2 has a positive end-tidal pressure of > 10 cm _H2O .

In certain embodiments, individuals infected with SARS-CoV-2 are undergoing extracorporeal membrane oxygenation or mechanical ventilation, or are receiving supplemental oxygen via a nasal cannula or an ordinary face mask. When mechanical ventilation is used, this includes the use of low tidal volumes (< 6 mL/kg ideal body weight) and airway pressure (smooth pressure < 30 cmH ₂ O). This can be delivered at 2 to 6 liters/minute when supplemental oxygen is provided via a nasal cannula. This can be delivered at 5 to 10 liters/minute when supplemented with oxygen by a normal mask.

In certain embodiments, individuals infected with SARS-CoV-2 are receiving antiviral and/or steroid therapy, wherein antiviral or steroid therapy is treatment with an agent other than: N-[(1S)-1-{ [(1S)-3-Methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]-1-[(propane- 2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl] Benzyl carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1 -Pendant oxy-3-[(3S)-2-Pendant oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2 -(4,4-Difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof. In a specific embodiment, the individual is receiving antibody therapy, such as monoclonal antibody therapy. In a specific embodiment, the individual is receiving convalescent plasma therapy. In a more specific embodiment, an individual infected with SARS-CoV-2 is receiving an antiviral agent, wherein the antiviral agent is an agent other than: N-[(1S)-1-{[(1S)-3- Methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarboxylate Benzyl]propan-2-yl]aminocarbamic acid}butyl]aminocarbamic acid}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester or its medicine Scientifically acceptable salt; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3- [(3S)-2-Oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-di Haloperidin-1-yl)ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof. In an even more specific embodiment, the antiviral agent is selected from the group consisting of olsetemivir, remdesivir, ganciclovir, lopinavir, ritonavir (ritonavir) and zanamivir (zanamivir). In one embodiment, the patient is receiving oseltamivir (75 mg every 12 hours, orally). In another embodiment, an individual infected with SARS-CoV-2 is receiving ganciclovir (0.25 g every 12 hours, intravenously). In another embodiment, an individual infected with SARS-CoV-2 is receiving lopinavir/ritonavir (400/100 mg twice daily orally).

In another embodiment, an individual infected with SARS-CoV-2 is receiving 100 mg of remdesivir intravenously daily.

In certain embodiments, individuals infected with SARS-CoV-2 are receiving treatment with steroids. In a more specific embodiment, the steroid is selected from dexamethasone, prednisone, methylprednisone, and hydrocortisone.

In one embodiment, the individual infected with SARS-CoV-2 is receiving dexamethasone (6 mg once daily, orally or intravenously).

In one embodiment, an individual infected with SARS-CoV-2 is receiving prednisone (40 mg daily in two divided doses).

In one embodiment, an individual infected with SARS-CoV-2 is receiving methylprednisone (32 mg daily in two divided doses).

In one embodiment, an individual infected with SARS-CoV-2 is receiving hydrocortisone (160 mg daily in two to four divided doses).

In one embodiment, an individual receiving treatment with any of the above steroids is an individual receiving mechanical ventilation or supplemental oxygen.

In one embodiment, an individual infected with SARS-CoV-2 is receiving tocilizumab (8 mg/kg, intravenous) or tocilizumab (8 mg/kg, intravenous) with dexamethasone (6 mg once daily, orally or intravenously) in combination.

In one embodiment, an individual infected with SARS-CoV-2 is being treated with an antibody that neutralizes SARS-CoV-2. In a more specific embodiment, an individual infected with SARS-CoV-2 is receiving bamlanivimab (eg, by iv infusion at a dose of 700 mg, 2800 mg, or 7000 mg). In another embodiment, an individual infected with SARS-CoV-2 is receiving casirivimab and imdevimab, eg, 1200 mg of each antibody or 4000 mg of each antibody .

In certain embodiments, individuals infected with SARS-CoV-2 are receiving convalescent plasma therapy. Blood was collected from ABO-compatible donors at least 3 weeks after disease onset and 4 days after discharge, and plasma was prepared by hemocytometry.

In one embodiment, the plasma has a neutralizing antibody titer of 1:640 or greater as measured by a thrombocytopenia neutralization test using the SARS-CoV-2 virus.

In one embodiment, the dose of convalescent plasma is 200 mL.

In one aspect, there is provided a method for treating or preventing COVID-19 in an individual infected with SARS-CoV-2 or at risk of infection with SARS-CoV-2, the method comprising administering a therapeutically effective amount of a selected from The following compounds or pharmaceutically acceptable salts: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof.

In one embodiment, the method comprises administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof, One of the systems is at risk of contracting SARS-CoV-2, and the method comprises preventing COVID-19 in individuals at risk of contracting SARS-CoV-2. In a specific embodiment, each system: a close contact of a patient infected with SARS-CoV-2, in a high-risk category; or a healthcare professional.

In one embodiment, the method comprises administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof, wherein the individual is infected with SARS-CoV-2, and the method comprises treating COVID-19 in the individual infected with SARS-CoV-2. In a specific embodiment, an individual is identified as infected with SARS-CoV-2 by detecting viral RNA of SARS-CoV-2 in a sample obtained from the individual.

In one embodiment, the individual infected with SARS-CoV-2 is infected with a strain (branch) of SAR-CoV-2 selected from the group consisting of: L, S, G, GH of SARS-CoV-2 , GR strain, V strain or O strain. In a specific embodiment, an individual infected with SARS-CoV-2 is infected with strain L of SAR-Co-V-2. In a specific embodiment, an individual infected with SARS-CoV-2 is infected with the S strain of SAR-Co-V-2. In a specific embodiment, an individual infected with SARS-CoV-2 is infected with the G strain of SAR-Co-V-2. In a specific embodiment, an individual infected with SARS-CoV-2 is infected with a GH strain of SAR-Co-V-2. In a specific embodiment, an individual infected with SARS-CoV-2 is infected with a GR strain of SAR-Co-V-2. In a specific embodiment, an individual infected with SARS-CoV-2 is infected with a V strain of SAR-Co-V-2. In a specific embodiment, an individual infected with SARS-CoV-2 is infected with strain O of SAR-Co-V-2. In a specific embodiment, the individual is infected with a variant of SAR-Co-V-2, including the British variant (201/501Y.V1/B.1.1.7), the South African variant (20H/501Y.V2/B. 1.351), the Brazilian variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from branch 20C (defined by 5 mutants (ORF1a:I4205V, ORF1b:D1183Y, S: S13I, W152C, L452R) and designated CAL.20C (20C/S;452R;B.1.429).

In one embodiment, the method comprises administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof, wherein COVID-19 in individuals infected with SARS-CoV-2 is associated with pneumonia. In a specific embodiment, COVID-19 in individuals infected with SARS-CoV-2 is associated with acute respiratory distress.

In one embodiment, the individual infected with SARS-CoV-2 is undergoing extracorporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, or receiving oxygen therapy.

In one embodiment, the individual infected with SARS-CoV-2 is receiving antiviral and/or steroid therapy, wherein the antiviral or steroid therapy is treatment with an agent other than: N-[(1S)-1-{ [(1S)-3-Methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]-1-[(propane- 2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl] Benzyl carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1 -Pendant oxy-3-[(3S)-2-Pendant oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2 -(4,4-Difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof. In a specific embodiment, the individual infected with SARS-CoV-2 is receiving an antiviral agent, wherein the antiviral agent is an agent other than the following: N-[(1S)-1-{[(1S)-3-methyl yl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarboxy ]propan-2-yl]aminocarbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester or its medicament or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3-[ (3S)-2-Oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoro Benzyl piperidin-1-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof. In another specific embodiment, the antiviral agent is selected from the group consisting of remdesivir, ganciclovir, lopinavir, oseltamivir, ritonavir and zanamivir. In one embodiment, an individual infected with SARS-CoV-2 receives 100 mg of remdesivir intravenously daily. In a specific embodiment, the individual infected with SARS-CoV-2 is receiving treatment with steroids. In another specific embodiment, the steroid is selected from the group consisting of dexamethasone, prednisone, methylprednisone, and hydrocortisone. In one embodiment, the individual infected with SARS-CoV-2 is receiving dexamethasone (6 mg once daily, orally or intravenously). In one embodiment, the individual receiving treatment with steroids is a patient receiving mechanical ventilation or supplemental oxygen. In a specific embodiment, an individual infected with SARS-CoV-2 is receiving convalescent plasma therapy.

In one embodiment, the method comprises administering a therapeutically effective amount of a compound selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof, wherein the compound or pharmaceutically acceptable salt is administered via inhalation.

；及 N-[(1S)-1-{[(1S)-1-{[(2S)-1-(丁基胺甲醯基)-1-側氧基-3-[(3S)-2-側氧基吡咯啶-3-基]丙烷-2-基]胺甲醯基}-3-甲基丁基]胺甲醯基}-2-(4,4-二氟哌啶-1-基)乙基]胺甲酸苄酯游離鹼具有以下結構：

。 Compound N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidine- 3-yl]-1-[(propan-2-yl)aminocarboxy]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl ) benzyl piperidin-1-yl]ethyl]carbamate free base has the following structure:

; and N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3-[(3S)-2 -Pendant oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidine-1- benzyl)ethyl]carbamate free base has the following structure:

.

Compounds can be prepared as described in WO2018/042343 or according to the following synthetic schemes.

Scheme 1 : Preparation of N-[(1S)-1-{[(1S)-3 -methyl- 1-{[(2S)-1 -oxy -3-[(3S)-2 -oxy- Pyrrolidin- 3 -yl ]-1-[( propan -2- yl ) carbamoyl ] propan -2- yl ] carbamoyl } butyl ] carbamoyl }-2-[4-( tris Fluoromethyl ) piperidin- 1 -yl ] ethyl ] carbamic acid benzyl ester .

In Synthesis Scheme 1 shown above, lactamol 1 can be prepared according to literature (Journal of Medicinal Chemistry 48(22), 6767-6771, 2005). Alcohol 1 can be oxidized by reaction with SO3 _- pyridine complex to give aldehyde 2, and subsequent reaction of 2 with an isonitrile such as isopropylisonitrile in the presence of a suitable acid such as benzoic acid yields ester 3. Amino-alcohol 5 can be obtained by removal of the benzyl group of 3 under basic conditions followed by removal of the Boc group of 4 using a suitable acid such as HCl in a suitable solvent such as 1,4-dioxane. to protect. Any suitable amide forming conditions can be used to prepare compound 6. Preferably, 2,4,6-trioxy2,4,6-tripropyl-1,3,5,2,4,6-trioxatriphosphane is used in the present invention. The Boc group of compound 6 was removed using HCl to yield amine 7. Amine 7 (free amine) can be made by using 2,4,6-trioxy2,4,6-tripropyl-1,3,5,2,4,6-trioxatriphosane as a preferred coupling agent or its salt) with (S)-2-(((benzyloxy)carbonyl)amino)-3-(4-(trifluoromethyl)piperidin-1-yl)propionic acid (commercially available) A suitable Cbz-amino acid undergoes an amide formation reaction to give amide 8. Subsequent oxidation was accomplished using Dess-Martin periodinane to yield final compound 9.

Scheme 2. Preparation of N-[(1S)-1-{[(1S)-1-{[(2S)-1-( butylaminocarboxy)-1-pendoxo- 3 - [(3S) -2 -Oxypyrrolidin- 3 -yl ] propan -2- yl ] aminocarbamoyl }-3 -methylbutyl ] carbamoyl }-2-(4,4 - difluoropiperidine- 1- yl ) ethyl ] carbamic acid benzyl ester .

In the synthetic scheme 2 shown above, lactamol 1 can be prepared according to literature (Journal of Medicinal Chemistry 48(22), 6767-6771, 2005). Alcohol 1 can be oxidized to give aldehyde 2 by reaction with SO3 _- pyridine complex, and then 2 is reacted with n-butylisonitrile to give ester 10 in the presence of a suitable acid such as benzoic acid. Amino-alcohol 12 can be obtained by removal of the benzyl group of 10 under basic conditions followed by removal of the Boc group of 11 using a suitable acid such as HCl in a suitable solvent such as 1,4-dioxane to protect. Any suitable amide forming conditions can be used to prepare compound 13. Preferably, 2,4,6-trioxy2,4,6-tripropyl-1,3,5,2,4,6-trioxatriphosphane is used in the present invention. The Boc group of compound 13 was removed using HCl to yield amine 14. Amine 14 (free amine) can be made by using 2,4,6-trioxy2,4,6-tripropyl-1,3,5,2,4,6-trioxatriphosane as a preferred coupling agent or its salt) and (S)-2-(((benzyloxy)carbonyl)amino)-3-(4,4-difluoropiperidin-1-yl)propanoic acid for amide formation reaction to form amide Amine 15. Subsequent oxidation was accomplished using Dess-Martin periodane to give final compound 16.

