WO2022178298A1 - Methods for treating sensorineural hearing loss using otoferlin dual vector systems - Google Patents

Methods for treating sensorineural hearing loss using otoferlin dual vector systems Download PDF

Info

Publication number
WO2022178298A1
WO2022178298A1 PCT/US2022/017058 US2022017058W WO2022178298A1 WO 2022178298 A1 WO2022178298 A1 WO 2022178298A1 US 2022017058 W US2022017058 W US 2022017058W WO 2022178298 A1 WO2022178298 A1 WO 2022178298A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
otof
sequence
promoter
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/017058
Other languages
English (en)
French (fr)
Inventor
Adam Palermo
Ning Pan
Arun SENAPATI
Jonathon WHITTON
Xichun Zhang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Decibel Therapeutics Inc
Original Assignee
Decibel Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Decibel Therapeutics Inc filed Critical Decibel Therapeutics Inc
Priority to KR1020237031961A priority Critical patent/KR20240004253A/ko
Priority to US18/277,858 priority patent/US20240148905A1/en
Priority to JP2023550062A priority patent/JP2024507837A/ja
Priority to MX2023009714A priority patent/MX2023009714A/es
Priority to CN202280028998.9A priority patent/CN117295529A/zh
Priority to EP22757028.0A priority patent/EP4294460A4/en
Publication of WO2022178298A1 publication Critical patent/WO2022178298A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/16Otologicals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/072Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/40Systems of functionally co-operating vectors

Definitions

  • compositions and methods for the treatment of sensorineural hearing loss and auditory neuropathy particularly forms of the disease that are associated with mutations in otoferlin (OTOF) in a human subject 25 years of age or older, by way of OTOF gene therapy.
  • the disclosure provides dual vector systems that include a first nucleic acid vector that contains a polynucleotide encoding an N-terminal portion of an OTOF protein and a second nucleic acid vector that contains a polynucleotide encoding a C-terminal portion of an OTOF protein. These vectors can be used to increase the expression of or provide wild-type OTOF to a subject, such as a human subject suffering from sensorineural hearing loss.
  • Sensorineural hearing loss is a type of hearing loss caused by defects in the cells of the inner ear or the neural pathways that project from the inner ear to the brain.
  • sensorineural hearing loss is often acquired, and can be caused by noise, infections, head trauma, ototoxic drugs, or aging, there are also congenital forms of sensorineural hearing loss associated with autosomal recessive mutations.
  • One such form of autosomal recessive sensorineural hearing loss is associated with mutation of the otoferlin (OTOF) gene, which is implicated in prelingual nonsyndromic hearing loss.
  • OTOF otoferlin
  • the present invention provides compositions and methods for treating a human subject 25 years of age or older having biallelic otoferlin (OTOF) mutations, which are known to cause hearing loss and auditory neuropathy.
  • the compositions described herein can be used to deliver wild-type (WT) OTOF to the subject by way of gene therapy, and can, therefore, be used to treat hearing loss and auditory neuropathy in the subject.
  • WT wild-type
  • Gene therapy for treating biallelic OTOF mutations is thought to be needed during the first year of life to restore hearing; however, the present inventors have determined that gene therapy can restore hearing that is lost due to biallelic OTOF mutations even if treatment is begun much later in life.
  • compositions described herein can also be used to treat a subject having biallelic OTOF mutations that is identified as having detectable otoacoustic emissions, detectable cochlear microphonics, and/or detectable summating potential.
  • the invention provides a method of treating a human subject 25 years of age or older having biallelic otoferlin (OTOF) mutations by administering to the subject a therapeutically effective amount of a dual vector system including: a first nucleic acid vector containing a promoter operably linked to a first coding polynucleotide that encodes an N-terminal portion of an OTOF protein; and a second nucleic acid vector containing a second coding polynucleotide that encodes a C-terminal portion of an OTOF protein and a polyadenylation (poly(A)) sequence positioned 3’ of the second coding polynucleotide; in which neither the first nor the second nucleic acid vector encodes
  • the invention provides a method of treating a human subject having biallelic otoferlin (OTOF) mutations and identified as having detectable otoacoustic emissions, detectable cochlear microphonics, and/or detectable summating potential by administering to the subject a therapeutically effective amount of a dual vector system including: a first nucleic acid vector containing a promoter operably linked to a first coding polynucleotide that encodes an N-terminal portion of an OTOF protein; and a second nucleic acid vector containing a second coding polynucleotide that encodes a C- terminal portion of an OTOF protein and a polyadenylation (poly(A)) sequence positioned 3’ of the second coding polynucleotide; in which neither the first nor the second nucleic acid vector encodes a full-length OTOF protein.
  • OTOF biallelic otoferlin
  • the first coding polynucleotide and the second coding polynucleotide do not overlap.
  • the first nucleic acid vector includes a splice donor signal sequence positioned 3’ of the first coding polynucleotide and the second nucleic acid vector includes a splice acceptor signal sequence positioned 5’ of the second coding polynucleotide.
  • the first nucleic acid vector includes a first recombinogenic region positioned 3’ of the splice donor signal sequence and the second nucleic acid vector includes a second recombinogenic region positioned 5’ of the splice acceptor signal sequence.
  • the first and second recombinogenic regions are the same.
  • the first and/or second recombinogenic region is an AP gene fragment or an F1 phage AK gene.
  • the F1 phage AK gene includes or has the sequence of SEQ ID NO: 19.
  • the AP gene fragment includes or has the sequence of any one of SEQ ID NOs: 62-67.
  • the AP gene fragment includes or has the sequence of SEQ ID NO: 65.
  • the splice donor sequence includes or has the sequence of SEQ ID NO: 20 or SEQ ID NO: 68.
  • splice acceptor sequence includes or has the sequence of SEQ ID NO: 21 or SEQ ID NO: 69.
  • the first nucleic acid vector further includes a degradation signal sequence positioned 3’ of the recombinogenic region
  • the second nucleic acid vector further includes a degradation signal sequence positioned between the recombinogenic region and the splice acceptor signal sequence.
  • the degradation signal sequence includes or has the sequence of SEQ ID NO: 22.
  • the first and second coding polynucleotides are divided at an OTOF exon boundary.
  • the OTOF exon boundary is not within a portion of the first coding polynucleotide or the second coding polynucleotide that encodes a C2 domain.
  • the first coding polynucleotide partially overlaps with the second coding polynucleotide.
  • the first coding polynucleotide overlaps with the second coding polynucleotide by at least 1 kilobase (kb).
