WO2021191827A1 - Tripeptides derivatives for treating sars-cov-2 infections - Google Patents

Tripeptides derivatives for treating sars-cov-2 infections Download PDF

Info

Publication number
WO2021191827A1
WO2021191827A1 PCT/IB2021/052460 IB2021052460W WO2021191827A1 WO 2021191827 A1 WO2021191827 A1 WO 2021191827A1 IB 2021052460 W IB2021052460 W IB 2021052460W WO 2021191827 A1 WO2021191827 A1 WO 2021191827A1
Authority
WO
WIPO (PCT)
Prior art keywords
sars
cov
carbamoyl
subject
pharmaceutically acceptable
Prior art date
Application number
PCT/IB2021/052460
Other languages
French (fr)
Inventor
Janos Botyanszki
Qi Jin
Neil David Pearson
Reema K. Thalji
Original Assignee
Glaxosmithkline Intellectual Property Development Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Glaxosmithkline Intellectual Property Development Limited filed Critical Glaxosmithkline Intellectual Property Development Limited
Publication of WO2021191827A1 publication Critical patent/WO2021191827A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/06—Tripeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/007—Pulmonary tract; Aromatherapy
    • A61K9/0073—Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy
    • A61K9/0075—Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy for inhalation via a dry powder inhaler [DPI], e.g. comprising micronized drug mixed with lactose carrier particles