N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) benzyl piperidin-1-yl]ethyl]carbamate; and N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate is a base-containing compound and is capable of forming pharmaceutically acceptable acid addition salts by treatment with a suitable acid. Suitable acids include pharmaceutically acceptable inorganic acids and pharmaceutically acceptable organic acids. Such acid addition salts can be formed by optionally reacting with a suitable acid in a suitable solvent, such as an organic solvent, to form a salt, which can be isolated by various methods including crystallization and filtration.

In one embodiment, a compound selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate free base; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate free base.

In one embodiment, the uses and methods described herein use N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-pendantoxy-3 -[(3S)-2-Oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl Acyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof. In a more specific embodiment, the uses and methods employ N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-pendoxyl-3- [(3S)-2-Oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]aminocarbamoyl}butyl]carbamoyl yl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester free base.

In one embodiment, the uses and methods described herein use N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1 -Pendant oxy-3-[(3S)-2-Pendant oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2 -(4,4-Difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof. In a more specific embodiment, the uses and methods employ N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1- Pendant oxy-3-[(3S)-2-Pendant oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2- (4,4-Difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester free base.

Pharmaceutical Compositions / Routes of Administration / Dose The compounds of the invention N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1 can be administered by any convenient route -Pendant oxy-3-[(3S)-2-Pendant oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]aminocarbamoyl }butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof; or N-[( 1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidine -3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]aminocarbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]amine Benzyl formate or a pharmaceutically acceptable salt thereof. In particular embodiments, the compound, or a pharmaceutically acceptable salt thereof, can be administered by inhalation, oral, parenteral, or intranasal means.

In one embodiment, the compound or pharmaceutically acceptable salt is administered as a pharmaceutical composition comprising the compound or pharmaceutically acceptable salt and a pharmaceutically acceptable excipient.

In one embodiment, the compound or pharmaceutically acceptable salt is formulated in a pharmaceutical composition suitable for oral or parenteral administration, or for intranasal or by inhalation.

Pharmaceutical compositions suitable for oral administration may be presented as discrete units such as capsules or lozenges; powders or granules; solutions or suspensions in aqueous or non-aqueous liquids; edible foams or creamy desserts; Oil liquid emulsion or water-in-oil liquid emulsion.

Pharmaceutical compositions suitable for intranasal administration may comprise coarse powders having, for example, particle sizes in the range of 20 to 500 microns, and the compositions are administered in a manner wherein snus is ingested, that is, by self-approaching The powder container in the nose is quickly inhaled through the nasal passages. Suitable formulations for administration as a nasal spray or as nasal drops, wherein the carrier is a liquid, include aqueous or oily solutions of the compound or a pharmaceutically acceptable salt thereof.

In one embodiment, the pharmaceutical composition may be suitable for parenteral administration. Such compositions include aqueous and non-aqueous sterile injectable solutions, which may contain antioxidants, buffers, bacteriostatic agents, co-solvents, organic solvent mixtures, cyclodextrin complexes, emulsifiers (for forming and stabilizing emulsified formulations) ), liposome components for forming liposomes, gelatable polymers for forming polymeric gels, lyoprotectants and combinations of agents, especially for stabilizing active ingredients in soluble form and the formulation is made isotonic with the blood of the desired recipient. Pharmaceutical formulations for parenteral administration may also be in the form of aqueous and non-aqueous sterile suspensions, which may include suspending and thickening agents (RG Strickly, Solubilizing Excipients in oral and injectable formulations, Pharmaceutical Research, p. 21 ( 2) Vol. 2004, pp. 201-230).

If the pKa of the drug is sufficiently different from the pH of the formulation, the ionizable drug molecule can be solubilized to the desired concentration by pH adjustment. For intravenous and intramuscular administration, an acceptable range is pH 2-12, but for subcutaneous administration, an acceptable range is pH 2.7-9.0. The pH of the solution is controlled by the salt form of the drug, a strong acid/base such as hydrochloric acid or sodium hydroxide, or by a buffer solution including, but not limited to, glycine, citrate, acetate, maleic acid acid, succinate, histidine, phosphate, tris(hydroxymethyl)aminomethane (TRIS) or carbonate.

Combinations of aqueous solutions and water-soluble organic solvents/surfactants (ie, co-solvents) are often employed in injectable formulations. Water-soluble organic solvents and surfactants used in injectable formulations include, but are not limited to, propylene glycol, ethanol, polyethylene glycol 300, polyethylene glycol 400, glycerol, dimethylacetamide (DMA), N - Methyl-2-pyrrolidone (NMP; Pharmasolve), dimethyl sulfoxide (DMSO), Solutol HS 15, Cremophor EL, Cremophor RH 60 and polysorbate 80. Often, but not always, such formulations can be diluted prior to injection.

Propylene glycol, PEG 300, ethanol, Cremophor EL, Cremophor RH 60 and polysorbate 80 are fully organic water-soluble solvents and surfactants used in commercially available injectable formulations and can be used in combination with each other. The resulting organic formulation is often diluted at least 2-fold prior to administration by IV bolus injection or IV infusion.

Alternatively, water solubility can be enhanced by molecular complexation with cyclodextrin.

Lipid system-enclosed balloons consisting of an outer lipid bilayer membrane and an inner aqueous core and having an overall diameter of < 100 µm. Depending on the degree of hydrophobicity, moderately hydrophobic drugs can be solubilized by liposomes if the drug is encapsulated or intercalated within liposomes. The hydrophobic drug can also be solubilized by liposomes if the drug molecule becomes part of the lipid bilayer membrane, and in this case the hydrophobic drug is solubilized in the lipid portion of the lipid bilayer. Typical liposome formulations contain -5-20 mg/mL water with phospholipids, isotonicity agents, pH 5-8 buffers, and optionally cholesterol.

The formulations can be presented in unit-dose or multi-dose containers, such as sealed ampoules and vials, and can be stored in freeze-dried (lyophilized) conditions requiring only the addition of a sterile liquid carrier, e.g., for injection, before use. water.

Pharmaceutical formulations can be prepared by lyophilizing a compound of the invention as described herein. Lyophilization refers to the process of freeze-drying a composition. Therefore, freeze drying and lyophilization are used synonymously herein. A typical procedure is to solubilize and clarify the compound, sterile filter the resulting formulation, and aseptically transfer it to a container (eg, a vial) suitable for lyophilization. In the case of vials, the vials were partially stoppered with a medicinal rubber stopper. The formulations can be cooled to freeze and lyophilized under standard conditions, and then sealed and capped to form stable, dry lyophilic formulations. The composition should generally have a low residual water content, eg, less than 5% by weight, eg, less than 1% by weight, based on the weight of the lyophile.

Lyophilized formulations may contain other excipients such as thickening agents, dispersing agents, buffers, antioxidants, preservatives, and tonicity adjusting agents. Typical buffers include phosphate, acetate, citrate and glycine. Examples of antioxidants include ascorbic acid, sodium bisulfite, sodium metabisulfite, monothioglycerol, thiourea, butylated cresol, butylated hydroxyanisole, and ethylenediaminetetraacetate. Preservatives may include benzoic acid and its salts, sorbic acid and its salts, alkyl esters of parahydroxybenzoic acid, phenol, chlorobutanol, benzyl alcohol, thimerosal, benzalkonium, and cetylpyridine chloride. The previously mentioned buffers as well as dextrose and sodium chloride may be used to adjust tonicity as needed.

Bulking agents are commonly used in lyophilization technology to facilitate processing and/or provide bulk and/or mechanical integrity to lyophilized cakes. Bulking agent means a freely water-soluble, solid particulate diluent which, when co-lyophilized with a compound or salt thereof, provides a physically stable lyophilized cake, a more desirable freeze-drying process, and rapid and complete rehydration. Bulking agents can also be used to make the solution isotonic.

The water-soluble bulking agent can be any of the pharmaceutically acceptable inert solid materials commonly used in lyophilization. Such bulking agents include, for example, sugars such as glucose, maltose, sucrose, and lactose; polyalcohols such as sorbitol or mannitol; amino acids such as glycine; polymers such as polyvinylpyrrolidone; The polysaccharide of glucan.

The weight ratio of bulking agent to active compound is generally in the range of about 1 to about 5, such as about 1 to about 3, such as in the range of about 1 to 2.

Alternatively, the compounds may be provided as solutions, possibly concentrated and sealed in suitable vials. Sterilization of the dosage form can be carried out by filtration or by autoclaving the vial and its contents at an appropriate stage of the formulation process. Further dilution or preparation of the supplied formulation may be required prior to delivery of, for example, the dilution into a suitable sterile infusion package.

Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets.

In one embodiment of the invention, the pharmaceutical composition is in a form suitable for i.v. administration, eg, by injection or infusion.

Pharmaceutical compositions of the present invention for parenteral injection may also comprise sterile pharmaceutically acceptable, aqueous or non-aqueous solutions, dispersions, suspensions or emulsions for reconstitution to sterile injectable solutions immediately prior to use or sterile powder for dispersion. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents or vehicles include water, ethanol, polyalcohols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethyl cellulose and suitable mixtures thereof , vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the desired particle size in the case of dispersions, and by the use of surfactants.

The compositions of the present invention may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents including, for example, parabens, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents such as sugars, sodium chloride and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents that delay absorption such as aluminum monostearate and gelatin.

If the compound is unstable or has low solubility in aqueous media, it can be formulated as a concentrate in organic solvent. Subsequently, the concentrate can be diluted to lower concentrations in aqueous systems and can be sufficiently stable for a short period of time during administration. Thus, in another aspect, there is provided a pharmaceutical composition comprising a non-aqueous solution consisting entirely of one or more organic solvents, which can be administered as is or more often prior to administration using a suitable IV excipient (saline, saline, Dextrose; buffered or unbuffered) dilution (Solubilizing excipients in oral and injectable formulations, Pharmaceutical Research, 21(2), 2004, pp. 201-230). Examples of solvents and surfactants are propylene glycol, PEG300, PEG400, ethanol, dimethylacetamide (DMA), N-methyl-2-pyrrolidone (NMP, Pharmasolve), glycerin, Cremophor EL, Cremophor RH 60 and polysorbate. Certain non-aqueous solutions consist of 70-80% propylene glycol and 20-30% ethanol. A specific non-aqueous solution consists of 70% propylene glycol and 30% ethanol. The other is 80% propylene glycol and 20% ethanol. Typically, these solvent systems are used in combination and are usually diluted at least 2-fold prior to IV bolus injection or IV infusion. Typical amounts for a bolus IV formulation are ~50% glycerol, propylene glycol, PEG300, PEG400, and ~20% ethanol. Typical amounts for IV infusion formulations are ~15% glycerol, 3% DMA and ~10% propylene glycol, PEG300, PEG400 and ethanol.

In one embodiment of the invention, the pharmaceutical composition is in a form suitable for i.v. administration, eg, by injection or infusion. For intravenous administration, the solution may be administered as is, or may be injected into an infusion bag (containing a pharmaceutically acceptable excipient such as 0.9% saline or 5% dextrose) prior to administration.

In one embodiment, the pharmaceutical composition is in a form suitable for subcutaneous (s.c.) administration.

Pharmaceutical dosage forms suitable for oral administration include lozenges, capsules, caplets, pills, lozenges, syrups, solutions, powders, granules, elixirs and suspensions, sublingual lozenges, wafers or patches and cheek pieces.

Pharmaceutical compositions described herein containing pharmaceutically acceptable salts of the compounds can be formulated according to known techniques, see eg, Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA, USA.

In one embodiment, the compounds described herein can be formulated into solid dosage forms (eg, lozenges and capsules, etc.). Lozenge compositions may contain a unit dose of the active compound together with an inert diluent or carrier such as a sugar or sugar alcohol, for example lactose, sucrose, sorbitol or mannitol; and/or a non-sugar derived diluent such as sodium carbonate, Calcium phosphate, calcium carbonate or cellulose or derivatives thereof, such as methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, and starches such as cornstarch. Tablets may also contain such standard ingredients as binding and granulating agents, such as polyvinylpyrrolidone, disintegrants (eg, expanded cross-linked polymers such as croscarmellose), lubricants ( For example, stearate), preservatives (for example, parabens), antioxidants (for example, BHT), buffers (for example, phosphate or citrate buffers), and agents such as citrate/diol Foaming agent for carbonate mixtures. Such excipients are well known and need not be discussed in detail here.