  • the region of overlap between the first and second coding polynucleotides is centered at an OTOF exon boundary.
  • the first coding polynucleotide encodes an N-terminal portion of the OTOF protein and includes an OTOF N-terminus to 500 bp 3’ of the exon boundary at the center of the overlap region; and the second coding polynucleotide encodes a C-terminal portion of the OTOF protein and includes 500 bp 5’ of the exon boundary at the center of the overlap region to an OTOF C-terminus.
  • the OTOF exon boundary at the center of the overlap region is not within a portion of the first coding polynucleotide or second coding polynucleotide that encodes a C2 domain.
  • the OTOF exon boundary is selected such that the first coding polynucleotide encodes an entire C2C domain and the second coding polynucleotide encodes an entire C2D domain.
  • the OTOF exon boundary is an exon 19/20 boundary, an exon 20/21 boundary, or an exon 21/22 boundary.
  • the OTOF exon boundary is selected such that the first coding polynucleotide encodes an entire C2D domain and the second coding polynucleotide encodes an entire C2E domain.
  • the OTOF exon boundary is an exon 26/27 boundary or an exon 28/29 boundary.
  • the OTOF exon boundary is within a portion of the first coding polynucleotide and the second coding polynucleotide that encodes a C2D domain. In some embodiments, the OTOF exon boundary is an exon 24/25 boundary or an exon 25/26 boundary.
  • each of the first and second coding polynucleotides encode about half of the OTOF protein sequence.
  • the first nucleic acid vector and the second nucleic acid vector do not include OTOF untranslated regions (UTRs).
  • the first nucleic acid vector includes an OTOF 5’ UTR.
  • the second nucleic acid vector includes an OTOF 3’ UTR.
  • the first and second coding polynucleotides that encode the OTOF protein do not include introns.
  • the first and second coding polynucleotides that encode the OTOF protein do not contain introns.
  • the OTOF protein is a mammalian OTOF protein.
  • the OTOF protein is a murine OTOF protein.
  • the murine OTOF protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.
  • the OTOF protein comprises or consists of the sequence of SEQ ID NO: 6.
  • the OTOF protein is a human OTOF protein.
  • the human OTOF protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, or SEQ ID NO: 5.
  • the OTOF protein comprises or consists of the sequence of SEQ ID NO: 1 .
  • the OTOF protein comprises or consists of the sequence of SEQ ID NO: 2. In some embodiments of any of the foregoing aspects, the OTOF protein comprises or consists of the sequence of SEQ ID NO: 3. In some embodiments of any of the foregoing aspects, the OTOF protein comprises or consists of the sequence of SEQ ID NO: 4. In some embodiments of any of the foregoing aspects, the OTOF protein comprises or consists of the sequence of SEQ ID NO: 5.
  • the human OTOF protein comprises the sequence of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, or SEQ ID NO: 5 or a variant thereof having one or more e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions.
  • no more than 10% (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or fewer) of the amino acids in the OTOF protein variant are conservative amino acid substitutions.
  • the OTOF protein is encoded by any one of SEQ ID NOs: 10-14. In some embodiments, the OTOF protein is encoded by SEQ ID NO: 10. In some embodiments, the OTOF protein is encoded by SEQ ID NO: 14.
  • the OTOF protein is encoded by any one of SEQ ID NOs: 15-18.
  • the first coding polynucleotide encodes amino acids 1-802 of SEQ ID NO: 1 or SEQ ID NO: 5 and the second coding polynucleotide encodes amino acids 803-1997 of SEQ ID NO: 1 or SEQ ID NO: 5. In some embodiments, the first coding polynucleotide encodes amino acids 1-802 of SEQ ID NO: 1 and the second coding polynucleotide encodes amino acids 803-1997 of SEQ ID NO: 1 . In some embodiments, the first coding polynucleotide encodes amino acids 1-802 of SEQ ID NO: 5 and the second coding polynucleotide encodes amino acids 803-1997 of SEQ ID NO: 5.
  • the N-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 73 or a variant thereof having one or more (e.g., 1 , 2, 3, 4, 5, 6,
  • the N-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 73. In some embodiments, the N-terminal portion of the OTOF protein is encoded by the sequence of SEQ ID NO: 71.
  • the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 74 or a variant thereof having one or more (e.g., 1 , 2, 3, 4, 5, 6,
  • the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 74. In some embodiments, the C-terminal portion of the OTOF protein is encoded by the sequence of SEQ ID NO: 72.
  • the first nucleic acid vector includes a Kozak sequence positioned 3’ of the promoter and 5’ of the first coding polynucleotide that encodes the N-terminal portion of the OTOF protein.
  • the promoter is a ubiquitous promoter.
  • the ubiquitous promoter is a CAG promoter, a cytomegalovirus (CMV) promoter, a chicken b-actin promoter, a truncated CMV-chicken b-actin promoter (smCBA), a CB7 promoter, a hybrid CMV enhancer/human b-actin promoter, a human b-actin promoter, an elongation factor-1 a (EF1a) promoter, or a phosphoglycerate kinase (PGK) promoter.
  • the ubiquitous promoter is a CAG promoter.
  • the ubiquitous promoter is a smCBA promoter.
  • the smCBA promoter has the sequence of SEQ ID NO: 70.
  • the promoter is a cochlear hair cell- specific promoter.
  • the cochlear hair cell-specific promoter is a myosin 15 (Myo15) promoter, a myosin 7A (Myo7A) promoter, a myosin 6 (Myo6) promoter, a POU class 4 homeobox 3 (POU4F3) promoter, an atonal BHLH transcription factor 1 (ATOH1) promoter, a LIM homeobox 3 (LHX3) promoter, an a9 acetylcholine receptor (a9AChR) promoter, or an a10 acetylcholine receptor (cdOAChFt) promoter.
  • the cochlear hair cell-specific promoter is a Myo15 promoter.
  • the promoter is an inner hair cell-specific promoter.
  • the inner hair cell-specific promoter is a fibroblast growth factor 8 (FGF8) promoter, a vesicular glutamate transporter 3 (VGLUT3) promoter, an OTOF promoter, or a calcium binding protein 2 (CABP2) promoter.
  • FGF8 fibroblast growth factor 8
  • VGLUT3 vesicular glutamate transporter 3
  • CABP2 calcium binding protein 2
  • the inner hair cell-specific promoter is a CABP2 promoter.
  • the promoter is a short promoter (e.g., a promoter that is 1 kb or shorter, e.g., approximately 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp 500 bp, 450 bp, 400 bp, 350 bp, 300 bp or shorter).