Definitions

  • the present disclosure relates to a 3C-Like (3CL) protease inhibitor for use in the treatment or prevention of COVID-19.
  • COVID-19 was declared a Public Health Emergency of International Concern on 30 January 2020, following its emergence in China in December 2019. At the time of writing, over 21,689,800 cases and 770,273 deaths have been reported globally.
  • the infectious agent has been identified as a coronavirus (initially designated 2019-nCoV2 and more recently designated SARS-CoV-2 (also referred to as SARS-CoV2 and SARS-CoV-2), Severe Acute Respiratory Syndrome CoronaVirus-2) capable of spreading by human to human transmission.
  • SARS severe acute respiratory syndrome
  • SARS-CoV SARS-CoV1 or SARS-CoV- 1
  • MERS Middle East respiratory syndrome
  • Coronaviruses consist of an enveloped single strand positive sense RNA genome of 26 to 32 kb in length. They are classified by phylogenetic similarity into four categories: ⁇ (e.g. 229E and NL-63), ⁇ (e.g. SARS-CoV-2 , SARS-CoV, MERS-CoV, HKU1, and OC43), ⁇ and ⁇ . SARS-CoV-2 has also been reported to have 79% sequence identity to SARS-CoV-1, however certain regions of the SARS-CoV-2 genome exhibit greater or lesser degrees of conservation to SARS-CoV-1.
  • ⁇ e.g. 229E and NL-63
  • ⁇ e.g. SARS-CoV-2 , SARS-CoV, MERS-CoV, HKU1, and OC43
  • SARS-CoV-2 has also been reported to have 79% sequence identity to SARS-CoV-1, however certain regions of the SARS-CoV-2 genome exhibit greater or lesser degrees of conservation to SARS-CoV
  • Coronaviruses utilise membrane bound spike proteins to bind to a host cell surface receptor to gain cellular entry. Following entry into the host cell, the RNA genome is translated into two large polypeptides by the host ribosomal machinery and several smaller polypeptides. The two large polypeptides are processed by two proteases, the coronavirus main proteinase (3C-Like) and the papain- like proteinase to generate the proteins required for viral replication and packaging.
  • the coronavirus main proteinase 3C-Like
  • the papain- like proteinase to generate the proteins required for viral replication and packaging.
  • Clade G comprises two derivative clades, GH (characterized by the ORF3a:Q57FI mutation) and GR (having a N:RG203KR mutation).
  • clades G and GR are prevelant in Europe, and clades S and GH have been mostly observed in the Americas.
  • the L clade is mostly represented by sequences from Asia.
  • clades G and its derivatie offspring clades GH and GR are the most common among the sequences SAR-CoV-2 genomes, accounting for 74% of all world sequences, globally.
  • the GR clade having both the Spike D614G and Nucleocapsid RG203KR mutations, is the most common representative of the SARS-CoV-2 genome population worldwide.
  • the invention provides a compound which is benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ -2-(4,4-di
  • the invention also provides use of benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ - 2-(4,4-difluoropiperidin-1-
  • the subject is infected with SARS-CoV-2 .
  • Methods for identifying subjects infected with SARS-CoV-2 are known in the art and are in current clinical use, including in vitro detection of viral proteins (antigens) using an antibody to SARS-CoV-2, and use of real-time reverse- transcription polymerase-chain reaction for detection of SARS-CoV-2 genetic material.
  • high-throughput sequencing or real-time reverse-transcriptase polymerase-chain-reaction (RT-PCR) assay of specimens, for example, nasal and pharyngeal swab specimens may be used to identify subjects with active SARS-CoV-2 infection.
  • SARS-CoV-2 antigens such as SARS-CoV-2 surface protesin
  • SARS-CoV-2 surface protesin are detected by collecting a sample of mucus from the back of a subject's throat or nose using a swab, or taking a small drop of blood from a patient, and using a rapid diagnostic test (RDT) based on lateral flow immunoassay (LFIA) to identify subjects with active SARS-CoV-2 infection.
  • RDT rapid diagnostic test
  • LFIA lateral flow immunoassay
  • the invention also provides a method of treatment of a subject with COVID-19 with a therapeutically effective amount of a compound selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl ⁇ -3-methyl
  • the invention provides a method for identifying subjects to be treated in accordance with the methods described herein, the method comprising a step of assaying a specimen from a subject for the presence of SARS-CoV-2 RNA.
  • the method is capable of identifying L strain SARS-CoV-2 RNA, S strain SARS-CoV-2 RNA, G strain SARS-CoV-2 RNA, GH strain SARS-CoV-2 RNA, GR strain SARS-CoV-2 RNA, V strain SARS-CoV-2 RNA, or 0 strain SARS-CoV-2 RNA.
  • the method may further comprises a treatment step as described herein.
  • the invention provides treatment for particular populations of patients with COVID-19, for example a patient or subject infected with SARS-CoV-2 i.e. a patient or subject who test positive to SARS-Co-2, a patient or subject in a high risk category and a patient or subject with a secondary condition.
  • the patient or subject has pneumonia or acute respiratory distress disorder.
  • the patient or subject is additionally undergoing extra-corporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, receiving oxygen therapy or receiving antiviral or steroid treatment.
  • the uses and methods described herein are for treatment of a patient infected with a strain (clade) of SARS-CoV-2 selected from the L strain (clade), the S strain (clade), the G strain (clade), the GH strain (clade), the GR strain (clade), the V strain (clade) or the O strain (clade) of SARS-CoV-2.
  • a strain (clade) of SARS-CoV-2 selected from the L strain (clade), the S strain (clade), the G strain (clade), the GH strain (clade), the GR strain (clade), the V strain (clade) or the O strain (clade) of SARS-CoV-2.
  • the uses and methods described herein are for treatment of a patient infected with the L strain (clade) of SARS-CoV-2 or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the S strain (clade) of SARS- CoV-2, or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the G strain (clade) of SARS-CoV-2, or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the GH strain (clade) of SARS-CoV-2, or a variant thereof.
  • the uses and methods described herein are for treatment of a patient infected with the GR strain (clade) of SARS-CoV-2, or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the V strain (clade) of SARS-CoV-2, or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the O strain (clade) of SARS-CoV-2, or a variant thereof.
  • the uses and methods described herein are for treatment of a subject infected with a variant of SARS-CoV-2, including the UK variant (201/501Y.V1/B.1.1.7), the South Africa variant (20H/501Y.V2/B.1.351), the Brazil variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, ORF1b:D1183Y, S:S13I; W152C; L452R) and designated CAL.20C (20C/S;452R;B.1.429).
  • a variant of SARS-CoV-2 including the UK variant (201/501Y.V1/B.1.1.7), the South Africa variant (20H/501Y.V2/B.1.351), the Brazil variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, OR
  • the subject is not infected with SARS-CoV-2 such that the use is for prevention of COVID-19.
  • Subjects suitable for such prophylactic use include subjects in high risk categories, health care professionals and close contacts of subjects infected with SARS-CoV-2 .
  • Fig. 1 shows an air-liquid interface (ALI) culture with primary human lung cells infected with SARS-CoV- 2 and treated with Compound A (Compound A is GSKE in Fig. 1) for 48 hr, at concentrations of 0.04, 0.12, 0.37, 1.1, 3.3, 10 and 30 ⁇ M compound, compared to controls including redemsivir (RDM), solvent (DMSO) and solvent + virus.
  • ALI air-liquid interface
  • SARS-CoV-2 is a beta coronavirus having greater than 90% sequence identity at the RNA level with any one of the sequences deposited in the China National Microbiological Data Centre under accession number NMDC10013002, or greater than 90% sequence identity at the RNA level with any one of the sequences deposited in the Global Initiative on Sharing All Influenza Data (GISAID) under reference NC_045512.2 SARS-CoV-2 Wuhan genome (Coronaviridae Study Group of the International Committee on Taxonomy of Viruses, 2020).
  • the SARS-CoV-2 coronavirus has greater than 95% sequence identity at the RNA level with any one of the sequences deposited in the China National Microbiological Data Centre under accession number NMDC10013002 or with reference NC_045512.2 SARS-CoV-2 Wuhan genome (GISAID). In other embodiments, the SARS-CoV-2 coronavirus has greater than 96% sequence identity, greater than 97% sequence identity, greater than 98% sequence identity or greater than 99% sequence identity at the RNA level with any one of the sequences deposited in the China National Microbiological Data Centre under accession number NMDC10013002 or with reference NC_045512.2 SARS-CoV-2 Wuhan genome (GISAID).
  • SARS-CoV-2 is intended to cover all strains of SARS-CoV-2 including the L, S, G, GH, GR, V and 0 clades, as well as recent variants thereof, including the UK variant (201/501Y.V1/B.1.1.7), the South Africa variant (20H/501Y.V2/B.1.351), the Brazil variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, ORF1b:D1183Y, S:S13I; W152C; L452R) and designated CAL.20C (20C/S;452R;B.1.429).
  • S clade has a T at position 8782 and a C at position 28144; L clade has a C at position 8782 and a T at position 28144; G clade has a G at position 23403 (A23403G); GH clade has a T at position 25563 (G25563T); GR clade has a AAC for GGG starting at position 28881 (GGG28881AAC); clade V has a T at position 26144 (ORG2a:G251V); and O has sequence variations and mutations not defined by clades L, S, G, GH, GR or V, with numbering relating to the reference genome of 2019-nCoV-2 (NC_045512).
  • SARS-CoV-2 also encompasses SARS-CoV-2 clades that have amino acid changes for clade S (ORF8:L84S mutation), clade G (S:D614G mutation), clade GH (ORF3a:Q57H mutation), clade GR (both S:D614G and N:RG203KR mutations), clade V (ORF3a:G251V mutation), and clade O (sequences and mutations not matching any of these criteria for the other clades), as well as other emerging variants descended from the clades defined above.
  • COVID-19 refers to the collection of symptoms (e.g. https://www.cdc.gov/coronavirus/2019- ncov/symptoms-testing/symptoms.html) exhibited by patients infected with any strain or clade of SARS- CoV-2 . Symptoms typically include cough, fever and shortness of breath (dyspnoea), although some patients are asymptomatic, in which case COVID-19 refers to SARS-CoV-2 infection alone.
  • “Secondary condition associated with COVID-19” or “secondary conditions associated with COVID019” means any one or more of a myriad of symptoms associated with COVID-19 including but not limited to fever; chills; cough; shortness of breath; difficulty breathing; fatigue; muscle ache; body ache; headache; chest pain; pink eye (conjunctivitis); rash; loss of taste, loss of smell; sore throat; congestion; runny nose; nausea; vomiting; diarrhea; heart palpitations; racing heartbeat; Takotsubo cardiomyopathy; light-headedness; feeling faint; brain fogginess; numbness in fingers, hands, feet, limbs; tingling sensation in the body; postural orthostatic tachycardia syndrome (POTS); less effective blood pumping; inflammation of the heart; inflammation of the membrane around the heart; blood clots; and neurological symptoms.
  • POTS postural orthostatic tachycardia syndrome
  • Treatment of COVID-19 refers to a reduction in the viral load of SARS-CoV-2 and/or to a reduction in the viral titre of SARS-CoV-2 , and/or to a reduction in the severity or duration of the symptoms of the disease.
  • Viral load may be measured by a suitable quantitative RT-PCR assay or a suitable qualitative diagnostic test such as a RDT based on LFIA performed on a specimen from the patient.
  • the specimen may be a specimen from the upper or lower respiratory tract (such as a nasopharyneal or oropharyngeal swab, sputum, lower respiratory tract aspirates, bronchoalveolar lavage, bronchial biopsy, transbronchial biopsy and nasopharyngeal wash/spirate or nasal aspirate) saliva or plasma.
  • the specimen is mucous.
  • the specimen is saliva.
  • COVID-19 RdRp/Hel assay is used. This has been validated with clinical specimens and has a limit of detection of 1.8 TCID 50 /mL with genomic RNA and 11.2 RNA copies/reaction with in vitro RNA transcripts. (Chan et al., J Clin Microbiol., 2020, doi:10.1128/JCM.00310-20). Viral titre may be measured by assays well known in the art.
  • treatment of COVID-19 refers to at least a 5 fold, 10 fold, 50 fold, 100 fold, 500 fold or 1000 fold reduction in the viral load (RNA copies/ml) measured by the same assay from a specimen from the same origin taken prior to treatment (baseline) and the end of the treatment period in a single patient.
  • treatment of COVID-19 refers to a greater than 0.5 log unit reduction in viral load.
  • treatment of COVID-19 refers to the situation where the mean viral load (RNA copies/ml) from specimens of the same origin from 30 patients measured in the same assay being reduced by at least 5 fold, 10 fold, 50 fold, 100 fold, 500 fold or 1000 fold at the end of the treatment period compared to baseline.
  • treatment of COVID-19 refers to a clinical improvement in signs and symptoms, as evidenced by patient vitals, patient self-reporting, and clinical observations.
  • treatment of COVID-19 refers to the viral load being decreased to below the limit of detection of the 19 RdRp/Hel assay at the end of the treatment period.
  • High risk subjects and “high risk” categories include the following: subjects of 60 years of age and over; subjects with a body-mass index (BMI) ⁇ 35; smokers, subjects having a chronic medical condition including heart disease, lung disease, diabetes, cancer or high blood pressure; immunocompromised subjects such as subjects undergoing treatment for cancer or autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis and inflammatory bowel disease, subjects having a transplant and HIV positive individuals, including persons living in a community residence such as a dormatory, assisted living facility, nursing home, rehabilitation center and the like, persons having attended a gathering of 10, 25, 50, 100, 500, 1000 or more people not separated by feet (2 meters) or not separated by ⁇ 3 feel; (1 meter) and/or not protected by a face mask or shield, and persons having travelled to, from or through a region with high levels of SARS-CoV-2 and CGVID-19 cases.
  • BMI body-mass index
  • Close contacts and “Close contacts of a subject infected with SARS-CoV-2” are defined as (i) persons living in the same household as the infected subject; (ii) persons having had direct or physical contact with the infected subject; (iii) persons having remained within two metres of an infected subject for longer than 15 minutes on or after the date on which symptoms were first reported by the subject, or for an a asymptomatic subject, in the 2 days prior to test specimen collection.
  • Subjects infected with SARS-CoV-2 may be identified by detection of viral RNA from SARS-CoV-2 from a specimen obtained from the subject.
  • the specimen may be a specimen from the upper or lower respiratory tract (such as a nasopharyneal or oropharyngeal swab, sputum, lower respiratory tract aspirates, bronchoalveolar lavage and nasopharyngeal wash/spirate or nasal aspirate).
  • Any known methods of RNA detection may be used, such as high-throughput sequencing or real-time reverse-transcriptase polymerase-chain-reaction (RT-PCR) assay.
  • RT-PCR real-time reverse-transcriptase polymerase-chain-reaction
  • the method comprises the following steps: a) Isolating RNA from a specimen; b) Reverse transcription of the RNA; c) Amplification with forward and reverse primers in the presence of a probe; and d) Detection of the probe; wherein the presence of SARS-CoV-2 is confirmed if the cycle threshold growth curves cross the threshold within 40 cycles.
  • step c) utilises the following:
  • step c) utilises the following:
  • RT-PCR real-time reverse-transcriptase polymerase-chain-reaction
  • the invention comprises a method for treating COVID-19 in a subject comprising a method of detecting viral RNA from SARS-CoV-2 from a specimen obtained from the subject and, where viral RNA is detected, a step of treating COVID-19 as described herein.
  • the invention provides a method for testing for SARS-CoV-2 in a subject and treating SARS-CoV-2 infection in the subject, which method comprises the following steps: a) Isolating RNA from a specimen derived from a subject; b) Reverse transcription of the RNA; c) Amplification with forward and reverse primers in the presence of a probe; and d) Detection of the probe; wherein the subject is defined as having SARS-CoV-2 infection if the cycle threshold growth curves cross the threshold within 40 cycles; and e) treating the subject having SARS-CoV-2 infection with a therapeutically effective amount of a compound selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl
  • the method of identification of subjects infected with SARS-CoV-2 is capable of identifying whether the subject is infected with L strain SARS-CoV-2 RNA, S strain SARS-CoV- 2 RNA, G strain SARS-CoV-2 RNA, GH strain SARS-CoV-2 RNA, GR strain SARS-CoV-2 RNA, V strain SARS-CoV-2 RNA, or 0 strain SARS-CoV-2 RNA.
  • the method described herein could include a further step of sequencing amplified cDNA to identify whether the subject is infected with S strain, L strain, G strain, GH strain, GR strain, V strain or 0 strain, as well as a further step to identify whether the subject is infected with a variant thereof, including the UK variant (201/501Y.V1/B.1.1.7), the South Africa variant (20H/501Y.V2/B.1.351), the Brazil variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, ORF1b:D1183Y, S:S13I; W152C; L452R) and designated CAL.20C (20C/S;452R;B.1.429).
  • subjects infected with SARS-CoV-2 may be identified by detection of an SARS-CoV-2 antigen or subject antibodies directed to SARS-CoV-2 in a sample of blood or mucous taken from the subject.
  • subjects infected with SARS-CoV-2 may be identified by detection of an SARS-CoV-2 antigens in a sample of blood or mucous taken from the subject. Any suitable assay may be used. Kits for conducting such serological assays are already commercially available, e.g. from Biomerica and Pharmact.
  • the assay to identify subjects infected with SARS-CoV-2 comprises: a) contacting at least one immobilised antigen from SARS-CoV-2 with blood from the subject; and b) detection of a complex formed between subject antibodies directed to the immobilised antigen and the immobilised antigen; where the the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b).
  • the antigen from SARS-CoV-2 is selected from the N- protein and the S protein or fragments thereof. In a more particular embodiment, the the antigen from SARS-CoV-2 is selected from the N-protein, the SI domain of the S protein and the S2 domain of the S protein. In one embodiment, the assay comprises more than one immobilised antigen.
  • step b there is a step of washing the immobilised antigen after step a) and before step b).
  • the detection step b) comprises contacting the complex formed with a labelled antibody or antibodies recognising the same antigen or antigens followed by detection of the label.
  • the complex is washed after addition of labelled antibody(ies) prior to detection of the label.
  • the label is capable of producing a coloured product, enabling visual detection of the label.
  • the assay is a lateral flow assay.
  • the lateral flow assay has the immobilised antigen(s) on a dipstick.
  • the invention provides a method for testing for SARS-CoV-2 in a subject and treating SARS-CoV-2 infection in the subject, which method comprises the following steps: a) contacting at least one immobilised antigen from SARS-CoV-2 with blood from the subject; and b) detecting a complex formed between subject antibodies directed to the immobilised antigen and the immobilised antigen; where the the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b); and c) treating the subject having SARS-CoV-2 infection with a therapeutically effective amount of a compond selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbam
  • the assay to identify subjects infected with SARS-CoV-2 comprises: a) contacting an immobilised antibody recognising an antigen from SARS-CoV-2 with blood from the subject; and b) detection of a complex formed between an antigen from SARS-CoV-2 and the immobilised antibody recognising said antigen; where the the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b).
  • the antigen from SARS-CoV-2 is selected from the N-protein and the S protein or fragments thereof.
  • the antigen from SARS-CoV-2 is selected from the N-protein, the SI domain of the S protein and the S2 domain of the S protein.
  • the assay comprises more than one immobilised antibody, each antibody recognising a different antigen.
  • step b) there is a step of washing the immobilised antibody after step a) and before step b).
  • the detection step b) comprises contacting the complex formed in step a) with labelled antibodies recognising the same antigen or antigens followed by detection of the label.
  • step b) comprises a step of washing prior to detection of the label.
  • the label is capable of producing a coloured product, enabling visual detection of the label.
  • the assay is a lateral flow assay.
  • the lateral flow assay has the immobilised antibod(ies) on a dipstick.
  • the invention provides a method for testing for and treating SARS-CoV-2 infection, which method comprises the following steps: a) contacting an immobilised antibody recognising an antigen from SARS-CoV-2 with blood from the subject; and b) detecting of a complex formed between an antigen from SARS-CoV-2 and the immobilised antibody recognising said antigen; wherein the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b), and treating the subject having SARS-CoV-2 infection with a therapeutically effective amount of a compound selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[
  • the invention provides a compound selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ -2-(4,4-
  • a specimen from the subject has been tested for SARS-CoV-2 RNA and no SARS-CoV-2 RNA was detected. In another embodiment, a specimen from the subject has not been tested for SARS-CoV-2 RNA.
  • the subject is in a high risk category (as defined herein), a health care professional or is a close contact of a patient infected with SARS-CoV-2 (as defined herein).
  • a method of preventing COVID-19 in a subject at risk of an infection from SARS-Co-V-2 comprising: administering to the subject at risk of infection from SARS-CoV-2 a therapeutically effective amount of a compound selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo
  • the invention provides a compound selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ -2-(4,4-
  • treatment is initated in a subject within 5 to 7 days of the onset of symptoms, or within 72 hours of being tested positive for SARS-CoV-2 infection, using for example, the method defined herein.
  • treatment is initated in a subject within 2 days of the onset of symptoms, or within 48 hours of being tested positive for SARS-CoV-2 infection, using for example, the method defined herein.
  • treatment is initated in a subject within 24 hours of the onset of symptoms, or within 24 hours of being tested positive for SARS-CoV-2 infection, using for example, the method defined herein.
  • the subject is a subject infected with SARS-CoV-2 who tests positive for SARS-CoV-2.
  • the subject is a subject infected with SARS-CoV-2 who tests positive for SARS-CoV-2 who had previously received a SARS-CoV-2 vaccine.
  • the subject infected with SARS-CoV-2 is a subject with a secondary condition associated with COVID-19.
  • the subject infected with SARS-CoV-2 is in a high risk category, as defined above.
  • the COVID-19 in the subject infected with SARS-CoV-2 is associated with pneumonia.
  • the subject infected with SARS-CoV-2 has a MuLBSTA score of ⁇ 12, or a CURB-65 score of ⁇ 2 or a PSI score ⁇ 70.
  • the subject infected with SARS-CoV-2 meets one or more of the following criteria: pulse ⁇ 125/minute, respiratory rate >30/minute, blood oxygen saturation ⁇ 93%, PaO 2 /FiO 2 ratio ⁇ 300 mmHg, peripheral blood lymphocyte count ⁇ 0.8*10 9/ L, systolic blood pressure ⁇ 90 mmHg, temperature ⁇ 35 or ⁇ 40°C, arterial pH ⁇ 7.35, blood urea nitrogen ⁇ 30 mg/dl, partial pressure of arterial O 2 ⁇ 60 mmHg, pleural effusion, lung infiltrates >50% of the lung field within 24-48 hours.
  • the COVID-19 in the subject infected with SARS-CoV-2 is associated with acute respiratory distress disorder.
  • the subject infected with SARS- CoV-2 has a Murray Score of ⁇ 2.
  • the subject infected with SARS-CoV-2 has a PaO 2 /FiO 2 ratio ⁇ 200 mmHg.
  • the subject infected with SARS-CoV-2 has a PaO 2 /FiO 2 ratio ⁇ 100 mmHg.
  • the patient has a corrected expired volume per minute ⁇ 10 L/min.
  • the subject infected with SARS-CoV-2 has respiratory system compliance ⁇ 40 rnl/cm H 2 O.
  • the subject infected with SARS-CoV-2 has positive end-expiratory pressure ⁇ 10 cm H 2 O.
  • the subject infected with SARS-CoV-2 is undergoing extra -corporeal membrane oxygenation or mechanical ventilation, or receiving oxygen supplementation via a nasal cannula or simple mask.
  • mechanical ventilation this includes use of low tidal volumes ( ⁇ 6 mL/kg ideal body weight) and airway pressures (plateau pressure ⁇ 30 cm H 2 O).
  • oxygen supplementation is via a nasal cannula, this may be delivered as 2 to 6 L/minute.
  • oxygen supplementation is by a simple mask, this may be delivered at 5 to 10 L/minute.
  • the subject infected with SARS-CoV-2 is receiving anti-viral and or steroid treatment wherein the anti-viral or steroid treatment is treatment with an agent other than benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan
  • the subject is receiving antibody treatment, such as a monoclonal antibody treatment.
  • the subject is receiving convalescent plasma therapy.
  • the subject infected with SARS-CoV-2 is receiving an anti-viral agent wherein the anti-viral agent is an agent other than benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2- oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4- (trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamo
  • the anti-viral agent is selected from olsetemivir, remdesivir, ganciclovir, lopinavir, ritonavir and zanamivir.
  • the patient is receiving oseitamivir (75 mg every 12 h orally).
  • the subject infected with SARS-CoV-2 is receiving ganciclovir (0,25 g every 12 h intravenously).
  • the subject infected with SARS-CoV-2 is receiving lopinavir/ ritonavir (400/100 mg twice daily orally).
  • the subject infected with SARS-CoV-2 is receiving 100 mg remdesivir daily intravenously.
  • the subject infected with SARS-CoV-2 is receiving treatment with steroids.
  • the steroid is selected from dexamethasone, prednisone, methyl prednisone and hydrocortisone.
  • the subject infected with SARS-CoV-2 is receiving dexamethasone (6 mg once daily, orally or intravenously).
  • the subject infected with SARS-CoV-2 is receiving prednisone (40 mg daily, in two divided doses). In one embodiment, the subject infected with SARS-CoV-2 is receiving methylprednisone (32 mg daily, in two divided doses).
  • the subject infected with SARS-CoV-2 is receiving hydrocortisone (160 mg daily, in two to four divided doses).
  • the subject receiving treatment with any of the above steroids is a subject receiving mechanical ventilation or supplemental oxygen.
  • the subject infected with SARS-CoV-2 is receiving treatment with tocilizumab (8 mg/kg intravenously), or tocilizumab (8 mg/kg intravenously) in combination with dexamethasone (6 mg once daily, orally or intravenously).
  • the subject infected with SARS-CoV-2 is receiving treatment with a SARS- CoV-2 neutralizing antibody.
  • the subject infected with SARS-CoV-2 is receiving bamlanivimab (for example at a dose of 700 mg, 2800 mg or 7000 mg by iv infusion).
  • the subject infected with SARS-CoV-2 is receiving casirivimab and imdevimab, for example, at a dose of either 1200 mg for each antibody or at a dose of 4000 mg for each antibody.
  • the subject infected with SARS-CoV-2 is receiving convalescent plasma therapy.
  • Blood is collected from an ABO compatible donor after at least 3 weeks post onset of illness and 4 days post discharge and plasma is prepared by apheresis.
  • the plasma has a neutralizing antibody titer of 1:640 or above, as measured by the plaque reduction neutralization test using SARS-CoV-2 virus.
  • the dose of convalescent plasma is 200 mL.
  • a method for treating or preventing COVID-19 in a subject infected with SARS-CoV-2 or at risk of infection with SARS-CoV-2 comprising administering a therapeutically effective amount of a compound or a pharmaceutically acceptable salt which is selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-o
  • the method comprises administering a therapeutically effective amount of a compound or a pharmaceutically acceptable salt selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl ⁇ -3-methylbutyl]
  • the method comprises administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl ⁇ -3-methylbutyl]carb
  • the subject infected with SARS-CoV-2 is infected with a strain (clade) of SAR-Co-V-2 selected from the L strain, the S strain, the G strain, the GH strain, the GR strain, the V strain or the 0 strain of SARS-CoV-2 .
  • the subject infected with SARS-CoV- 2 is infected with the L strain of SARS-CoV-2.
  • the subject infected with SARS-CoV-2 is infected with the S strain of SARS-CoV-2.
  • the subject infected with SARS-CoV-2 is infected with the G strain of SARS-CoV-2.
  • the subject infected with SARS-CoV-2 is infected with the GH strain of SARS-CoV-2. In a particular embodiment, the subject infected with SARS-CoV-2 is infected with the GR strain of SARS-CoV-2. In a particular embodiment, the subject infected with SARS-CoV-2 is infected with the V strain of SARS-CoV- 2. In a particular embodiment, the subject infected with SARS-CoV-2 is infected with the 0 strain of SARS-CoV-2.
  • the subject is infected with a variant of SARS-CoV-2, including the UK variant (201/501Y.V1/B.1.1.7), the South Africa variant (20H/501Y.V2/B.1.351), the Brazil variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, ORF1b:D1183Y, S:S13I; W152C; L452R) and designated CAL.20C (20C/S;452R;B.1.429).
  • SARS-CoV-2 including the UK variant (201/501Y.V1/B.1.1.7), the South Africa variant (20H/501Y.V2/B.1.351), the Brazil variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, ORF1b:D1183Y, S:S13I;
  • the method comprises administering a therapeutically effective amount of a compound or a pharmaceutically acceptable salt selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl ⁇ -3-methylbutyl]
  • the subject infected with SARS-CoV-2 is undergoing extra-corporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, or receiving oxygen therapy.
  • the subject infected with SARS-CoV-2 is receiving anti-viral and or steroid treatment wherein the anti-viral or steroid treatment is treatment with an agent other than benzyl N- [(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-
  • the subject infected with SARS-CoV-2 is receiving an anti-viral agent wherein the anti-viral agent is an agent other than benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-ox
  • the anti-viral agent is selected from remdesivir, ganciclovir, lopinavir, olsetemivir ritonavir and zanamivir.
  • the subject infected with SARS-CoV-2 is receiving 100 mg remdesivir daily intravenously.
  • the subject infected with SARS-CoV-2 is receiving treatment with steroids.
  • the steroid is selected from dexamethasone, prednisone, methylprednisone and hydrocortisone.
  • the subject infected with SARS-CoV-2 is receiving dexamethasone (6 mg once daily, orally or intravenously).
  • the subject receiving treatment with steroids is a patient receiving mechanical ventilation or supplemental oxygen.
  • the subject infected with SARS-CoV-2 is receiving convalescent plasma therapy.
  • the method comprises administering a therapeutically effective amount of a compound selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl>-3-methylbutyl]carbamoyl>
  • the compounds may be prepared as described in WO2018/042343, or in accordance with the following synthetic schemes.
  • the lactam alcohol 1 can be prepared according to literature (Journal of Medicinal Chemistry 48(22), 6767-6771, 2005).
  • Alcohol 1 may be oxidised by reaction with a SO 3 -pyridine complex to produce an aldehyde 2, and the following reaction of 2 with an isocyanide, such as isopropyl isocyanide, in the presence of an appropriate acid, such as benzoic acid yields ester 3.
  • the amino-alcohol 5 can be obtained by removal of benzoyl group of 3 under basic condition, followed by deprotection of Boc group of 4 using an appropriate acid, such as HCI, in a suitable solvent such as 1,4- dioxane. Any suitable amide forming condition can be used to prepare compound 6.
  • 2,4,6- tripropyl-l,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide is used in this invention.
  • the removal of Boc group of compound 6 with HCI produces amine 7.
  • Amine 7 (free or salt thereof) may be subjected to an amide formation reaction with a suitable Cbz-amino acid such as (S)-2-(((benzyloxy)carbonyl)amino)-3- (4-(trifluoromethyl)piperidin-1-yl)propanoic acid (commercially available), by using 2,4,6-tripropyl- 1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide as the preferred coupling reagent, to give amide 8.
  • the subsequent oxidation is completed with Dess-Martin periodinane to yield final compound 9.
  • the lactam alcohol 1 can be prepared according to literature (Journal of Medicinal Chemistry 48(22), 6767-6771, 2005).
  • Alcohol 1 may be oxidised by reaction with a SO 3 -pyridine complex to produce an aldehyde 2, and the following reaction of 2 with n-butyl isocyanide, in the presence of an appropriate acid, such as benzoic acid yields ester 10.
  • the amino-alcohol 12 can be obtained by removal of benzoyl group of 10 under basic condition, followed by deprotection of Boc group of 11 using an appropriate acid, such as HCI, in a suitable solvent such as 1,4-dioxane. Any suitable amide forming condition can be used to prepare compound 13.
  • 2,4,6-tripropyl- 1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide is used in this invention.
  • the removal of Boc group of compound 13 with HCI produces amine 14.
  • Amine 14 (free or salt thereof) may be subjected to an amide formation reaction with (S)-2-(((benzyloxy)carbonyl)amino)-3-(4,4-difluoropiperidin-1-yl)propanoic acid by using 2,4,6-tripropyl-1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide as the preferred coupling reagent, to give amide 15.
  • the subsequent oxidation is completed with Dess-Martin periodinane to yield final compound 16.
  • Benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate; and benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ -2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate are compounds that
  • Suitable acids include pharmaceutically acceptable inorganic acids and pharmaceutically acceptable organic acids.
  • Such acid addition salts can be formed by reaction of the with the appropriate acid, optionally in a suitable solvent such as an organic solvent, to give the salt which can be isolated by a variety of methods, including crystallisation and filtration.
  • the uses and methods described herein use benzyl N-[(1S)-1- ⁇ [(1S)-3- methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2- yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof.
  • the uses and methods use benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate free base.
  • the uses and methods described herein use benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl ⁇ -3- methylbutyl]carbamoyl ⁇ -2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof.
  • the uses and methods use benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl ⁇ -3- methylbutyl]carbamoyl ⁇ -2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate free base.
  • the compound or pharmaceutically acceptable salt is administered in a pharmaceutical composition containing the compound or pharmaceutically acceptable salt and a pharmaceutically acceptable excipient.
  • the compound or pharmaceutically acceptable salt is formulated in a pharmaceutical composition adapted for oral or parenteral administration, or for administration intranasally or by inhalation.
  • Pharmaceutical compositions adapted for oral administration may be presented as discrete units such as capsules or tablets; powders or granules; solutions or suspensions in aqueous or non-aqueous liquids; edible foams or whips; or oil-in-water liquid emulsions or water-in-oil liquid emulsions.
  • compositions adapted for nasal administration can comprise a coarse powder having a particle size for example in the range 20 to 500 microns which is administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close up to the nose.
  • Suitable formulations wherein the carrier is a liquid, for administration as a nasal spray or as nasal drops, include aqueous or oil solutions of the compound or pharmaceutically acceptable salt thereof.
  • the pharmaceutical composition may be adapted for parenteral administration.
  • Such compositions include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats, co-solvents, organic solvent mixtures, cyclodextrin complexation agents, emulsifying agents (for forming and stabilizing emulsion formulations), liposome components for forming liposomes, gellable polymers for forming polymeric gels, lyophilization protectants and combinations of agents for, inter alia, stabilizing the active ingredient in a soluble form and rendering the formulation isotonic with the blood of the intended recipient.
  • compositions for parenteral administration may also take the form of aqueous and non- aqueous sterile suspensions which may include suspending agents and thickening agents (R. G. Strickly, Solubilizing Excipients in oral and injectable formulations, Pharmaceutical Research, Vol 21(2) 2004, p 201-230).
  • a drug molecule that is ionizable can be solubilized to the desired concentration by pH adjustment if the drug's pKa is sufficiently far away from the formulation pH value.
  • the acceptable range is pH 2-12 for intravenous and intramuscular administration, but for subcutaneous administration the acceptable range is pH 2.7-9.0.
  • the solution pH is controlled by either the salt form of the drug, strong acids/bases such as hydrochloric acid or sodium hydroxide, or by solutions of buffers which include but are not limited to buffering solutions formed from glycine, citrate, acetate, maleate, succinate, histidine, phosphate, tris(hydroxymethyl)aminomethane (TRIS), or carbonate.
  • the combination of an aqueous solution and a water-soluble organic solvent/surfactant is often used in injectable formulations.
  • the water-soluble organic solvents and surfactants used in injectable formulations include but are not limited to propylene glycol, ethanol, polyethylene glycol 300, polyethylene glycol 400, glycerin, dimethylacetamide (DMA), N-methyl-2-pyrrolidone (NMP; Pharmasolve), dimethylsulphoxide (DMSO), Solutol HS 15, Cremophor EL, Cremophor RH 60, and polysorbate 80.
  • Such formulations can usually be, but are not always, diluted prior to injection.
  • Propylene glycol, PEG 300, ethanol, Cremophor EL, Cremophor RH 60, and polysorbate 80 are the entirely organic water-miscible solvents and surfactants used in commercially available injectable formulations and can be used in combinations with each other.
  • the resulting organic formulations are usually diluted at least 2-fold prior to administration by IV bolus or IV infusion. Alternatively, increased water solubility can be achieved through molecular complexation with cyclodextrins.
  • Liposomes are closed spherical vesicles composed of outer lipid bilayer membranes and an inner aqueous core and with an overall diameter of ⁇ 100 ⁇ m.
  • moderately hydrophobic drugs can be solubilized by liposomes if the drug becomes encapsulated or intercalated within the liposome.
  • Hydrophobic drugs can also be solubilized by liposomes if the drug molecule becomes an integral part of the lipid bilayer membrane, and in this case, the hydrophobic drug is dissolved in the lipid portion of the lipid bilayer.
  • a typical liposome formulation contains water with phospholipid at -5-20 mg/mL, an isoton icifier, a pH 5-8 buffer, and optionally cholesterol.
  • the formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.
  • sterile liquid carrier for example water for injections
  • the pharmaceutical formulation can be prepared by lyophilizing a compound of the invention as described herein. Lyophilization refers to the procedure of freeze-drying a composition. Freeze-drying and lyophilization are therefore used herein as synonyms. A typical process is to solubilize the compound and the resulting formulation is clarified, sterile filtered and aseptically transferred to containers appropriate for lyophilization (e.g. vials). In the case of vials, they are partially stoppered with lyo-stoppers. The formulation can be cooled to freezing and subjected to lyophilization under standard conditions and then hermetically capped forming a stable, dry lyophile formulation. The composition will typically have a low residual water content, e.g. less than 5% e.g. less than 1% by weight based on weight of the lyophile.
  • the lyophilization formulation may contain other excipients for example, thickening agents, dispersing agents, buffers, antioxidants, preservatives, and tonicity adjusters.
  • Typical buffers include phosphate, acetate, citrate and glycine.
  • antioxidants include ascorbic acid, sodium bisulphite, sodium metabisulphite, monothioglycerol, thiourea, butylated hydroxytoluene, butylated hydroxyl anisole, and ethylenediaminetetraacetic acid salts.
  • Preservatives may include benzoic acid and its salts, sorbic acid and its salts, alkyl esters of para-hydroxybenzoic acid, phenol, chlorobutanol, benzyl alcohol, thimerosal, benzalkonium chloride and cetylpyridinium chloride.
  • the buffers mentioned previously, as well as dextrose and sodium chloride, can be used for tonicity adjustment if necessary.
  • Bulking agents are generally used in lyophilization technology for facilitating the process and/or providing bulk and/or mechanical integrity to the lyophilized cake.
  • Bulking agent means a freely water soluble, solid particulate diluent that when co-lyophilized with the compound or salt thereof, provides a physically stable lyophilized cake, a more optimal freeze-drying process and rapid and complete reconstitution.
  • the bulking agent may also be utilized to make the solution isotonic.
  • the water-soluble bulking agent can be any of the pharmaceutically acceptable inert solid materials typically used for lyophilization.