Capsule formulations can be of the hard or soft gelatin variety and can contain the active ingredient in solid, semi-solid or liquid form. Gelatin capsules can be formed from animal gelatin or its synthetic or plant-derived equivalents.

Solid dosage forms (eg, lozenges, capsules, etc.) may be coated or uncoated, but typically have a coating, such as a protective film coating (eg, a wax or varnish) or an extended release coating. Coatings (eg, Eudragit®-type polymers) can be designed to release the active ingredient at the desired location within the gastrointestinal tract. Accordingly, the coating may be selected to disintegrate under specific pH conditions in the gastrointestinal tract, thereby selectively releasing the compound in the stomach or in the ileum or duodenum.

As an alternative to or in addition to a coating, the drug may be present in the form of a solid matrix containing a sustained release agent, such as a release delaying agent that can be adapted to selectively release compounds in the gastrointestinal tract under various acidic or basic conditions . Alternatively, the matrix material or release delaying coating may be in the form of an erodible polymer (eg, a maleic anhydride polymer) that erodes substantially continuously as the dosage form passes through the gastrointestinal tract. As another alternative, the active compound can be formulated in a delivery system that provides osmotic control of the release of the compound. Osmotic release and other delayed or sustained release formulations can be prepared according to methods well known to those skilled in the art.

Pharmaceutical formulations may be delivered to the patient in a "patient pack" containing a complete course of treatment in a single package, often a blister pack. The patient package has advantages over traditional prescriptions where the pharmacist divides the patient's medical supply from the bulk supply because the patient always has access to the package insert that is contained in the patient package but is often missing from the patient's prescription. The inclusion of a drug label has been shown to improve patient compliance with physician instructions.

Compositions for topical use include ointments, creams, sprays, patches, gels, liquid drops, and inserts (eg, intraocular inserts). Such compositions can be formulated according to known methods.

Compositions for parenteral administration are usually in the form of sterile aqueous or oily solutions or refined suspensions, or may be in the form of finely divided sterile powders for extemporaneous fusion with sterile water for injection.

Pharmaceutical formulations suitable for parenteral administration include aqueous and non-aqueous sterile injectable solutions that may contain antioxidants, buffers, bacteriostatic agents, and solutes that render the formulation isotonic with the blood of the intended recipient; and may include suspensions Aqueous and non-aqueous sterile suspensions of agents and thickening agents. The formulations can be presented in unit-dose or multi-dose containers, such as sealed ampoules and vials, and can be stored in freeze-dried (lyophilized) conditions requiring only the addition of a sterile liquid carrier, e.g., for injection, before use. water. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets.

It is to be understood that, in addition to the ingredients specifically mentioned above, the formulations described herein may include other agents known in the art, such as those suitable for oral administration, with respect to the type of formulation concerned. Such formulations may include flavoring agents.

The present invention also provides single pharmaceutical compositions wherein a compound of the present invention, or a pharmaceutically acceptable salt thereof, and one or more other pharmaceutically active agents may be administered together or separately. In one embodiment, the pharmaceutical composition contains a compound or pharmaceutically acceptable salt selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof, and one or more antiviral agents or steroids.

In one embodiment, the pharmaceutical composition contains a compound or pharmaceutically acceptable salt selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate, or a pharmaceutically acceptable salt thereof, and one or more other antiviral agents.

In one embodiment, the one or more other antiviral agents are selected from the group consisting of oseltamivir, remdesivir, ganciclovir, lopinavir, ritonavir, and zanamivir . In one embodiment, the pharmaceutical composition contains a single other antiviral agent. In a more specific embodiment, the single other antiviral agent is remdesivir.

In one embodiment, the pharmaceutical composition contains a compound selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof, and one or more steroids.

In one embodiment, the one or more steroids are selected from the group consisting of dexamethasone, prednisone, methylprednisone, and hydrocortisone. In one embodiment, the pharmaceutical composition contains a single steroid. In a more specific embodiment, the single steroid is dexamethasone.

Appropriate dosages will be readily apparent to those skilled in the art. When a compound of the present invention, or a pharmaceutically acceptable salt thereof, is used in combination with a second therapeutic agent, the dose of each compound may be different from that when the compound is used alone.

Inhalable pharmaceutical composition In one embodiment, the compound of the present invention can be formulated N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[( 3S)-2-Oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl} - Benzyl 2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof is administered by inhalation. Administration by inhalation compositions may be in the form of inhalable powder compositions or liquid or powder sprays, and may be administered in standard form using powder inhalation devices or aerosol dispensing devices. Such devices are well known and include, for example, breath-induced inhalers. For administration by inhalation, powder formulations typically contain the compound of the invention N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-pendoxyloxy-3 -[(3S)-2-Oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl Benzyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{ [(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propane -2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or its medicine Scientifically acceptable salts and inert solid powdered diluents such as lactose.

The inhalable pharmaceutical composition comprises the micronized compound N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxy-3-[( 3S)-2-Oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl} - Benzyl 2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S )-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propane-2- Benzyl]aminocarbamic acid}-3-methylbutyl]aminocarbamic acid}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or its pharmaceutically acceptable Accepted salts and optional carriers such as lactose. Compounds of the invention N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)- 1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarboxy]propan-2-yl]aminocarboxy [ (1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrole Perid-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl] Benzyl carbamate or a pharmaceutically acceptable salt thereof is micronized.

In one embodiment, substantially all of the micronized compounds of the present invention are N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-pendoxo-3 -[(3S)-2-Oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl Benzyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{ [(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propane -2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or its medicine Academically acceptable salts have particle sizes less than 10 µm.

In one embodiment, the formulation of the present invention comprises the compound of the present invention N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-pendantoxy- 3-[(3S)-2-Oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]aminocarbamoyl}butyl]amine carboxyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof; or N-[(1S)-1- {[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl] Propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or its A pharmaceutically acceptable salt in an amount such that, when administered by inhalation from an inhaler, a therapeutically effective single dose (hereafter a single dose) is between about 25 to about 150 mg BiD (total dose 50 to 300 mg) . In one embodiment, the therapeutically effective single dose of the compound is between about 50 mg to about 85 mg BiD (total dose 100 mg to 170 mg). In one embodiment, the therapeutically effective single dose of the compound is between about 10 mg to about 50 mg TiD (total dose 30 mg to 150 mg).

A single dose should depend on the type and severity (weight, sex, age) of the patient's disease and condition and should be administered one or more times a day, eg, once, twice or three times a day.

Pharmaceutical formulations suitable for administration by inhalation include dry powders or finely divided dusts or sprays, which can be produced by means of various types of metered, dose-pressurized sprays, nebulizers or inhalers. Pharmaceutical formulations can be made by eg Ives et al .: Dry powder inhaled compound delivery for early pre-clinical in vivo efficacy studies. Journal of Inflammation 2013 10(Suppl 1):P36 (doi:10.1186/1476-9255-10-S1 -Dry powder as described in P36) is delivered by inhalation.

In one embodiment, N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-sideoxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4- Pharmaceutical formulations of benzyl (trifluoromethyl)piperidin-1-yl]ethyl]carbamate can be delivered at the desired concentration as a single dry powder dose for inhalation, optionally containing lactose or other excipients (optional) .

Administration of a single inhalation dry powder dose using a Wright Dust Feeder (WDF) and Aerosolised Dust Generation (ADG) inhalation tower at a target dose level of 5 mg/kg (free base equivalent) , 32% w/w compound with lactose blend) N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-pendoxyl-3- [(3S)-2-Oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]aminocarbamoyl}butyl]carbamoyl A single inhalation dry powder dose of benzyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate was administered to male Wistar Han (WH) rats.

Animal randomization lines were used to group animals into cages and were tagged on the tail with permanent markers for identification. Rats were weighed within 24 hours of administration, with one group placed in an incubator with a tail cannula inserted for serial blood collection. Rats were dosed as an inhalation dry powder, 32% compound (w/w) in lactose at a target dose level of 5 mg/kg (free base equivalent) using a 60 minute inhalation period.

Determination of N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-sideoxy-3-[(3S)-2-side in blood and lung Oxypyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4- Concentration of benzyl (trifluoromethyl)piperidin-1-yl]ethyl]carbamate, allowing calculation of PK parameters and lung retention. The compound mixture is dispensed using a WDF mechanism with a nozzle section. The WDF is attached to the 24-section ADG tower. WDF velocities were determined from pre-tests, recorded and used for administration. A conditioned compressed air flow (~14 liters/min) delivered the aerosol from the WDF into the inhalation chamber. The extraction speed was set to ~16 liters/min. Room air was slightly drawn (2.0 liters/min) into the chamber to equalize airflow and keep the chamber at ~ambient pressure while ensuring aerosol flow through the chamber. Rats were placed individually in Perspex confinement cones and attached to one of the 24 ports on the ADG tower. Three rats were placed on different tiers of the dosing tower per time point to account for differences between tiers and to minimize differences between groups. Using a rough schedule, all rats were subjected to a 15 minute inhalation tube acclimation on the inhalation tower with 14 L in, 16 L out flow, then the gas flow was turned off, the compound was placed on the apparatus, and the gas flow was then turned on again. Rats were dosed with the compound mixture over a 60-minute period (data not shown) and thereafter returned to their cages and storage if not sampled immediately after dose (IAD). Data will be used to facilitate dosing predictions in humans and guide dose selection in preclinical safety studies. The rat line was of the selected species for use in the safety analysis study.

In one embodiment, the compounds of the present invention may be administered in a human dose range of about 25 to about 150 mg BiD (total dose 50 to 300 mg). In one embodiment, the compounds of the present invention may be administered in a human dose range of about 50 mg to about 85 mg BiD (total dose 100 mg to 170 mg). In one embodiment, the compounds of the present invention can be administered in a human dose range of about 10 mg to about 50 mg TiD (total dose 30 mg to 150 mg).

In one embodiment, the compounds of the present invention may be administered in a human dose range of about 15 mg to about 35 mg TiD (total dose 45 mg to 105 mg). In one embodiment, the compounds of the present invention may be administered to humans at doses ranging from about 25 mg TiD (75 mg total daily dose) to about 70 mg BiD (140 mg total daily dose) based on the course of the dosing interval to obtain the desired unconstrained concentration in the lung.

When selected from N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidine -3-yl]-1-[(propan-2-yl)aminocarboxy]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethane yl)piperidin-1-yl]ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) When a compound of benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof is used in combination with a second therapeutic agent, the human dose of each compound can be different from the dose when the compound is used alone.

Biological data To assess inhibition of coronaviruses, a series of biochemical inhibition and cell-based antiviral assays were performed in different formats and locations. Analysis was performed using different cell lines and different viral replication assays using coronaviruses including SARS-CoV1, SARS-CoV2, MERS, OC43 and 229e. The results showed that in most of these assays, compounds A and B were inhibitors of the coronavirus strains, with differences in potency due to the format of the assay.

Antiviral Assessment - Part A : In Vitro Biochemical 3CL Protease Inhibition; Coronavirus OC43 3CL Protease Protocol - Method 1 Compounds were tested starting at a high concentration of 1.0 mM, using 100% DMSO in solvent for 3-fold serial dilutions in an 11-point curve. Each dilution was transferred to a black 384-well Greiner (784076) dish in a 100 nL volume, yielding the highest final concentration of 10 μM in the assay. The lower control wells in column 18 (0% reaction, 100% inhibition) contained 100 nL DMSO and buffer without enzyme. The higher control wells in column 6 (100% reaction, 0% inhibition) contained 100 nL DMSO with buffer and enzyme. The highest DMSO concentration was about 1% in the entire pan.

The assay buffer consisted of 25 mM HEPES (pH 7.5), 50 mM NaCl, 1 mM CHAPS and 1 mM EDTA. Assay disk preparation consisted of spinning the disk, then adding the reaction, and adding only 5 μL of Assay Buffer (no enzyme) to column 18 (lower control - represents 100% inhibition) and 5 μL of 2 nM enzyme (OC43 3CL protease, 1 nM final concentration) in assay buffer to columns 1-17 and 19-24.