  • the short promoter is a CAG promoter.
  • the short promoter is a CMV promoter.
  • the short promoter is a smCBA promoter.
  • the short promoter is a Myo15 promoter that is 1 kb or shorter (e.g., a Myo15 promoter having a sequence with at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to any one of SEQ ID NOs: 38, 39, or 49-60).
  • a Myo15 promoter having a sequence with at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to any one of SEQ ID NOs: 38, 39, or 49-60).
  • the promoter is a long promoter (e.g., a promoter that is longer than 1 kb, e.g., 1 .1 kb, 1 .25 kb, 1 .5 kb, 1 .75 kb, 2 kb, 2.5 kb, 3 kb or longer).
  • the long promoter is a Myo15 promoter that is longer than 1 kb (e.g., a Myo15 promoter comprising or consisting of a sequence with at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the sequence of SEQ ID NO: 36).
  • the first and second nucleic acid vectors are a pair of nucleic acid vectors listed in Table 4.
  • the first nucleic acid vector contains a polynucleotide sequence comprising the sequence of nucleotides 2272 to 6041 of SEQ ID NO: 75. In some embodiments of any of the foregoing aspects, the first nucleic acid vector contains a polynucleotide sequence comprising or consisting of the sequence of nucleotides 2049 to 6264 of SEQ ID NO: 75.
  • the first nucleic acid vector contains a polynucleotide sequence comprising the sequence of nucleotides 182 to 3949 of SEQ ID NO: 77. In some embodiments of any of the foregoing aspects, the first nucleic acid vector contains a polynucleotide sequence comprising or consisting of the sequence of nucleotides 19 to 4115 of SEQ ID NO: 77.
  • the first nucleic acid vector contains a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6014 of SEQ ID NO: 79. In some embodiments of any of the foregoing aspects, the first nucleic acid vector contains a polynucleotide sequence comprising or consisting of the sequence of nucleotides 2049 to 6237 of SEQ ID NO: 79.
  • the first nucleic acid vector contains a polynucleotide sequence comprising the sequence of nucleotides 177 to 3924 of SEQ ID NO: 80. In some embodiments of any of the foregoing aspects, the first nucleic acid vector contains a polynucleotide sequence comprising or consisting of the sequence of nucleotides 19 to 4090 of SEQ ID NO: 80.
  • the second nucleic acid vector contains a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6476 of SEQ ID NO: 76. In some embodiments of any of the foregoing aspects, the second nucleic acid vector contains a polynucleotide sequence comprising or consisting of the sequence of nucleotides 2049 to 6693 of SEQ ID NO: 76.
  • the second nucleic acid vector contains a polynucleotide sequence comprising the sequence of nucleotides 187 to 4396 of SEQ ID NO: 78. In some embodiments of any of the foregoing aspects, the second nucleic acid vector contains a polynucleotide sequence comprising or consisting of the sequence of nucleotides 19 to 4589 of SEQ ID NO: 78.
  • the first nucleic acid vector contains a polynucleotide sequence comprising the sequence of nucleotides 235 to 4004 of SEQ ID NO: 81 . In some embodiments of any of the foregoing aspects, the first nucleic acid vector contains a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4227 of SEQ ID NO: 81 .
  • the first nucleic acid vector contains a polynucleotide sequence comprising the sequence of nucleotides 230 to 3977 of SEQ ID NO: 83. In some embodiments of any of the foregoing aspects, the first nucleic acid vector contains a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4200 of SEQ ID NO: 83.
  • the second nucleic acid vector contains a polynucleotide sequence comprising the sequence of nucleotides 229 to 4438 of SEQ ID NO: 72. In some embodiments of any of the foregoing aspects, the second nucleic acid vector contains a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4655 of SEQ ID NO: 82. In some embodiments of any of the foregoing aspects, the first and second nucleic acid vectors comprise an inverted terminal repeat (ITR) at each end of the nucleic acid sequence.
  • ITR inverted terminal repeat
  • the first vector includes a first inverted terminal repeat (ITR) sequence 5’ of the promoter and a second ITR sequence 3’ of the recombinogenic region
  • the second vector includes a first ITR sequence 5’ of the recombinogenic region and a second ITR sequence 3’ of the poly(A) sequence.
  • the ITRs in the first vector and second vector are AAV2 ITRs.
  • the ITRs in the first vector and second vector have at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to AAV2 ITRs.
  • the poly(A) sequence is a bovine growth hormone (bGH) poly(A) signal sequence.
  • the second nucleic acid vector includes a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE).
  • WPRE Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element
  • the WPRE comprises or consists of the sequence of SEQ ID NO: 23 or SEQ ID NO: 61 .
  • the nucleic acid vectors are overlapping dual vectors.
  • the nucleic acid vectors are trans-splicing dual vectors.
  • the nucleic acid vectors are dual hybrid vectors.
  • the nucleic acid vectors are adeno- associated virus (AAV) vectors.
  • the AAV vectors have an AAV1 , AAV2, AAV2quad(Y-F), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ/8, DJ/9, 7m8, PHP.B, PHP.eb, or PHP.S capsid.
  • the AAV vectors have an AAV1 capsid.
  • the AAV vectors have an AAV9 capsid.
  • the AAV vectors have an AAV6 capsid. In some embodiments, the AAV vectors have an Anc80 capsid. In some embodiments, the AAV vectors have an Anc80L65 capsid. In some embodiments, the AAV vectors have a DJ/9 capsid. In some embodiments, the AAV vectors have a 7m8 capsid. In some embodiments, the AAV vectors have an AAV2 capsid. In some embodiments, the AAV vectors have an AAV2quad(Y-F) capsid. In some embodiments, the AAV vectors have a PHP.B capsid.
  • the AAV vectors have an AAV8 capsid.
  • the first and second nucleic acid vectors have the same capsid (e.g., both the first and second nucleic acid vectors are AAV vectors having an AAV1 capsid or an AAV9 capsid). In some embodiments of any of the foregoing aspects, the first and second nucleic acid vectors have different capsids (e.g., the first nucleic acid vector is an AAV having an AAV1 capsid, and the second nucleic acid vector is an AAV having an AAV9 capsid).
  • the subject is 30 years of age or older.
  • the subject is 35 years of age or older.
  • the subject is 40 years of age or older.
  • the subject is 45 years of age or older.
  • the subject is no older than 50 years old. In some embodiments of any of the foregoing aspects, the subject has been identified as having biallelic OTOF mutations.