  • Such bulking agents include, for example, sugars such as glucose, maltose, sucrose, and lactose; polyalcohols such as sorbitol or mannitol; amino acids such as glycine; polymers such as polyvinylpyrrolidone; and polysaccharides such as dextran.
  • the ratio of the weight of the bulking agent to the weight of active compound is typically within the range from about 1 to about 5, for example of about 1 to about 3, e.g. in the range of about 1 to 2.
  • dosage forms may be via filtration or by autoclaving of the vials and their contents at appropriate stages of the formulation process.
  • the supplied formulation may require further dilution or preparation before delivery for example dilution into suitable sterile infusion packs.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets.
  • the pharmaceutical composition is in a form suitable for i.v. administration, for example by injection or infusion.
  • compositions of the present invention for parenteral injection can also comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.
  • suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • compositions of the present invention may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents such as sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
  • a compound If a compound is not stable in aqueous media or has low solubility in aqueous media, it can be formulated as a concentrate in organic solvents. The concentrate can then be diluted to a lower concentration in an aqueous system, and can be sufficiently stable for the short period of time during dosing. Therefore in another aspect, there is provided a pharmaceutical composition comprising a non aqueous solution composed entirely of one or more organic solvents, which can be dosed as is or more commonly diluted with a suitable IV excipient (saline, dextrose; buffered or not buffered) before administration (Solubilizing excipients in oral and injectable formulations, Pharmaceutical Research, 21(2), 2004, p201-230).
  • a suitable IV excipient saline, dextrose; buffered or not buffered
  • solvents and surfactants are propylene glycol, PEG300, PEG400, ethanol, dimethylacetamide (DMA), N-methyl-2-pyrrolidone (NMP, Pharmasolve), Glycerin, Cremophor EL, Cremophor RH 60 and polysorbate.
  • Particular non aqueous solutions are composed of 70-80% propylene glycol, and 20-30% ethanol.
  • One particular non aqueous solution is composed of 70% propylene glycol, and 30% ethanol.
  • the typical amounts for bolus IV formulations are ⁇ 50% for Glycerin, propylene glycol, PEG300, PEG400, and ⁇ 20% for ethanol.
  • the typical amounts for IV infusion formulations are ⁇ 15% for Glycerin, 3% for DMA, and ⁇ 10% for propylene glycol, PEG300, PEG400 and ethanol.
  • the pharmaceutical composition is in a form suitable for i.v. administration, for example by injection or infusion.
  • the solution can be dosed as is, or can be injected into an infusion bag (containing a pharmaceutically acceptable excipient, such as 0.9% saline or 5% dextrose), before administration.
  • the pharmaceutical composition is in a form suitable for sub-cutaneous (s.c.) administration.
  • Pharmaceutical dosage forms suitable for oral administration include tablets, capsules, caplets, pills, lozenges, syrups, solutions, powders, granules, elixirs and suspensions, sublingual tablets, wafers or patches and buccal patches.
  • compositions containing a pharmaceutically acceptable salt of compounds described here can be formulated in accordance with known techniques, see for example, Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA, USA.
  • the compounds described herein can be formulated as a solid dosage form (e.g. tablets and capsules etc.).
  • Tablet compositions can contain a unit dosage of active compound together with an inert diluent or carrier such as a sugar or sugar alcohol, e.g.; lactose, sucrose, sorbitol or mannitol; and/or a non-sugar derived diluent such as sodium carbonate, calcium phosphate, calcium carbonate, or a cellulose or derivative thereof such as methyl cellulose, ethyl cellulose, hydroxypropyl methyl cellulose, and starches such as corn starch.
  • an inert diluent or carrier such as a sugar or sugar alcohol, e.g.; lactose, sucrose, sorbitol or mannitol
  • a non-sugar derived diluent such as sodium carbonate, calcium phosphate, calcium carbonate, or a cellulose or derivative thereof such as methyl
  • Tablets may also contain such standard ingredients as binding and granulating agents such as polyvinylpyrrolidone, disintegrants (e.g. swellable crosslinked polymers such as crosslinked carboxymethylcellulose), lubricating agents (e.g. stearates), preservatives (e.g. parabens), antioxidants (e.g. BHT), buffering agents (for example phosphate or citrate buffers), and effervescent agents such as citrate/bicarbonate mixtures.
  • binding and granulating agents such as polyvinylpyrrolidone, disintegrants (e.g. swellable crosslinked polymers such as crosslinked carboxymethylcellulose), lubricating agents (e.g. stearates), preservatives (e.g. parabens), antioxidants (e.g. BHT), buffering agents (for example phosphate or citrate buffers), and effervescent agents such as citrate/bicarbonate mixtures.
  • disintegrants e
  • Capsule formulations may be of the hard gelatin or soft gelatin variety and can contain the active component in solid, semi-solid, or liquid form.
  • Gelatin capsules can be formed from animal gelatin or synthetic or plant derived equivalents thereof.
  • the solid dosage forms can be coated or un-coated, but typically have a coating, for example a protective film coating (e.g. a wax or varnish) or a release controlling coating.
  • a protective film coating e.g. a wax or varnish
  • the coating e.g. a Eudragit® type polymer
  • the coating can be designed to release the active component at a desired location within the gastro-intestinal tract.
  • the coating can be selected so as to degrade under certain pH conditions within the gastrointestinal tract, thereby selectively release the compound in the stomach or in the ileum or duodenum.
  • the drug can be presented in a solid matrix comprising a release controlling agent, for example a release delaying agent which may be adapted to selectively release the compound under conditions of varying acidity or alkalinity in the gastrointestinal tract.
  • a release controlling agent for example a release delaying agent which may be adapted to selectively release the compound under conditions of varying acidity or alkalinity in the gastrointestinal tract.
  • the matrix material or release retarding coating can take the form of an erodible polymer (e.g. a maleic anhydride polymer) which is substantially continuously eroded as the dosage form passes through the gastrointestinal tract.
  • the active compound can be formulated in a delivery system that provides osmotic control of the release of the compound. Osmotic release and other delayed release or sustained release formulations may be prepared in accordance with methods well known to those skilled in the art.
  • the pharmaceutical formulations may be presented to a patient in "patient packs" containing an entire course of treatment in a single package, usually a blister pack.
  • Patient packs have an advantage over traditional prescriptions, where a pharmacist divides a patient's supply of a pharmaceutical from a bulk supply, in that the patient always has access to the package insert contained in the patient pack, normally missing in patient prescriptions.
  • the inclusion of a package insert has been shown to improve patient compliance with the physician's instructions.
  • compositions for topical use include ointments, creams, sprays, patches, gels, liquid drops and inserts (for example intraocular inserts). Such compositions can be formulated in accordance with known methods.
  • compositions for parenteral administration are typically presented as sterile aqueous or oily solutions or fine suspensions, or may be provided in finely divided sterile powder form for making up extemporaneously with sterile water for injection.
  • compositions adapted for parenteral administration include aqueous and non- aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non- aqueous sterile suspensions which may include suspending agents and thickening agents.
  • the formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets.
  • formulations described herein may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.
  • the present invention also provides unitary pharmaceutical compositions in which the compound or pharmaceutically acceptable salt thereof of the present invention and one or more other pharmaceutically active agent(s) may be administered together or separately.
  • the pharmaceutical composition contains a compound or pharmaceutically acceptable salt selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-
  • the pharmaceutical composition contains a compound or pharmaceutically acceptable salt selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ -2-(
  • the one or more other anti-viral agents are selected from the group consisting of: olsetemivir, remdesivir, ganciclovir, lopinavir, ritonavir and zanamivir.
  • the pharmaceutical composition contains a single other anti-viral agent.
  • the single other anti-viral agent is remdesivir.
  • the pharmaceutical composition contains a compound selected from: benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ -2-(4,4-di
  • one or more steroids are selected from the group consisting of: dexamethasone, prednisone, methylprednisone and hydrocortisone.
  • the pharmaceutical composition contains a single steroid.
  • the single steroid is dexamethasone.
  • a compound of the invention benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1- oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2- [4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ -2-(4,4-difluoropiperi
  • Compositions for administration by inhalation may take the form of inhalable powder compositions or liquid or powder sprays, and can be administrated in standard form using powder inhaler devices or aerosol dispensing devices. Such devices are well known, and include for example breath-actuated inhalers.
  • the powdered formulations typically comprise a compound of the invention benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan- 2-yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ - 2-
  • the inhalable pharmaceutical composition comprises a micronized compound of the invention benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ -
  • 1-yl)ethyl]carbamate may be micronized by any suitable technique known in the art e.g., jet-milling.
  • substantially all of the particles of the micronized compound of the invention benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ -
  • 2-(4,4-d ifluoropiperidin-1-yl)ethyl]carba mate, or a pharmaceutically acceptable salt thereof, are less than 10 ⁇ m in size.
  • the formulation of the invention comprises a compound of the invention benzyl N-[(1S)-1- ⁇ [(1S)-3-methyl-1- ⁇ [(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl ⁇ butyl]carbamoyl ⁇ -2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ - 2-(4,4-
  • compounds of the therapeutically effective single dose is between about 50 mg to about 85 mg BiD (total dose 100 mg to 170 mg). In one embodiment compounds of the therapeutically effective single dose is between about 10 mg to about 50 mg TiD (total dose 30 mg to 150 mg).
  • the single dose will depend on the kind and the severity of the disease and the conditions (weight, sex, age) of the patient and shall be administered one or more times a day, for example once, twice or three times a day.
  • compositions adapted for administration by inhalation include dry poiser or fine particle dusts or mists, which may be generated by means of various types of metered, dose pressurized aerosols, nebulizers or insufflators.
  • Pharmaceutical formulations may be delivered by dry powder inhalation as described in Ives et al.: Dry powder inhaled compound delivery for early pre-clinical in vivo efficacy studies. Journal of Inflammation 2013 10(Suppl 1):P36 (doi:10.1186/1476-9255-10-Sl-P36).
  • 2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate may be delivered as a single inhaled dry powder dose at a desired concentration, optionally comprising lactose or other excipient, as needed.
  • WDF Wright Dust Feeder
  • ADG Aerosolised Dust Generation
  • Rats were weighed within 24 h of administration, with one group placed in a warming cabnet with a tail cannula inserted for serial bleeds. Rats were dosed as an inhaled dry powder, 32% compound (w/w) in lactose, at a target dose level of 5 mg/kg (free base equivalent) with a 60-min inhalation period.
  • WDF speed is determined from a preliminary test, with such speed recorded and used for administration.
  • a regulated flow of compressed air ( ⁇ 14L/min) delivered the aerosol from the WDF into an inhalation chamber.
  • the extract was set at ⁇ 16L/min.
  • a slight draw (2.0 L/min) of room air is allowed into the chamber to balance airflow and maintain the chamber at ⁇ ambient pressure while ensuring a flow of aerosol throughout the chamber.
  • Rats were individually placed into Perspex restraint cones and attached to one of the 24 ports on the ADG tower. Three rats per timepoint were placed on a different level on the dosing tower, to allow for differences between levels, and to minimise differences between groups.
  • compounds of the invention may be administered at a human dose range of about 25 to about 150 mg BiD (total dose 50 to 300 mg). In one embodiment compounds of the invention may be administered at a human dose range of about 50 mg to about 85 mg BiD (total dose 100 mg to 170 mg). In one embodiment, compounds of the invention may be administered at a human dose range from about 10 mg to about 50 mg TiD (total dose 30 mg to 150 mg).
  • compounds of the invention may be administered at a human dose range of about 15 mg to about 35 mg TiD (total dose 45 mg to 105 mg). In one embodiment, compounds of the invention may be administered at a human dose range from about 25mg TiD (total daily dose 75mg) to about 70mg BiD (total daily dose 140mg), such dose based on achieving a desired unbound concentration in the lung throughout the dosing interval.
  • Test compound was 3-fold serially diluted in an 11 point curve with a solvent of 100% DMSO, starting from a high concentration of 1.0 mM. Each dilution was transferred in 100 nL volume into black 384-well Greiner (784076) plates yielding a 10 ⁇ M top final concentration in the assay.
  • Low control wells in column 18 (0% response, 100% inhibition) contained 100 nL of DMSO plus buffer, without enzyme.
  • High control wells in column 6 (100% response, 0% inhibition) contained 100 nL DMSO plus buffer and enzyme. Maximum DMSO concentration is approximately 1% throughout the plate.
  • the assay buffer consists of 25 mM HEPES (pH 7.5), 50 mM NaCI, 1 mM CHAPS, and 1 mM EDTA.
  • Assay plate preparation included spinning the plates prior to reaction additions and the addition of 5 ⁇ L assay buffer only (no enzyme) to column 18 (low control — representing 100% inhibition) and 5 ⁇ L of 2 nM enzyme (OC43 3CL protease, 1 nM final concentration) in assay buffer to columns 1-17, and 19-24.
  • FRET substrate peptide FAM - VARLQSG FG-TAM RA (SEQ ID NO: 7) was suspended at 4 ⁇ M concentration and 5 ⁇ L was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 2 ⁇ M. Reactions were incubated in the dark at room temperature for 60 minutes. At that time the FRET signal was measured with an Envision or equivalent plate reader and used to quantify the endpoint of the assay for apparent EC 50 calculations.
  • Test compound was 1.5-fold serially diluted in a 22 point curve with a solvent of 100% DMSO, starting from a high concentration of 1.0 mM. Each dilution was transferred using an Echo acoustic dispenser in 2.5 nL volume into black 384-well Greiner (784076) plates yielding a 0.25 ⁇ M top final concentration and 75 pM low concentraton in the assay.
  • the assay buffer consists of 25 mM Hepes (pH 7.5), 50 mM NaCI, 1 mM CHAPS, 1 mM EDTA, 0.08% (w/v) fatty acid free BSA, and 1% (v/v) DMSO.
  • the assay plates were centrifuged for 1 min at 500 rpm and incubated at room temperature for 2 hours.
  • a FRET substrate peptide (FAM-VARLQSGFG-TAMRA; AnaSpec) (SEQ ID NO: 7) was suspended at 125 ⁇ M concentration in assay buffer and 1 ⁇ L was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 12.5 ⁇ M.
  • the assay plates were centrifuged for 1 min at 500 rpm and incubated at room temperature for 60 minutes. At that time the FRET signal was measured with a PheraSTAR plate reader (BMG LabTech) with excitation at 485 nm and emissiona at 520 nm and used to quantify the endpoint of the assay for apparent Ki calculations.
  • B uninhibited control
  • C total active enzyme concentration (in M). By default, C is allowed to float during the ABASE initial fitting. If C ⁇ 0, manually apply the constraint where C is fixed to the calculated enzyme concentration (3.2 x 10 -9 M) or actual active enzyme concentration based on a separate active site titration.
  • Test compound was 3-fold serially diluted in an 11 point curve with a solvent of 100% DMSO, starting from a high concentration of 1.0 mM. Each dilution was transferred in 100 nL volume into black 384-well Greiner (784076) plates yielding a 10 ⁇ M top final concentration in the assay.
  • Low control wells in column 18 (0% response, 100% inhibition) contained 100 nL of DMSO plus buffer, without enzyme.
  • High control wells in column 6 (100% response, 0% inhibition) contained 100 nL DMSO plus buffer and enzyme. Maximum DMSO concentration is approximately 1% throughout the plate.
  • the assay buffer consists of 25 mM Hepes (pH 7.5), 50 mM NaCI, 1 mM CHAPS, and 1 mM EDTA.
  • Assay plate preparation included spinning the plates prior to reaction additions and the addition of 5 ⁇ L assay buffer only (no enzyme) to column 18 (low control — representing 100% inhibition) and 5 ⁇ L of 200 pM enzyme (229e 3CL protease, 100 pM final concentration) in assay buffer to columns 1-17, and 19-24.
  • FRET substrate peptide FAM - VARLQSG FG-TAM RA (SEQ ID NO: 7) was suspended at 4 ⁇ M concentration and 5 ⁇ L was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 2 ⁇ M. Reactions were incubated in the dark at room temperature for 60 minutes. At that time the FRET signal was measured with an Envision or equivalent plate reader and used to quantify the endpoint of the assay for apparent EC 50 calculations.
  • Test compound was 1.5-fold serially diluted in a 22 point curve with a solvent of 100% DMSO, starting from a high concentration of 1.0 or 0.25 mM.
  • Each dilution with a high of 1 mM was transferred using an Echo acoustic dispenser in 2.5 nL volume into black 384-well Greiner (784076) plates yielding a 0.25 ⁇ M top final concentration and 75 pM low concentration in the assay.
  • each dilution with a 0.25 mM high concentration was transferred using an Echo acoustic dispenser in 20 nL volume into black 384-well Greiner (784076) plates yielding a 0.50 ⁇ M top final concentration and 100 pM low concentration in the assay.
  • Low control wells in column 18 contained 2.5 nL of DMSO plus buffer, without enzyme.
  • High control wells in column 6 contained 2.5 nL DMSO plus buffer and enzyme.
  • the high inhibitor was in rows A and B column 1 and the high controls (no inhibitor) were in rows A and B columns 23 and 24 with intermediate dilutions in columns 2 to 22.
  • the low control rate was insignificant and not subtracted.
  • the assay buffer consists of 25 or 50 mM Hepes (pH 7.5), 50 or 100 mM NaCI, 1 mM CHAPS or 0.02% Pluronic F-127, 0 or 1 mM EDTA, 0 or 1 mM EDTA, 0 or 10% DMSO.
  • the low control, 9 ⁇ L assay buffer only (no enzyme) was added to to column 18, followed by 9 ⁇ L of 3.2 or 11.1 nM enzyme (229e CoV 3CL protease) in assay buffer to columns 1-17, and 19-24.
  • the assay plates were centrifuged for 1 min at 500 or 1000 rpm and incubated at room temperature for 1.5 or 2 hours.
  • a FRET substrate peptide (FAM-VARLQSGFG-TAMRA (SEQ ID NO: 7); AnaSpec) was suspended at 125 ⁇ M concentration in assay buffer or a FRET substrate peptide (HiLyte488-ESATLQSGLRKAK- (QXL520)-NFI2; AnaSpec) (SEQ ID NO: 9) was suspended at 250 ⁇ M concentration in assay buffer and 1 ⁇ L was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 12.5 ⁇ M or added by pipet to a final concentration of 25 ⁇ M.
  • the assay plates were centrifuged for 1 min at 500 or 1000 rpm and incubated at room temperature for 60 minutes for the FAM-TAMRA substrate or read kinetically every 15 seconds for 60 minutes for the HiLyte-QXL substrate.
  • the FAM-TAMRA FRET signal was measured with a PheraSTAR plate reader (BMG LabTech) with excitation at 485 nm and emission at 520 nm and used to quantify the endpoint of the assay for apparent Ki calculations.
  • the HiLyte-QXL FRET signal was measured with a Spectromax M2 plate reader (Molecular Devices) with excitation at 485 nm and emission at 528 nM. Linear rates were determined using the vendor software (Softmax 5.4), exported to Microsoft Excel and used for apparent Ki calculations.
  • Endpoint or rate data from each plate is normalized to fractional activity remaining (vi/vo), i.e. [Net test sample activity (total FLINT counts - average of low control counts)] / [Net DMSO control activity (average of high control FLINT counts - average of low control counts)] and fit to either a four- parameter model for inhibition in GraphPad Prism for endpoint data or a quadratic model for tight binding inhibition in GraFit (Erithacus) for rate data.
  • B uninhibited control
  • C total active enzyme concentration (in M). By default, C is allowed to float during the ABASE initial fitting. If C ⁇ 0, manually apply the constraint where C is fixed to the calculated enzyme concentration (5 x 10 -9 M) or actual active enzyme concentration based on a separate active site titration.
  • Test compound was 3-fold serially diluted in an 11 point curve with a solvent of 100% DMSO, starting from a high concentration of 1.0 mM. Each dilution was transferred in 100 nL volume into black 384-well Greiner (784076) plates yielding a 10 ⁇ M top final concentration in the assay.
  • Low control wells in column 18 (0% response, 100% inhibition) contained 100 nL of DMSO plus buffer, without enzyme.
  • High control wells in column 6 (100% response, 0% inhibition) contained 100 nL DMSO plus buffer and enzyme. Maximum DMSO concentration is approximately 1% throughout the plate.
  • the assay buffer consists of 25 mM Hepes (pH 7.5), 50 mM NaCI, 1 mM CHAPS, and 1 mM EDTA.
  • Assay plate preparation included spinning the plates prior to reaction additions and the addition of 5 ⁇ L assay buffer only (no enzyme) to column 18 (low control — representing 100% inhibition) and 5 ⁇ L of 60 nM enzyme (SARS 3CL protease, 30 nM final concentration) in assay buffer to columns 1-17, and 19-24.
  • FAM-KTSAVLQSGFRKME-TAMRA FAM-KTSAVLQSGFRKME-TAMRA
  • SEQ ID NO: 8 A FRET substrate peptide ( FAM-KTSAVLQSGFRKME-TAMRA) (SEQ ID NO: 8) was suspended at 6 ⁇ M concentration and 5 ⁇ L was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 3 ⁇ M. Reactions were incubated in the dark at room temperature for 60 minutes. At that time the FRET signal was measured with an Envision or equivalent plate reader and used to quantify the endpoint of the assay for apparent EC 50 calculations.
  • the assay buffer consists of 50 mM Hepes (pH 7.5), 100 mM NaCI, 0.02% (w/v) Pluronic F-127, 1 mM DTT, 0% or 0.005% (w/v) fatty acid free BSA, and 1% or 10% (v/v) DMSO.
  • Assay plate preparation included the addition of 9 ⁇ L of 5 nM or 5 ⁇ L of 80 nM enzyme (SARS 3CL protease, 5 or 40 nM final concentration) in assay buffer to columns 1-3. The assay plates were centrifuged for 1 min at 500 or 1000 rpm to mix enzyme and inhibitor and pre-incubated at room temperature for 90, 100 or 180 min.
  • a FRET substrate peptide (HiLyte488-ESATLQSGLRKAK-(QXL520)-NH2; AnaSpec) (SEQ ID NO: 9) was suspended at 400 ⁇ M or 40 ⁇ M concentration in assay buffer and 1 ⁇ L or 5 ⁇ L was added to each reaction well to initiate the reactions with a final reaction concentration of 40 ⁇ M or 20 ⁇ M in a total volume of 10 ⁇ L.
  • the assay plates were centrifuged for 1 min at 500 or 1000 rpm to mix and read in kinetic mode every 10 seconds at room temperature for 45 or 120 minutes.
  • the FRET signal was measured with a Spectromax Gemini, M2 or M5 plate reader (Molecular Devices) with excitation at 485 nm and emission at 528 nM. Linear rates were determined using the vendor software (Softmax 5.4), or exported to Microsoft Excel or GraFit 7.0 (Erithacus) and used for apparent Ki calculations.
  • B uninhibited control
  • C total active enzyme concentration (in M). By default, C is allowed to float during the initial fitting. If C ⁇ 0, manually apply the constraint where C is fixed to the calculated enzyme concentration (5 x 10-9 M or 40 x 10-9 M) or actual active enzyme concentration based on a separate active site titration.
  • Test compound was 1.5-fold serially diluted in a 22 point curve with a solvent of 100% DMSO, starting from a high concentration of 0.5 mM. Each dilution was transferred using an Echo acoustic dispenser in 20 nL volume into black 384-well Greiner (784076) plates yielding a 1 ⁇ M top final concentration and 200 pM low concentration in the assay.
  • the assay buffer consists of 50 mM Hepes (pH 7.5), 100 mM NaCI, 0.02% (w/v) Pluronic F-127,
  • a FRET substrate peptide (HiLyte488-ESATLQSGLRKAK-(QXL520)-NH2; AnaSpec) (SEQ ID NO:
  • B uninhibited control
  • C total active enzyme concentration (in M). By default, C is allowed to float during the ABASE initial fitting. If C ⁇ 0, manually apply the constraint where C is fixed to the calculated enzyme concentration (1 x 10 -8 M) or actual active enzyme concentration based on a separate active site titration.
  • VeroE6 cells kidney epithelial cells extracted from an African green monkey derived from were infected with SARS-1 coronavirus.
  • Compound with anti-viral activity reduced the expression of spike protein as measured immunologically, and cell viability as measured by nuclear integrity.
  • test compound was serially diluted in 100% DMSO with a 3-fold 8- point curve for a top assay concentration of 50 uM.
  • DMSO was normalized in reaction wells to a final concentration of 1%.
  • VeroE6 Cells were treated with compound for 2 hours prior to infection with SARS-CoV1 at an MOI of 1. Virus was allowed to replicate for 48 hours, after which virus was inactivated with formalin. Infected cells were detected by immunostaining with anti-S protein antibodies and quantified by a PE Opera confocal platform. Signal for S protein staining was converted to % infection, and % inhibition was calculated using the positive and negative controls. EC50s were calculated with a standard equation using GeneData software.
  • Table 4 B benzyl N-[(1S)-1- ⁇ [(1S)-1- ⁇ [(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl ⁇ -3-methylbutyl]carbamoyl ⁇ -2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate
  • the viruses and cell lines utilized for these evaluations were obtained from WRCEVA and American Type Culture Collection (ATCC) (followed by sorting and sub-cloning cells for high expression of ACE2) as listed in Table 5 and Table 6, respectively.
  • the evaluation was performed using a CPE reduction assay to measure antiviral effect and a cell viability assay to measure cytotoxic effect of compounds (non-GLP assays). The day of each assay, a pre-titered aliquot of virus was removed from the freezer (-80°C) and allowed to thaw to room temperature in a biological safety cabinet. The virus was re-suspended and diluted into tissue culture medium.
  • Cells were sub-cultured twice a week at a split ratio of 1:2 to 1:5 using standard cell culture techniques and the cell culture media as specified below in Table 6. Total cell number and percent viability determinations were performed using a Luna cell viability analyzer and trypan blue dye exclusion. Cell viability was greater than 95% for the cells to be utilized in the assays (see Table 6 for the number of cells seeded per well for each assay).
  • Compound stock solutions (50 ⁇ L at 10 or 50 mM in 100% DMSO) were transferred into wells of an empty ECFIO plate (stock plate). Compounds were diluted 3-fold by transferring 17 ⁇ L of each sample from the stock plate into an adjacent well containing 34 ⁇ L DMSO in each well and mixing. This process was repeated to create 8 more wells of serially diluted sample, each well containing a 3-fold diluted sample of the previous well. A 30 nL aliquot for each sample was dispensed into corresponding wells of assay ready plates using an ECFI0555 acoustic liquid handling system.
  • the final assay concentration range was as follows: for 10 mM stocks, 10 - 0.0005 ⁇ M; for 50 mM stocks, 50 - 0.003 ⁇ M.
  • DMSO was added to control wells to maintain a consistent assay concentration of 0.1% in all wells.
  • Vero E6 cells were grown in MEM supplemented with 10% HI FBS and harvested in MEM/1% PS supplemented 2% HI FBS on the day of assay.
  • Assay ready plates pre-drugged with test compounds were prepared in the BSL-2 lab by adding 5 ⁇ L assay media to each well. The plates and cells were then passed into the BSL3 facility. Cells were batch inoculated with appropriate coronavirus (SARS CoV-1, SARS CoV-2 or MERS) at M.O.I. ⁇ 0.002 which resulted in 5% cell viability 72 (for SARS) or 96 (for MERS) hours post infection.
  • coronavirus SARS CoV-1, SARS CoV-2 or MERS
  • a 25 ⁇ L aliquot of virus inoculated cells (4,000 Vero E6 cells/well) was added to each well in columns 3-24 of the assay plates.
  • the wells in columns 23-24 contained only virus infected cells for the 0% CPE reduction controls.
  • Prior to virus inoculation a 25 ⁇ L aliquot of cells was added to columns 1-2 of each plate for the cell only 100% CPE reduction controls.
  • 30 ⁇ L of Cell Titer-Glo (Promega) was added to each well.
  • Luminescence was read using a Perkin Elmer Envision plate reader following incubation at room temperature for 10 minutes to measure cell viability. Plates were sealed with a clear cover and surface decontaminated prior to luminescence reading.
  • Method for measuring cytotoxic effect of compounds Compound cytotoxicity was assessed in a BSL-2 counter screen as follows: VeroE6 cells in media were added in 25 ⁇ l aliquots (4,000 cells/well) to each well of assay ready plates prepared with test compounds as above. Cells only (100% viability) and cells treated with hyamine at 100 ⁇ M final concentration (0% viability) serve as the high and low signal controls, respectively, for cytotoxic effect in the assay. DMSO was maintained at a constant concentration for all wells as dictated by the dilution factor of stock test compound concentrations. After incubating plates at 37°C/5%CO2 and 90% humidity for 72 hours, 30 ⁇ l Cell Titer-Glo (Promega) was added to each well. Luminescence was read using a BMG PHERAstar plate reader following incubation at room temperature for 10 minutes to measure cell viability. RESULTS - Section C
  • Table 14 shows the comprehensive data from all four assays.
  • HBE cells are isolated from the trachea regions as well as the upper bronchus. If possible, branches are isolated that are approximately 2mm. All cells are all pooled together during these isolations.
  • Resulting cells are grown on a porous support at an air-liquid interface undergo mucociliary differentiation, which reproduces both in vivo morphology and key physiologic processes in the cells.
  • the ALI assay was used as another means to evaluate the antiviral activity of the test compounds described herein against SARS-CoV-2, using essentially the protocol for evaluating SARS-CoV infection as described by Sims, A. C. et al. in J. Virol(Dec 2005), vol. 79 (24), p.
  • 15511-15524 (“Severe Acute Respiratory Syndrome Coronavirus Infection of Human Ciliated Airway Epithelia: Role of Ciliated Cells in Viral Spread in the Conducting Airways of the Lungs"), 0022- 538X/2017$08.00+0 doi:10.1128/JVI.79.24.15511-15524.2005.
  • Prmary lung cells (Marsico Lung Institute) were cultured essentially as described by Randell and Fulcher, and infected wih SARS-CoV-2 essentially as described by Sims et al., with a MOI of 0.5.
  • DMSO dimethylsulfoxide
  • Results are shown in FIG. 1.
  • Compound A shows antiviral activity comparable to 10 ⁇ M remdesivir (RDV in FIG. 1) at concentrations of 3.3, 10 and 30 ⁇ M, with measurable antiviral activity also seen at 1.1 ⁇ M GSKE).
  • Test compound was tested via cellular assays utilizing expression of coronavirus N protein and cell nuclei as end points for imaging (indicators of efficacy and toxicity respectively).
  • Calu3 cells ATCC, FITB- 55
  • SARS-CoV-2 coronavirus ⁇ CoV/KOR/KCDC03/2020
  • Compound with anti-viral activity reduced the expression of N protein, shown below, as measured immunologically.
  • DRCs dose-response curves
  • Calu-3 cells were seeded at 2.0 x 10 4 cells per well in Eagle's Minimum Essential Medium (EMEM, ATCC) supplemented with 20% heat-inactivated fetal bovine serum (FBS), 1% MEM-Non-Essential Amino Acid solution (Gibco) and 1X Antibiotic-Antimycotic solution (Gibco) in black , 384-well, ⁇ CIear plates (Greiner Bio-One) 24 hours before the experiment. The cells were maintained at 37°C with 5% CO 2 .
  • EMEM Eagle's Minimum Essential Medium
  • FBS heat-inactivated fetal bovine serum
  • Gibco MEM-Non-Essential Amino Acid solution
  • Gabco 1X Antibiotic-Antimycotic solution
  • the cells were treated with test compound at concentrations ranging from 0.0025 to 50 ⁇ M for 1 to 48 hours prior to infection with SARS-CoV-2 at an MOI of 0.03.
  • DMSO was normalized in reaction wells to a final concentration of 0.5%.
  • the plates were incubated at 37°C for 24 hours before fixing with 4% paraformaldehyde (PFA), 0.25% tritonX-100 solution.
  • PFA paraformaldehyde
  • Imaging Plates were imaged using the ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) with a 10x objective, with 4 fields imaged per well. Images were analyzed using the Multi-Wavelength Cell Scoring Application Module (MetaXpress), with DAPI staining identifying the host- cell nuclei (the total number of cells in the images) and the SARS-CoV-2 immunofluorescence signal leading to identification of infected cells.
  • MethodaXpress Multi-Wavelength Cell Scoring Application Module
  • Uninfected host cell cytotoxicity counter screen Compounds were acoustically transferred into 1,536-well ⁇ clear plates (Greiner Part. No. 789091). HeLa-ACE2 cells were maintained as described for the infection assay and seeded in the assay-ready plates at 400 cells/well in DMEM with 2% FBS. Plates were incubated for 24 hours at 37°C 5% CO 2 . To assess cell viability, the Image-iT DEAD green reagent (Thermo Fisher) was used according to manufacturer instructions. Cells were fixed with 4% paraformaldehyde, and counterstained with DAPI. Fixed cells were imaged using the ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) with a 10x objective, and total live cells per well quantified in the acquired images using the Live Dead Application Module (MetaXpress).
  • Compounds were acoustically transferred into 384-well ⁇ clear-bottom plates (Greiner, Part. No. 781090-2B) before seeding Calu-3 cells in assay media (MEM with 2% FBS) at a density of 5,000 cells per 20 ⁇ L per well.
  • the plated cells were transported to the BSL3 facility where SARS-CoV-2 (strain USA- WAl/2020 propagated in Vero E6 cells) diluted in assay media was added at an MOI between 0.75 and 1 to achieve ⁇ 30 - 60% infected cells. Plates were incubated for 48 h at 34°C 5% CO 2 , and then fixed with a final concentration of 4% formaldehyde.
  • Imaging Plates were imaged using the ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) with a 10x objective, with 4 fields imaged per well. Images were analyzed using the Multi-Wavelength Cell Scoring Application Module (MetaXpress), with DAPI staining identifying the host- cell nuclei (the total number of cells in the images) and the SARS-CoV-2 immunofluorescence signal leading to identification of infected cells.
  • MethodaXpress Multi-Wavelength Cell Scoring Application Module
  • Curves were fitted as either increasing or decreasing and noted as such in the data output. This is of particular note for the cell count readout from the SARS-CoV-2 infection assay which captured both an antiviral effect, protection from virus-induced cell death (increasing), and cellular toxicity (decreasing). HeLa-ACE2 cells were infected with SARS-CoV-2 virus at a MOI of between 0.3-0.5 in the presence of test compounds, and viral infection was quantified 24 hours later.
  • Immunofluorescent (IF) detection of SARS-CoV-2 proteins with sera purified from patients exposed to the virus was used as the efficacy endpoint of antiviral activity of test compounds, which together with host cell nuclear staining allowed for quantification of the percent infected cells in each well and calculation of IC 50 values.
  • MRC-5 or Huh7 cells will be seeded at an appropriate density and cultured at 37°C and 5% CO 2 overnight.
  • the medium in each well will be replenished with medium containing serially diluted compounds (8 doses, in duplicate wells) and virus.
  • the resulting cultures will be kept under at 33 °C and 5% CO 2 for additional 4 days (MRC5) or 7 days (Huh7). Endpoint measured will be cytopathic effect of the virus.
  • Cytotoxicity of compounds will be assessed under the same conditions, but without virus infection, in parallel. Cell viability will be measured with CellTiter Glo (Promega) following the manufacturer's manual. For qPCR assays, the supernatants will be collected. Viral RNA will be extracted and quantified by the absolute RT-qPCR assay. EC 50 and CC 50 values will be calculated with the GraphPad Prism software. Samples will be run alongside a remdesivir reference compound.
  • MRC-5 will be seeded at an appropriate density and cultured at 37°C and 5% CO 2 overnight.
  • the medium in each well will be replenished with medium containing serially diluted compounds (8 doses, in duplicate wells) and virus.
  • the resulting cultures will be kept under at 35 °C and 5% CO 2 for additional 3 days.
  • Cytotoxicity of compounds will be assessed under the same conditions, but without virus infection, in parallel. Cell viability will be measured with CellTiter Glo (Promega) following the manufacturer's manual. For qPCR assays, the supernatants will be collected. Viral RNA will be extracted and quantified by the absolute RT-qPCR assay. EC 50 and CC 50 values will be calculated with the GraphPad Prism software. Samples will be run alongside a remdesivir reference compound.
  • VeroE6 cells were cultivated biweekly 1:4-1 :5 passage in filtered (0.22 ⁇ m) DMEM (Gibco) supplemented with 10% FBS (Gibco, Origin Brazil) and Penicillin/Streptomycin (Sigma) 1% (assay Media), using PBS (Gibco) and trypsin (Gibco) to detach.
  • Virus SARS Cov 2 NY isolate
  • MDR1 inhibitor Elacridar was synthesized internally and stocks prepared to 10 mM final concentration in DMSO.
  • Vero E6 cells were detached using 4mL of trypsin during 5 min for T175 cm 2 FLASK, neutralized using 16 mL of assay media, centrifuged and resuspend in assay media 10 mL /Flask 50 ⁇ L of cells were added to 10 mL CASYTON contained in a CASYCUP and cells were counted in CASY system, measuring cells number between 8 and 25 ⁇ m.
  • a cell solution with a final cell concentration of 2e5 cells/ml was prepared.
  • Virus was taken from the freezer following the established work protocol for a BSL3 facility and thawed at RT.
  • a -4 virus dilution was prepared adding 1 ⁇ L of virus stock per 10mL of assay media.
  • Control 2 was prepared adding the same volume of assay media and cells to a final concentration of 1 e5 cells/mL, and Elacridar (MDR1 inhibitor) was added to a final concentration of 1 ⁇ M.
  • Test compounds were serially diluted in a 10 point curve. Plates for the assay contained a serial dilution of test compounds from columns 1 to 10 to allow testing at final concentrations between 50 uM and 0.0025 uM.
  • Control 1 was prepared adding cells and virus in 1:1 proportion (veroE6 final concentration le5 cells/mL; virus 0.5 ⁇ L from stock to 10 mL of final solution), and Elacridar (MDR1 inhibitor) to a final concentration of 1 ⁇ M.
  • Control 2 solution was dispensed to column 12 in predispensed 96 well plates (Costar 3399) using Multidrop combi (speed slow).
  • Control 1 solution was dispensed to columns 1 to 11 in predispensed 96 well plates (Costar 3399) using Multidrop combi (speed slow).
  • Plates were incubated at 5%C02, 37°C for 3 days, following requirement of a BSL3 lab.
  • Vero E6 cells were detached using 4 mL of trypsin during 5 min for T175 cm 2 FLASK, neutralized using 16 mL of assay media, centrifuged and resuspend in assay media 10 mL /Flask.
  • a cell solution with a final cell concentration of 2e5 cells/ml was prepared.
  • Virus was taken from the freezer following the established work protocol for a BSL3 facility and thawed at RT.
  • a -3 virus dilution was prepared adding 1 ⁇ L of virus stock per 1 mL of assay media.
  • Control 2 was prepared adding the same volume of assay media and cells to a final concentration of 1 e5 cells/mL, and Elacridar (MDR1 inhibitor) was added to a final concentration of 1 ⁇ M.
  • Test compounds were serially diluted in a 10 point curve. Plates for the assay contained a serial dilution of test compounds to allow testing at final concentrations between 50 uM and 0.0025 uM.
  • Control 1 was prepared adding cells and virus in 1:1 proportion (veroE6 final concentration le5 cells/mL; virus 0.5 ⁇ L from stock to 1 mL of final solution), and Elacridar (MDR1 inhibitor) to a final concentration of 1 ⁇ M.
  • Control 2 solution 50 ⁇ L Control 2 solution was dispensed to column 18 in predispensed 384 well plates (Greiner 781091) using Multidrop combi (speed slow).
  • Control 1 solution 50 ⁇ L Control 1 solution was dispensed to columns 1 to 17 and 19 to 24 in predispensed 384 well plates (Greiner 781091) using Multidrop combi (speed slow).
  • the demonstrated activity in cells demonstrate cellular penetration by the compound.
  • Applicant also performed a comparison of the coding nucleotide sequence and amino acid sequence of the 3-CL protease from 44 severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) strains. These were collected from diverse geographical locations including China, Hong Kong, Australia, Japan (some cruise ship subjects) and USA (15 strains). This showed that the 3CL Protease is 100 % identical across all strains at both nucleotide and amino acid levels.
  • SARS-CoV-2 severe acute respiratory syndrome coronavirus 2
  • SEQ ID NO:l N1 forward primer 5' GACCCCAAAATCAGCGAAAT 3'
  • SEQ ID NO:2 N1 reverse primer 5' TCTGGTTACTGCCAGTTGAATCTG 3' SEQ ID NO: 3: N1 Probe Sequence
  • SEQ ID NO: 4 N2 forward primer 5' TTACAAACATTGGCCGCAAA 3'
  • SEQ ID NO: 5 N2 reverse primer 5' GCGCGACATTCCGAAGAA 3'
  • SEQ ID NO: 7 FRET substrate peptide for coronavirus OC43 3CL and 229E protease enzyme assays
  • SEQ ID NO: 8 FRET substrate peptide for SARS coronavirus 3CL protease enzyme assay