The FRET substrate peptide (FAM-VARLQSGFG-TAMRA) (SEQ ID NO: 7) was suspended at a concentration of 4 μM, and 5 μL was added to each reaction well using a Thermo Combi liquid handler to obtain a final reaction concentration of 2 μM. Reactions were incubated in the dark for 60 minutes at room temperature. At that time, the FRET signal was measured using an Envision or equivalent disc reader and used as the endpoint of the quantification analysis for apparent _EC50 calculations.

Data from each plate was analyzed and plotted as % inhibition versus compound concentration. The data were normalized using the formula 100*(Control 1-Unknown)/(Control 1-Control 2), where Control 1 was the mean value of the plate corresponding to the 0% inhibition control well (DMSO, column 6), and Control 2 Corresponds to the mean of 100% control wells (column 18). Curve fitting is performed using the 4-parameter curve fitting formula y=A+((BA)/(1+(10 ^{^} x/10 ^{^} C) ^{^} D)), where A is the minimum response, B is the maximum response, and C is the maximum response log( _XC50 ) and D is the Hill slope. Results for test compounds are reported as _pIC50 values (-C in the formula above) and are reported as the maximal response at a given concentration. The detection limit of this method is usually one-half the enzyme concentration of highly purified enzyme.

Coronavirus OC43 3CL Protease Protocol Method 2 Test compounds were serially diluted 1.5-fold in a 22-point curve using 100% DMSO in solvent starting from a high concentration of 1.0 mM. Each dilution was transferred to a black 384-well Greiner (784076) dish in a 2.5 nL volume using an Echo sound dispenser, yielding a maximum final concentration of 0.25 μM and a lower concentration of 75 pM in the assay. The lower control wells in column 18 (fractional residual activity = 0) contained 2.5 nL DMSO with buffer, no enzyme. The higher control wells in column 6 (fractional residual activity = 1) contained 2.5 nL DMSO with buffer and enzyme.

The assay buffer consisted of 25 mM Hepes (pH 7.5), 50 mM NaCl, 1 mM CHAPS, 1 mM EDTA, 0.08% (w/v) fatty acid free BSA and 1% (v/v) DMSO. Add lower control only, 9 μL assay buffer (no enzyme) to column 18, followed by 9 μL of 3.2 nM enzyme (OC43 CoV 3CL protease) in assay buffer to columns 1-17 and 19-24 in the column. The assay disks were centrifuged at 500 rpm for 1 minute and incubated at room temperature for 2 hours.

FRET substrate peptide (FAM-VARLQSGFG-TAMRA; AnaSpec) (SEQ ID NO: 7) was suspended in assay buffer at a concentration of 125 μM and 1 μL was added to each well using a Thermo Combi liquid handler to obtain Final reaction concentration of 12.5 μM. The assay disks were centrifuged at 500 rpm for 1 minute and incubated at room temperature for 60 minutes. At that time, the FRET signal was measured using a PheraSTAR disk reader (BMG LabTech) with excitation at 485 nm and emission at 520 nm, and was used as the endpoint of quantitative analysis for apparent Ki calculations.

Data from each plate was normalized for fractional residual activity (vi/vo), i.e. [net test sample activity (total FLINT counts - average of lower control counts)]/[net DMSO control activity (higher control FLINT counts) The mean of the lower control counts)] and fit to a quadratic model for tight binding inhibition in ABASE XE.

Tight binding equation system: y = ((B/(2*C))*(((Cx)-A)+(((((x+A)-C)^2)+((4*A)* C))^0.5))); inv = (((((A*B)/y)-((y*C)/B))+C)-A); res = (y-fit) where, X = [inhibitor] (M) Y = fractional residual activity (vi/vo) A = explicit Ki; converted to pKi = -log (explicit Ki) B = uninhibited control, if y value is set to fractional residual activity, then B=1, ie, test sample net activity/control (no inhibitor) net activity (vi/v0) and mean higher control net activity=1. C = total active enzyme concentration (in M). By default, C is allowed to float during the initial fit of ABASE. Constraints were applied manually if C < 0, where C was fixed at the calculated enzyme concentration (3.2 x ^10-9 M) or the actual active enzyme concentration titrated based on individual active sites.

Coronavirus 229e 3CL Protease Protocol - Method 1 Test compounds starting at a high concentration of 1.0 mM were serially diluted 3-fold in an 11-point curve using 100% DMSO in solvent. Each dilution was transferred to a black 384-well Greiner (784076) dish in a 100 nL volume, yielding the highest final concentration of 10 μM in the assay. The lower control wells in column 18 (0% reaction, 100% inhibition) contained 100 nL DMSO and buffer without enzyme. The higher control wells in column 6 (100% reaction, 0% inhibition) contained 100 nL DMSO with buffer and enzyme. The highest DMSO concentration was about 1% in the entire pan.

The assay buffer consisted of 25 mM Hepes (pH 7.5), 50 mM NaCl, 1 mM CHAPS and 1 mM EDTA. Assay disk preparation consisted of spinning the disk, then adding the reaction, and adding only 5 μL of Assay Buffer (no enzyme) to column 18 (lower control - represents 100% inhibition) and 5 μL of 200 pM enzyme (229e 3CL protease, 100 pM final concentration) in assay buffer to columns 1-17 and 19-24.

The FRET substrate peptide (FAM-VARLQSGFG-TAMRA) (SEQ ID NO: 7) was suspended at a concentration of 4 μM, and 5 μL was added to each reaction well using a Thermo Combi liquid handler to obtain a final reaction concentration of 2 μM. Reactions were incubated in the dark for 60 minutes at room temperature. At that time, the FRET signal was measured using an Envision or equivalent disc reader and used as the endpoint of the quantification analysis for apparent _EC50 calculations.

Data from each plate was analyzed and plotted as % inhibition versus compound concentration. The data were normalized using the formula 100*(Control 1-Unknown)/(Control 1-Control 2), where Control 1 was the mean value of the plate corresponding to the 0% inhibition control well (DMSO, column 6), and Control 2 Corresponds to the mean of 100% control wells (column 18). Curve fitting is performed using the 4-parameter curve fitting formula y=A+((BA)/(1+(10 ^{^} x/10 ^{^} C) ^{^} D)), where A is the minimum response, B is the maximum response, and C is the maximum response log( _XC50 ) and D is the Hill slope. Results for test compounds are reported as pIC50 values (-C in the formula above) and are reported as the maximal response at a given concentration. The detection limit of this method is usually one-half the enzyme concentration of highly purified enzyme.

Coronavirus 229e 3CL Protease Protocol Method 2 Test compounds starting at high concentrations of 1.0 or 0.25 mM were serially diluted 1.5-fold in a 22-point curve using 100% DMSO in solvent. Each dilution with a high concentration of 1 mM was transferred into a black 384-well Greiner (784076) dish in a 2.5 nL volume using an Echo sound dispenser, resulting in a maximum final concentration of 0.25 μM and a lower concentration of 75 pM in the assay. Alternatively, each dilution with a high concentration of 0.25 mM was transferred to a black 384-well Greiner (784076) dish in a 20 nL volume using an Echo sound dispenser, resulting in a maximum final concentration of 0.50 μM and a lower concentration of 100 pM in the assay. The lower control wells in column 18 (fractional residual activity = 0) contained 2.5 nL DMSO with buffer, no enzyme. The higher control wells in column 6 (fractional residual activity = 1) contained 2.5 nL DMSO with buffer and enzyme. For the rate data, the higher inhibitor is in column 1, rows A and B, and the higher control (no inhibitor) is in columns 23 and 24, rows A and B, where the intermediate diluent is in column 1 2 to 22 columns. Lower control rates were unimportant but not subtracted.

Assay buffers consisted of 25 or 50 mM Hepes (pH 7.5), 50 or 100 mM NaCl, 1 mM CHAPS or 0.02% Pluronic F-127, 0 or 1 mM EDTA, 0 or 1 mM EDTA, 0 or 10% DMSO. Add lower control only, 9 μL assay buffer (no enzyme) to column 18, then add 3.2 or 11.1 nM enzyme (229e CoV 3CL protease) in assay buffer to columns 1-17 and 19-24 in the column. The assay plates were centrifuged at 500 or 1000 rpm for 1 minute and incubated at room temperature for 1.5 or 2 hours.

FRET substrate peptide (FAM-VARLQSGFG-TAMRA (SEQ ID NO: 7); AnaSpec) was suspended in assay buffer at a concentration of 125 μM, or FRET substrate peptide (HiLyte488-ESATLQSGLRKAK-(QXL520) at a concentration of 250 μM -NH2;AnaSpec) (SEQ ID NO: 9) was suspended in assay buffer and 1 μL was added to each reaction well using a Thermo Combi liquid handler to obtain a final reaction concentration of 12.5 μM, or added by pipette to a final concentration of 25 μM. Assay disks were centrifuged at 500 or 1000 rpm for 1 minute for FAM-TAMRA matrix and incubated for 60 minutes at room temperature, or read kinetically every 15 seconds for 60 minutes for HiLyte-QXL matrix. At that time, the FAM-TAMRA FRET signal was measured using a PheraSTAR disc reader (BMG LabTech) with excitation at 485 nm and emission at 520 nm, and was used as the endpoint of quantitative analysis for apparent Ki calculations. Alternatively, the HiLyte-QXL FRET signal was measured using a Spectromax M2 disk reader (Molecular Devices) with excitation at 485 nm and emission at 528 nm. Linear rates were determined using the supplier's software (Softmax 5.4), exported to Microsoft Excel and used for apparent Ki calculations.

Endpoint or rate data from each plate were normalized for fractional residual activity (vi/vo), i.e. [net test sample activity (total FLINT counts - average of lower control counts)]/[net DMSO control activity (vs. Mean of high control FLINT counts - mean of lower control counts)] and fit to a four-parameter model for inhibition in GraphPad Prism for endpoint data, or tight binding inhibition in GraFit (Erithacus) for rate data into a quadratic model. 4-parameter IC50 fitting equation system: y = A+((B-A)/(1+(IC50/X)^D)), where, X = [Inhibitor] (M) Y = reaction, fractional residual activity (vi/vo) A = bottom asymptote, high enzyme activity control, no I B = top asymptote, low enzyme activity control, no enzyme C = -log10 Negative value of IC50 D = Hill slope

Tight binding equation system: y = ((B/(2*C))*(((Cx)-A)+(((((x+A)-C)^2)+((4*A)* C))^0.5))); inv = (((((A*B)/y)-((y*C)/B))+C)-A); res = (y-fit), where X = [inhibitor] (M) Y = fractional residual activity (vi/vo) A = apparent Ki; converted to pKi = -log (apparent Ki) B = uninhibited control, if y value is set to Fractional residual activity, then B=1, ie, test sample net activity/control (no inhibitor) net activity (vi/v0) and mean higher control net activity=1. C = total active enzyme concentration (in M). By default, C is allowed to float during the initial fit of ABASE. Constraints were applied manually if C < 0, where C was fixed at the calculated enzyme concentration (5 x ^10-9 M) or the actual active enzyme concentration titrated based on individual active sites.

SARS -CoV 3CL Protease Protocol - Method 1 Test compounds starting at a high concentration of 1.0 mM were serially diluted 3-fold in an 11-point curve using 100% DMSO in solvent. Each dilution was transferred to a black 384-well Greiner (784076) dish in a 100 nL volume, yielding the highest final concentration of 10 μM in the assay. The lower control wells in column 18 (0% reaction, 100% inhibition) contained 100 nL DMSO and buffer without enzyme. The higher control wells in column 6 (100% reaction, 0% inhibition) contained 100 nL DMSO with buffer and enzyme. The highest DMSO concentration was about 1% in the entire pan.

The assay buffer consisted of 25 mM Hepes (pH 7.5), 50 mM NaCl, 1 mM CHAPS and 1 mM EDTA. Assay disk preparation consisted of spinning the disk, then adding the reaction, and adding only 5 μL of Assay Buffer (no enzyme) to column 18 (lower control - represents 100% inhibition) and 5 μL of 60 nM enzyme (SARS 3CL protease, 30 nM final concentration) in assay buffer to columns 1-17 and 19-24.

The FRET substrate peptide (FAM-KTSAVLQSGFRKME-TAMRA) (SEQ ID NO: 8) was suspended at a concentration of 6 μM and 5 μL was added to each well using a Thermo Combi liquid handler to obtain a final reaction concentration of 3 μM. Reactions were incubated in the dark for 60 minutes at room temperature. At that time, the FRET signal was measured using an Envision or equivalent disc reader and used as the endpoint of the quantification analysis for apparent _EC50 calculations.