  • the method further includes the step of identifying the subject as having biallelic OTOF mutations prior to administering the dual vector system.
  • the subject is identified as having detectable otoacoustic emissions.
  • the method further includes the step of identifying the subject as having detectable otoacoustic emissions prior to administering the dual vector system.
  • the subject is identified as having detectable cochlear microphonics.
  • the method further includes the step of identifying the subject as having detectable cochlear microphonics prior to administering the dual vector system.
  • the subject is identified as having a detectable summating potential.
  • the method further includes the step of identifying the subject as having detectable summating potential prior to administering the dual vector system.
  • the method further includes the step of evaluating the hearing of the subject prior to administering the dual vector system.
  • the subject has or is identified as having Deafness, Autosomal Recessive 9 (DFNB9).
  • DFNB9 Autosomal Recessive 9
  • the method further includes the step of evaluating the hearing of the subject prior to administering the dual vector system.
  • the dual vector system is administered locally to the middle or inner ear.
  • the dual vector system is administered by injection through the round window membrane, injection into a semicircular canal, canalostomy, insertion of a catheter through the round window membrane, transtympanic injection, or intratympanic injection.
  • the method further includes the step of evaluating the hearing of the subject after administering the dual vector system.
  • the method increases OTOF expression in a cochlear hair cell.
  • the cochlear hair cell is an inner hair cell.
  • the dual vector system increases OTOF expression in a cell (e.g., a cochlear hair cell), improves hearing (e.g., as assessed by standard tests, such as audiometry, auditory brainstem response (ABR), electrocochleography (ECOG), and otoacoustic emissions), prevents or reduces hearing loss, delays the development of hearing loss, slows the progression of hearing loss, improves speech discrimination, or improves hair cell function.
  • a cell e.g., a cochlear hair cell
  • improves hearing e.g., as assessed by standard tests, such as audiometry, auditory brainstem response (ABR), electrocochleography (ECOG), and otoacoustic emissions
  • the dual vector system is administered in an amount sufficient to increase OTOF expression in a cochlear hair cell, prevent or reduce hearing loss, delay the development of hearing loss, slow the progression of hearing loss, improve hearing (e.g., as assessed by standard tests, such as audiometry, ABR, ECOG, and otoacoustic emissions), improve speech discrimination, or improve hair cell function.
  • the first vector and the second vector are administered concurrently.
  • the first vector and the second vector are administered sequentially.
  • the first vector and the second vector are administered at a concentration of 1 x 10 7 vector genomes (VG)/ear to about 2 x 10 15 VG/ear (e.g., 1 x 10 7 VG/ear, 2 x 10 7 VG/ear, 3 x 10 7 VG/ear, 4 x 10 7 VG/ear, 5 x 10 7 VG/ear, 6 x 10 7 VG/ear, 7 x 10 7 VG/ear, 8 x 10 7 VG/ear, 9 x 10 7 VG/ear, 1 x 10 s VG/ear, 2 x 10 8 VG/ear, 3 x 10 8 VG/ear, 4 x 10 8 VG/ear, 5 x 10 8 VG/ear, 6 x 10 8 VG/ear, 7 x 10 8 VG/ear, 8 x 10 8 VG/ear, 9 x 10 8 VG/ear, 1 x 10 9 VG/ear, 2 x 10 9 VG/ear, 2 x 10 9 VG/ear
  • VG/ear 7 x 10 10 VG/ear, 8 x 10 10 VG/ear, 9 x 10 10 VG/ear, 1 x 10 11 VG/ear, 2 x 10 11 VG/ear, 3 x 10 11
  • VG/ear 1 x 10 12 VG/ear, 2 x 10 12 VG/ear, 3 x 10 12 VG/ear, 4 x 10 12 VG/ear, 5 x 10 12 VG/ear, 6 x 10 12
  • VG/ear 7 x 10 12 VG/ear, 8 x 10 12 VG/ear, 9 x 10 12 VG/ear, 1 x 10 13 VG/ear, 2 x 10 13 VG/ear, 3 x 10 13
  • VG/ear 1 x 10 14 VG/ear, 2 x 10 14 VG/ear, 3 x 10 14 VG/ear, 4 x 10 14 VG/ear, 5 x 10 14 VG/ear, 6 x 10 14
  • VG/ear 7 x 10 14 VG/ear, 8 x 10 14 VG/ear, 9 x 10 14 VG/ear, 1 x 10 15 VG/ear, or 2 x 10 15 VG/ear).
  • the first vector and the second vector are administered in amounts that together are sufficient to transduce at least 20% of the subject’s inner hair cells with both the first vector and the second vector (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%,
  • the dual vectors are administered in a composition including a pharmaceutically acceptable excipient.
  • the Myo15 promoter comprises or consists of a first region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 24 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 26 and/or SEQ ID NO: 27, operably linked to a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 25 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 31 and/or SEQ ID NO: 32, optionally containing a linker including one to one hundred nucleotides (e.g.,
  • the first region comprises or consists of the sequence of SEQ ID NO: 24.
  • the second region comprises or consists of the sequence of SEQ ID NO: 25.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 36.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 36.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 38.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 38.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 39.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 39.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 53.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 53.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 54.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 54.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 59.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 59.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 60.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 60.
  • the Myo15 promoter comprises or consists of a first region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 25 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 31 and/or SEQ ID NO: 32, operably linked to a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 24 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 26 and/or SEQ ID NO: 27, optionally containing a linker including one to one hundred nucleotides (e.g.,
  • the first region comprises or consists of the sequence of SEQ ID NO: 25.
  • the second region comprises or consists of the sequence of SEQ ID NO: 24.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 37.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 37.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 58.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 58.
  • the Myo15 promoter comprises or consists of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 24 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 26 and/or SEQ ID NO: 27.
  • the region comprises or consists of the sequence of SEQ ID NO: 24.
  • the Myo15 promoter comprises or consists of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 25 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 31 and/or SEQ ID NO: 32.
  • the region comprises or consists of the sequence of SEQ ID NO: 25.
  • the functional portion of SEQ ID NO: 24 contains the sequence of SEQ ID NO: 26. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 24 contains the sequence of SEQ ID NO: 27. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 24 contains the sequence of SEQ ID NO: 26 and the sequence of SEQ ID NO: 27. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 24 contains the sequence of SEQ ID NO: 28. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 24 contains the sequence of SEQ ID NO: 29.
  • the functional portion of SEQ ID NO: 24 contains the sequence of SEQ ID NO: 30. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 24 contains the sequence of SEQ ID NO: 50.