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Otolaryngology (AREA)
  • Communicable Diseases (AREA)
  • Pulmonology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Dermatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present disclosure relates to a 3C-Like (3CL) protease inhibitor for use in the treatment or prevention of COVID-19. In particular embodiments, COVID-19 is associated with pneumonia or acute respiratory distress disorder. In other aspects, the patient is undergoing extra-corporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, receiving oxygen therapy or receiving antiviral or steroid treatment.

Description

TRIPEPTIDES DERIVATIVES FOR TREATING SARS-COV-2 INFECTIONS
SEQUENCE LISTING
A sequence listing filed herewith, entitled PU66900WO_SEQ_LIST_ST25 created March 24, 2021, 2 KB in size, is hereby incorporated by reference herein in its entirety.
FIELD OF THE INVENTION
The present disclosure relates to a 3C-Like (3CL) protease inhibitor for use in the treatment or prevention of COVID-19.
BACKGROUND TO THE INVENTION
COVID-19 was declared a Public Health Emergency of International Concern on 30 January 2020, following its emergence in China in December 2019. At the time of writing, over 21,689,800 cases and 770,273 deaths have been reported globally.
The infectious agent has been identified as a coronavirus (initially designated 2019-nCoV2 and more recently designated SARS-CoV-2 (also referred to as SARS-CoV2 and SARS-CoV-2), Severe Acute Respiratory Syndrome CoronaVirus-2) capable of spreading by human to human transmission. Other coronaviruses that are pathogenic to humans are associated with mild clinical symptoms, with two notable exceptions: severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV, SARS-CoV1 or SARS-CoV- 1) and Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV).
Coronaviruses consist of an enveloped single strand positive sense RNA genome of 26 to 32 kb in length. They are classified by phylogenetic similarity into four categories: α (e.g. 229E and NL-63), β (e.g. SARS-CoV-2 , SARS-CoV, MERS-CoV, HKU1, and OC43), γ and δ. SARS-CoV-2 has also been reported to have 79% sequence identity to SARS-CoV-1, however certain regions of the SARS-CoV-2 genome exhibit greater or lesser degrees of conservation to SARS-CoV-1.
Coronaviruses utilise membrane bound spike proteins to bind to a host cell surface receptor to gain cellular entry. Following entry into the host cell, the RNA genome is translated into two large polypeptides by the host ribosomal machinery and several smaller polypeptides. The two large polypeptides are processed by two proteases, the coronavirus main proteinase (3C-Like) and the papain- like proteinase to generate the proteins required for viral replication and packaging.
By mid 2020, 48, 635 coronavirus genomes of SARS-CoV-2 from around the world had been analysed (Daniele Mercatelli, Federico M. Giorgi. Geographic and Genomic Distribution of SARS-CoV-2 Mutations. Frontiers in Microbiology, 2020; 11 DOI: 10.3389/fmicb.2020.01800). By early 2021 over 400,000 genomes were available on the Global Initiative on Sharing Avian Influenzae Data (GISAID), an open-access global collection of viral genomic data. All mutations were analzed and annotated with reference to the Wuhan genome (NC_045512.2) which has been designated the L strain or clade. Several clades (strains) have been identified which are designated L (original strain from Wuhan), S (named after the L to S amino acid change - the ORF8:L84S mutation), G (named after the D to G amino acid change in the Spike protein - the S:D614G mutation), V (named after the G to V amino acid change - the ORF3a:G251V mutation), and 0 (sequences not matching any of these criteria for the other clades). Clade G comprises two derivative clades, GH (characterized by the ORF3a:Q57FI mutation) and GR (having a N:RG203KR mutation). Generally, clades G and GR are prevelant in Europe, and clades S and GH have been mostly observed in the Americas. The L clade is mostly represented by sequences from Asia. At present, clades G and its derivatie offspring clades GH and GR are the most common among the sequences SAR-CoV-2 genomes, accounting for 74% of all world sequences, globally. The GR clade, having both the Spike D614G and Nucleocapsid RG203KR mutations, is the most common representative of the SARS-CoV-2 genome population worldwide. The original viral strain, clade L, continues to account for 7% of the sequenced genomes, and clades S and V have similar frenquencies in the global dataset of sequences. For a somewhat different assessment of SARS-CoV-2 clades, see Li, T., Liu, D., Yang, Y. et al. Phylogenetic supertree reveals detailed evolution of SARS-CoV-2. Sci Rep 10, 22366 (2020). https://doi.org/10.1038/s41598-020-79484-8.
Although several groups have confirmed the relatively low variability of SARS-CoV-2 genomes, it is not clear if the different fatality rates or speed of transmission observed within different countries is related to differences in transmissibility and virulence between different clades. Several new variants have recently emerged in the UK (201/501Y.V1/B.1.1.7), South Africa (20H/501Y.V2/B.1.351), Brazil (P.1/20J/501Y.V3/B.1.1.248) and a novel variant in California descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, ORF1b:D1183Y, S:S13I; W152C; L452R) and designated CAL.20C (20C/S;452R;B.1.429).
SUMMARY OF THE INVENTION
In a first aspect, the invention provides a compound which is benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, for use in the treatment or prevention of COVID-19.
The invention also provides use of benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}- 2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment or prevention of COVID-19.
In one embodiment, the subject is infected with SARS-CoV-2 . Methods for identifying subjects infected with SARS-CoV-2 are known in the art and are in current clinical use, including in vitro detection of viral proteins (antigens) using an antibody to SARS-CoV-2, and use of real-time reverse- transcription polymerase-chain reaction for detection of SARS-CoV-2 genetic material. In one embodiment, high-throughput sequencing or real-time reverse-transcriptase polymerase-chain-reaction (RT-PCR) assay of specimens, for example, nasal and pharyngeal swab specimens, may be used to identify subjects with active SARS-CoV-2 infection. In one embodiment, SARS-CoV-2 antigens such as SARS-CoV-2 surface protesin, are detected by collecting a sample of mucus from the back of a subject's throat or nose using a swab, or taking a small drop of blood from a patient, and using a rapid diagnostic test (RDT) based on lateral flow immunoassay (LFIA) to identify subjects with active SARS-CoV-2 infection.
The invention also provides a method of treatment of a subject with COVID-19 with a therapeutically effective amount of a compound selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}- 2-(4,4-difluoropiperidin-1-yl )ethyl]ca rba mate, or a pharmaceutically acceptable salt thereof. In one embodiment, the subject is a human.
In addition, the invention provides a method for identifying subjects to be treated in accordance with the methods described herein, the method comprising a step of assaying a specimen from a subject for the presence of SARS-CoV-2 RNA. In some embodiments, the method is capable of identifying L strain SARS-CoV-2 RNA, S strain SARS-CoV-2 RNA, G strain SARS-CoV-2 RNA, GH strain SARS-CoV-2 RNA, GR strain SARS-CoV-2 RNA, V strain SARS-CoV-2 RNA, or 0 strain SARS-CoV-2 RNA. In some embodiments, where SARS-CoV-2 RNA is detected, the method may further comprises a treatment step as described herein.
In specific embodiments, the invention provides treatment for particular populations of patients with COVID-19, for example a patient or subject infected with SARS-CoV-2 i.e. a patient or subject who test positive to SARS-Co-2, a patient or subject in a high risk category and a patient or subject with a secondary condition. In particular embodiments, the patient or subject has pneumonia or acute respiratory distress disorder. In additional embodiments, the patient or subject is additionally undergoing extra-corporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, receiving oxygen therapy or receiving antiviral or steroid treatment.
In one embodiment, the uses and methods described herein are for treatment of a patient infected with a strain (clade) of SARS-CoV-2 selected from the L strain (clade), the S strain (clade), the G strain (clade), the GH strain (clade), the GR strain (clade), the V strain (clade) or the O strain (clade) of SARS-CoV-2.
In one embodiment, the uses and methods described herein are for treatment of a patient infected with the L strain (clade) of SARS-CoV-2 or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the S strain (clade) of SARS- CoV-2, or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the G strain (clade) of SARS-CoV-2, or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the GH strain (clade) of SARS-CoV-2, or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the GR strain (clade) of SARS-CoV-2, or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the V strain (clade) of SARS-CoV-2, or a variant thereof. In another embodiment, the uses and methods described herein are for treatment of a patient infected with the O strain (clade) of SARS-CoV-2, or a variant thereof. In a particular embodiment the uses and methods described herein are for treatment of a subject infected with a variant of SARS-CoV-2, including the UK variant (201/501Y.V1/B.1.1.7), the South Africa variant (20H/501Y.V2/B.1.351), the Brazil variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, ORF1b:D1183Y, S:S13I; W152C; L452R) and designated CAL.20C (20C/S;452R;B.1.429).
In another embodiment, the subject is not infected with SARS-CoV-2 such that the use is for prevention of COVID-19. Subjects suitable for such prophylactic use include subjects in high risk categories, health care professionals and close contacts of subjects infected with SARS-CoV-2 .
DESCRIPTION OF FIGURES
Fig. 1 shows an air-liquid interface (ALI) culture with primary human lung cells infected with SARS-CoV- 2 and treated with Compound A (Compound A is GSKE in Fig. 1) for 48 hr, at concentrations of 0.04, 0.12, 0.37, 1.1, 3.3, 10 and 30 μM compound, compared to controls including redemsivir (RDM), solvent (DMSO) and solvent + virus.
DETAILED DESCRIPTION OF THE INVENTION
DEFINITIONS
"SARS-CoV-2" is a beta coronavirus having greater than 90% sequence identity at the RNA level with any one of the sequences deposited in the China National Microbiological Data Centre under accession number NMDC10013002, or greater than 90% sequence identity at the RNA level with any one of the sequences deposited in the Global Initiative on Sharing All Influenza Data (GISAID) under reference NC_045512.2 SARS-CoV-2 Wuhan genome (Coronaviridae Study Group of the International Committee on Taxonomy of Viruses, 2020). In another embodiment, the SARS-CoV-2 coronavirus has greater than 95% sequence identity at the RNA level with any one of the sequences deposited in the China National Microbiological Data Centre under accession number NMDC10013002 or with reference NC_045512.2 SARS-CoV-2 Wuhan genome (GISAID). In other embodiments, the SARS-CoV-2 coronavirus has greater than 96% sequence identity, greater than 97% sequence identity, greater than 98% sequence identity or greater than 99% sequence identity at the RNA level with any one of the sequences deposited in the China National Microbiological Data Centre under accession number NMDC10013002 or with reference NC_045512.2 SARS-CoV-2 Wuhan genome (GISAID). The definition of SARS-CoV-2 is intended to cover all strains of SARS-CoV-2 including the L, S, G, GH, GR, V and 0 clades, as well as recent variants thereof, including the UK variant (201/501Y.V1/B.1.1.7), the South Africa variant (20H/501Y.V2/B.1.351), the Brazil variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, ORF1b:D1183Y, S:S13I; W152C; L452R) and designated CAL.20C (20C/S;452R;B.1.429). As defined, S clade has a T at position 8782 and a C at position 28144; L clade has a C at position 8782 and a T at position 28144; G clade has a G at position 23403 (A23403G); GH clade has a T at position 25563 (G25563T); GR clade has a AAC for GGG starting at position 28881 (GGG28881AAC); clade V has a T at position 26144 (ORG2a:G251V); and O has sequence variations and mutations not defined by clades L, S, G, GH, GR or V, with numbering relating to the reference genome of 2019-nCoV-2 (NC_045512). Of note, the actual RNA base in the SARS-CoV-2 genome is U - uracil - but to be consistent with the original NCBI NC_045512.2 reference genomic notation, T is used here to characterize the genetic events. The definition of SARS-CoV-2 also encompasses SARS-CoV-2 clades that have amino acid changes for clade S (ORF8:L84S mutation), clade G (S:D614G mutation), clade GH (ORF3a:Q57H mutation), clade GR (both S:D614G and N:RG203KR mutations), clade V (ORF3a:G251V mutation), and clade O (sequences and mutations not matching any of these criteria for the other clades), as well as other emerging variants descended from the clades defined above.
"COVID-19" refers to the collection of symptoms (e.g. https://www.cdc.gov/coronavirus/2019- ncov/symptoms-testing/symptoms.html) exhibited by patients infected with any strain or clade of SARS- CoV-2 . Symptoms typically include cough, fever and shortness of breath (dyspnoea), although some patients are asymptomatic, in which case COVID-19 refers to SARS-CoV-2 infection alone.
"Secondary condition associated with COVID-19" or "secondary conditions associated with COVID019" means any one or more of a myriad of symptoms associated with COVID-19 including but not limited to fever; chills; cough; shortness of breath; difficulty breathing; fatigue; muscle ache; body ache; headache; chest pain; pink eye (conjunctivitis); rash; loss of taste, loss of smell; sore throat; congestion; runny nose; nausea; vomiting; diarrhea; heart palpitations; racing heartbeat; Takotsubo cardiomyopathy; light-headedness; feeling faint; brain fogginess; numbness in fingers, hands, feet, limbs; tingling sensation in the body; postural orthostatic tachycardia syndrome (POTS); less effective blood pumping; inflammation of the heart; inflammation of the membrane around the heart; blood clots; and neurological symptoms.
"Treatment of COVID-19" refers to a reduction in the viral load of SARS-CoV-2 and/or to a reduction in the viral titre of SARS-CoV-2 , and/or to a reduction in the severity or duration of the symptoms of the disease. Viral load may be measured by a suitable quantitative RT-PCR assay or a suitable qualitative diagnostic test such as a RDT based on LFIA performed on a specimen from the patient. In one embodiment, the specimen may be a specimen from the upper or lower respiratory tract (such as a nasopharyneal or oropharyngeal swab, sputum, lower respiratory tract aspirates, bronchoalveolar lavage, bronchial biopsy, transbronchial biopsy and nasopharyngeal wash/spirate or nasal aspirate) saliva or plasma. In a particular embodiment the specimen is mucous. In a more particular embodiment, the specimen is saliva. The protocols of a number of quantitative RT-PCR assays are published on https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical- guidance/laboratory-guidance. In addition, Corman and colleagues have published primers and probes for use in such assays (Corman et al., European communicable disease bulletin, 2020, DOI: 10.2807/1560- 7917). In one embodiment, the COVID-19 RdRp/Hel assay is used. This has been validated with clinical specimens and has a limit of detection of 1.8 TCID50/mL with genomic RNA and 11.2 RNA copies/reaction with in vitro RNA transcripts. (Chan et al., J Clin Microbiol., 2020, doi:10.1128/JCM.00310-20). Viral titre may be measured by assays well known in the art.
In one embodiment, treatment of COVID-19 refers to at least a 5 fold, 10 fold, 50 fold, 100 fold, 500 fold or 1000 fold reduction in the viral load (RNA copies/ml) measured by the same assay from a specimen from the same origin taken prior to treatment (baseline) and the end of the treatment period in a single patient. In one embodiment, treatment of COVID-19 refers to a greater than 0.5 log unit reduction in viral load. In another embodiment, treatment of COVID-19 refers to the situation where the mean viral load (RNA copies/ml) from specimens of the same origin from 30 patients measured in the same assay being reduced by at least 5 fold, 10 fold, 50 fold, 100 fold, 500 fold or 1000 fold at the end of the treatment period compared to baseline.
In one embodiment, treatment of COVID-19 refers to a clinical improvement in signs and symptoms, as evidenced by patient vitals, patient self-reporting, and clinical observations.
In one embodiment, treatment of COVID-19 refers to the viral load being decreased to below the limit of detection of the 19 RdRp/Hel assay at the end of the treatment period.
"Prevention of COVID-19" is interpreted in accordance with the usual meaning of the word "prevent".
"High risk" subjects and "high risk" categories include the following: subjects of 60 years of age and over; subjects with a body-mass index (BMI) ≥ 35; smokers, subjects having a chronic medical condition including heart disease, lung disease, diabetes, cancer or high blood pressure; immunocompromised subjects such as subjects undergoing treatment for cancer or autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis and inflammatory bowel disease, subjects having a transplant and HIV positive individuals, including persons living in a community residence such as a dormatory, assisted living facility, nursing home, rehabilitation center and the like, persons having attended a gathering of 10, 25, 50, 100, 500, 1000 or more people not separated by feet (2 meters) or not separated by ~3 feel; (1 meter) and/or not protected by a face mask or shield, and persons having travelled to, from or through a region with high levels of SARS-CoV-2 and CGVID-19 cases.
"Close contacts" and "Close contacts of a subject infected with SARS-CoV-2" are defined as (i) persons living in the same household as the infected subject; (ii) persons having had direct or physical contact with the infected subject; (iii) persons having remained within two metres of an infected subject for longer than 15 minutes on or after the date on which symptoms were first reported by the subject, or for an a asymptomatic subject, in the 2 days prior to test specimen collection.
IDENTIFICATION OF SUBJECTS INFECTED WITH SARS-CoV-2
Subjects infected with SARS-CoV-2 may be identified by detection of viral RNA from SARS-CoV-2 from a specimen obtained from the subject. Without intending to be limiting, the specimen may be a specimen from the upper or lower respiratory tract (such as a nasopharyneal or oropharyngeal swab, sputum, lower respiratory tract aspirates, bronchoalveolar lavage and nasopharyngeal wash/spirate or nasal aspirate). Any known methods of RNA detection may be used, such as high-throughput sequencing or real-time reverse-transcriptase polymerase-chain-reaction (RT-PCR) assay. In one embodiment, the method comprises the following steps: a) Isolating RNA from a specimen; b) Reverse transcription of the RNA; c) Amplification with forward and reverse primers in the presence of a probe; and d) Detection of the probe; wherein the presence of SARS-CoV-2 is confirmed if the cycle threshold growth curves cross the threshold within 40 cycles.
In a more particular embodiment, step c) utilises the following:
Fwd Primer 5' GACCCCAAAATCAGCGAAAT 3' (SEQ ID NO: 1)
Rev Primer 5' TCTGGTTACTGCCAGTTGAATCTG 3' (SEQ ID NO: 2)
Probe 5' FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ-1 3' (SEQ ID NO: 3)
In an alternative embodiment, step c) utilises the following:
Fwd Primer 5' TTACAAACATTGGCCGCAAA 3' (SEQ ID NO: 4)
Rev Primer 5' GCGCGACATTCCGAAGAA 3' (SEQ ID NO: 5)
Probe 5' FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ-1 3' (SEQ ID NO: 6)
These primers and probes are commercially available from Integrated DNA Technologies (Catalogue No. 10006606) and BioSearch Technologies (Catalogue No. KIT-nCoV-PP1-1000). Detailed instructions for performing real-time reverse-transcriptase polymerase-chain-reaction (RT-PCR) assay using these primers has been published by the CDC (https://www.cdc.gov/coronavirus/2019- nCoV/lab/index.html).
Accordingly, in one embodiment, the invention comprises a method for treating COVID-19 in a subject comprising a method of detecting viral RNA from SARS-CoV-2 from a specimen obtained from the subject and, where viral RNA is detected, a step of treating COVID-19 as described herein.
In one aspect, the invention provides a method for testing for SARS-CoV-2 in a subject and treating SARS-CoV-2 infection in the subject, which method comprises the following steps: a) Isolating RNA from a specimen derived from a subject; b) Reverse transcription of the RNA; c) Amplification with forward and reverse primers in the presence of a probe; and d) Detection of the probe; wherein the subject is defined as having SARS-CoV-2 infection if the cycle threshold growth curves cross the threshold within 40 cycles; and e) treating the subject having SARS-CoV-2 infection with a therapeutically effective amount of a compound selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}- 2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof. In specific embodiments of this method, the subject is human, and the specimen and/or the primers and probe are as described above. The treatment may also be conducted as described herein.
In some embodiments, the method of identification of subjects infected with SARS-CoV-2 is capable of identifying whether the subject is infected with L strain SARS-CoV-2 RNA, S strain SARS-CoV- 2 RNA, G strain SARS-CoV-2 RNA, GH strain SARS-CoV-2 RNA, GR strain SARS-CoV-2 RNA, V strain SARS-CoV-2 RNA, or 0 strain SARS-CoV-2 RNA. The method described herein could include a further step of sequencing amplified cDNA to identify whether the subject is infected with S strain, L strain, G strain, GH strain, GR strain, V strain or 0 strain, as well as a further step to identify whether the subject is infected with a variant thereof, including the UK variant (201/501Y.V1/B.1.1.7), the South Africa variant (20H/501Y.V2/B.1.351), the Brazil variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, ORF1b:D1183Y, S:S13I; W152C; L452R) and designated CAL.20C (20C/S;452R;B.1.429).
In an alternative embodiment, subjects infected with SARS-CoV-2 may be identified by detection of an SARS-CoV-2 antigen or subject antibodies directed to SARS-CoV-2 in a sample of blood or mucous taken from the subject. In one embodiment, subjects infected with SARS-CoV-2 may be identified by detection of an SARS-CoV-2 antigens in a sample of blood or mucous taken from the subject. Any suitable assay may be used. Kits for conducting such serological assays are already commercially available, e.g. from Biomerica and Pharmact. Details of performance of authorised serology tests is available on https://www.fda.gov/medical-devices/coronavirus-disease-2019-covid-19- emergency-use-authorizations-medical-devices/eua-authorized-serology-test-performance.
In one embodiment, the assay to identify subjects infected with SARS-CoV-2 comprises: a) contacting at least one immobilised antigen from SARS-CoV-2 with blood from the subject; and b) detection of a complex formed between subject antibodies directed to the immobilised antigen and the immobilised antigen; where the the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b).
In a particular embodiment of this assay, the antigen from SARS-CoV-2 is selected from the N- protein and the S protein or fragments thereof. In a more particular embodiment, the the antigen from SARS-CoV-2 is selected from the N-protein, the SI domain of the S protein and the S2 domain of the S protein. In one embodiment, the assay comprises more than one immobilised antigen.
In one embodiment, there is a step of washing the immobilised antigen after step a) and before step b).
In one embodiment, the detection step b) comprises contacting the complex formed with a labelled antibody or antibodies recognising the same antigen or antigens followed by detection of the label. In a more particular embodiment, the complex is washed after addition of labelled antibody(ies) prior to detection of the label.
In one embodiment, the label is capable of producing a coloured product, enabling visual detection of the label.
In one embodiment, the assay is a lateral flow assay. In more particular embodiment, the lateral flow assay has the immobilised antigen(s) on a dipstick.
In one embodiment, the invention provides a method for testing for SARS-CoV-2 in a subject and treating SARS-CoV-2 infection in the subject, which method comprises the following steps: a) contacting at least one immobilised antigen from SARS-CoV-2 with blood from the subject; and b) detecting a complex formed between subject antibodies directed to the immobilised antigen and the immobilised antigen; where the the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b); and c) treating the subject having SARS-CoV-2 infection with a therapeutically effective amount of a compond selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}- 2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof. In specific embodiments of this method, the subject is human, and the assay is conducted as as described above. The treatment may also be conducted as described herein.
In one embodiment, the assay to identify subjects infected with SARS-CoV-2 comprises: a) contacting an immobilised antibody recognising an antigen from SARS-CoV-2 with blood from the subject; and b) detection of a complex formed between an antigen from SARS-CoV-2 and the immobilised antibody recognising said antigen; where the the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b). In a particular embodiment of this assay, the antigen from SARS-CoV-2 is selected from the N-protein and the S protein or fragments thereof. In a more particular embodiment, the the antigen from SARS-CoV-2 is selected from the N-protein, the SI domain of the S protein and the S2 domain of the S protein. In one embodiment, the assay comprises more than one immobilised antibody, each antibody recognising a different antigen.
In one embodiment, there is a step of washing the immobilised antibody after step a) and before step b).
In one embodiment, the detection step b) comprises contacting the complex formed in step a) with labelled antibodies recognising the same antigen or antigens followed by detection of the label. In a more particular embodiment, step b) comprises a step of washing prior to detection of the label.
In one embodiment, the label is capable of producing a coloured product, enabling visual detection of the label.
In one embodiment, the assay is a lateral flow assay. In more particular embodiment, the lateral flow assay has the immobilised antibod(ies) on a dipstick.
In one embodiment, the invention provides a method for testing for and treating SARS-CoV-2 infection, which method comprises the following steps: a) contacting an immobilised antibody recognising an antigen from SARS-CoV-2 with blood from the subject; and b) detecting of a complex formed between an antigen from SARS-CoV-2 and the immobilised antibody recognising said antigen; wherein the subject is identified to be infected with SARS-CoV-2 if a complex is detected in step b), and treating the subject having SARS-CoV-2 infection with a therapeutically effective amount of a compound selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}- 2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof. In specific embodiments of this method, the subject is human, and the assay is conducted as as described above. The treatment may also be conducted as described herein.
PROPHYLACTIC USE
In one aspect of the invention, the invention provides a compound selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, for use in the prevention of COVID-19.
In one embodiment, a specimen from the subject has been tested for SARS-CoV-2 RNA and no SARS-CoV-2 RNA was detected. In another embodiment, a specimen from the subject has not been tested for SARS-CoV-2 RNA. In more particular embodiments, the subject is in a high risk category (as defined herein), a health care professional or is a close contact of a patient infected with SARS-CoV-2 (as defined herein).
In one aspect of the invention there is provided a method of preventing COVID-19 in a subject at risk of an infection from SARS-Co-V-2, the method comprising: administering to the subject at risk of infection from SARS-CoV-2 a therapeutically effective amount of a compound selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof. In more particular embodiments, the subject is in a high risk category (as defined herein), the subject is a health care professional or the subject is a close contact of a subject infected with SARS-CoV-2 (as defined herein).
THERAPEUTIC USE
In one aspect of the invention, the invention provides a compound selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, for use in the treatment of COVID-19.
In one embodiment, treatment is initated in a subject within 5 to 7 days of the onset of symptoms, or within 72 hours of being tested positive for SARS-CoV-2 infection, using for example, the method defined herein.
In one embodiment, treatment is initated in a subject within 2 days of the onset of symptoms, or within 48 hours of being tested positive for SARS-CoV-2 infection, using for example, the method defined herein.
In one embodiment, treatment is initated in a subject within 24 hours of the onset of symptoms, or within 24 hours of being tested positive for SARS-CoV-2 infection, using for example, the method defined herein.
In one embodiment, the subject is a subject infected with SARS-CoV-2 who tests positive for SARS-CoV-2.
In one embodiment, the subject is a subject infected with SARS-CoV-2 who tests positive for SARS-CoV-2 who had previously received a SARS-CoV-2 vaccine.
In one embodiment, the subject infected with SARS-CoV-2 is a subject with a secondary condition associated with COVID-19.
In one embodiment, the subject infected with SARS-CoV-2 is in a high risk category, as defined above.