Data from each plate was analyzed and plotted as % inhibition versus compound concentration. The data were normalized using the formula 100*(Control 1-Unknown)/(Control 1-Control 2), where Control 1 was the mean value of the plate corresponding to the 0% inhibition control well (DMSO, column 6), and Control 2 Corresponds to the mean of 100% control wells (column 18). Curve fitting is performed using the 4-parameter curve fitting formula y=A+((BA)/(1+(10 ^{^} x/10 ^{^} C) ^{^} D)), where A is the minimum response, B is the maximum response, and C is the maximum response log( _XC50 ) and D is the Hill slope. Results for test compounds are reported as pIC50 values (-C in the formula above) and are reported as the maximal response at a given concentration. The detection limit of this method is usually one-half the enzyme concentration of highly purified enzyme.

SARS -CoV 3CL Protease Protocol Method 2 Test compounds were serially diluted 1.5-fold in a 14-point curve using 100% DMSO in solvent starting from a high concentration of 0.25 mM in columns 1 to 3 (3 replicates). Each dilution was transferred to a black 384-well Greiner (784076) dish in a 20 nL volume using an Echo sound dispenser, yielding a maximum final concentration of 500 nM and a lower concentration of 2.6 nM in a 10 μL total volume assay. High control wells (fractional residual activity = 1 vo of vo) in rows O and P contained 20 nL DMSO with buffer and enzyme.

Assay buffer consisted of 50 mM Hepes (pH 7.5), 100 mM NaCl, 0.02% (w/v) Pluronic F-127, 1 mM DTT, 0% or 0.005% (w/v) fatty acid free BSA and 1% or 10% (v/v) DMSO composition. Assay plate preparation included adding 9 μL of 5 nM enzyme or 5 μL of 80 nM enzyme (SARS 3CL protease, 5 or 40 nM final concentration) in assay buffer to columns 1-3. Assay plates were centrifuged at 500 or 1000 rpm for 1 minute to mix enzymes and inhibitors and preincubated for 90, 100 or 180 minutes at room temperature.

FRET substrate peptide (HiLyte488-ESATLQSGLRKAK-(QXL520)-NH2; AnaSpec) (SEQ ID NO: 9) was suspended in assay buffer at a concentration of 400 μM or 40 μM and 1 μL or 5 μL was added to each reaction wells to initiate the reaction with a final reaction concentration of 40 μM or 20 μM in a total volume of 10 μL. The assay disks were centrifuged for 1 minute at 500 or 1000 rpm to mix and read every 10 seconds in kinetic mode for 45 or 120 minutes at room temperature. FRET signals were measured using a Spectromax Gemini M2 or M5 disk reader (Molecular Devices) with excitation at 485 nm and emission at 528 nm. Linear rates were determined using vendor software (Softmax 5.4) or exported to Microsoft Excel or GraFit 7.0 (Erithacus) and used for apparent Ki calculations.

Rate data from each plate was normalized for fractional residual activity (vi/vo), i.e. [test sample activity (vi = linear rate at each inhibitor)] / [mean no inhibitor DMSO control activity (vo = high control) mean of linear rates)] and fit to a quadratic model of tight binding inhibition using 7.0 (Erithacus) or using Microsoft EXCEL plus XLfit (IDBS). A tightly bound equation system: y = ((B/(2*C))*(((Cx)-A)+(((((x+A)-C)^2)+((4*A)*C))^0.5 ))); inv = (((((A*B)/y)-((y*C)/B))+C)-A); res = (y-fit) in, X = [Inhibitor] (M) Y = fractional residual activity (vi/vo) A = apparent Ki; converted to pKi = -log (apparent Ki) B = uninhibited control, if y value is set to fractional residual activity, then B = 1, i.e., test sample net activity/control (no inhibitor) net activity (vi/v0) and average higher control net activity Active = 1. C = total active enzyme concentration (in M). By default, C is allowed to float during the initial fit. Constraints were applied manually if C < 0, where C was fixed at the calculated enzyme concentration (5 x 10-9 M or 40 x 10-9 M) or the actual active enzyme concentration titrated based on individual active sites.

SARS - CoV- 2 3CL Protease Protocol Test compounds were serially diluted 1.5-fold with a 22-point curve using 100% DMSO solvent starting from a high concentration of 0.5 mM. Each dilution was transferred to a black 384-well Greiner (784076) dish in a 20 nL volume using an Echo sound dispenser, yielding a maximum final concentration of 1 μM and a lower concentration of 200 pM in the assay. The lower control wells in column 18 (fractional residual activity = 0) contained 20 nL DMSO with buffer, no enzyme. The higher control wells in column 6 (fractional residual activity = 1) contained 20 nL DMSO with buffer and enzyme.

Assay buffer consisted of 50 mM Hepes (pH 7.5), 100 mM NaCl, 0.02% (w/v) Pluronic F-127, 1 mM DTT, 0.005% (w/v) fatty acid free BSA and 10% (v/v) ) DMSO composition. Add lower control only, 5 μL assay buffer (no enzyme) to column 18, followed by 9 μL of 10 nM enzyme (SARS CoV2 3CL protease) in assay buffer to columns 1-17 and 19-24 in the column. The assay disks were centrifuged at 500 rpm for 1 minute and incubated at room temperature for 2 hours.

FRET substrate peptide (HiLyte488-ESATLQSGLRKAK-(QXL520)-NH2; AnaSpec) (SEQ ID NO: 9) was suspended in assay buffer at a concentration of 200 μM and 1 μL was added to each reaction using a Thermo Combi liquid handler In the wells, a final reaction concentration of 20 μM was obtained. The assay disks were centrifuged at 500 rpm for 1 minute and incubated at room temperature for 60 minutes. At that time, the FRET signal was measured using a PheraSTAR disk reader (BMG LabTech) with excitation at 485 nm and emission at 520 nm, and was used as the endpoint of quantitative analysis for apparent Ki calculations.

Data from each plate was normalized for fractional residual activity (vi/vo), i.e. [net test sample activity (total FLINT counts - average of lower control counts)]/[net DMSO control activity (higher control FLINT counts) The mean of the lower control counts)] and fit to a quadratic model for tight binding inhibition in ABASE XE. Tight binding equation system: y = ((B/(2*C))*(((Cx)-A)+(((((x+A)-C)^2)+((4*A)* C))^0.5))); inv = (((((A*B)/y)-((y*C)/B))+C)-A); res = (y-fit) where X = [inhibitor] (M) Y = fractional residual activity (vi/vo) A = apparent Ki; converted to pKi = -log (apparent Ki) B = uninhibited control, if y value is set to fraction Remaining activity, then B=1, ie, test sample net activity/control (no inhibitor) net activity (vi/v0) and mean higher control net activity=1. C = total active enzyme concentration (in M). By default, C is allowed to float during the initial fit of ABASE. Constraints were applied manually if C < 0, where C was fixed at the calculated enzyme concentration (1 x ^10-8 M) or the actual active enzyme concentration titrated based on individual active sites.

Results - Part A N -[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxy- Pyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(tris Fluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester free base; and N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butyl Aminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl] Aminocarbamate}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester free bases were each tested for in vitro inhibitory activity against 3CL protease from alpha and beta coronaviruses, The results are as follows: Table 1 Compound* SARS-CoV-2 apparent pKi SARS-CoV pIC ₅₀ ¹ , apparent pKi ² 229e pIC ₅₀ ¹ , apparent pKi ² OC43 pIC ₅₀ ¹ , apparent pKi ² A 8.2 (n=62) 7.3 (n=14) ¹ , 8.1 (n=6) ² 7.2 (n=14) ¹ , 7.3 (n=2) ² 7.8 (n=12) ¹ , 8.7 (n=12) ² B 8.4 (n=6) 7.3(n=2) ¹ 7.2 (n=2) ¹ , 7.2 (n=1) ² 8.0 (n=2) ¹ , 8.9 (n=2) ² * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate 1 Method 1 2 Method 2

SARS-CoV-1 3-CL enzyme showed 96% amino acid similarity with SARS-CoV-2 3-CL enzyme.

Antiviral Assessment - Part B : Cell- Based In Vitro Assays of SARS-CoV1 and MERS Using VeroE6 and MRC-5 Cells Protocol for SARS-CoV1 Coronavirus Cellular Assays Using Cellular Assays Expressing the Coronavirus Spike Protein as an Endpoint Test compounds. VeroE6 cells (kidney epithelial cells extracted from African green monkeys) were infected with SARS-1 coronavirus. Compounds with antiviral activity reduce spike protein expression, as measured by immunological methods, and cell viability, as measured by nuclear integrity.

In preparation of the assay, a 3-fold 8-point curve was used to serially dilute test compounds in 100% DMSO to obtain the highest assay concentration of 50 uM. DMSO was normalized to a final concentration of 1% in the wells. Low control wells (100% CPE or 100% cytotoxicity) contained DMSO in the presence of virus-infected cells.

VeroE6 cells were treated with compounds for 2 hours and subsequently infected with SARS-CoV1 at an MOI of 1. Viruses were allowed to replicate for 48 hours, after which they were inactivated with formalin. Infected cells were detected by immunostaining using anti-S protein antibody and quantified by PE Opera confocal platform. The signal of S protein staining was converted to % infection and % inhibition was calculated using positive and negative controls. EC50s were calculated using standard equations using GeneData software.

Result - Part B Pyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(tris Fluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester free base; and N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butyl Aminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl] Aminocarbamate}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester free base was also each directed against MERS cell assays using human lung fibroblast MRC-5 cells. Inhibitory activity was tested and the following EC50 values are presented. Table 2 Compound* MERS cell analysis MRC-5 cell EC ₅₀ (μM) performed alone A 0.23, 0.22, 0.14 B 0.06, 0.14 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester

N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate free base; and N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamoyl )-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl }-2-(4,4-Difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester free bases were also each tested for inhibitory activity in a MERS cell assay using VeroE6 cells and presented the following _EC50 values : table 3 Compound* MERS cell analysis VeroE6 cells EC ₅₀ (μM) performed alone A 14.67, 20.14 B 0.74, 0.67 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester

N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate free base; and N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamoyl )-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl }-2-(4,4-Difluoropiperidin-1-yl)ethyl]carbamate free bases were also each tested for inhibitory activity in SARS cell assays using VeroE6 cells and presented the following _EC50 values : Table 4 Compound* SARS cell analysis VeroE6 cells EC ₅₀ (μM) performed alone A 14.67, 20.14 B 4.78, 5.19 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester

Antiviral Evaluation - Part C: Cell- Based In Vitro Assays of SARS-CoV1 , SARS-CoV2 and MERS in Vero E6 Cells As described below, Applicants separately evaluated compounds N-[(1S)-1-{ by CPE analysis [(1S)-3-Methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]-1-[(propane- 2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl] benzyl carbamate free base; and N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-pendoxyl-3- [(3S)-2-Oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-di Inhibitory effect of benzyl haloperidin-1-yl)ethyl]carbamate free base against SARS-CoV-1, SARS-CoV-2 and MERS in Vero E6 cells.

Materials and Methods for Coronavirus Analysis 2-Pendant oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]aminocarbamoyl}butyl]aminocarbamoyl}-2- [4-(Trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester free base; and N-[(1S)-1-{[(1S)-1-{[(2S)- 1-(Butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3- Methylbutyl]aminocarbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester free base is supplied as a solid and diluted to 50 mM or 10 mM stock Solutions were in DMSO and stored at 4°C until the day of analysis. A panel of positive control antiviral compounds was included in each of the assays performed.