  • the functional portion of SEQ ID NO: 25 contains the sequence of SEQ ID NO: 31 . In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 25 contains the sequence of SEQ ID NO: 32. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 25 contains the sequence of SEQ ID NO: 51 . In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 25 contains the sequence of SEQ ID NO: 51 . In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 25 contains the sequence of SEQ ID NO: 31 and the sequence of SEQ ID NO: 32.
  • the functional portion of SEQ ID NO: 25 contains the sequence of SEQ ID NO: 33. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 25 contains the sequence of SEQ ID NO: 34. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 25 contains the sequence of SEQ ID NO: 35. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 25 contains the sequence of SEQ ID NO: 55.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the nucleic acid sequence of any one of SEQ ID NOs: 50-58.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 50.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 51 .
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 52.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 53. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 54. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 55. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 56. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 57. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 58.
  • the Myo15 promoter comprises or consists of a first region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 40 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 42, joined (e.g., operably linked) to a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 41 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 43 and/or SEQ ID NO: 44, optionally containing a linker including one to four hundred nucleotides (e.g.,
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 48.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 48.
  • the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 49.
  • the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 49.
  • the Myo15 promoter comprises or consists of a first region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 41 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 43 and/or SEQ ID NO: 44, joined (e.g., operably linked) to a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 40 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 42, optionally containing a linker including one to four hundred nucleotides (e.g.,
  • the Myo15 promoter comprises or consists of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 40 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 42.
  • the region comprises or consists of the sequence of SEQ ID NO: 40.
  • the Myo15 promoter comprises or consists of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to SEQ ID NO: 41 or a functional portion or derivative thereof including the sequence of SEQ ID NO: 43 and/or SEQ ID NO: 44.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity
  • the region comprises or consists of the sequence of SEQ ID NO: 41 .
  • the functional portion of SEQ ID NO: 40 contains the sequence of SEQ ID NO: 42.
  • the functional portion of SEQ ID NO: 41 contains the sequence of SEQ ID NO: 43. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 41 contains the sequence of SEQ ID NO: 44. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 41 contains the sequence of SEQ ID NO: 43 and the sequence of SEQ ID NO: 44. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 41 contains the sequence of SEQ ID NO: 45. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 41 contains the sequence of SEQ ID NO: 46. In some embodiments of any of the foregoing aspects, the functional portion of SEQ ID NO: 41 contains the sequence of SEQ ID NO: 47.
  • the Myo15 promoter induces transgene expression when operably linked to a transgene and introduced into a hair cell.
  • the term “about” refers to a value that is within 10% above or below the value being described.
  • administration refers to providing or giving a subject a therapeutic agent (e.g., a composition containing a first nucleic acid vector containing a polynucleotide that encodes an N-terminal portion of an otoferlin protein and a second nucleic acid vector containing a polynucleotide that encodes a C-terminal portion of an otoferlin protein), by any effective route.
  • a therapeutic agent e.g., a composition containing a first nucleic acid vector containing a polynucleotide that encodes an N-terminal portion of an otoferlin protein and a second nucleic acid vector containing a polynucleotide that encodes a C-terminal portion of an otoferlin protein
  • biaselic OTOF mutations refers to a condition in which a mutation is present in both alleles (copies) of an OTOF gene.
  • a subject having biallelic OTOF mutations may have two OTOF alleles that carry the same mutation or may have a different mutation on each allele.
  • administering to the inner ear refers to providing or giving a therapeutic agent described herein to a subject by any route that allows for transduction of inner ear cells.
  • routes of administration to the inner ear include administration into the perilymph or endolymph, such as to or through the oval window, round window, or semicircular canal (e.g., horizontal canal), or by transtympanic or intratympanic injection, e.g., administration to a hair cell.
  • cell type refers to a group of cells sharing a phenotype that is statistically separable based on gene expression data. For instance, cells of a common cell type may share similar structural and/or functional characteristics, such as similar gene activation patterns and antigen presentation profiles. Cells of a common cell type may include those that are isolated from a common tissue (e.g., epithelial tissue, neural tissue, connective tissue, or muscle tissue) and/or those that are isolated from a common organ, tissue system, blood vessel, or other structure and/or region in an organism.
  • tissue e.g., epithelial tissue, neural tissue, connective tissue, or muscle tissue
  • cochlear hair cell refers to group of specialized cells in the inner ear that are involved in sensing sound. There are two types of cochlear hair cells: inner hair cells and outer hair cells. Damage to cochlear hair cells and genetic mutations that disrupt cochlear hair cell function are implicated in hearing loss and deafness.
  • the terms “conservative mutation,” “conservative substitution,” and “conservative amino acid substitution” refer to a substitution of one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and steric volume. These properties are summarized for each of the twenty naturally occurring amino acids in table 1 below.
  • conservative amino acid families include (i) G, A, V, L, and I; (ii) D and E; (iii) C, S and T; (iv) H, K and R; (v) N and Q; and (vi) F, Y and W.
  • a conservative mutation or substitution is therefore one that substitutes one amino acid for a member of the same amino acid family (e.g., a substitution of Ser for Thr or Lys for Arg).
  • degradation signal sequence refers to a sequence (e.g., a nucleotide sequence that can be translated into an amino acid sequence) that mediates the degradation of a polypeptide in which it is contained.
  • Degradation signal sequences can be included in the nucleic acid vectors of the invention to reduce or prevent the expression of portions of otoferlin proteins that have not undergone recombination and/or splicing.
  • An exemplary degradation signal sequence for use in the invention is GCCTGCAAGAACTGGTTCAGCAGCCTGAGCCACTTCGTGATCCACCTG (SEQ ID NO:
  • the terms “effective amount,” “therapeutically effective amount,” and a “sufficient amount” of a composition, vector construct, or viral vector described herein refer to a quantity sufficient to, when administered to the subject in need thereof, including a mammal, for example a human, effect beneficial or desired results, including clinical results, and, as such, an “effective amount” or synonym thereto depends upon the context in which it is being applied. For example, in the context of treating sensorineural hearing loss, it is an amount of the composition, vector construct, or viral vector sufficient to achieve a treatment response as compared to the response obtained without administration of the composition, vector construct, or viral vector.
  • a “therapeutically effective amount” of a composition, vector construct, or viral vector of the present disclosure is an amount which results in a beneficial or desired result in a subject as compared to a control. Note that when a combination of active ingredients is administered, the effective amount of the combination may or may not include amounts of each ingredient that would have been effective if administered individually. As defined herein, a therapeutically effective amount of a composition, vector construct, viral vector or cell of the present disclosure may be readily determined by one of ordinary skill by routine methods known in the art.