In one embodiment, the COVID-19 in the subject infected with SARS-CoV-2 is associated with pneumonia. In a more particular embodiment, the subject infected with SARS-CoV-2 has a MuLBSTA score of ≥12, or a CURB-65 score of ≥2 or a PSI score ≥ 70. In other embodiments, the subject infected with SARS-CoV-2 meets one or more of the following criteria: pulse ≥ 125/minute, respiratory rate >30/minute, blood oxygen saturation ≤93%, PaO2/FiO2 ratio <300 mmHg, peripheral blood lymphocyte count <0.8*109/L, systolic blood pressure <90 mmHg, temperature <35 or ≥40°C, arterial pH < 7.35, blood urea nitrogen ≥ 30 mg/dl, partial pressure of arterial O2 < 60 mmHg, pleural effusion, lung infiltrates >50% of the lung field within 24-48 hours.
In one embodiment, the COVID-19 in the subject infected with SARS-CoV-2 is associated with acute respiratory distress disorder. In a more particular embodiment, the subject infected with SARS- CoV-2 has a Murray Score of ≥2. In another embodiment, the subject infected with SARS-CoV-2 has a PaO2/FiO2 ratio ≤ 200 mmHg. In a more particular embodiment, the subject infected with SARS-CoV-2 has a PaO2/FiO2 ratio ≤ 100 mmHg. In another embodiment, the patient has a corrected expired volume per minute ≥10 L/min. In another embodiment, the subject infected with SARS-CoV-2 has respiratory system compliance ≤40 rnl/cm H2O. In another embodiment, the subject infected with SARS-CoV-2 has positive end-expiratory pressure ≥10 cm H2O. In particular embodiments, the subject infected with SARS-CoV-2 is undergoing extra -corporeal membrane oxygenation or mechanical ventilation, or receiving oxygen supplementation via a nasal cannula or simple mask. Where mechanical ventilation is used, this includes use of low tidal volumes (<6 mL/kg ideal body weight) and airway pressures (plateau pressure <30 cm H2O). Where oxygen supplementation is via a nasal cannula, this may be delivered as 2 to 6 L/minute. Where oxygen supplementation is by a simple mask, this may be delivered at 5 to 10 L/minute.
In particular embodiments, the subject infected with SARS-CoV-2 is receiving anti-viral and or steroid treatment wherein the anti-viral or steroid treatment is treatment with an agent other than benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}- 2-(4,4-d ifluoropiperidin-1-yl)ethyl]carba mate or a pharmaceutically acceptable salt thereof. In a particular embodiment, the subject is receiving antibody treatment, such as a monoclonal antibody treatment. In a particular embodiment, the subject is receiving convalescent plasma therapy. In a more particular embodiment, the subject infected with SARS-CoV-2 is receiving an anti-viral agent wherein the anti-viral agent is an agent other than benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2- oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4- (trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof. In even more particular embodiments, the anti-viral agent is selected from olsetemivir, remdesivir, ganciclovir, lopinavir, ritonavir and zanamivir. In one embodiment, the patient is receiving oseitamivir (75 mg every 12 h orally). In another embodiment, the subject infected with SARS-CoV-2 is receiving ganciclovir (0,25 g every 12 h intravenously). In another embodiment, the subject infected with SARS-CoV-2 is receiving lopinavir/ ritonavir (400/100 mg twice daily orally).
In a further embodiment, the subject infected with SARS-CoV-2 is receiving 100 mg remdesivir daily intravenously.
In particular embodiments, the subject infected with SARS-CoV-2 is receiving treatment with steroids. In a more particular embodiment, the steroid is selected from dexamethasone, prednisone, methyl prednisone and hydrocortisone.
In one embodiment, the subject infected with SARS-CoV-2 is receiving dexamethasone (6 mg once daily, orally or intravenously).
In one embodiment, the subject infected with SARS-CoV-2 is receiving prednisone (40 mg daily, in two divided doses). In one embodiment, the subject infected with SARS-CoV-2 is receiving methylprednisone (32 mg daily, in two divided doses).
In one embodiment, the subject infected with SARS-CoV-2 is receiving hydrocortisone (160 mg daily, in two to four divided doses).
In one embodiment, the subject receiving treatment with any of the above steroids is a subject receiving mechanical ventilation or supplemental oxygen.
In one embodiment, the subject infected with SARS-CoV-2 is receiving treatment with tocilizumab (8 mg/kg intravenously), or tocilizumab (8 mg/kg intravenously) in combination with dexamethasone (6 mg once daily, orally or intravenously).
In one embodiment, the subject infected with SARS-CoV-2 is receiving treatment with a SARS- CoV-2 neutralizing antibody. In a more particular embodiment, the subject infected with SARS-CoV-2 is receiving bamlanivimab (for example at a dose of 700 mg, 2800 mg or 7000 mg by iv infusion). In another embodiment, the subject infected with SARS-CoV-2 is receiving casirivimab and imdevimab, for example, at a dose of either 1200 mg for each antibody or at a dose of 4000 mg for each antibody.
In particular embodiments, the subject infected with SARS-CoV-2 is receiving convalescent plasma therapy. Blood is collected from an ABO compatible donor after at least 3 weeks post onset of illness and 4 days post discharge and plasma is prepared by apheresis.
In one embodiment, the plasma has a neutralizing antibody titer of 1:640 or above, as measured by the plaque reduction neutralization test using SARS-CoV-2 virus.
In one embodiment, the dose of convalescent plasma is 200 mL.
In one aspect there is provided a method for treating or preventing COVID-19 in a subject infected with SARS-CoV-2 or at risk of infection with SARS-CoV-2, the method comprising administering a therapeutically effective amount of a compound or a pharmaceutically acceptable salt which is selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof.
In one embodiment, the method comprises administering a therapeutically effective amount of a compound or a pharmaceutically acceptable salt selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, wherein the subject is at risk of infection with SARS-CoV-2 and the method comprises prevention of COVID-19 in the subject at risk of infection with SARS-CoV-2. In one particular embodiment, the subject is: a close contact of a patient infected with SARS-CoV-2, in a high risk category; or a healthcare professional.
In one embodiment, the method comprises administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, wherein the subject is infected with SARS-CoV-2 and the method comprises treating COVID-19 in the subject infected with SARS-CoV-2. In a particular embodiment, the subject was identified as being infected with SARS-CoV-2, by detection of viral RNA from SARS-CoV-2 from a specimen obtained from the subject.
In one embodiment, the subject infected with SARS-CoV-2 is infected with a strain (clade) of SAR-Co-V-2 selected from the L strain, the S strain, the G strain, the GH strain, the GR strain, the V strain or the 0 strain of SARS-CoV-2 . In a particular embodiment, the subject infected with SARS-CoV- 2 is infected with the L strain of SARS-CoV-2. In a particular embodiment, the subject infected with SARS-CoV-2 is infected with the S strain of SARS-CoV-2. In a particular embodiment, the subject infected with SARS-CoV-2 is infected with the G strain of SARS-CoV-2. In a particular embodiment, the subject infected with SARS-CoV-2 is infected with the GH strain of SARS-CoV-2. In a particular embodiment, the subject infected with SARS-CoV-2 is infected with the GR strain of SARS-CoV-2. In a particular embodiment, the subject infected with SARS-CoV-2 is infected with the V strain of SARS-CoV- 2. In a particular embodiment, the subject infected with SARS-CoV-2 is infected with the 0 strain of SARS-CoV-2. In a particular embodiment, the subject is infected with a variant of SARS-CoV-2, including the UK variant (201/501Y.V1/B.1.1.7), the South Africa variant (20H/501Y.V2/B.1.351), the Brazil variant (P.1/20J/501Y.V3/B.1.1.248) and the novel California variant descended from cluster 20C, defined by 5 mutations (ORF1a: I4205V, ORF1b:D1183Y, S:S13I; W152C; L452R) and designated CAL.20C (20C/S;452R;B.1.429).
In one embodiment, the method comprises administering a therapeutically effective amount of a compound or a pharmaceutically acceptable salt selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, wherein COVID-19 in the subject infected with SARS-CoV-2 is associated with pneumonia. In a particular embodiment, COVID-19 in the subject infected with SARS- CoV-2 is associated with acute respiratory distress disorder.
In one embodiment, the subject infected with SARS-CoV-2 is undergoing extra-corporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, or receiving oxygen therapy.
In one embodiment, the subject infected with SARS-CoV-2 is receiving anti-viral and or steroid treatment wherein the anti-viral or steroid treatment is treatment with an agent other than benzyl N- [(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-
2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-
3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-
1-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof. In a particular embodiment, the subject infected with SARS-CoV-2 is receiving an anti-viral agent wherein the anti-viral agent is an agent other than benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-
2-(4,4-d ifluoropiperidin-1-yl)ethyl]carba mate or a pharmaceutically acceptable salt thereof. In another particular embodiment, the anti-viral agent is selected from remdesivir, ganciclovir, lopinavir, olsetemivir ritonavir and zanamivir. In one embodiment, the subject infected with SARS-CoV-2 is receiving 100 mg remdesivir daily intravenously. In a particular embodiments, the subject infected with SARS-CoV-2 is receiving treatment with steroids. In another particular embodiment, the steroid is selected from dexamethasone, prednisone, methylprednisone and hydrocortisone. In one embodiment, the subject infected with SARS-CoV-2 is receiving dexamethasone (6 mg once daily, orally or intravenously). In one embodiment, the subject receiving treatment with steroids is a patient receiving mechanical ventilation or supplemental oxygen. In a particular embodiment, the subject infected with SARS-CoV-2 is receiving convalescent plasma therapy.
In one embodiment, the method comprises administering a therapeutically effective amount of a compound selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl>-3-methylbutyl]carbamoyl>-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, wherein the compound or pharmaceutically acceptable salt is administered via inhalation.
COMPOUND benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl>butyl]carbamoyl>-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate free base has the following structure:
Figure imgf000018_0001
benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate free base has the following structure:
Figure imgf000018_0002
The compounds may be prepared as described in WO2018/042343, or in accordance with the following synthetic schemes.
Scheme 1: Preparation of benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)- 2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2- yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate.
Figure imgf000019_0001
In the synthetic Scheme 1 shown above, the lactam alcohol 1 can be prepared according to literature (Journal of Medicinal Chemistry 48(22), 6767-6771, 2005). Alcohol 1 may be oxidised by reaction with a SO3-pyridine complex to produce an aldehyde 2, and the following reaction of 2 with an isocyanide, such as isopropyl isocyanide, in the presence of an appropriate acid, such as benzoic acid yields ester 3. The amino-alcohol 5 can be obtained by removal of benzoyl group of 3 under basic condition, followed by deprotection of Boc group of 4 using an appropriate acid, such as HCI, in a suitable solvent such as 1,4- dioxane. Any suitable amide forming condition can be used to prepare compound 6. Preferably, 2,4,6- tripropyl-l,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide is used in this invention. The removal of Boc group of compound 6 with HCI produces amine 7. Amine 7 (free or salt thereof) may be subjected to an amide formation reaction with a suitable Cbz-amino acid such as (S)-2-(((benzyloxy)carbonyl)amino)-3- (4-(trifluoromethyl)piperidin-1-yl)propanoic acid (commercially available), by using 2,4,6-tripropyl- 1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide as the preferred coupling reagent, to give amide 8. The subsequent oxidation is completed with Dess-Martin periodinane to yield final compound 9.
Scheme 2. Preparation of benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-
[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4- difluoropiperidin-1-yl)ethyl]carbamate.
Figure imgf000020_0001
In the synthetic Scheme 2 shown above, the lactam alcohol 1 can be prepared according to literature (Journal of Medicinal Chemistry 48(22), 6767-6771, 2005). Alcohol 1 may be oxidised by reaction with a SO3-pyridine complex to produce an aldehyde 2, and the following reaction of 2 with n-butyl isocyanide, in the presence of an appropriate acid, such as benzoic acid yields ester 10. The amino-alcohol 12 can be obtained by removal of benzoyl group of 10 under basic condition, followed by deprotection of Boc group of 11 using an appropriate acid, such as HCI, in a suitable solvent such as 1,4-dioxane. Any suitable amide forming condition can be used to prepare compound 13. Preferably, 2,4,6-tripropyl- 1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide is used in this invention. The removal of Boc group of compound 13 with HCI produces amine 14. Amine 14 (free or salt thereof) may be subjected to an amide formation reaction with (S)-2-(((benzyloxy)carbonyl)amino)-3-(4,4-difluoropiperidin-1-yl)propanoic acid by using 2,4,6-tripropyl-1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide as the preferred coupling reagent, to give amide 15. The subsequent oxidation is completed with Dess-Martin periodinane to yield final compound 16.
Benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate; and benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate are compounds that contain a basic group and are capable of forming a pharmaceutically acceptable acid addition salt by treatment with a suitable acid. Suitable acids include pharmaceutically acceptable inorganic acids and pharmaceutically acceptable organic acids. Such acid addition salts can be formed by reaction of the with the appropriate acid, optionally in a suitable solvent such as an organic solvent, to give the salt which can be isolated by a variety of methods, including crystallisation and filtration. In one embodiment, a compound selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate free base; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate free base, is used in accordance with the invention.
In one embodiment, the uses and methods described herein use benzyl N-[(1S)-1-{[(1S)-3- methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2- yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof. In a more particular embodiment, the uses and methods use benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate free base.
In one embodiment, the uses and methods described herein use benzyl N-[(1S)-1-{[(1S)-1- {[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3- methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof. In a more particular embodiment, the uses and methods use benzyl N-[(1S)-1-{[(1S)-1- {[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3- methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate free base.
PHARMACEUTICAL COM POSITIONS/ ROUTES OF ADMINISTRATION/DOSAGE
Compounds of the invention benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2- oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4- (trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, may be administered by any convenient route. In particular embodiments, the compound or pharmaceutically acceptable salt thereof may be administered by inhalation, orally, parenterally or intranasally.
In one embodiment, the compound or pharmaceutically acceptable salt is administered in a pharmaceutical composition containing the compound or pharmaceutically acceptable salt and a pharmaceutically acceptable excipient.
In one embodiment, the compound or pharmaceutically acceptable salt is formulated in a pharmaceutical composition adapted for oral or parenteral administration, or for administration intranasally or by inhalation. Pharmaceutical compositions adapted for oral administration may be presented as discrete units such as capsules or tablets; powders or granules; solutions or suspensions in aqueous or non-aqueous liquids; edible foams or whips; or oil-in-water liquid emulsions or water-in-oil liquid emulsions.
Pharmaceutical compositions adapted for nasal administration can comprise a coarse powder having a particle size for example in the range 20 to 500 microns which is administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close up to the nose. Suitable formulations wherein the carrier is a liquid, for administration as a nasal spray or as nasal drops, include aqueous or oil solutions of the compound or pharmaceutically acceptable salt thereof.
In one embodiment, the pharmaceutical composition may be adapted for parenteral administration. Such compositions include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats, co-solvents, organic solvent mixtures, cyclodextrin complexation agents, emulsifying agents (for forming and stabilizing emulsion formulations), liposome components for forming liposomes, gellable polymers for forming polymeric gels, lyophilization protectants and combinations of agents for, inter alia, stabilizing the active ingredient in a soluble form and rendering the formulation isotonic with the blood of the intended recipient. Pharmaceutical formulations for parenteral administration may also take the form of aqueous and non- aqueous sterile suspensions which may include suspending agents and thickening agents (R. G. Strickly, Solubilizing Excipients in oral and injectable formulations, Pharmaceutical Research, Vol 21(2) 2004, p 201-230).
A drug molecule that is ionizable can be solubilized to the desired concentration by pH adjustment if the drug's pKa is sufficiently far away from the formulation pH value. The acceptable range is pH 2-12 for intravenous and intramuscular administration, but for subcutaneous administration the acceptable range is pH 2.7-9.0. The solution pH is controlled by either the salt form of the drug, strong acids/bases such as hydrochloric acid or sodium hydroxide, or by solutions of buffers which include but are not limited to buffering solutions formed from glycine, citrate, acetate, maleate, succinate, histidine, phosphate, tris(hydroxymethyl)aminomethane (TRIS), or carbonate.
The combination of an aqueous solution and a water-soluble organic solvent/surfactant (i.e., a cosolvent) is often used in injectable formulations. The water-soluble organic solvents and surfactants used in injectable formulations include but are not limited to propylene glycol, ethanol, polyethylene glycol 300, polyethylene glycol 400, glycerin, dimethylacetamide (DMA), N-methyl-2-pyrrolidone (NMP; Pharmasolve), dimethylsulphoxide (DMSO), Solutol HS 15, Cremophor EL, Cremophor RH 60, and polysorbate 80. Such formulations can usually be, but are not always, diluted prior to injection.
Propylene glycol, PEG 300, ethanol, Cremophor EL, Cremophor RH 60, and polysorbate 80 are the entirely organic water-miscible solvents and surfactants used in commercially available injectable formulations and can be used in combinations with each other. The resulting organic formulations are usually diluted at least 2-fold prior to administration by IV bolus or IV infusion. Alternatively, increased water solubility can be achieved through molecular complexation with cyclodextrins.
Liposomes are closed spherical vesicles composed of outer lipid bilayer membranes and an inner aqueous core and with an overall diameter of <100 μm. Depending on the level of hydrophobicity, moderately hydrophobic drugs can be solubilized by liposomes if the drug becomes encapsulated or intercalated within the liposome. Hydrophobic drugs can also be solubilized by liposomes if the drug molecule becomes an integral part of the lipid bilayer membrane, and in this case, the hydrophobic drug is dissolved in the lipid portion of the lipid bilayer. A typical liposome formulation contains water with phospholipid at -5-20 mg/mL, an isoton icifier, a pH 5-8 buffer, and optionally cholesterol.
The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.
The pharmaceutical formulation can be prepared by lyophilizing a compound of the invention as described herein. Lyophilization refers to the procedure of freeze-drying a composition. Freeze-drying and lyophilization are therefore used herein as synonyms. A typical process is to solubilize the compound and the resulting formulation is clarified, sterile filtered and aseptically transferred to containers appropriate for lyophilization (e.g. vials). In the case of vials, they are partially stoppered with lyo-stoppers. The formulation can be cooled to freezing and subjected to lyophilization under standard conditions and then hermetically capped forming a stable, dry lyophile formulation. The composition will typically have a low residual water content, e.g. less than 5% e.g. less than 1% by weight based on weight of the lyophile.
The lyophilization formulation may contain other excipients for example, thickening agents, dispersing agents, buffers, antioxidants, preservatives, and tonicity adjusters. Typical buffers include phosphate, acetate, citrate and glycine. Examples of antioxidants include ascorbic acid, sodium bisulphite, sodium metabisulphite, monothioglycerol, thiourea, butylated hydroxytoluene, butylated hydroxyl anisole, and ethylenediaminetetraacetic acid salts. Preservatives may include benzoic acid and its salts, sorbic acid and its salts, alkyl esters of para-hydroxybenzoic acid, phenol, chlorobutanol, benzyl alcohol, thimerosal, benzalkonium chloride and cetylpyridinium chloride. The buffers mentioned previously, as well as dextrose and sodium chloride, can be used for tonicity adjustment if necessary.
Bulking agents are generally used in lyophilization technology for facilitating the process and/or providing bulk and/or mechanical integrity to the lyophilized cake. Bulking agent means a freely water soluble, solid particulate diluent that when co-lyophilized with the compound or salt thereof, provides a physically stable lyophilized cake, a more optimal freeze-drying process and rapid and complete reconstitution. The bulking agent may also be utilized to make the solution isotonic.
The water-soluble bulking agent can be any of the pharmaceutically acceptable inert solid materials typically used for lyophilization. Such bulking agents include, for example, sugars such as glucose, maltose, sucrose, and lactose; polyalcohols such as sorbitol or mannitol; amino acids such as glycine; polymers such as polyvinylpyrrolidone; and polysaccharides such as dextran. The ratio of the weight of the bulking agent to the weight of active compound is typically within the range from about 1 to about 5, for example of about 1 to about 3, e.g. in the range of about 1 to 2.
Alternatively, they can be provided in a solution form which may be concentrated and sealed in a suitable vial. Sterilization of dosage forms may be via filtration or by autoclaving of the vials and their contents at appropriate stages of the formulation process. The supplied formulation may require further dilution or preparation before delivery for example dilution into suitable sterile infusion packs.
Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets.
In one embodiment of the invention, the pharmaceutical composition is in a form suitable for i.v. administration, for example by injection or infusion.
Pharmaceutical compositions of the present invention for parenteral injection can also comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
The compositions of the present invention may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents such as sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
If a compound is not stable in aqueous media or has low solubility in aqueous media, it can be formulated as a concentrate in organic solvents. The concentrate can then be diluted to a lower concentration in an aqueous system, and can be sufficiently stable for the short period of time during dosing. Therefore in another aspect, there is provided a pharmaceutical composition comprising a non aqueous solution composed entirely of one or more organic solvents, which can be dosed as is or more commonly diluted with a suitable IV excipient (saline, dextrose; buffered or not buffered) before administration (Solubilizing excipients in oral and injectable formulations, Pharmaceutical Research, 21(2), 2004, p201-230). Examples of solvents and surfactants are propylene glycol, PEG300, PEG400, ethanol, dimethylacetamide (DMA), N-methyl-2-pyrrolidone (NMP, Pharmasolve), Glycerin, Cremophor EL, Cremophor RH 60 and polysorbate. Particular non aqueous solutions are composed of 70-80% propylene glycol, and 20-30% ethanol. One particular non aqueous solution is composed of 70% propylene glycol, and 30% ethanol. Another is 80% propylene glycol and 20% ethanol. Normally these solvents are used in combination and usually diluted at least 2-fold before IV bolus or IV infusion. The typical amounts for bolus IV formulations are ~50% for Glycerin, propylene glycol, PEG300, PEG400, and ~20% for ethanol. The typical amounts for IV infusion formulations are ~15% for Glycerin, 3% for DMA, and ~10% for propylene glycol, PEG300, PEG400 and ethanol.
In one embodiment of the invention, the pharmaceutical composition is in a form suitable for i.v. administration, for example by injection or infusion. For intravenous administration, the solution can be dosed as is, or can be injected into an infusion bag (containing a pharmaceutically acceptable excipient, such as 0.9% saline or 5% dextrose), before administration.
In one embodiment, the pharmaceutical composition is in a form suitable for sub-cutaneous (s.c.) administration.
Pharmaceutical dosage forms suitable for oral administration include tablets, capsules, caplets, pills, lozenges, syrups, solutions, powders, granules, elixirs and suspensions, sublingual tablets, wafers or patches and buccal patches.
Pharmaceutical compositions containing a pharmaceutically acceptable salt of compounds described here can be formulated in accordance with known techniques, see for example, Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA, USA.
In one embodiment, the compounds described herein can be formulated as a solid dosage form (e.g. tablets and capsules etc.). Tablet compositions can contain a unit dosage of active compound together with an inert diluent or carrier such as a sugar or sugar alcohol, e.g.; lactose, sucrose, sorbitol or mannitol; and/or a non-sugar derived diluent such as sodium carbonate, calcium phosphate, calcium carbonate, or a cellulose or derivative thereof such as methyl cellulose, ethyl cellulose, hydroxypropyl methyl cellulose, and starches such as corn starch. Tablets may also contain such standard ingredients as binding and granulating agents such as polyvinylpyrrolidone, disintegrants (e.g. swellable crosslinked polymers such as crosslinked carboxymethylcellulose), lubricating agents (e.g. stearates), preservatives (e.g. parabens), antioxidants (e.g. BHT), buffering agents (for example phosphate or citrate buffers), and effervescent agents such as citrate/bicarbonate mixtures. Such excipients are well known and do not need to be discussed in detail here.
Capsule formulations may be of the hard gelatin or soft gelatin variety and can contain the active component in solid, semi-solid, or liquid form. Gelatin capsules can be formed from animal gelatin or synthetic or plant derived equivalents thereof.
The solid dosage forms (e.g., tablets, capsules etc.) can be coated or un-coated, but typically have a coating, for example a protective film coating (e.g. a wax or varnish) or a release controlling coating. The coating (e.g. a Eudragit® type polymer) can be designed to release the active component at a desired location within the gastro-intestinal tract. Thus, the coating can be selected so as to degrade under certain pH conditions within the gastrointestinal tract, thereby selectively release the compound in the stomach or in the ileum or duodenum. Instead of, or in addition to, a coating, the drug can be presented in a solid matrix comprising a release controlling agent, for example a release delaying agent which may be adapted to selectively release the compound under conditions of varying acidity or alkalinity in the gastrointestinal tract. Alternatively, the matrix material or release retarding coating can take the form of an erodible polymer (e.g. a maleic anhydride polymer) which is substantially continuously eroded as the dosage form passes through the gastrointestinal tract. As a further alternative, the active compound can be formulated in a delivery system that provides osmotic control of the release of the compound. Osmotic release and other delayed release or sustained release formulations may be prepared in accordance with methods well known to those skilled in the art.
The pharmaceutical formulations may be presented to a patient in "patient packs" containing an entire course of treatment in a single package, usually a blister pack. Patient packs have an advantage over traditional prescriptions, where a pharmacist divides a patient's supply of a pharmaceutical from a bulk supply, in that the patient always has access to the package insert contained in the patient pack, normally missing in patient prescriptions. The inclusion of a package insert has been shown to improve patient compliance with the physician's instructions.
Compositions for topical use include ointments, creams, sprays, patches, gels, liquid drops and inserts (for example intraocular inserts). Such compositions can be formulated in accordance with known methods.
Compositions for parenteral administration are typically presented as sterile aqueous or oily solutions or fine suspensions, or may be provided in finely divided sterile powder form for making up extemporaneously with sterile water for injection.