The virus strains and cell lines are as listed in Tables 5 and 6, and the virus and cell lines used for these evaluations were obtained from WRCEVA and the American Type Culture Collection (ATCC), respectively (subsequent lines highly expressing ACE2 classification and subcloning of cells). Evaluations were performed using a CPE reduction assay to measure antiviral effect and a cell viability assay (non-GLP assay) to measure cytotoxic effect of compounds. On each assay day, pre-titrated samples of virus were removed from the freezer (-80°C) and allowed to thaw to room temperature in a biosafety cabinet. Viruses were resuspended and diluted in tissue culture dishes. Cells were subcultured twice a week using standard cell culture techniques and cell culture medium as detailed in Table 6 below at a separation ratio of 1 :2 to 1 :5. Total cell counts and percent viability were determined using the Luna cell viability analyzer and trypan blue dye exclusion. Cell viability was greater than 95% for the cells used for the assay (see Table 6 for the number of cells seeded per well for each assay). Table 5. Virus strains used for antiviral evaluation Virus strain Tested cell line MOI positive control BSL Analysis duration ( days) endpoint SARS-CoV-1 Toronto 2 VeroE6 0.002 Calcium Activase Inhibitor IV, Chloroquine, Remdesivir, Specialty Compounds 3 3 CPE SARS-CoV-2 USA_WA1/2020 VeroE6 0.002 Calcium Activase Inhibitor IV, Chloroquine, Remdesivir, Specialty Compounds 3 3 CPE MERS EMC/2012 VeroE6 0.002 Calcium Activase Inhibitor IV, Chloroquine, Remdesivir, Specialty Compounds 3 3 CPE BSL - Biosafety Level Table 6. Cells and Media for Antiviral Evaluation cell line Cat# source cell number/ well Cell sources and assay media Vero E6 ¹ CRL-1586 American Culture Collection (ATCC) 4,000 cells/well in 384-well format Medium : MEM2 10% heat ^- inactivated FBS3 Assay Medium: MEM2 ² % heat-inactivated FBS3, ¹ % penicillin-streptomycin ¹ Subcloning for highly expressing ACE2 ² DMEM = Dulbecco's Modified Eagle's Medium ³ FBS - Fetal Bovine Serum

Materials: 1. Corning 3764 BC black wall, clear bottom and Greiner 784076 black wall, low volume 384 plate 2. Promega CellTiter Glo (CTG) (G7573, Promega) 3. Medium: a. MEM Gibco (#11095) b. HI FBS Gibco (#14000) c. Pen/Strep Gibco (#15140); 10U/ml Penicillin and 10ug/ml Streptomycin 4. PBS -/- (w/o Ca ²⁺ or Mg ²⁺ ) 5. Trypsin - EDTA Gibco (#25300-054) 6. Cells - selected from Vero E6 cells with high ACE2 expression 7. Positive controls: a. Calcium Activase Inhibitor IV (Calbiochem #208724) b. Chloroquine (Applicants' Resource Bank) c . Remdesivir (Selleck)

equipment: 1. Beckman FX 2. Echo and Thermo Combi Liquid Handlers 3. Matrix WellMate 4. Thermo Fisher Steri-Cult Incubator 5. Microdisk Reader - Envision, Spectromax M2, M5 or Gemini or PheraSTAR

Compound preparation: Compound stock solutions (50 µL of 10 or 50 mM in 100% DMSO) were transferred to the wells of an empty ECHO plate (stock plate). Compounds were diluted 3-fold by transferring 17 μL of each sample from the stock dish to adjacent wells containing 34 μL DMSO in each well and mixing. This process was repeated to make 8 additional wells of serially diluted samples, each well containing a 3-fold dilution of the previous well. An ECHO555 Acoustic Liquid Handling System was used to dispense 30 nL of each sample into the corresponding wells of the assay preparation plate. Final assay concentration ranges are as follows: 10 - 0.0005 µM for 10 mM stock; 50 - 0.003 µM for 50 mM stock. DMSO was added to control wells to maintain a consistent assay concentration of 0.1% in all wells.

Method to measure the antiviral effect of compounds: Vero E6 cells were grown in MEM supplemented with 10% HI FBS and harvested on assay day in MEM supplemented with 2% HI FBS/1% PS. Assay preparation plates pre-loaded with test compounds were prepared in the BSL-2 laboratory by adding 5 μL assay medium to each well. Plates and cells were then sent to the BSL3 facility. Cells were incubated in batches with the appropriate coronavirus (SARS CoV-1, SARS CoV-2, or MERS) at MOI ~ 0.002, which resulted in 5% cell viability at 72 hours (SARS) or 96 hours (MERS) post-infection. A 25 μL sample of virus-incubated cells (4,000 Vero E6 cells/well) was added to each well in columns 3-24 of the assay plate. For the 0% CPE reduction control, wells in columns 23-24 contained virus-infected cells only. A 25 μL aliquot of cells was added to columns 1-2 of each plate for a 100% CPE reduction control in the presence of cells only, prior to virus inoculation. After culturing the plates for 72 hours at 37°C/5% CO ₂ and 90% humidity, 30 μL of Cell Titer-Glo (Promega) was added to each well. Fluorescence was read using a Perkin Elmer Envision plate reader, followed by incubation at room temperature for 10 minutes to measure cell viability. The disk was sealed with a transparent lid, and the surface was sterilized, and the fluorescence was read.

Method for measuring cytotoxic effect of compounds: Compound cytotoxicity was assayed in a BSL-2 counter as follows: VeroE6 cells in culture medium were added in 25 μl aliquots (4,000 cells/well) to test compounds as above. Prepare the assay preparation plate in each well. Cells alone (100% viability) and cells treated with a final concentration of 100 µM quaternary ammonium salt (0% viability) were used as high and low signal controls, respectively, for cytotoxic effects in the assay. A constant concentration of DMSO was maintained for all wells as determined by the dilution factor for stock test compound concentrations. After culturing the plates for 72 hours at 37°C/5% CO2 and 90% humidity, 30 μL of Cell Titer-Glo (Promega) was added to each well. Fluorescence was read using a BMG PHERAstar plate reader, followed by incubation at room temperature for 10 minutes to measure cell viability.

Results - Part C Summary information for reference compounds and test articles is provided in Tables 7-9 and 10-13.

Table 14 shows the combined data from all four analyses. Table 7. Antiviral activity of reference compounds in SARS-CoV-1 CPE assay Compound ID batch supplier Supplier ID Antiviral IC ₅₀ (μM ) Cytotoxicity CC ₅₀ (μM ) Selectivity Index CC ₅₀ /IC ₅₀ CalpainInh-IV 01 Sigma Calpain Inh-IV 0.98 >7.17 >7.3 Chloroquine 01 Inhouse Stock Chloroquine 2.02 >30.00 >14.9 remdesivir 01 Selleck remdesivir 7.42 >30.00 >4.0 Table 8. Antiviral activity of reference compounds in SARS-CoV-2 CPE assay Compound ID batch supplier Supplier ID Antiviral IC ₅₀ (μM ) Cytotoxicity CC ₅₀ (μM ) Selectivity Index CC ₅₀ /IC ₅₀ CalpainInh-IV 01 Sigma Calpain Inh-IV 0.47 >7.17 >15.3 Chloroquine 01 Inhouse stock Chloroquine 3.71 >30.00 >8.1 remdesivir 01 Selleck remdesivir 4.15 >30.00 >7.2 Table 9. Antiviral Activity of Reference Compounds in MERS CPE Assay ( Standard Incubation ) Compound ID batch supplier Supplier ID Antiviral IC ₅₀ (μM ) Cytotoxicity CC ₅₀ (μM ) Selectivity Index CC ₅₀ /IC ₅₀ CalpainInh-IV 01 Sigma Calpain Inh-IV 1.07 >7.17 >6.7 Chloroquine 01 Inhouse stock Chloroquine 20.96 >30.00 >1.4 remdesivir 01 Selleck remdesivir 12.53 >30.00 >2.4 Table 10. Antiviral activity of compounds tested in SARS-CoV-1 CPE assay Compound ID* batch Antiviral IC ₅₀ (μM ) Cytotoxicity CC ₅₀ (μM ) Selectivity Index CC ₅₀ /IC ₅₀ A 01 19.52 >50.00 >2.6 B 01 6.89 >50.00 >7.3 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate Table 11. Antiviral Activity of Test Compounds in SARS-CoV-2 CPE Assay Compound ID* batch Antiviral IC ₅₀ (μM ) Cytotoxicity CC ₅₀ (μM ) Selectivity Index CC ₅₀ /IC ₅₀ A 01 4.27 >50.00 >11.7 B 01 2.67 >50.00 >18.7 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate Table 12. Antiviral Activity of Test Compounds in MERS CPE Assay ( Standard Incubation ) Compound ID* batch Antiviral IC ₅₀ (μM ) Cytotoxicity CC ₅₀ (μM ) Selectivity Index CC ₅₀ /IC ₅₀ A 01 7.35 >50.00 >6.8 B 01 4.37 >50.00 >11.4 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate Table 13. Comparison of Antiviral Activity of Sponsor Compounds in MERS CPE Assay ( Standard vs. Pre-Incubation Method **) Compound ID* batch Pre-incubation _IC50 ( μM ) Standard incubation _IC50 ( μM ) A 01 8.29 7,35 B 01 4.30 4.37 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate ** Modification of pre-incubation method: 25 µL of uninfected cells in medium were added to pre-dose The assay preparation plates were incubated for four hours, followed by the addition of 5 µL of MERS virus diluted in the medium. Table 14. Summary of Antiviral Activity of Tested Compounds in SARS-CoV-1 , SARS-CoV-2 , MERS Compound ID* SARS-CoV-1 SARS-CoV-2 MERS Antiviral IC ₅₀ ( μM ) Cytotoxicity CC ₅₀ ( μM ) Selectivity Index CC ₅₀ /IC ₅₀ Antiviral IC ₅₀ ( μM ) Cytotoxicity CC ₅₀ ( μM ) Selectivity Index CC ₅₀ /IC ₅₀ Antiviral IC ₅₀ ( μM ) Cytotoxicity CC ₅₀ ( μM ) Selectivity Index CC ₅₀ /IC ₅₀ A 19.52 >50.00 >2.6 4.27 >50.00 >11.7 7.35 >50.00 >6.8 B 6.89 >50.00 >7.3 2.67 >50.00 >18.7 4.37 >50.00 >11.4 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate

Antiviral Evaluation - Part D : In Vitro Inhibition of SARS-CoV2 in ALI Model As described below, Applicants separately evaluated compound N-[(1S) by CPE assay in an air-liquid interface (ALI) assay using human lung cells -1-{[(1S)-3-methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]-1- [(Propan-2-yl)aminocarbamoyl]propan-2-yl]aminocarbamoyl}butyl]aminocarbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl ]ethyl]benzyl carbamate free base; and N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamoyl)-1-oxygen yl-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4 The inhibitory effect of benzyl ,4-difluoropiperidin-1-yl)ethyl]carbamate free base against SARS-CoV-1, SARS-CoV-2 and MERS: basically as Randell, S. H and Fulcher, ML (ed.) Epithelial Cell Culture Protocols: Second Edition Chapter 8 , Methods in Molecular Biology, Vol. 945, DOI 10.1007/978-1-62703-125-7_8 © Springer Science+ Primary human lung cell lines were used to evaluate test compounds in an air-liquid interface assay as described in Business Media, LLC 2012. Briefly, HBE cell lines were isolated from the tracheal region and superior bronchus. Branches about 2 mm are separated if possible. All cells were aggregated in this isolation. The resulting cells are grown on porous supports at the air-liquid interface where mucociliary differentiation takes place, which reproduce in vitro morphology and key physiological processes in the cells. The ALI assay is used as an additional means of assessing the antiviral activity of the test compounds described herein against SARS-CoV-2, essentially using methods such as Sims, AC et al. In J. Virol (Dec 2005), p. 79 (24), pp. 15511-15524 (“Severe Acute Respiratory Syndrome Coronavirus Infection of Human Ciliated Airway Epithelia: Role of Ciliated Cells in Viral Spread in the Conducting Airways of the Lungs”), 0022-538X/05/$08.00+0 Protocol for assessing SARS-CoV infection as described in doi:10.1128/JVI.79.24.15511-15524.2005. Primary lung cells (Marsico Lung Institute) were cultured essentially as described by Randell and Fulcher and infected with SARS-CoV-2 using an MOI of 0.5 essentially as described by Sims et al. Test compounds dissolved in dimethyl sulfoxide (DMSO) were administered at doses of 0.04, 0.12, 0.37, 1.1, 3.3, 10, and 30 μM for 48 hours, and compared to using 10 μM remdesivir, the virus was at Antiviral activity was assessed by platelet assay in DMSO solvent and a single DMSO solvent control.

Results - Part D The results are shown in Figure 1 . As can be seen, Compound A (GSKE in Figure 1) showed antiviral activity at concentrations of 3.3, 10 and 30 μM compared to 10 μM remdesivir (RDV in Figure 1), and also at 1.1 μM GSKE Measurable antiviral activity was found. Each symbol in Figure 1 represents the titer from one culture, and the middle dashed line represents the level of detection (LOD = 50 PFU).