  • Dosage regime may be adjusted to provide the optimum therapeutic response.
  • endogenous describes a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is found naturally in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, a tissue, or a cell, such as a human cell, e.g., a human cochlear hair cell).
  • the term “express” refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and/or 3' end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.
  • exogenous describes a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is not found naturally in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, a tissue, or a cell, such as a human cell, e.g., a human cochlear hair cell).
  • Exogenous materials include those that are provided from an external source to an organism or to cultured matter extracted there from.
  • hair cell-specific expression refers to production of an RNA transcript or polypeptide primarily within hair cells (e.g., cochlear hair cells) as compared to other cell types of the inner ear (e.g., spiral ganglion neurons, glia, or other inner ear cell types). Hair cell-specific expression of a transgene can be confirmed by comparing transgene expression (e.g., RNA or protein expression) between various cell types of the inner ear (e.g., hair cells vs.
  • transgene expression e.g., RNA or protein expression
  • a hair cell-specific promoter induces expression (e.g., RNA or protein expression) of a transgene to which it is operably linked that is at least 50% greater (e.g., 50%, 75%, 100%, 125%, 150%, 175%, 200% greater or more) in hair cells (e.g., cochlear hair cells) compared to at least 3 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more) of the following inner ear cell types: Border cells, inner phalangeal cells, inner pillar cells, outer pillar cells, first row Deiter cells, second row Deiter cells, third row Deiter cells, Hensen’s cells, Claudius cells, inner sulcus cells, outer sulcus cells, spiral prominence cells, root cells, inter
  • the terms “increasing” and “decreasing” refer to modulating resulting in, respectively, greater or lesser amounts, of function, expression, or activity of a metric relative to a reference.
  • the amount of a marker of a metric e.g., OTOF expression or auditory brainstem response
  • the amount of a marker of a metric may be increased or decreased in a subject by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%,
  • the metric is measured subsequent to administration at a time that the administration has had the recited effect, e.g., at least one week, one month, 3 months, or 6 months, after a treatment regimen has begun.
  • the term “intron” refers to a region within the coding region of a gene, the nucleotide sequence of which is not translated into the amino acid sequence of the corresponding protein.
  • the term intron also refers to the corresponding region of the RNA transcribed from a gene. Introns are transcribed into pre-mRNA, but are removed during processing, and are not included in the mature mRNA.
  • locally or “local administration” means administration at a particular site of the body intended for a local effect and not a systemic effect.
  • local administration are epicutaneous, inhalational, intra-articular, intrathecal, intravaginal, intravitreal, intrauterine, intra-lesional administration, lymph node administration, intratumoral administration, administration to the inner ear, and administration to a mucous membrane of the subject, wherein the administration is intended to have a local and not a systemic effect.
  • operably linked refers to a first molecule that can be joined to a second molecule, wherein the molecules are so arranged that the first molecule affects the function of the second molecule.
  • operably linked includes the juxtaposition of two or more components (e.g., a promoter and another sequence element) such that both components function normally and allow for the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components.
  • the two molecules may or may not be part of a single contiguous molecule and may or may not be adjacent.
  • a promoter is operably linked to a transcribable polynucleotide molecule if the promoter modulates transcription of the transcribable polynucleotide molecule of interest in a cell.
  • two portions of a transcription regulatory element are operably linked to one another if they are joined such that the transcription-activating functionality of one portion is not adversely affected by the presence of the other portion.
  • Two transcription regulatory elements may be operably linked to one another by way of a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operably linked to one another with no intervening nucleotides present.
  • the terms “otoferlin” and “OTOF” refer to the gene associated with nonsyndromic recessive deafness DNFB9.
  • the terms “otoferlin” and “OTOF” also refer to variants of wild-type OTOF protein and nucleic acids encoding the same, such as variant proteins having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more) to the amino acid sequence of a wild-type OTOF protein (e.g., any one of SEQ ID NOs: 1 -5) or polynucleotides having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity,
  • OTOF may refer to the protein localized to inner hair cells or to the gene encoding this protein, depending upon the context, as will be appreciated by one of skill in the art.
  • the terms “otoferlin isoform 5” and “OTOF isoform 5” refer to an isoform of the gene associated with nonsyndromic recessive deafness DFNB9.
  • the human isoform of the gene is associated with reference sequence NM 001287489, and the transcript includes exons 1-45 and 47 of human otoferlin, but lacks exon 46 of the OTOF gene.
  • the human OTOF isoform 5 protein is also known as Otoferlin isoform e.
  • OTOF isoform 5 also refer to variants of the wild-type OTOF isoform 5 protein and polynucleotides encoding the same, such as variant proteins having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more) to the amino acid sequence of a wild-type OTOF isoform 5 protein (e.g., SEQ ID NO: 1 ) or polynucleotides having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more) to the polynucleotide sequence of a wild-type OTOF isoform 5 gene
  • variant proteins having at least 85% sequence identity e.
  • OTOF isoform 5 protein variants can have one or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) conservative amino acid substitutions relative to a wild-type OTOF isoform 5 (e.g., SEQ ID NO: 1 ), provided that the that the OTOF isoform 5 variant retains the therapeutic function of wild-type OTOF isoform 5 and has no more than 10% amino acid substitutions in an N-terminal portion of the amino acid sequence and no more than 10% amino acid substitutions in a C-terminal portion of the amino acid sequence.
  • a wild-type OTOF isoform 5 e.g., SEQ ID NO: 1
  • OTOF isoform 5 may refer to the protein localized to inner hair cells or to the gene encoding this protein, depending upon the context, as will be appreciated by one of skill in the art.
  • OTOF isoform 5 may refer to human OTOF isoform 5 or to a homolog from another mammalian species.
  • Murine otoferlin contains one additional exon relative to human otoferlin (48 exons in murine otoferlin), and the exons of murine otoferlin that correspond to those that encode human OTOF isoform 5 are 1-5, 7-46, and 48.
  • the exon numbering convention used herein is based on the exons currently understood to be present in the consensus transcripts of human OTOF.
  • plasmid refers to a to an extrachromosomal circular double stranded DNA molecule into which additional DNA segments may be ligated.
  • a plasmid is a type of vector, a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • Certain plasmids are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial plasmids having a bacterial origin of replication and episomal mammalian plasmids).