Pharmaceutical formulations adapted for parenteral administration include aqueous and non- aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non- aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets.
It should be understood that in addition to the ingredients particularly mentioned above, the formulations described herein may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.
The present invention also provides unitary pharmaceutical compositions in which the compound or pharmaceutically acceptable salt thereof of the present invention and one or more other pharmaceutically active agent(s) may be administered together or separately. In one embodiment, the pharmaceutical composition contains a compound or pharmaceutically acceptable salt selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, and one or more antiviral agents or steroids.
In one embodiment, the pharmaceutical composition contains a compound or pharmaceutically acceptable salt selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, and one or more other antiviral agents.
In one embodiment, the one or more other anti-viral agents are selected from the group consisting of: olsetemivir, remdesivir, ganciclovir, lopinavir, ritonavir and zanamivir. In one embodiment, the pharmaceutical composition contains a single other anti-viral agent. In a more particular embodiment, the single other anti-viral agent is remdesivir.
In one embodiment, the pharmaceutical composition contains a compound selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, and one or more steroids.
In one embodiment, one or more steroids are selected from the group consisting of: dexamethasone, prednisone, methylprednisone and hydrocortisone. In one embodiment, the pharmaceutical composition contains a single steroid. In a more particular embodiment, the single steroid is dexamethasone.
Appropriate doses will be readily appreciated by those skilled in the art. When a compound of the invention or a pharmaceutically acceptable salt thereof is used in combination with a second therapeutic agent, the dose of each compound may differ from that when the compound is used alone.
INHALABLE PHARMACEUTICAL COMPOSITION
In one embodiment, a compound of the invention benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1- oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2- [4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, may be formulated for administration by inhalation. Compositions for administration by inhalation may take the form of inhalable powder compositions or liquid or powder sprays, and can be administrated in standard form using powder inhaler devices or aerosol dispensing devices. Such devices are well known, and include for example breath-actuated inhalers. For administration by inhalation, the powdered formulations typically comprise a compound of the invention benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan- 2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}- 2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, together with an inert solid powdered diluent such as lactose.
The inhalable pharmaceutical composition comprises a micronized compound of the invention benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-
2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, and optionally a carrier (such as lactose). The compound of the invention benzyl N-[(1S)-1-{[(1S)-3-methyl- l-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2- yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-
3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-
1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, may be micronized by any suitable technique known in the art e.g., jet-milling.
In one embodiment, substantially all of the particles of the micronized compound of the invention benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-
2-(4,4-d ifluoropiperidin-1-yl)ethyl]carba mate, or a pharmaceutically acceptable salt thereof, are less than 10 μm in size.
In one embodiment, the formulation of the invention comprises a compound of the invention benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1- (butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}- 2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, in an amount such that, upon administration by inhalation from inhalers, the therapeutically effective single dose (hereinafter the single dose) is between about 25 to about 150 mg BiD (total dose 50 to 300 mg). In one embodiment compounds of the therapeutically effective single dose is between about 50 mg to about 85 mg BiD (total dose 100 mg to 170 mg). In one embodiment compounds of the therapeutically effective single dose is between about 10 mg to about 50 mg TiD (total dose 30 mg to 150 mg).
The single dose will depend on the kind and the severity of the disease and the conditions (weight, sex, age) of the patient and shall be administered one or more times a day, for example once, twice or three times a day.
Pharmaceutical formulations adapted for administration by inhalation include dry poweder or fine particle dusts or mists, which may be generated by means of various types of metered, dose pressurized aerosols, nebulizers or insufflators. Pharmaceutical formulations may be delivered by dry powder inhalation as described in Ives et al.: Dry powder inhaled compound delivery for early pre-clinical in vivo efficacy studies. Journal of Inflammation 2013 10(Suppl 1):P36 (doi:10.1186/1476-9255-10-Sl-P36).
In one embodiment, pharmaceutical formulations of benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-
1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-
2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate may be delivered as a single inhaled dry powder dose at a desired concentration, optionally comprising lactose or other excipient, as needed.
Administration of Single Inhaled Dry Powder Dose
A single inhaled dry powder dose of benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2- oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4- (trifluoromethyl)piperidin-1-yl]ethyl]carbamate was administered to male Wistar Han (WH) rats at a target dose level of 5 mg/kg (free base equivalent, 32% w/w compound to lactose blend) using a Wright Dust Feeder (WDF) and Aerosolised Dust Generation (ADG) inhalation tower.
Animal randomisation was used to assign animals to cages and marked for identification on the tail with permanent marker. Rats were weighed within 24 h of administration, with one group placed in a warming cabnet with a tail cannula inserted for serial bleeds. Rats were dosed as an inhaled dry powder, 32% compound (w/w) in lactose, at a target dose level of 5 mg/kg (free base equivalent) with a 60-min inhalation period.
Concentration of benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]- l-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate was determined in blood and lung, allowing PK parameters and lung retention to be calculated. The compound mix was dispersed using a WDF mechanism with a jet nozzle section. The WDF is attached to a 24-part ADG tower. WDF speed is determined from a preliminary test, with such speed recorded and used for administration. A regulated flow of compressed air (~14L/min) delivered the aerosol from the WDF into an inhalation chamber. The extract was set at ~16L/min. A slight draw (2.0 L/min) of room air is allowed into the chamber to balance airflow and maintain the chamber at ~ambient pressure while ensuring a flow of aerosol throughout the chamber. Rats were individually placed into Perspex restraint cones and attached to one of the 24 ports on the ADG tower. Three rats per timepoint were placed on a different level on the dosing tower, to allow for differences between levels, and to minimise differences between groups. Using a block plan, all rats received 15 min of inhalation tube acclimatisation on the inhalation tower with an airflow of 14L in, 16L out, followed by the air turned off, the compound placed on the equipment, and then airflow turned back on. The rats were dosed with the compound mix over 60 minute period (data not shown), and thereafter the rats were returned to their cages and holding rooms unless samples are taken immediately after dose (IAD). The data will be used to contribute to the human dose prediction and guide dose selectipn in preclinical safety studies. The rat is the species of choice to match use that used in the safety assessment studies.
In one embodiment compounds of the invention may be administered at a human dose range of about 25 to about 150 mg BiD (total dose 50 to 300 mg). In one embodiment compounds of the invention may be administered at a human dose range of about 50 mg to about 85 mg BiD (total dose 100 mg to 170 mg). In one embodiment, compounds of the invention may be administered at a human dose range from about 10 mg to about 50 mg TiD (total dose 30 mg to 150 mg).
In one embodiment, compounds of the invention may be administered at a human dose range of about 15 mg to about 35 mg TiD (total dose 45 mg to 105 mg). In one embodiment, compounds of the invention may be administered at a human dose range from about 25mg TiD (total daily dose 75mg) to about 70mg BiD (total daily dose 140mg), such dose based on achieving a desired unbound concentration in the lung throughout the dosing interval.
When a compound selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2- oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4- (trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, is used in combination with a second therapeutic agent, the human dose of each compound may differ from that when the compound is used alone.
BIOLOGICAL DATA
In order to evaluate inhibition of coronavirus, a series of biochemical inhibition and cell-based antiviral assays were run in different formats and locations. The assays were performed with coronavirus including SARS-CoV1, SARS-CoV2, MERS, OC43, and 229e, using different cell lines and different measurements of viral replication. The results show compounds A and B to be inhibitors of coronavirus strains across the majority of these assays with any differences in potency attributed to the differences in assay format. Antiviral Evaluations - Section A: in vitro biochemical 3CL Protease inhibition;
Coronavirus OC43 3CL Protease Enzyme Protocol - Method 1
Test compound was 3-fold serially diluted in an 11 point curve with a solvent of 100% DMSO, starting from a high concentration of 1.0 mM. Each dilution was transferred in 100 nL volume into black 384-well Greiner (784076) plates yielding a 10 μM top final concentration in the assay. Low control wells in column 18 (0% response, 100% inhibition) contained 100 nL of DMSO plus buffer, without enzyme. High control wells in column 6 (100% response, 0% inhibition) contained 100 nL DMSO plus buffer and enzyme. Maximum DMSO concentration is approximately 1% throughout the plate.
The assay buffer consists of 25 mM HEPES (pH 7.5), 50 mM NaCI, 1 mM CHAPS, and 1 mM EDTA. Assay plate preparation included spinning the plates prior to reaction additions and the addition of 5 μL assay buffer only (no enzyme) to column 18 (low control — representing 100% inhibition) and 5 μL of 2 nM enzyme (OC43 3CL protease, 1 nM final concentration) in assay buffer to columns 1-17, and 19-24.
A FRET substrate peptide ( FAM - VARLQSG FG-TAM RA) (SEQ ID NO: 7) was suspended at 4 μM concentration and 5 μL was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 2 μM. Reactions were incubated in the dark at room temperature for 60 minutes. At that time the FRET signal was measured with an Envision or equivalent plate reader and used to quantify the endpoint of the assay for apparent EC50 calculations.
Data from each plate is analyzed and plotted as % inhibition versus compound concentration. Data is normalized using the formula 100*( control1-unknown)/(control1-control 2) where control1 is the average of the values for that plate corresponding to the 0% inhibition control wells (DMSO, column 6) and control2 is the average of the values corresponding to the 100% control wells (column 18). Curve fitting was performed with the 4-parameter curve fit equation y=A+((B-A)/(1+(10^x/10^C)^ D)), where A was the minimum response, B was the maximum response, C is the log(XC50) and D was the Hill slope. The results for test compound were recorded as pIC50 values (-C in the above equation) and as max response values at a given concentration. The lower limit of detection for this method is typically one half the enzyme concentration for highly purified enzymes.
Coronavirus OC43 3CL Protease Enzyme Protocol Method 2
Test compound was 1.5-fold serially diluted in a 22 point curve with a solvent of 100% DMSO, starting from a high concentration of 1.0 mM. Each dilution was transferred using an Echo acoustic dispenser in 2.5 nL volume into black 384-well Greiner (784076) plates yielding a 0.25 μM top final concentration and 75 pM low concentraton in the assay. Low control wells in column 18 (fractional activity remaining = 0) contained 2.5 nL of DMSO plus buffer, without enzyme. High control wells in column 6 (fractional activity remaining = 1) contained 2.5 nL DMSO plus buffer and enzyme. The assay buffer consists of 25 mM Hepes (pH 7.5), 50 mM NaCI, 1 mM CHAPS, 1 mM EDTA, 0.08% (w/v) fatty acid free BSA, and 1% (v/v) DMSO. The low control, 9 μL assay buffer only (no enzyme) was added to to column 18, followed by 9 μL of 3.2 nM enzyme (OC43 CoV 3CL protease) in assay buffer to columns 1-17, and 19-24. The assay plates were centrifuged for 1 min at 500 rpm and incubated at room temperature for 2 hours.
A FRET substrate peptide (FAM-VARLQSGFG-TAMRA; AnaSpec) (SEQ ID NO: 7) was suspended at 125 μM concentration in assay buffer and 1 μL was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 12.5 μM. The assay plates were centrifuged for 1 min at 500 rpm and incubated at room temperature for 60 minutes. At that time the FRET signal was measured with a PheraSTAR plate reader (BMG LabTech) with excitation at 485 nm and emissiona at 520 nm and used to quantify the endpoint of the assay for apparent Ki calculations.
Data from each plate is normalized to fractional activity remaining (vi/vo), i.e. [Net test sample activity (total FLINT counts - average of low control counts)] / [Net DMSO control activity (average of high control FLINT counts - average of low control counts)] and fit to a quadratic model for tight binding inhibition in ABASE XE. The tight binding equation is: y = ((B/(2*C))*(((C-X)-A)+(((((X+A)-C)^ 2)+((4*A)*C))^ 0.5))); inv = (((((A*B)/y)- ((y*C)/B))+C)-A); res = (y-fit) where,
X = [inhibitor] (M)
Y = fraction activity remaining (vi/vo)
A = apparent Ki; converted to pKi = -log (apparent Ki)
B = uninhibited control, B = 1 if y value is set as Fractional Activity remaining, i.e. test sample net activity/control (no inhibitor) net activity (vi/vO) and average high control net activity = 1.
C = total active enzyme concentration (in M). By default, C is allowed to float during the ABASE initial fitting. If C < 0, manually apply the constraint where C is fixed to the calculated enzyme concentration (3.2 x 10-9 M) or actual active enzyme concentration based on a separate active site titration.
Coronavirus 229e 3CL Protease Enzyme Protocol - Method 1
Test compound was 3-fold serially diluted in an 11 point curve with a solvent of 100% DMSO, starting from a high concentration of 1.0 mM. Each dilution was transferred in 100 nL volume into black 384-well Greiner (784076) plates yielding a 10 μM top final concentration in the assay. Low control wells in column 18 (0% response, 100% inhibition) contained 100 nL of DMSO plus buffer, without enzyme. High control wells in column 6 (100% response, 0% inhibition) contained 100 nL DMSO plus buffer and enzyme. Maximum DMSO concentration is approximately 1% throughout the plate.
The assay buffer consists of 25 mM Hepes (pH 7.5), 50 mM NaCI, 1 mM CHAPS, and 1 mM EDTA. Assay plate preparation included spinning the plates prior to reaction additions and the addition of 5 μL assay buffer only (no enzyme) to column 18 (low control — representing 100% inhibition) and 5 μL of 200 pM enzyme (229e 3CL protease, 100 pM final concentration) in assay buffer to columns 1-17, and 19-24.
A FRET substrate peptide ( FAM - VARLQSG FG-TAM RA) (SEQ ID NO: 7) was suspended at 4 μM concentration and 5 μL was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 2 μM. Reactions were incubated in the dark at room temperature for 60 minutes. At that time the FRET signal was measured with an Envision or equivalent plate reader and used to quantify the endpoint of the assay for apparent EC50 calculations.
Data from each plate is analyzed and plotted as % inhibition versus compound concentration. Data is normalized using the formula 100*(control1-unknown)/(control1-control2) where contrail is the average of the values for that plate corresponding to the 0% inhibition control wells (DMSO, column 6) and control2 is the average of the values corresponding to the 100% control wells (column 18). Curve fitting was performed with the 4-parameter curve fit equation y=A+((B-A)/(l+(10^x/10^C)^ D)), where A was the minimum response, B was the maximum response, C is the log(XC50) and D was the Hill slope. The results for test compound were recorded as pIC50 values (-C in the above equation) and as max response values at a given concentration. The lower limit of detection for this method is typically one half the enzyme concentration for highly purified enzymes.
Coronavirus 229e 3CL Protease Enzyme Protocol Method 2
Test compound was 1.5-fold serially diluted in a 22 point curve with a solvent of 100% DMSO, starting from a high concentration of 1.0 or 0.25 mM. Each dilution with a high of 1 mM was transferred using an Echo acoustic dispenser in 2.5 nL volume into black 384-well Greiner (784076) plates yielding a 0.25 μM top final concentration and 75 pM low concentration in the assay. Alternately, each dilution with a 0.25 mM high concentration was transferred using an Echo acoustic dispenser in 20 nL volume into black 384-well Greiner (784076) plates yielding a 0.50 μM top final concentration and 100 pM low concentration in the assay. Low control wells in column 18 (fractional activity remaining = 0) contained 2.5 nL of DMSO plus buffer, without enzyme. High control wells in column 6 (fractional activity remaining = 1) contained 2.5 nL DMSO plus buffer and enzyme. For the rate data method the high inhibitor was in rows A and B column 1 and the high controls (no inhibitor) were in rows A and B columns 23 and 24 with intermediate dilutions in columns 2 to 22. The low control rate was insignificant and not subtracted.
The assay buffer consists of 25 or 50 mM Hepes (pH 7.5), 50 or 100 mM NaCI, 1 mM CHAPS or 0.02% Pluronic F-127, 0 or 1 mM EDTA, 0 or 1 mM EDTA, 0 or 10% DMSO. The low control, 9 μL assay buffer only (no enzyme) was added to to column 18, followed by 9 μL of 3.2 or 11.1 nM enzyme (229e CoV 3CL protease) in assay buffer to columns 1-17, and 19-24. The assay plates were centrifuged for 1 min at 500 or 1000 rpm and incubated at room temperature for 1.5 or 2 hours. A FRET substrate peptide (FAM-VARLQSGFG-TAMRA (SEQ ID NO: 7); AnaSpec) was suspended at 125 μM concentration in assay buffer or a FRET substrate peptide (HiLyte488-ESATLQSGLRKAK- (QXL520)-NFI2; AnaSpec) (SEQ ID NO: 9) was suspended at 250 μM concentration in assay buffer and 1 μL was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 12.5 μM or added by pipet to a final concentration of 25 μM. The assay plates were centrifuged for 1 min at 500 or 1000 rpm and incubated at room temperature for 60 minutes for the FAM-TAMRA substrate or read kinetically every 15 seconds for 60 minutes for the HiLyte-QXL substrate. At that time the FAM-TAMRA FRET signal was measured with a PheraSTAR plate reader (BMG LabTech) with excitation at 485 nm and emission at 520 nm and used to quantify the endpoint of the assay for apparent Ki calculations. Alternately, the HiLyte-QXL FRET signal was measured with a Spectromax M2 plate reader (Molecular Devices) with excitation at 485 nm and emission at 528 nM. Linear rates were determined using the vendor software (Softmax 5.4), exported to Microsoft Excel and used for apparent Ki calculations.
Endpoint or rate data from each plate is normalized to fractional activity remaining (vi/vo), i.e. [Net test sample activity (total FLINT counts - average of low control counts)] / [Net DMSO control activity (average of high control FLINT counts - average of low control counts)] and fit to either a four- parameter model for inhibition in GraphPad Prism for endpoint data or a quadratic model for tight binding inhibition in GraFit (Erithacus) for rate data. The 4-parameter IC50 fitting equation is: y = A+((B-A)/(1+(IC50/X)^ D)) where,
X = [inhibitor] (M)
Y = response, fraction activity remaining (vi/vo)
A = Bottom asymptote, high enzyme activity control, No I
B = Top asymptote, low enzyme activity control, No enzyme
C = negative value of -log10 IC50
D = Hill Slope
The tight binding equation is: y = ((B/(2*C))*(((C-X)-A)+(((((X+A)-C)^ 2)+((4*A)*C))^ 0.5))); inv = (((((A*B)/y)-((y*C)/B))+C)-A); res = (y-fit) where,
X = [inhibitor] (M)
Y = fraction activity remaining (vi/vo)
A = apparent Ki; converted to pKi = -log (apparent Ki)
B = uninhibited control, B = 1 if y value is set as Fractional Activity remaining, i.e. test sample net activity/control (no inhibitor) net activity (vi/v0) and average high control net activity = 1.
C = total active enzyme concentration (in M). By default, C is allowed to float during the ABASE initial fitting. If C < 0, manually apply the constraint where C is fixed to the calculated enzyme concentration (5 x 10-9 M) or actual active enzyme concentration based on a separate active site titration. SARS Coronavirus 3CL Protease Enzyme Protocol - Method 1
Test compound was 3-fold serially diluted in an 11 point curve with a solvent of 100% DMSO, starting from a high concentration of 1.0 mM. Each dilution was transferred in 100 nL volume into black 384-well Greiner (784076) plates yielding a 10 μM top final concentration in the assay. Low control wells in column 18 (0% response, 100% inhibition) contained 100 nL of DMSO plus buffer, without enzyme. High control wells in column 6 (100% response, 0% inhibition) contained 100 nL DMSO plus buffer and enzyme. Maximum DMSO concentration is approximately 1% throughout the plate.
The assay buffer consists of 25 mM Hepes (pH 7.5), 50 mM NaCI, 1 mM CHAPS, and 1 mM EDTA. Assay plate preparation included spinning the plates prior to reaction additions and the addition of 5 μL assay buffer only (no enzyme) to column 18 (low control — representing 100% inhibition) and 5 μL of 60 nM enzyme (SARS 3CL protease, 30 nM final concentration) in assay buffer to columns 1-17, and 19-24.
A FRET substrate peptide ( FAM-KTSAVLQSGFRKME-TAMRA) (SEQ ID NO: 8) was suspended at 6 μM concentration and 5 μL was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 3 μM. Reactions were incubated in the dark at room temperature for 60 minutes. At that time the FRET signal was measured with an Envision or equivalent plate reader and used to quantify the endpoint of the assay for apparent EC50 calculations.
Data from each plate is analyzed and plotted as % inhibition versus compound concentration. Data is normalized using the formula 100*(control1-unknown)/(control1-control2) where contrail is the average of the values for that plate corresponding to the 0% inhibition control wells (DMSO, column 6) and control2 is the average of the values corresponding to the 100% control wells (column 18). Curve fitting was performed with the 4-parameter curve fit equation y=A+((B-A)/(1+(10^x/10^C)^ D)), where A was the minimum response, B was the maximum response, C is the log(XC50) and D was the Hill slope. The results for test compound were recorded as pIC50 values (-C in the above equation) and as max response values at a given concentration. The lower limit of detection for this method is typically one half the enzyme concentration for highly purified enzymes.
SARS Coronavirus 3CL Protease Enzyme Protocol Method 2
Test compound was 1.5-fold serially diluted in a 14 point curve with a solvent of 100% DMSO, starting from a high concentration of 0.25 mM in columns 1 to 3 (3 replicates). Each dilution was transferred using an Echo acoustic dispenser in 20 nL volume into black 384-well Greiner (784076) plates yielding a 500 nM top final concentration and 2.6 nM low concentration in the 10 μL total volume assay. High control wells in rows O and P (vo with fractional activity remaining = 1) contained 20 nL DMSO plus buffer and enzyme.
The assay buffer consists of 50 mM Hepes (pH 7.5), 100 mM NaCI, 0.02% (w/v) Pluronic F-127, 1 mM DTT, 0% or 0.005% (w/v) fatty acid free BSA, and 1% or 10% (v/v) DMSO. Assay plate preparation included the addition of 9 μL of 5 nM or 5 μL of 80 nM enzyme (SARS 3CL protease, 5 or 40 nM final concentration) in assay buffer to columns 1-3. The assay plates were centrifuged for 1 min at 500 or 1000 rpm to mix enzyme and inhibitor and pre-incubated at room temperature for 90, 100 or 180 min.
A FRET substrate peptide (HiLyte488-ESATLQSGLRKAK-(QXL520)-NH2; AnaSpec) (SEQ ID NO: 9) was suspended at 400 μM or 40 μM concentration in assay buffer and 1 μL or 5 μL was added to each reaction well to initiate the reactions with a final reaction concentration of 40 μM or 20 μM in a total volume of 10 μL. The assay plates were centrifuged for 1 min at 500 or 1000 rpm to mix and read in kinetic mode every 10 seconds at room temperature for 45 or 120 minutes. The FRET signal was measured with a Spectromax Gemini, M2 or M5 plate reader (Molecular Devices) with excitation at 485 nm and emission at 528 nM. Linear rates were determined using the vendor software (Softmax 5.4), or exported to Microsoft Excel or GraFit 7.0 (Erithacus) and used for apparent Ki calculations.
Rate data from each plate is normalized to fractional activity remaining (vi/vo), i.e. [Test sample activity (vi = linear rates at each inhibitor)] / [Average no inhibitor DMSO control activity (vo = average of high control linear rates)] and fit to a quadratic model for tight binding inhibition with Grafit 7.0 (Erithacus) or with the Microsoft EXCEL add-in XLfit (IDBS). The tight binding equation is: y = ((B/(2*C))*(((C-X)-A)+(((((X+A)-C)^ 2)+((4*A)*C))^ 0.5))); inv = (((((A*B)/y)-
((y*C)/B))+C)-A); res = (y-fit) where,
X = [inhibitor] (M)
Y = fraction activity remaining (vi/vo)
A = apparent Ki; converted to pKi = -log (apparent Ki)
B = uninhibited control, B = 1 if y value is set as Fractional Activity remaining, i.e. test sample net activity/control (no inhibitor) net activity (vi/vO) and average high control net activity = 1.
C = total active enzyme concentration (in M). By default, C is allowed to float during the initial fitting. If C < 0, manually apply the constraint where C is fixed to the calculated enzyme concentration (5 x 10-9 M or 40 x 10-9 M) or actual active enzyme concentration based on a separate active site titration.
SARS-Coronavirus-2 3CL Protease Enzyme Protocol
Test compound was 1.5-fold serially diluted in a 22 point curve with a solvent of 100% DMSO, starting from a high concentration of 0.5 mM. Each dilution was transferred using an Echo acoustic dispenser in 20 nL volume into black 384-well Greiner (784076) plates yielding a 1 μM top final concentration and 200 pM low concentration in the assay. Low control wells in column 18 (fractonal activity remaining = 0) contained 20 nL of DMSO plus buffer, without enzyme. High control wells in column 6 (fractional activity remaining = 1) contained 20 nL DMSO plus buffer and enzyme.
The assay buffer consists of 50 mM Hepes (pH 7.5), 100 mM NaCI, 0.02% (w/v) Pluronic F-127,
1 mM DTT, 0.005% (w/v) fatty acid free BSA, and 10% (v/v) DMSO. The low control, 5 μL assay buffer only (no enzyme) was added to to column 18, followed by 9 μL of 10 nM enzyme (SARS CoV2 3CL protease) in assay buffer to columns 1-17, and 19-24. The assay plates were centrifuged for 1 min at 500rpm and incubated at room temperature for 2 hours.
A FRET substrate peptide (HiLyte488-ESATLQSGLRKAK-(QXL520)-NH2; AnaSpec) (SEQ ID NO:
9) was suspended at 200 μM concentration in assay buffer and 1 μL was added to each reaction well with a Thermo Combi liquid handler for a final reaction concentration of 20 μM. The assay plates were centrifuged for 1 min at 500 rpm and incubated at room temperature for 60 minutes. At that time the FRET signal was measured with a PheraSTAR plate reader (BMG LabTech) with excitation at 485 nm and emission at 520 nm and used to quantify the endpoint of the assay for apparent Ki calculations.
Data from each plate is normalized to fractional activity remaining (vi/vo), i.e. [Net test sample activity (total FLINT counts - average of low control counts)] / [Net DMSO control activity (average of high control FLINT counts - average of low control counts)] and fit to a quadratic model for tight binding inhibition in ABASE XE. The tight binding equation is: y = ((B/(2*C))*(((C-X)-A)+(((((x+A)-C)^ 2)+((4*A)*C))^ 0.5))); inv = (((((A*B)/y)- ((y*C)/B))+C)-A); res = (y-fit) where,
X = [inhibitor] (M)
Y = fraction activity remaining (vi/vo)
A = apparent Ki; converted to pKi = -log (apparent Ki)
B = uninhibited control, B = 1 if y value is set as Fractional Activity remaining, i.e. test sample net activity/control (no inhibitor) net activity (vi/vO) and average high control net activity = 1.
C = total active enzyme concentration (in M). By default, C is allowed to float during the ABASE initial fitting. If C < 0, manually apply the constraint where C is fixed to the calculated enzyme concentration (1 x 10-8 M) or actual active enzyme concentration based on a separate active site titration.
RESULTS - Section A
Benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate free base; and benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, free base, were each tested for inhibitory activity in vitro against the 3CL proteases from a and b coronaviruses with the following results:
Table 1
Figure imgf000037_0001
Figure imgf000038_0001
Antiviral Evaluations - Section B: in vitro cell based assays of SARS-CoVl and MERS with VeroE6 and MRC-5 cells
Protocol for SARS-CoV1 Coronavirus Cellular Assay