Antiviral Evaluation - Part E : In Vitro Inhibition of SARS-CoV2 in Calu3 Cells (Operetta High Throughput Imaging System ) As described below, Applicants separately evaluated test compound N by CPE analysis in cell assays using Calu3 immortal human lung cells -[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidine-3- yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidine Benzyl pyridin-1-yl]ethyl]carbamate free base; and/or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Inhibitory effect of benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate free base against SARS-CoV-1, SARS-CoV-2 and MERS:

Protocol for SARS-CoV-2 Coronavirus Cellular Assay The coronavirus N protein and nucleus were presented as endpoints for imaging (indices of efficacy and toxicity, respectively), and the compounds to be tested were tested by cellular assays. Calu3 cells (ATCC, HTB-55) were infected with SARS-CoV-2 coronavirus (βCoV/KOR/KCDC03/2020). Compounds with antiviral activity are shown below to reduce the expression of the N protein as measured immunologically.

In preparation for the assay, ten-point, triple dose-response curves (DRCs) were generated for test compounds in DMSO with compound concentrations ranging from 0.0025 to 50 Mm.

Calu-3 cells were seeded in black, 384-well, clear dishes (Greiner Bio-One) in Eagle's Minimum Essential Medium (EMEM) at 2.0 x 104 cells/well ²⁴ hours before the experiment , ATCC), the medium was supplemented with 20% heat-inactivated fetal bovine serum (FBS), 1% MEM-non-basal amino acid solution (Gibco), and 1× antibiotic-antifungal solution (Gibco). Cells were kept at 37°C with 5% CO ₂ .

Cells were treated with test compounds at concentrations ranging from 0.0025 to 50 μM for 1 to 48 hours, followed by infection with SARS-CoV-2 at an MOI of 0.03. The DMSO in the wells was normalized to a final concentration of 0.5%. The plates were incubated at 37°C for 24 hours and then fixed with a 4% paraformaldehyde (PFA), 0.25% tritonX-100 solution.

Anti-SARS-CoV-2 nucleocapsid (N) primary antibody, 488-conjugated goat anti-rabbit IgG secondary antibody and Hoechst 33342 were added, followed by immunofluorescence assay. Images were acquired using an Operetta high throughput imaging device (Perkin Elmer) and analyzed using Columbus software (Perkin Elmer) to quantify cell number and infection ratio. In each assay plate, antiviral activity was normalized against an infection control (0.5% DMSO). Cell viability was measured by counting the number of nuclei in each well and normalizing to infection controls. _IC50 values were calculated using nonlinear regression analysis - log[inhibitor] versus response - variable slope (four parameters). All _IC50 values were measured in triplicate.

Results - Part E Table 15 Compound ID* Example 1-A IC ₅₀ ( μM ) Example 1-B IC ₅₀ ( μM ) A 20.59 15.74 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester

Antiviral Evaluation - Part F : In Vitro Inhibition of SARS-CoV2 in Calu3 and HeLa-ACE2 Cell Lines - IF As described below, Applicants used an ACE2-overexpressing HeLa-ACE2 immortal human cervical cell line (angiotensin converting enzyme 2 ) Separate assessment of the test compound N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[ by CPE analysis in cell analysis (3S)-2-Oxypyrrolidin-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]aminocarbamoyl}butyl]aminocarbamoyl }-2-[4-(Trifluoromethyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester free base; and N-[(1S)-1-{[(1S)-1-{[ (2S)-1-(butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy }-3-Methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester free base against SARS-CoV-1, SARS-CoV -2 and the inhibitory effect of MERS.

SARS-CoV-2/HeLa-ACE2 High Throughput Screening Assay Compounds were acoustically transferred into a 384-well clarification tray (Greiner, Catalog No. 781090-2B) and HeLa was plated at a density of 1.0 x ¹⁰ cells/well -ACE2 cells were seeded in 2% FBS in a dish. Plated cells were transferred to a BSL3 facility where SARS-CoV-2 (USA-WA1/2020 strain propagated in Vero E6 cells) diluted in assay medium was added to obtain ~30-50% infected cells. The plates were incubated for 24 hours at 34°C 5% CO ₂ and then fixed using 8% formaldehyde. Human polyclonal serum was used as the primary antibody, goat anti-human H+L-conjugated Alexa 488 (Thermo Fisher Scientific A11013) was used as the secondary antibody, and immutable-46-diamidino-2-phenylindole (DAPI; Thermo Fisher) Scientific D1306) staining of DNA to stain fixed cells, PBS 0.05% Tween 20 washes between fixation and subsequent primary and secondary antibody staining.

The disks were imaged with 4 imaging fields per well using an ImageXpress Microconfocal High Throughput Imaging System (Molecular Devices) with a lOx objective. Images were analyzed using the Multi-Wavelength Cell Scoring Application Module (MetaXpress), where DAPI staining identified host cell nuclei (total number of cells in the image) and SARS-CoV-2 immunofluorescence signal resulted in the identification of infected cells.

Uninfected Host Cytotoxicity Counting Screen Compounds were acoustically transferred into 1,536-well clearing dishes (Greiner, Prod. No. 789091). HeLa-ACE2 cells were maintained for infection assays as described and seeded at 400 cells/well in DMEM with 2% FBS in assay-ready dishes. The plates were incubated for 24 hours at 37°C 5% _CO2 . To analyze cell viability, Image-iT DEAD Green Reagent (Thermo Fisher) was used according to the supplier's instructions. Cells were fixed with 4% paraformaldehyde and counterstained with DAPI. Fixed cells were imaged using an ImageXpress microconfocal high-throughput imaging system (Molecular Devices) with a 10× objective, and total viable cells per well in the obtained images were quantified using the Life and Death Application Module (MetaXpress).

Data Analysis The main in vitro screening and host cytotoxicity counting screening data were uploaded to the Genedata screener version 16.0. Data were normalized against neutral (DMSO) negative inhibitor controls (2.5 µM remdesivir for antiviral efficacy and 10 µM puromycin for infected host cytotoxicity). For the uninfected host cytotoxicity count screen, 40 µM puromycin (Sigma) was used as a positive control. For dose response experiments, compounds were tested in technical triplicates on different assay plates and dose curves were fitted using the four parameter Hill Equation.

SARS-CoV-2/Calu-3 High Throughput Screening Assay Compounds were acoustically transferred into a 384-well clarification tray (Greiner, Catalog No. 781090-2B), followed by Calu at a density of 5,000 cells per 20 μL per well -3 Cells were seeded in assay medium (MEM with 2% FBS). Plated cells were transferred to a BSL3 facility where SARS-CoV-2 (strain USA-WA1/2020 propagated in Vero E6 cells) diluted in assay medium was added at an MOI between 0.75 and 1 to obtain ~30 − 60% infected cells. The plates were incubated for 48 hours at 34°C 5% CO ₂ and then fixed with 4% final concentration of formaldehyde. Human polyclonal serum was used as the primary antibody, goat anti-human H+L-conjugated Alexa 488 (Thermo Fisher Scientific A11013) was used as the secondary antibody, and immutable-46-diamidino-2-phenylindole (DAPI; Thermo Fisher) Scientific D1306) staining of DNA to stain fixed cells, PBS 0.05% Tween 20 washes between fixation and subsequent primary and secondary antibody staining.

The disks were imaged with 4 imaging fields per well using an ImageXpress Microconfocal High Throughput Imaging System (Molecular Devices) with a lOx objective. Images were analyzed using the Multi-Wavelength Cell Scoring Application Module (MetaXpress), where DAPI staining identified host cell nuclei (total number of cells in the image) and SARS-CoV-2 immunofluorescence signal resulted in the identification of infected cells.

Uninfected host cytotoxicity counters were acoustically transferred to compounds into 1,536-well plates (Corning #9006BC) and Calu-3 cells were then seeded in assay medium (with 2 % FBS in MEM). The plates were incubated for 48 hours at 37°C 5% _CO2 . To analyze cell viability, 2 μL of 50% Cell-Titer Glo (Promega No G7573) in water was added to cells and fluorescence was measured on an EnVision plate reader (Perkin Elmer).

Data Analysis Data from the SARS-CoV-2 antiviral assay and host cytotoxicity count screen were uploaded to the Genedata screener version 16.0. For SARS-CoV-2 antiviral readouts, % CoV-2 positive cells were normalized against a neutral (DMSO) negative inhibitor control (10 µM remdesivir). For cell number readings, total cells were normalized to the activator (10 µM remdesivir) negative neutral control (DMSO). The uninfected host cytotoxicity count screen was normalized to a neutral (DMSO) negative inhibitor control (30 µM remdesivir). For dose-response experiments, compounds were tested in technical triplicates on different assay plates and dose curves were fitted using the four-parameter Hill equation. The curve is fitted as rising or falling, and is noted in the data output as such. In particular, cell count readings from SARS-CoV-2 infection assays that capture antiviral efficacy, protection against virus-induced cell death (increase), and cytotoxicity (decrease) should be noted.

HeLa-ACE2 cells were infected with SARS-CoV-2 virus at MOI between 0.3-0.5 in the presence of test compounds and viral infection was quantified after 24 hours. Immunofluorescent (IF) detection of SARS-CoV-2 protein using purified sera from virus-exposed patients was used as an efficacy endpoint for the antiviral activity of test compounds, which together with staining of host nuclei allowed quantification of each well Percentage of infected cells and calculation of _IC50 values.

Results - Part F Table 16 - HeLa-ACE2 Cells Compound ID* Reaction _IC50 (μM ) A 0.15 B 0.15 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate Table 17 - Calu-3 Cells Compound ID* Reaction _IC50 (μM ) A >10 B 5.6 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester

Antiviral Assessment - Part G : In vitro Inhibition of HCoV OC43 by OC43 in MRC-5/Huh7 Cell Lines and 229e in MRC5 Cells OC43 Assays MRC-5 or Huh7 cells should be seeded at the appropriate density in 96-well plates and plated at 37 Incubate overnight at °C and 5% CO ₂ . The medium in each well should be supplemented with medium containing serial dilutions of compound (8 doses in duplicate wells) and virus. The resulting cultures should be stored at 33°C and 5% _CO2 for an additional 4 days (MRC5) or 7 days (Huh7). The endpoint measured should be the cytopathic effect of the virus.

The cytotoxicity of compounds should be analyzed in parallel under the same conditions in the absence of viral infection. Cell viability should be measured using CellTiter Glo (Promega) following the supplier's manual. For qPCR analysis, the supernatant should be collected. Viral RNA should be extracted and quantified by absolute RT-qPCR analysis. _EC50 and _CC50 values should be calculated using GraphPad Prism software. Sample analysis should be performed with the remdesivir reference compound.

HCoV 229E Assay MRC-5 should be seeded at an appropriate density in 96-well dishes and incubated overnight at 37°C and 5% CO2. The medium in each well should be supplemented with medium containing serial dilutions of compound (8 doses in duplicate wells) and virus. The resulting culture should be stored at 35°C and 5% _CO for an additional 3 days.

The cytotoxicity of compounds should be analyzed in parallel under the same conditions in the absence of viral infection. Cell viability should be measured using CellTiter Glo (Promega) following the supplier's manual. For qPCR analysis, the supernatant should be collected. Viral RNA should be extracted and quantified by absolute RT-qPCR analysis. _EC50 and _CC50 values should be calculated using GraphPad Prism software. Sample analysis should be performed with the remdesivir reference compound.

Results - Part G Table 18 - Coronavirus OC43 and 229e (Measurement of Cytopathic Effect) Compound ID* OC43 EC ₅₀ , μM ( CPE) CC ₅₀ , μM OC43 EC ₅₀ , μM ( CPE) CC50 , μM 229e EC ₅₀ , μM (CPE) CC ₅₀ , μM MRC5 MRC5 Huh7 Huh7 MRC5 MRC5 A 0.313, 0.211 49.17, >10 0.236 >50 0.453 >50 B 0.196 28.81 0.103 33.95 0.238 28.85 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate Table 19 - Coronavirus OC43 (Viral RNA Measurement) Compound ID* OC43 EC ₅₀ , μM (RNA) CC ₅₀ , μM MRC5 MRC5 A 0.131 31.61 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester

Antiviral Evaluation – Part H : In Vitro Inhibition of SARS-CoV2 in Vero Cells Cells were cultured in filtered DMEM supplemented with 10% FBS (Gibco, origin Brazil) and penicillin/streptomycin (Sigma) 1% (assay medium) (Gibco) (0.22 µm) VeroE6 cells were cultured biweekly in a 1:4-1:5 period and detached using PBS (Gibco) and trypsin (Gibco). Virus SARS Cov 2 (NY isolate) from BEI was frozen in OPTIPRO-0.5% gelatin stock solution. The MDRl inhibitor Elacridar was synthesized in-house and stock solutions were prepared in DMSO at a final concentration of 10 mM.