  • Other vectors e.g., non-episomal mammalian vectors
  • Certain plasmids are capable of directing the expression of genes to which they are operably linked.
  • nucleic acid and “polynucleotide,” used interchangeably herein, refer to a polymeric form of nucleosides in any length.
  • a polynucleotide is composed of nucleosides that are naturally found in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) joined by phosphodiester bonds.
  • nucleosides or nucleoside analogs containing chemically or biologically modified bases, modified backbones, etc., whether or not found in naturally occurring nucleic acids, and such molecules may be preferred for certain applications.
  • this application refers to a polynucleotide it is understood that both DNA, RNA, and in each case both single- and double-stranded forms (and complements of each single-stranded molecule) are provided.
  • Polynucleotide sequence as used herein can refer to the polynucleotide material itself and/or to the sequence information (i.e. , the succession of letters used as abbreviations for bases) that biochemically characterizes a specific nucleic acid. A polynucleotide sequence presented herein is presented in a 5' to 3' direction unless otherwise indicated.
  • the terms “complementarity” or “complementary” of nucleic acids means that a nucleotide sequence in one strand of nucleic acid, due to orientation of its nucleobase groups, forms hydrogen bonds with another sequence on an opposing nucleic acid strand.
  • the complementary bases in DNA are typically A with T and C with G. In RNA, they are typically C with G and U with A. Complementarity can be perfect or substantial/sufficient. Perfect complementarity between two nucleic acids means that the two nucleic acids can form a duplex in which every base in the duplex is bonded to a complementary base by Watson-Crick pairing.
  • “Substantial” or “sufficient” complementary means that a sequence in one strand is not completely and/or perfectly complementary to a sequence in an opposing strand, but that sufficient bonding occurs between bases on the two strands to form a stable hybrid complex in set of hybridization conditions (e.g., salt concentration and temperature). Such conditions can be predicted by using the sequences and standard mathematical calculations to predict the Tm (melting temperature) of hybridized strands, or by empirical determination of Tm by using routine methods. Tm includes the temperature at which a population of hybridization complexes formed between two nucleic acid strands are 50% denatured (i.e., a population of double-stranded nucleic acid molecules becomes half dissociated into single strands).
  • promoter refers to a recognition site on DNA that is bound by an RNA polymerase.
  • the polymerase drives transcription of the transgene.
  • exemplary promoters suitable for use with the compositions and methods described herein include ubiquitous promoters (e.g., the CAG promoter, cytomegalovirus (CMV) promoter, and a truncated form of the chimeric CMV-chicken b-actin promoter (CBA), in which the hybrid chicken b-actin/rabbit b-g!obin intron Is greatly shortened to produce a smaller version of the promoter called smCBA), cochlear hair cell-specific promoters (e.g., the Myosin 15 (Myo15) promoter, the Myosin 7A (Myo7A) promoter, the Myosin 6 (Myo6) promoter, the POU Class 4 Homeobox 3 (POU4F3) promoter), and inner hair cell-specific promoters (e.
  • Percent (%) sequence identity with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software.
  • percent sequence identity values may be generated using the sequence comparison computer program BLAST.
  • percent sequence identity of a given nucleic acid or amino acid sequence, A, to, with, or against a given nucleic acid or amino acid sequence, B, (which can alternatively be phrased as a given nucleic acid or amino acid sequence, A that has a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence, B) is calculated as follows:
  • derivative refers to a nucleic acid, peptide, or protein or a variant or analog thereof comprising one or more mutations and/or chemical modifications as compared to a corresponding full-length wild-type nucleic acid, peptide, or protein.
  • Non-limiting examples of chemical modifications involving nucleic acids include, for example, modifications to the base moiety, sugar moiety, phosphate moiety, phosphate-sugar backbone, or a combination thereof.
  • the term “pharmaceutical composition” refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharmaceutically acceptable excipients, diluents, and/or carriers, to be administered to a subject, such as a mammal, e.g., a human, in order to prevent, treat or control a particular disease or condition affecting or that may affect the subject.
  • the term “pharmaceutically acceptable” refers to those compounds, materials, compositions and/or dosage forms, which are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human) without excessive toxicity, irritation, allergic response, and other problem complications commensurate with a reasonable benefit/risk ratio.
  • a mammal e.g., a human
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans.
  • recombinogenic region refers to a region of homology that mediates recombination between two different sequences.
  • regulatory sequence includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of the polynucleotides that encode OTOF.
  • promoters include promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of the polynucleotides that encode OTOF.
  • expression control elements e.g., polyadenylation signals
  • sample refers to a specimen (e.g., blood, blood component (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placental or dermal), pancreatic fluid, chorionic villus sample, and cells) isolated from a subject.
  • a specimen e.g., blood, blood component (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placental or dermal), pancreatic fluid, chorionic villus sample, and cells
  • transfection refers to any of a wide variety of techniques commonly used for the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, e.g., electroporation, lipofection, calcium- phosphate precipitation, DEAE- dextran transfection, Nucleofection, squeeze-poration, sonoporation, optical transfection, Magnetofection, impalefection and the like.
  • the terms “subject” and “patient” refer to an animal (e.g., a mammal, such as a human), veterinary animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.) and experimental animal models of diseases (e.g., mice, rats).
  • a subject to be treated according to the methods described herein may be one who has been diagnosed with hearing loss (e.g., hearing loss associated with a mutation in OTOF), or one at risk of developing these conditions. Diagnosis may be performed by any method or technique known in the art.
  • a subject to be treated according to the present disclosure may have been subjected to standard tests or may have been identified, without examination, as one at risk due to the presence of one or more risk factors associated with the disease or condition.
  • transduction refers to a method of introducing a vector construct or a part thereof into a cell.
  • the vector construct is contained in a viral vector such as for example an AAV vector
  • transduction refers to viral infection of the cell and subsequent transfer and integration of the vector construct or part thereof into the cell genome.
  • treatment and “treating” of a state, disorder or condition can include: (1) preventing, delaying, or reducing the incidence and/or likelihood of the appearance of at least one clinical or sub-clinical symptom of the state, disorder or condition developing in a subject that may be afflicted with or predisposed to the state, disorder or condition, but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; or (2) inhibiting the state, disorder or condition, i.e.
  • the benefit to a subject to be treated is either statistically significant or at least perceptible to the patient or to the physician.
  • vector includes a nucleic acid vector, e.g., a DNA vector, such as a plasmid, an RNA vector, virus, or other suitable replicon (e.g., viral vector).
  • a DNA vector such as a plasmid, an RNA vector, virus, or other suitable replicon (e.g., viral vector).