Compound was tested via cellular assays utilizing expression of coronavirus spike protein as an end point. VeroE6 cells (kidney epithelial cells extracted from an African green monkey derived from were infected with SARS-1 coronavirus. Compound with anti-viral activity reduced the expression of spike protein as measured immunologically, and cell viability as measured by nuclear integrity.
In preparation for the assays, test compound was serially diluted in 100% DMSO with a 3-fold 8- point curve for a top assay concentration of 50 uM. DMSO was normalized in reaction wells to a final concentration of 1%. Low control wells (100% CPE or 100% cytotoxicity) contained DMSO in the presence of virally infected cells.
VeroE6 Cells were treated with compound for 2 hours prior to infection with SARS-CoV1 at an MOI of 1. Virus was allowed to replicate for 48 hours, after which virus was inactivated with formalin. Infected cells were detected by immunostaining with anti-S protein antibodies and quantified by a PE Opera confocal platform. Signal for S protein staining was converted to % infection, and % inhibition was calculated using the positive and negative controls. EC50s were calculated with a standard equation using GeneData software.
Results - Section B
Benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate free base; and benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, free base were each also tested for inhibitory activity in a MERS cellular assay using Human lung fibroblast MRC-5 cells and exhibited the following EC50 values.
Table 2
Figure imgf000039_0001
Benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate free base; and benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, free base were each also tested for inhibitory activity in a MERS cellular assay using VeroE6 cells and exhibited the following EC50 values:
Table 3
Figure imgf000039_0002
Benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate free base; and benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, free base were each also tested for inhibitory activity in a SARS cellular assay using VeroE6 cells and exhibited the following EC50 values:
Table 4
Figure imgf000039_0003
B = benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate
Antiviral Evaluations - Section C: in vitro cell based assay of SARS-CoV1, SARS-CoV2, and MERSin Vero E6 Cells
Applicant separately evaluated compounds benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3- [(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4- (trifluoromethyl)piperidin-1-yl]ethyl]carbamate free base; and benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, free base for inhibitory effect against SARS-CoV-1, SARS-CoV-2 and MERS by CPE assay in Vero E6 cells as described below.
Materials and Methods for Coronavirus Assays
Benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate free base; and benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate free base were supplied as solids and diluted to either 50 mM or 10 mM stock solutions in DMSO and stored at 4°C until the day of the assays. A set of positive control antiviral compounds were included in each of the assays performed.
Virus Strains and Cell Lines
The viruses and cell lines utilized for these evaluations were obtained from WRCEVA and American Type Culture Collection (ATCC) (followed by sorting and sub-cloning cells for high expression of ACE2) as listed in Table 5 and Table 6, respectively. The evaluation was performed using a CPE reduction assay to measure antiviral effect and a cell viability assay to measure cytotoxic effect of compounds (non-GLP assays). The day of each assay, a pre-titered aliquot of virus was removed from the freezer (-80°C) and allowed to thaw to room temperature in a biological safety cabinet. The virus was re-suspended and diluted into tissue culture medium. Cells were sub-cultured twice a week at a split ratio of 1:2 to 1:5 using standard cell culture techniques and the cell culture media as specified below in Table 6. Total cell number and percent viability determinations were performed using a Luna cell viability analyzer and trypan blue dye exclusion. Cell viability was greater than 95% for the cells to be utilized in the assays (see Table 6 for the number of cells seeded per well for each assay).
Table 5. Virus Strain used for Antiviral Evaluations
Figure imgf000041_0001
Table 6. Cells and Media used for Antiviral Evaluations
Figure imgf000041_0002
Materials:
1. Corning 3764 BC black-walled, clear bottom and Greiner 784076 black-walled, low volume 384-plates 2. Promega CellTiter Glo (CTG) (G7573, Promega)
3. Media: a. MEM Gibco (#11095) b. HI FBS Gibco (#14000) c. Pen/Strep Gibco (#15140); 10U/ml penicillin and 10ug/ml streptomycin 4. PBS -/- (w/o Ca2+ or Mg2+)
5. Trypsin -EDTA Gibco (#25300-054)
6. Cells-Vero E6 cells selected for high ACE2 expression.
7. Positive controls: a. Calpain Inhibitor IV (Calbiochem #208724) b. Chloroquine (Applicant Repository) c. Remdesivir (Selleck)
Equipment:
1. Beckman FX
2. Echo and Thermo Combi Liquid handler
3. Matrix WellMate
4. Thermo Fisher Steri-Cult Incubator
5. Microplate Readers-Envision, Spectromax M2, M5 or Gemini or PheraSTAR
Compound preparation:
Compound stock solutions (50 μL at 10 or 50 mM in 100% DMSO) were transferred into wells of an empty ECFIO plate (stock plate). Compounds were diluted 3-fold by transferring 17 μL of each sample from the stock plate into an adjacent well containing 34 μL DMSO in each well and mixing. This process was repeated to create 8 more wells of serially diluted sample, each well containing a 3-fold diluted sample of the previous well. A 30 nL aliquot for each sample was dispensed into corresponding wells of assay ready plates using an ECFI0555 acoustic liquid handling system. The final assay concentration range was as follows: for 10 mM stocks, 10 - 0.0005 μM; for 50 mM stocks, 50 - 0.003 μM. DMSO was added to control wells to maintain a consistent assay concentration of 0.1% in all wells.
Method for measuring antiviral effect of compounds:
Vero E6 cells were grown in MEM supplemented with 10% HI FBS and harvested in MEM/1% PS supplemented 2% HI FBS on the day of assay. Assay ready plates pre-drugged with test compounds were prepared in the BSL-2 lab by adding 5μL assay media to each well. The plates and cells were then passed into the BSL3 facility. Cells were batch inoculated with appropriate coronavirus (SARS CoV-1, SARS CoV-2 or MERS) at M.O.I. ~ 0.002 which resulted in 5% cell viability 72 (for SARS) or 96 (for MERS) hours post infection. A 25μL aliquot of virus inoculated cells (4,000 Vero E6 cells/well) was added to each well in columns 3-24 of the assay plates. The wells in columns 23-24 contained only virus infected cells for the 0% CPE reduction controls. Prior to virus inoculation, a 25μL aliquot of cells was added to columns 1-2 of each plate for the cell only 100% CPE reduction controls. After incubating plates at 37°C/5%CO2 and 90% humidity for 72 hours, 30μL of Cell Titer-Glo (Promega) was added to each well. Luminescence was read using a Perkin Elmer Envision plate reader following incubation at room temperature for 10 minutes to measure cell viability. Plates were sealed with a clear cover and surface decontaminated prior to luminescence reading.
Method for measuring cytotoxic effect of compounds: Compound cytotoxicity was assessed in a BSL-2 counter screen as follows: VeroE6 cells in media were added in 25μl aliquots (4,000 cells/well) to each well of assay ready plates prepared with test compounds as above. Cells only (100% viability) and cells treated with hyamine at 100 μM final concentration (0% viability) serve as the high and low signal controls, respectively, for cytotoxic effect in the assay. DMSO was maintained at a constant concentration for all wells as dictated by the dilution factor of stock test compound concentrations. After incubating plates at 37°C/5%CO2 and 90% humidity for 72 hours, 30μl Cell Titer-Glo (Promega) was added to each well. Luminescence was read using a BMG PHERAstar plate reader following incubation at room temperature for 10 minutes to measure cell viability. RESULTS - Section C
Summary data for the reference compounds and test articles is provided in Table 7-9 and 10-13. Table 14 shows the comprehensive data from all four assays.
Table 7. Antiviral activity of Reference Compounds in the SARS-CoV-1 CPE assay
Figure imgf000043_0001
Table 8. Antiviral activity of Reference Compounds in the SARS-CoV-2 CPE assay
Figure imgf000043_0002
Table 9. Antiviral activity of Reference Compounds in the MERS CPE assay (Standard Incubation)
Figure imgf000043_0003
Table 10. Antiviral activity of Test Compounds in the SARS-CoV-1 CPE assay
Figure imgf000044_0001
* A = benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl>butyl]carbamoyl>-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate
B = benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl>-3-methylbutyl]carbamoyl>-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate
Table 11. Antiviral activity of Test Compounds in the SARS-CoV-2 CPE assay
Figure imgf000044_0002
* A = benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl>butyl]carbamoyl>-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate
B = benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl>-3-methylbutyl]carbamoyl>-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate
Table 12. Antiviral activity of Test Compounds in the MERS CPE assay (Standard Incubation)
Figure imgf000044_0003
* A = benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl>butyl]carbamoyl>-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate
B = benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl>-3-methylbutyl]carbamoyl>-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate
Table 13. Comparison of Antiviral activity of sponsor's Compounds in the MERS CPE assay (Standard vs preincubation method**)
Figure imgf000044_0004
* A = benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl>butyl]carbamoyl>-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate
B = benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl>-3-methylbutyl]carbamoyl>-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate
** Preincubation Method modification: Uninfected cells in 25 μL media were added to predrugged assay ready plates and incubated for four hours before adding 5 μL MERS virus diluted in media.
Table 14. Comprehensive Overview of Antiviral activity of Test Compounds in the SARS-Co V-l, SARS-Co V- 2, MERS
Figure imgf000044_0005
Figure imgf000045_0001
Antiviral E valuations - Section D: In vitro inhibition of SARS-Co V2 in ALI Model
Applicant separately evaluated compounds benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3- [(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4- (trifluoromethyl)piperidin-1-yl]ethyl]carbamate free base; and benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, free base for inhibitory effect against SARS-CoV-1, SARS-CoV-2 and MERS by CPE assay in air-liquid interface (ALI) assays using human lung cells as described below:
Primary human lung cells were used to evaluate test compounds in an air-liquid interface assay essentially as describe by Randell, S. H and Fulcher, M. L. (eds) in Chapter Eight of Epithelial Cell Culture Protocols: Second Edition, Methods in Molecular Biology, vo. 945, DOI 10.1007/978-1-62703-125-7_8 © Springer Science+Business Media, LLC 2012. In short, HBE cells are isolated from the trachea regions as well as the upper bronchus. If possible, branches are isolated that are approximately 2mm. All cells are all pooled together during these isolations. Resulting cells are grown on a porous support at an air-liquid interface undergo mucociliary differentiation, which reproduces both in vivo morphology and key physiologic processes in the cells. The ALI assay was used as another means to evaluate the antiviral activity of the test compounds described herein against SARS-CoV-2, using essentially the protocol for evaluating SARS-CoV infection as described by Sims, A. C. et al. in J. Virol(Dec 2005), vol. 79 (24), p. 15511-15524 ("Severe Acute Respiratory Syndrome Coronavirus Infection of Human Ciliated Airway Epithelia: Role of Ciliated Cells in Viral Spread in the Conducting Airways of the Lungs"), 0022- 538X/05/$08.00+0 doi:10.1128/JVI.79.24.15511-15524.2005. Prmary lung cells (Marsico Lung Institute) were cultured essentially as described by Randell and Fulcher, and infected wih SARS-CoV-2 essentially as described by Sims et al., with a MOI of 0.5. Test compounds dissolved in dimethylsulfoxide (DMSO), at doses of 0.04, 0.12, 0.37, 1.1, 3.3, 10 and 30 μM, were administered for 48 hours, and antiviral activity was evaluated by plaque assay compared to controls with 10 μM remdesivir, virus in DMSO solvent and DMSO solvent alone controls.
RESULTS - Section D
Results are shown in FIG. 1. As can be seen, Compound A (GSKE in FIG. 1) shows antiviral activity comparable to 10 μM remdesivir (RDV in FIG. 1) at concentrations of 3.3, 10 and 30 μM, with measurable antiviral activity also seen at 1.1 μM GSKE). Each symbol in FIG. 1 represents the titer from one culture, and the dotted line at the median represents the level of detection (LOD = 50PFU).
Antiviral Evaluations - Section E: In vitro inhibition of SARS-CoV2 in Caiu3 Cells (Operetta High Content Imaging System)
Applicants separately evaluated test compound benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo- 3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4- (trifluoromethyl)piperidin-1-yl]ethyl]carbamate free base; and/or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, free base for inhibitory effect against SARS-CoV-1, SARS-CoV-2 and MERS by CPE assay in a cellular assay using Calu3 immortilized human lung cells as described below:
Protocol for SARS-CoV-2 Coronavirus Cellular Assay
Test compound was tested via cellular assays utilizing expression of coronavirus N protein and cell nuclei as end points for imaging (indicators of efficacy and toxicity respectively). Calu3 cells (ATCC, FITB- 55) were infected with SARS-CoV-2 coronavirus (βCoV/KOR/KCDC03/2020). Compound with anti-viral activity reduced the expression of N protein, shown below, as measured immunologically.
In preparation for the assay, ten-point, three-fold dose-response curves (DRCs) were generated for the test compound in DMSO with compound concentrations ranging from 0.0025 to 50 μM.
Calu-3 cells were seeded at 2.0 x 104 cells per well in Eagle's Minimum Essential Medium (EMEM, ATCC) supplemented with 20% heat-inactivated fetal bovine serum (FBS), 1% MEM-Non-Essential Amino Acid solution (Gibco) and 1X Antibiotic-Antimycotic solution (Gibco) in black , 384-well, μCIear plates (Greiner Bio-One) 24 hours before the experiment. The cells were maintained at 37°C with 5% CO2.
The cells were treated with test compound at concentrations ranging from 0.0025 to 50 μM for 1 to 48 hours prior to infection with SARS-CoV-2 at an MOI of 0.03. DMSO was normalized in reaction wells to a final concentration of 0.5%. The plates were incubated at 37°C for 24 hours before fixing with 4% paraformaldehyde (PFA), 0.25% tritonX-100 solution.
Anti-SARS-CoV-2 Nucleocapsid (N) primary antibody, 488-conjugated goat anti-rabbit IgG secondary antibody and Hoechst 33342 was added prior to immunofluorescence. Images were acquired with an Operetta high-throughput imaging device (Perkin Elmer) and analyzed using the Columbus software (Perkin Elmer) to quantify cell numbers and infection ratios. Antiviral activity was normalized to infection control (0.5% DMSO) in each assay plate. Cell viability was measured by counting nucleus in each wells and normalizing it to the infection control. IC50 values were calculated using nonlinear regression analysis - log[inhibitor] vs. response - Variable slope (four parameters). All IC50 values were measured in triplicate. RESULTS - Section E
Table 15
Figure imgf000047_0001
Antiviral Evaluations - Section F: In vitro inhibition of SARS-CoV2 in Caiu3 and HeLa-ACE2 Cell lines - IF
Applicants separately evaluated test compound benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo- 3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4- (trifluoromethyl)piperidin-1-yl]ethyl]carbamate free base; and benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2- yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, free base for inhibitory effect against SARS-CoV-1, SARS-CoV-2 and MERS by CPE assay in a cellular assay using a HeLa- ACE2 immortilized human cervical cell line over-expressing ACE2 (angiotensin converting enzyme 2), as described below.
SARS-CoV-2/ HeLa-ACE2 high-content screening assay
Compounds were acoustically transferred into 384-well μclear-bottom plates (Greiner, Part. No. 781090-2B) and HeLa-ACE2 cells were seeded in the plates in 2% FBS at a density of 1.0x103 cells per well. Plated cells were transported to the BSL3 facility where SARS-CoV-2 (strain USA-WA1/2020 propagated in Vero E6 cells) diluted in assay media is added to achieve ~30 - 50% infected cells. Plates were incubated for 24 h at 34°C 5% CO2, and then fixed with 8% formaldehyde. Fixed cells were stained with human polyclonal sera as the primary antibody, goat anti-human H+L conjugated Alexa 488 (Thermo Fisher Scientific A11013) as the secondary antibody, and antifade-46-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific D1306) to stain DNA, with PBS 0.05% Tween 20 washes in between fixation and subsequent primary and secondary antibody staining.
Plates were imaged using the ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) with a 10x objective, with 4 fields imaged per well. Images were analyzed using the Multi-Wavelength Cell Scoring Application Module (MetaXpress), with DAPI staining identifying the host- cell nuclei (the total number of cells in the images) and the SARS-CoV-2 immunofluorescence signal leading to identification of infected cells.
Uninfected host cell cytotoxicity counter screen Compounds were acoustically transferred into 1,536-well μclear plates (Greiner Part. No. 789091). HeLa-ACE2 cells were maintained as described for the infection assay and seeded in the assay-ready plates at 400 cells/well in DMEM with 2% FBS. Plates were incubated for 24 hours at 37°C 5% CO2. To assess cell viability, the Image-iT DEAD green reagent (Thermo Fisher) was used according to manufacturer instructions. Cells were fixed with 4% paraformaldehyde, and counterstained with DAPI. Fixed cells were imaged using the ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) with a 10x objective, and total live cells per well quantified in the acquired images using the Live Dead Application Module (MetaXpress).
Data analysis
Primary in vitro screen and the host cell cytotoxicity counter screen data were uploaded to Genedata Screener, Version 16.0. Data were normalized to neutral (DMSO) minus inhibitor controls (2.5 μM remdesivir for antiviral effect and 10 μM puromycin for infected host cell toxicity). For the uninfected host cell cytotoxicity counter screen 40 μM puromycin (Sigma) was used as the positive control. For dose response experiments compounds were tested in technical triplicates on different assay plates and dose curves were fitted with the four parameter Hill Equation.
SARS-CoV-2/Calu-3 high-content screening assay
Compounds were acoustically transferred into 384-well μclear-bottom plates (Greiner, Part. No. 781090-2B) before seeding Calu-3 cells in assay media (MEM with 2% FBS) at a density of 5,000 cells per 20 μL per well. The plated cells were transported to the BSL3 facility where SARS-CoV-2 (strain USA- WAl/2020 propagated in Vero E6 cells) diluted in assay media was added at an MOI between 0.75 and 1 to achieve ~30 - 60% infected cells. Plates were incubated for 48 h at 34°C 5% CO2, and then fixed with a final concentration of 4% formaldehyde. Fixed cells were stained with human polyclonal sera as the primary antibody, goat anti-human H+L conjugated Alexa 488 (Thermo Fisher Scientific A11013) as the secondary antibody, and antifade-46-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific D1306) to stain DNA, with PBS 0.05% Tween 20 washes in between fixation and subsequent primary and secondary antibody staining.
Plates were imaged using the ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) with a 10x objective, with 4 fields imaged per well. Images were analyzed using the Multi-Wavelength Cell Scoring Application Module (MetaXpress), with DAPI staining identifying the host- cell nuclei (the total number of cells in the images) and the SARS-CoV-2 immunofluorescence signal leading to identification of infected cells.
Uninfected host cell cytotoxicity counter screen
Compounds were acoustically transferred into 1,536-well plates (Corning No. 9006BC) before seeding Calu-3 cells in assay media (MEM with 2% FBS) at a density of 600 cells per 5 μL per well. Plates were incubated for 48 hours at 37°C 5% CO2. To assess cell viability, 2 μL of 50% Cell-Titer Glo (Promega No G7573) diluted in water was added to the cells and luminescence measured on an EnVision Plate Reader (Perkin Elmer)
Data analysis
Data from the SARS-CoV-2 antiviral assay and host cell cytotoxicity counter screen were uploaded to Genedata Screener, Version 16.0. For the SARS-CoV-2 antiviral readout, the % CoV-2 positive cells are normalized to neutral (DMSO) minus inhibitor controls (10 μM remdesivir). For the cell count readout, the total cells were normalized to the stimulator (10 μM remdesivir) minus neutral control (DMSO). The uninfected host cell cytotoxicity counter screen was normalized to neutral (DMSO) minus inhibitor control (30 μM puromycin). For dose response experiments, compounds were tested in technical triplicates on different assay plates and dose curves were fitted with the four parameter Hill Equation. Curves were fitted as either increasing or decreasing and noted as such in the data output. This is of particular note for the cell count readout from the SARS-CoV-2 infection assay which captured both an antiviral effect, protection from virus-induced cell death (increasing), and cellular toxicity (decreasing). HeLa-ACE2 cells were infected with SARS-CoV-2 virus at a MOI of between 0.3-0.5 in the presence of test compounds, and viral infection was quantified 24 hours later. Immunofluorescent (IF) detection of SARS-CoV-2 proteins with sera purified from patients exposed to the virus was used as the efficacy endpoint of antiviral activity of test compounds, which together with host cell nuclear staining allowed for quantification of the percent infected cells in each well and calculation of IC50 values.
RESULTS - Section F
Table 16 - HeLa-ACE2 Cells
Figure imgf000049_0001
Figure imgf000049_0002
Antiviral Evaluations - Section G: In vitro inhibition of OC43 in MRC-5/Huh7 cell lines and 229e in MRC5 Cells
HCoV OC43 assay
In 96-well plates, MRC-5 or Huh7 cells will be seeded at an appropriate density and cultured at 37°C and 5% CO2 overnight. The medium in each well will be replenished with medium containing serially diluted compounds (8 doses, in duplicate wells) and virus. The resulting cultures will be kept under at 33 °C and 5% CO2 for additional 4 days (MRC5) or 7 days (Huh7). Endpoint measured will be cytopathic effect of the virus.
Cytotoxicity of compounds will be assessed under the same conditions, but without virus infection, in parallel. Cell viability will be measured with CellTiter Glo (Promega) following the manufacturer's manual. For qPCR assays, the supernatants will be collected. Viral RNA will be extracted and quantified by the absolute RT-qPCR assay. EC50 and CC50 values will be calculated with the GraphPad Prism software. Samples will be run alongside a remdesivir reference compound.
HCoV 229E assay
In 96-well plates, MRC-5 will be seeded at an appropriate density and cultured at 37°C and 5% CO2 overnight. The medium in each well will be replenished with medium containing serially diluted compounds (8 doses, in duplicate wells) and virus. The resulting cultures will be kept under at 35 °C and 5% CO2 for additional 3 days.
Cytotoxicity of compounds will be assessed under the same conditions, but without virus infection, in parallel. Cell viability will be measured with CellTiter Glo (Promega) following the manufacturer's manual. For qPCR assays, the supernatants will be collected. Viral RNA will be extracted and quantified by the absolute RT-qPCR assay. EC50 and CC50 values will be calculated with the GraphPad Prism software. Samples will be run alongside a remdesivir reference compound.
Results - Section G
Table 18 - Coronavirus OC43 and 229e (cytopathic effect measure)
Figure imgf000050_0001
Table 19 - Coronavirus OC43 (viral RNA measure)
Figure imgf000051_0001
Antiviral Evaluations - Section H: In vitro inhibition of SARS-CoV2 in Vero cells Cell culture
VeroE6 cells were cultivated biweekly 1:4-1 :5 passage in filtered (0.22μm) DMEM (Gibco) supplemented with 10% FBS (Gibco, Origin Brazil) and Penicillin/Streptomycin (Sigma) 1% (assay Media), using PBS (Gibco) and trypsin (Gibco) to detach. Virus SARS Cov 2 (NY isolate) from BEI was frozen in OPTIPRO-0.5%GELATINE stock. MDR1 inhibitor Elacridar was synthesized internally and stocks prepared to 10 mM final concentration in DMSO.
For 96-well plates
Vero E6 cells were detached using 4mL of trypsin during 5 min for T175 cm2 FLASK, neutralized using 16 mL of assay media, centrifuged and resuspend in assay media 10 mL /Flask 50 μL of cells were added to 10 mL CASYTON contained in a CASYCUP and cells were counted in CASY system, measuring cells number between 8 and 25 μm.
A cell solution with a final cell concentration of 2e5 cells/ml was prepared.
Virus was taken from the freezer following the established work protocol for a BSL3 facility and thawed at RT.
A -4 virus dilution was prepared adding 1 μL of virus stock per 10mL of assay media.
Control 2 was prepared adding the same volume of assay media and cells to a final concentration of 1 e5 cells/mL, and Elacridar (MDR1 inhibitor) was added to a final concentration of 1 μM.
Test compounds were serially diluted in a 10 point curve. Plates for the assay contained a serial dilution of test compounds from columns 1 to 10 to allow testing at final concentrations between 50 uM and 0.0025 uM.
Control 1 was prepared adding cells and virus in 1:1 proportion (veroE6 final concentration le5 cells/mL; virus 0.5 μL from stock to 10 mL of final solution), and Elacridar (MDR1 inhibitor) to a final concentration of 1 μM.
200 μL of Control 2 solution was dispensed to column 12 in predispensed 96 well plates (Costar 3399) using Multidrop combi (speed slow). 200 μL of Control 1 solution was dispensed to columns 1 to 11 in predispensed 96 well plates (Costar 3399) using Multidrop combi (speed slow).
Plates were incubated at 5%C02, 37°C for 3 days, following requirement of a BSL3 lab.
After this incubation time, 2 sequential additions were made using a multidrop combi:
- 25 μL of FA 36% and
10 μL of a solution of PBS (Gibco) and Draq5 50 μM (biostatus)
Plates were sealed and cleaned to leave the BSL3 facilities, following approved protocols.
Plates were imaged in the Opera Phenix and stored and analysed in Columbus.
For 384 plates
Vero E6 cells were detached using 4 mL of trypsin during 5 min for T175 cm2 FLASK, neutralized using 16 mL of assay media, centrifuged and resuspend in assay media 10 mL /Flask.
50 μL of cells were added to 10 mL CASYTON contained in a CASYCUP and cells were counted in CASY system, measuring cells number between 8 and 25 μm.
A cell solution with a final cell concentration of 2e5 cells/ml was prepared.
Virus was taken from the freezer following the established work protocol for a BSL3 facility and thawed at RT.
A -3 virus dilution was prepared adding 1 μL of virus stock per 1 mL of assay media.
Control 2 was prepared adding the same volume of assay media and cells to a final concentration of 1 e5 cells/mL, and Elacridar (MDR1 inhibitor) was added to a final concentration of 1 μM.
Test compounds were serially diluted in a 10 point curve. Plates for the assay contained a serial dilution of test compounds to allow testing at final concentrations between 50 uM and 0.0025 uM.
Control 1 was prepared adding cells and virus in 1:1 proportion (veroE6 final concentration le5 cells/mL; virus 0.5 μL from stock to 1 mL of final solution), and Elacridar (MDR1 inhibitor) to a final concentration of 1 μM.
50 μL Control 2 solution was dispensed to column 18 in predispensed 384 well plates (Greiner 781091) using Multidrop combi (speed slow).
50 μL Control 1 solution was dispensed to columns 1 to 17 and 19 to 24 in predispensed 384 well plates (Greiner 781091) using Multidrop combi (speed slow).
Plates incubate at 5%C02, 37°C for 3 days, following requirement of a BSL3 lab.
After this incubation time, 50 μL of PBS containing Formaldehyde 8% and Draq5 2 μM (biostatus) were added to each well.
Plates were sealed and cleaned to leave the BSL3 facilities, following approved protocols.
Plates were imaged in the Opera Phenix and analysed in Columbus. Results - Section H
Table 20 - SARS-CoV2 + MDR1 inhibitor
Figure imgf000053_0001
The demonstrated activity in cells demonstrate cellular penetration by the compound.
Applicant also performed a comparison of the coding nucleotide sequence and amino acid sequence of the 3-CL protease from 44 severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) strains. These were collected from diverse geographical locations including China, Hong Kong, Australia, Japan (some cruise ship subjects) and USA (15 strains). This showed that the 3CL Protease is 100 % identical across all strains at both nucleotide and amino acid levels. SEQUENCE LISTING
SEQ ID NO:l: N1 forward primer 5' GACCCCAAAATCAGCGAAAT 3'
SEQ ID NO:2: N1 reverse primer 5' TCTGGTTACTGCCAGTTGAATCTG 3' SEQ ID NO: 3: N1 Probe Sequence
5' FAM-ACCCCGCATT ACGTTTGGTGGACC-BHQ- 1 3'
SEQ ID NO: 4: N2 forward primer 5' TTACAAACATTGGCCGCAAA 3'
SEQ ID NO: 5: N2 reverse primer 5' GCGCGACATTCCGAAGAA 3'
SEQ ID NO: 6 N2 Probe Sequence
5' FAM -ACAATTTGCCCCCAGCGCTTCAG- BHQ- 1 3'
SEQ ID NO: 7: FRET substrate peptide for coronavirus OC43 3CL and 229E protease enzyme assays FAM -VARLQSG FG-TAMRA SEQ ID NO: 8: FRET substrate peptide for SARS coronavirus 3CL protease enzyme assay FAM-KTSAVLQSGFRKM E-TAMRA
SEQ ID NO: 9 FRET substrate peptide for SARS-Coronavirus-2 3CL, 229E Method 2 and SARS coronavirus 3CL Method 2 Protease Enzyme Assay H i Lyte488- ESATLQSG LRKAK-QXL520