For 96 -well plates For T175 ^cm2 flasks, Vero E6 cells were detached with 4 mL of trypsin over 5 minutes, neutralized with 16 mL of assay medium, centrifuged and resuspended in 10 mL/flask of assay medium.

50 µL of cells were added to 10 mL of CASYTON in CASYCUP and cell counts were performed in the CASY system, measuring cell number between 8 and 25 µm.

Cell solutions were prepared with a final cell concentration of 2e5 cells/ml. The virus was removed from the freezer following the existing working protocol for the BSL3 facility and thawed at RT.

Add 1 µL of virus stock per 10 mL of assay medium to prepare -4 virus dilutions.

Control 2 was prepared by adding the same volume of assay medium and cells to a final concentration of 1e5 cells/ml, and Eclata (MDR1 inhibitor) to a final concentration of 1 µM.

Test compounds were serially diluted in a 10-point curve. The assay plates contained serial dilutions of test compounds in columns 1 to 10 to be tested at final concentrations between 50 uM and 0.0025 uM.

Add cells and virus in a 1:1 ratio (veroE6 final concentration 1e5 cells/mL; add 0.5 µL virus from stock to 10 mL final solution) and Eclata (MDR1 inhibitor) to a final concentration of 1 µM Control 1 was prepared.

200 µL of Control 2 solution was dispensed into column 12 (slow speed) of a pre- dispensed 96-well plate (Costar 3399) using the Multidrop combi.

200 µL of Control 1 solution was dispensed into columns 1 to 11 (slow speed) of a pre- dispensed 96-well plate (Costar 3399) using the Multidrop combi.

The plates were incubated for 3 days at 37°C with 5% _CO2 following the requirements of the BSL3 laboratory.

After this incubation time, use the multidrop combi for 2 consecutive additions: - 25 µL FA 36% and - 10 µL solution of PBS (Gibco) and Draq5 50 µM (biostatus)

Disks were sealed and cleaned for retention in the BSL3 facility following an approved protocol.

Disks were imaged in Opera Phenix and stored and analyzed in Columbus.

For 384 dishes For T175 ^cm2 flasks, Vero E6 cells were detached with 4 mL of trypsin over 5 minutes, neutralized with 16 mL of assay medium, centrifuged and resuspended in 10 mL/flask of assay medium.

50 µL of cells were added to 10 mL of CASYTON in CASYCUP and cell counts were performed in the CASY system, measuring cell number between 8 and 25 µm.

Cell solutions were prepared with a final cell concentration of 2e5 cells/ml. The virus was removed from the freezer following the existing working protocol for the BSL3 facility and thawed at RT.

Add 1 µL of virus stock per 1 mL of assay medium to prepare -3 virus dilutions.

Control 2 was prepared by adding the same volume of assay medium and cells to a final concentration of 1e5 cells/ml, and Eclata (MDR1 inhibitor) to a final concentration of 1 µM.

Test compounds were serially diluted in a 10-point curve. The assay plates contained serial dilutions of test compounds to be tested at final concentrations between 50 uM and 0.0025 uM.

Add cells and virus in a 1:1 ratio (veroE6 final concentration 1e5 cells/mL; add 0.5 µL of virus from stock to 1 mL final solution) and Eclata (MDR1 inhibitor) to a final concentration of 1 µM Control 1 was prepared.

Use the Multidrop combi to dispense 50 µL of the Control 2 solution into column 18 (slow speed) of a pre-assigned 384-well plate (Greiner 781091).

Use the Multidrop combi to dispense 50 µL of Control 1 solution into columns 1 to 7 and 19 to 24 (slow speed) of a pre-dispensed 384-well plate (Greiner 781091).

The plates were incubated for 3 days at 37°C with 5% _CO2 following the requirements of the BSL3 laboratory.

After this incubation time, 50 µL of PBS containing formaldehyde 8% and Draq5 2 µM (biostatus) was added to each well.

Disks were sealed and cleaned for retention in the BSL3 facility following an approved protocol.

Disks were imaged in Opera Phenix and analyzed in Columbus.

Results - Part H Table 20 - SARS-CoV2 + MDR1 Inhibitors Compound ID* _IC50 (nM) A 162 B 97 * A = N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrole Perid-3-yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoro Methyl)piperidin-1-yl]ethyl]carbamic acid benzyl ester B = N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarbamate yl)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]aminocarboxy}-3-methylbutyl]carbamoyl Benzyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester

The activity exhibited in cells is indicative of cellular penetration of the compound.

Applicants also aligned the encoding nucleotide sequence with the amino acid sequence of the 3-CL protease from 44 severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) strains. These virus strains were collected from various geographic locations, including China, Hong Kong, Australia, Japan (some cruise ship individuals), and the United States (15 strains). This shows that the 3CL protease is 100% identical at the nucleotide and amino acid levels in all virus strains. Sequence Listing SEQ ID NO: 1: N1 forward primer 5' GACCCCAAAATCAGCGAAAT 3' SEQ ID NO: 2: N1 reverse primer 5' TCTGGTTACTGCCAGTTGAATCTG 3' SEQ ID NO: 3: N1 probe sequence 5' FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ- 1 3' SEQ ID NO: 4: N2 forward primer 5' TTACAAACATTGGCCGCAAA 3' SEQ ID NO: 5: N2 reverse primer 5' GCGCGACATTCCGAAGAA 3' SEQ ID NO: 6 N2 probe sequence 5' FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ- 1 3' SEQ ID NO: 7: FRET substrate peptide FAM-VARLQSGFG-TAMRA for the analysis of coronavirus OC43 3CL and 229E protease SEQ ID NO: 8: FRET substrate peptide FAM- for the analysis of SARS coronavirus 3CL protease KTSAVLQSGFRKME-TAMRA SEQ ID NO: 9 FRET substrate peptide HiLyte488-ESATLQSGLRKAK-QXL520 for protease analysis of SARS-coronavirus s-2 3CL, 229E method 2 and SARS coronavirus 3CL method 2

Figure 1 shows that compared to controls including redemsivir (RDM), solvent (DMSO), and solvent+virus, those infected with SARS-CoV-2 and treated with compound A (compound A is GSKE in Figure 1) ) air-liquid interface (ALI) cultures of nascent human lung cells treated with compound concentrations of 0.04, 0.12, 0.37, 1.1, 3.3, 10 and 30 μM for 48 hours.

Claims (32)

A use of a compound or a pharmaceutically acceptable salt selected from the group consisting of: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof. The use of claim 1, wherein the medicinal product is for the prevention of COVID-19 in individuals at risk of SARS-CoV-2 infection. Use as in claim 2, wherein the system: a close contact of a patient infected with SARS-CoV-2; in a high-risk category; or a health care professional. The use of claim 1, wherein the drug is for the treatment of COVID-19 in individuals infected with SARS-CoV-2. The use of claim 4, wherein the system has previously been vaccinated against SARS-CoV-2 in SARS-CoV-2-positive SARS-CoV-2 infected individuals. The use of claim 4, wherein the system is identified as being infected with SARS-CoV-2 by detecting viral RNA of SARS-CoV-2 in a sample obtained from the individual, wherein the system is human . The use of claim 4, wherein the system is identified to detect the SARS-CoV-2 antigen from a sample of the individual using a rapid diagnostic test (RDT). The use of any one of claims 1 to 4, wherein COVID-19 in the individual infected with SARS-CoV-2 is associated with pneumonia. The use of any one of claims 1 to 4, wherein COVID-19 in the individual infected with SARS-CoV-2 is associated with acute respiratory distress. The use of any one of claims 4 to 9, wherein the individual infected with SARS-CoV-2 is undergoing extracorporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, or receiving oxygen therapy. The use of any one of claims 4 to 10, wherein the individual infected with SARS-CoV-2 is receiving antiviral and/or steroid therapy, wherein the antiviral or steroid therapy is treatment with an agent other than: N -[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidine-3- yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidine Benzyl pyridin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-( Butylaminocarboxy)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl Benzyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamic acid benzyl ester or a pharmaceutically acceptable salt thereof. The use of claim 11, wherein the individual infected with SARS-CoV-2 is receiving an antiviral agent. The use of claim 12, wherein the antiviral agent is selected from the group consisting of remdesivir, ganciclovir, lopinavir, olsetemivir, ritonavir Wei (ritonavir) and zanamivir (zanamivir). The use of any one of claims 1 to 13, wherein the medicament is for inhalation, subcutaneous, intravenous or oral administration. the use of a compound or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the treatment or prevention of COVID-19 in asymptomatic individuals against COVID-19, wherein the compound or a pharmaceutically acceptable salt thereof is selected from: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof. Use of a compound or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for preventing the transmission of SARS-CoV-2 to asymptomatic individuals with COVID-19, wherein the compound or a pharmaceutically acceptable salt thereof is selected from: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof. the use of a compound or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the treatment or prevention of COVID-19 in individuals infected with SARS-CoV-2 or at risk of infection with SARS-CoV-2, wherein the compound or a pharmaceutically acceptable salt thereof is selected from: N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidine-3 -yl]-1-[(propan-2-yl)aminocarbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl) Benzyl piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1-side oxy-3-[(3S)-2-side Oxypyrrolidin-3-yl]propan-2-yl]aminocarbinyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl) Benzyl ethyl]carbamate or a pharmaceutically acceptable salt thereof. The use of claim 17, wherein the individual is at risk of SARS-CoV-2 infection, and the pharmaceutical product is for the prevention of COVID-19 in the individual at risk of SARS-CoV-2 infection. Use as in claim 18, wherein the system is: a close contact of a patient infected with SARS-CoV-2; in a high-risk category; or a health care professional. The use of claim 17, wherein the individual is infected with SARS-CoV-2, and the medicament is for the treatment of COVID-19 in the individual infected with SARS-CoV-2. The use of claim 17, wherein the system has previously been vaccinated against SARS-CoV-2 in SARS-CoV-2 infected individuals who tested positive for SARS-CoV-2. The use of claim 20, wherein the individual is identified as infected with SARS-CoV-2 by detecting viral RNA of SARS-CoV-2 in a sample obtained from the individual. The use of claim 20, wherein the system is identified using a rapid diagnostic test (RDT) to detect SARS-CoV-2 antigens in a sample from the individual. The use of claim 22, wherein the system is human. The use of any one of claims 17 to 24, wherein COVID-19 in the individual infected with SARS-CoV-2 is associated with pneumonia. The use of any one of claims 17 to 24, wherein COVID-19 in the individual infected with SARS-CoV-2 is associated with acute respiratory distress. The use of any one of claims 17 to 24, wherein the individual infected with SARS-CoV-2 is undergoing extracorporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, or receiving oxygen therapy. The use of any one of claims 17 to 24, wherein the individual infected with SARS-CoV-2 is receiving antiviral and/or steroid therapy. The use of claim 25 or claim 26, wherein the individual infected with SARS-CoV-2 is receiving an antiviral agent, wherein the antiviral agent is an agent other than N-[(1S)-1-{[ (1S)-3-Methyl-1-{[(2S)-1-oxy-3-[(3S)-2-oxypyrrolidin-3-yl]-1-[(propane-2 -yl)aminocarbamoyl]propan-2-yl]aminocarbamoyl}butyl]aminocarbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]amine Benzyl formate or a pharmaceutically acceptable salt thereof; or N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylaminocarboxy)-1- Pendant oxy-3-[(3S)-2-Pendant oxypyrrolidin-3-yl]propan-2-yl]aminocarbamoyl}-3-methylbutyl]carbamoyl}-2- Benzyl (4,4-difluoropiperidin-1-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof. The use of claim 29, wherein the antiviral agent is selected from the group consisting of remdesivir, ganciclovir, lopinavir, oseltamivir, ritonavir and zanamivir. The use of any one of claims 17 to 30, wherein the medicament is for administration via inhalation. The use of any one of claims 17 to 30, wherein the medicament is for parenteral administration.

Images