Claims

1. A compound or pharmaceutically acceptable salt which is selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate, or a pharmaceutically acceptable salt thereof, for use in the treatment or prevention of COVID-19.
2. A compound or pharmaceutically acceptable salt thereof for use according to claim 1, wherein the use is prevention of COVID-19 in a subject at risk of infection with SARS-CoV-2.
3. A compound or pharmaceutically acceptable salt thereof for use according to claim 2, wherein the subject is: a close contact of a patient infected with SARS-CoV-2 ; in a high risk category; or a healthcare professional.
4. A compound or pharmaceutically acceptable salt thereof for use according to claim 1, wherein the use is treating COVID-19 in a subject infected with SARS-CoV-2.
5. A compound or pharmaceutically acceptable salt thereof for use according to claim 4, wherein the subject is a subject infected with SARS-CoV-2 who tests positive for SARS-CoV-2 who had previously received a SARS-CoV-2 vaccine.
6. A compound or pharmaceutically acceptable salt thereof for use according to claim 4, wherein the subject was identified as being infected with SARS-CoV-2 by detection of viral RNA from SARS-CoV- 2 from a specimen obtained from the subject, wherein the subject is a human.
7. A compound or pharmaceutically acceptable salt thereof for use according to claim 4, wherein the subject was identified by detection of SARS-CoV-2 antigen using a rapid diagnostic test (RDT) from a specimen from the subject.
8. A compound or pharmaceutically acceptable salt thereof for use according to any one of claims 1-4, wherein COVID-19 in the subject infected with SARS-CoV-2 is associated with pneumonia.
9. A compound or pharmaceutically acceptable salt thereof for use according to any one of claims 1 to 4, wherein COVID-19 in the subject infected with SARS-CoV-2 is associated with acute respiratory distress disorder.
10. A compound or pharmaceutically acceptable salt thereof for use according to any one of claims 4 through 9, wherein the subject infected with SARS-CoV-2 is undergoing extra-corporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, or receiving oxygen therapy.
11. A compound or pharmaceutically acceptable salt thereof for use according to any one of claims 4 through 10, wherein the subject infected with SARS-CoV-2 is receiving anti-viral and or steroid treatment wherein the anti-viral or steroid treatment is treatment with an agent other than benzyl N-[(1S)-1- {[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2- yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo- 3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-
1-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof.
12. A compound or pharmaceutically acceptable salt thereof for use according to claim 11, wherein the subject infected with SARS-CoV-2 is receiving an anti-viral agent.
13. A compound or pharmaceutically acceptable salt thereof for use according to claim 12, wherein the anti-viral agent is selected from remdesivir, ganciclovir, lopinavir, olsetemivir ritonavir and zanamivir.
14. A compound or pharmaceutically acceptable salt thereof for use according to any preceding claim, wherein the compound or pharmaceutically acceptable salt is administered via inhalation, subcutaneous, intravenous or oral administration.
15. A method for treating or preventing COVID-19 in a subject asymptomatic for COVID-19, the method comprising: administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt thereof to the subject asymptomatic for COVID-19 which is selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-
2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof.
16. A method for preventing transmission of SARS-CoV-2 by a subject asymptomatic for COVID-19, the method comprising: administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt thereof to the subject asymptomatic for COVID-19 which is selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan- 2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof.
17. A method for treating or preventing COVID-19 in a subject infected with SARS-CoV-2 or at risk of infection with SARS-CoV-2, the method comprising: administering a therapeutically effective amount of a compound or pharmaceutically acceptable salt thereof which is selected from: benzyl N-[(1S)-1-{[(1S)-3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2- yl)carbamoyl]propan-2-yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1- yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-
2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin-1-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof.
18. The method according to claim 17, wherein the subject is at risk of infection with SARS-CoV-2 and the method comprises prevention of COVID-19 in the subject at risk of infection with SARS-CoV-2.
19. The method according to claim 18, wherein the subject is: a close contact of a patient infected with SARS-CoV-2; in a high risk category; or a healthcare professional.
20. The method according to claim 17, wherein the subject is infected with SARS-CoV-2 and the method comprises treating COVID-19 in the subject infected with SARS-CoV-2.
21. The method according to claim 17 wherein the subject is a subject infected with SARS-CoV-2 who tests positive for SARS-CoV-2 who had previously received a SARS-CoV-2 vaccine.
22. The method according to claim 20, wherein the subject was identified as being infected with SARS-CoV-2 by detection of viral RNA from SARS-CoV-2 from a specimen obtained from the subject.
23. The method according to claim 20, wherein the subject was identified by detection of SARS-CoV- 2 antigen using a rapid diagnostic test (RDT) from a specimen from the subject.
24. The method according to claim 22, wherein the subject is a human.
25. The method according to any one of claims 17 through 24, wherein COVID-19 in the subject infected with SARS-CoV-2 is associated with pneumonia.
26. The method according to any one of claims 17 through 24, wherein COVID-19 in the subject infected with SARS-CoV-2 is associated with acute respiratory distress disorder.
27. The method according to any one of claims 17 through 24, wherein the subject infected with SARS-CoV-2 is undergoing extra-corporeal membrane oxygenation, mechanical ventilation, non-invasive ventilation, or receiving oxygen therapy.
28. The method according to any one of claims 17 through 24, wherein the subject infected with SARS-CoV-2 is receiving anti-viral and or steroid treatment.
29. The method according to claim 25 or claim 26, wherein the subject infected with SARS-CoV-2 is receiving an anti-viral agent wherein the anti-viral agent is an agent other than benzyl N-[(1S)-1-{[(1S)-
3-methyl-1-{[(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]-1-[(propan-2-yl)carbamoyl]propan-2- yl]carbamoyl}butyl]carbamoyl}-2-[4-(trifluoromethyl)piperidin-1-yl]ethyl]carbamate or a pharmaceutically acceptable salt thereof; or benzyl N-[(1S)-1-{[(1S)-1-{[(2S)-1-(butylcarbamoyl)-1-oxo- 3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl]carbamoyl}-3-methylbutyl]carbamoyl}-2-(4,4-difluoropiperidin- l-yl)ethyl]carbamate or a pharmaceutically acceptable salt thereof.
30. The method according to claim 29, wherein the anti-viral agent is selected from remdesivir, ganciclovir, lopinavir, olsetemivir ritonavir and zanamivir.
31. The method according to any of claims 17 through 30, wherein the compound or pharmaceutically acceptable salt is administered via inhalation.
32. The method according to any of claims 17 through 30, wherein the compound or pharmaceutically acceptable salt is administered parenterally.
PCT/IB2021/052460 2020-03-26 2021-03-24 Tripeptides derivatives for treating sars-cov-2 infections WO2021191827A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063000175P 2020-03-26 2020-03-26
US202063000188P 2020-03-26 2020-03-26
US63/000,175 2020-03-26
US63/000,188 2020-03-26

Publications (1)

Publication Number Publication Date
WO2021191827A1 true WO2021191827A1 (en) 2021-09-30

Family

ID=75252600

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2021/052460 WO2021191827A1 (en) 2020-03-26 2021-03-24 Tripeptides derivatives for treating sars-cov-2 infections

Country Status (2)

Country Link
TW (1) TW202202167A (en)
WO (1) WO2021191827A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11312704B2 (en) 2020-04-17 2022-04-26 Pardes Biosciences, Inc. Inhibitors of cysteine proteases and methods of use thereof
US11524940B1 (en) 2020-06-09 2022-12-13 Pardes Biosciences, Inc. Inhibitors of cysteine proteases and methods of use thereof
WO2024078294A1 (en) * 2022-10-13 2024-04-18 广东众生睿创生物科技有限公司 Amorphous form of ketoamide derivative, and preparation method therefor

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018042343A2 (en) 2016-08-30 2018-03-08 Glaxosmithkline Intellectual Property (No.2) Limited Compounds that inhibit 3c and 3cl proteases and methods of use thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018042343A2 (en) 2016-08-30 2018-03-08 Glaxosmithkline Intellectual Property (No.2) Limited Compounds that inhibit 3c and 3cl proteases and methods of use thereof

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
"Methods in Molecular Biology", vol. 945, 2012, SPRINGER SCIENCE+BUSINESS MEDIA, LLC, article "Epithelial Cell Culture Protocols"
"Solubilizing excipients in oral and injectable formulations", PHARMACEUTICAL RESEARCH, vol. 21, no. 2, 2004, pages 201 - 230
CHAN ET AL., J CLIN MICROBIOL, 2020
CORMAN ET AL., EUROPEAN COMMUNICABLE DISEASE BULLETIN, 2020
IVES ET AL.: "Dry powder inhaled compound delivery for early pre-clinical in vivo efficacy studies", JOURNAL OF INFLAMMATION, vol. 10, 2013, pages 36
JOURNAL OF MEDICINAL CHEMISTRY, vol. 48, no. 22, 2005, pages 6767 - 6771
LI, T.LIU, D.YANG, Y. ET AL.: "Phylogenetic supertree reveals detailed evolution of SARS-CoV-2", SCI REP, vol. 10, 2020, pages 22366, Retrieved from the Internet <URL:https://doi.org/10.1038/s41598-020-79484-8>
R. G. STRICKLY: "Solubilizing Excipients in oral and injectable formulations", PHARMACEUTICAL RESEARCH, vol. 21, no. 2, 2004, pages 201 - 230
SIMS, A. C. ET AL.: "Severe Acute Respiratory Syndrome Coronavirus Infection of Human Ciliated Airway Epithelia: Role of Ciliated Cells in Viral Spread in the Conducting Airways of the Lungs", J. VIROL, vol. 79, no. 24, December 2005 (2005-12-01), pages 15511 - 15524
ZHANG LINLIN ET AL: "[alpha]-Ketoamides as Broad-Spectrum Inhibitors of Coronavirus and Enterovirus Replication: Structure-Based Design, Synthesis, and Activity Assessment", JOURNAL OF MEDICINAL CHEMISTRY, vol. 63, no. 9, 11 February 2020 (2020-02-11), US, pages 4562 - 4578, XP055806728, ISSN: 0022-2623, Retrieved from the Internet <URL:https://pubs.acs.org/doi/pdf/10.1021/acs.jmedchem.9b01828> DOI: 10.1021/acs.jmedchem.9b01828 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11312704B2 (en) 2020-04-17 2022-04-26 Pardes Biosciences, Inc. Inhibitors of cysteine proteases and methods of use thereof
US11472793B2 (en) 2020-04-17 2022-10-18 Pardes Biosciences, Inc. Inhibitors of cysteine proteases and methods of use thereof
US11524940B1 (en) 2020-06-09 2022-12-13 Pardes Biosciences, Inc. Inhibitors of cysteine proteases and methods of use thereof
WO2024078294A1 (en) * 2022-10-13 2024-04-18 广东众生睿创生物科技有限公司 Amorphous form of ketoamide derivative, and preparation method therefor

Also Published As

Publication number Publication date
TW202202167A (en) 2022-01-16

Similar Documents

Publication Publication Date Title
WO2021191827A1 (en) Tripeptides derivatives for treating sars-cov-2 infections
Hosoki et al. Molecular mechanisms and epidemiology of COVID-19 from an allergist’s perspective
CN116236580B (en) Application of old medicines such as auranofin and the like and compositions thereof in resisting single positive strand RNA viruses
Choudhary et al. Insights of severe acute respiratory syndrome coronavirus (SARS-CoV-2) pandemic: a current review
US11364227B2 (en) Sphingosine kinase 2 inhibitor for treating coronavirus infection
US11730723B2 (en) Compounds and methods for treating viral infections
CN112516143A (en) Application of dibenzyl tetrahydroisoquinoline derivative in preparation of anti-coronavirus medicines
JP2023516628A (en) Use of Nucleotide-Based Compounds to Treat Coronavirus Infections
Athari et al. Updates on coronavirus (COVID-19) and kidney.
WO2021211738A1 (en) Methods and compositions for antiviral treatment
Far et al. Spike protein and its proteases role in SARS-COV-2 pathogenicity and treatment; a review
US20230149429A1 (en) Use of a nitrogen-containing bisphosphonate in combination with a glucocorticoid in preventing or treating viral pneumonia
US11592445B2 (en) OLFR90 specificity and methods of detection
US20240066037A1 (en) Cathepsin inhibitors for preventing or treating viral infections
US20210338690A1 (en) Compounds and methods for prevention and treatment of coronavirus infections
US20240165096A1 (en) Anti Viral Therapy
Kaka et al. The Origin, Transmission, and Clinical Therapies in the Management of Coronavirus Diseases
US20230310369A1 (en) Method and composition for inhibiting virus infection
US20240207297A1 (en) Treatment for viral infection with polyene macrolide antibiotic
US11471448B2 (en) Sphingosine kinase 2 inhibitor for treating coronavirus infection in moderately severe patients with pneumonia
Sun et al. In vitro antiviral effect of fructopyrano-(1-4)-glucopyranose from Radix isatidis on infuenza virus A
Athari et al. Journal of Nephropathology
US20230158102A1 (en) Compounds for use in the treatment of coronavirus infection
KR20230128752A (en) COMPOSITION FOR ANTIVIRAL ACTIVITY COMPRISING Ipratropium
EP4000620A1 (en) Lactam and lactone derivatives for use in the treatment of a viral infection such as covid-19

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21714690

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21714690

Country of ref document: EP

Kind code of ref document: A1