  • a variety of vectors have been developed for the delivery of polynucleotides encoding exogenous proteins into a prokaryotic or eukaryotic cell. Examples of such expression vectors are disclosed in, e.g., W094/11026; incorporated herein by reference as it pertains to vectors suitable for the expression of a gene of interest.
  • Expression vectors suitable for use with the compositions and methods described herein contain a polynucleotide sequence as well as, e.g., additional sequence elements used for the expression of proteins and/or the integration of these polynucleotide sequences into the genome of a mammalian cell.
  • Certain vectors that can be used for the expression of OTOF as described herein include vectors that contain regulatory sequences, such as promoter and enhancer regions, which direct gene transcription.
  • Other useful vectors for expression of OTOF contain polynucleotide sequences that enhance the rate of translation of these genes or improve the stability or nuclear export of the mRNA that results from gene transcription.
  • sequence elements include, e.g., 5’ and 3’ untranslated regions and a polyadenylation signal site in order to direct efficient transcription of the gene carried on the expression vector.
  • the expression vectors suitable for use with the compositions and methods described herein may also contain a polynucleotide encoding a marker for selection of cells that contain such a vector. Examples of a suitable marker include genes that encode resistance to antibiotics, such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.
  • wild-type refers to a genotype with the highest frequency for a particular gene in a given organism.
  • FIGS. 2A-2B are a series of graphs showing the number of inner hair cells and outer hair cells over time in homozygous (Otof-Q828X horn) and heterozygous (Otof-Q828X het) Otof-Q828X mice.
  • Numbers of IHCs (FIG. 2A) and OHCs (FIG. 2B) were counted in 50 mouse ears in animals from 5 to 42 weeks of age. Counts are shown in cochlear regions corresponding to 5.6 kHz, 8 kHz, 11 .3 kHz, 16 kHz, 22.6 kHz, 32 kHz, and 45.2 kHz.
  • FIG. 3 is a graph showing ABR threshold recovery in homozygous OTOF-Q828X mutant mice.
  • ABR thresholds measured at 22.6 kHz were plotted vs. percent inner hair cells (IHCs) expressing otoferlin across multiple studies of adult homozygous OTOF-Q828X mutant mice treated with OTOF dual vector systems. Measurements were performed > 4 weeks after treatment.
  • compositions and methods for the treatment of sensorineural hearing loss or auditory neuropathy due to biallelic otoferlin (OTOF) mutations in a human subject that is at least 25 years old (e.g., 25-50, 25-45, 25-40, 25-35, 25-30, 30-50, 30-45, 30-40, 30-35, 35-50, 35-45, 35-40, 40- 50, 40-45, or 45-50 years old, e.g., 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42,
  • OPF biallelic otoferlin
  • a first nucleic acid vector containing a promoter and a polynucleotide encoding an N-terminal portion of an otoferlin (OTOF) protein e.g., a wild-type (WT) OTOF protein
  • OTOF otoferlin
  • WT wild-type
  • poly(A) polyadenylation
  • the polynucleotides encoded by the two nucleic acid vectors can combine to form a polynucleotide that encodes the full-length OTOF protein.
  • compositions and methods described herein can, therefore, be used to induce or increase expression of WT OTOF in cochlear hair cells of a subject who has an OTOF deficiency (e.g., a homozygous or compound heterozygous mutation in OTOF).
  • OTOF deficiency e.g., a homozygous or compound heterozygous mutation in OTOF.
  • the compositions and methods described herein can also be used to treat a subject having biallelic OTOF mutations that is identified as having detectable otoacoustic emissions, detectable cochlear microphonics, and/or detectable summating potential.
  • OTOF is a 230 kDa membrane protein that contains at least six C2 domains implicated in calcium, phospholipid, and protein binding. It is encoded by a gene that contains 48 exons, and the full- length protein is made up of 1 ,997 amino acids. OTOF is located at ribbon synapses in inner hair cells, where it is believed to function as a calcium sensor in synaptic vesicle fusion, triggering the fusion of neurotransmitter-containing vesicles with the plasma membrane.
  • OTOF was first identified by a study investigating the genetics of a non-syndromic form of deafness, autosomal recessive deafness-9 (DFNB9). Mutations in OTOF have since been found to cause sensorineural hearing loss in patients throughout the world, with many patients carrying OTOF mutations having auditory neuropathy, a disorder in which the inner ear detects sound, but is unable to properly transmit sound from the ear to the brain. These patients have an abnormal auditory brainstem response (ABR) and impaired speech discrimination with initially normal otoacoustic emissions.
  • ABR auditory brainstem response
  • OTOF Patients carrying homozygous or compound heterozygous mutations in OTOF often develop hearing loss in early childhood, and the severity of hearing impairment has been found to vary with the location and type of mutation in OTOF. At least 220 mutations in OTOF have been identified, including mutations that cause truncations and mutations that do not cause truncations.
  • the present invention is based, in part, on the discovery that administration of a first nucleic acid vector containing a polynucleotide encoding an N-terminal portion of an OTOF protein and a second nucleic acid vector containing a polynucleotide encoding a C-terminal portion of an OTOF protein to adult (32-week-old) and middle-aged (52-week-old) otoferlin-deficient mice was effective in rescuing hearing loss.
  • the inventors also discovered that hearing was restored in otoferlin-deficient mice when about 20% of inner hair cells expressed otoferlin, indicating that hearing can be rescued even if a relatively small percentage of inner hair cells are transduced.
  • adult human subjects e.g., human subjects aged 25 or older, such as 25-50, 25-45, 25- 40, 25-35, 25-30, 30-50, 30-45, 30-40, 30-35, 35-50, 35-45, 35-40, 40-50, 40-45, or 45-50 years old, e.g., 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50 years old) with biallelic OTOF mutations can be treated using dual vector systems encoding OTOF.
  • compositions and methods described herein can be used to treat sensorineural hearing loss or auditory neuropathy caused by biallelic OTOF mutations by administering a first nucleic acid vector containing a polynucleotide encoding an N-terminal portion of an OTOF protein and a second nucleic acid vector containing a polynucleotide encoding a C-terminal portion of an OTOF protein.
  • the full-length OTOF coding sequence is too large to include in the type of vector that is commonly used for gene therapy (e.g., an adeno-associated virus (AAV) vector, which is thought to have a packaging limit of 5 kb).
  • AAV adeno-associated virus
  • compositions and methods described herein overcome this problem by dividing the OTOF coding sequence between two different nucleic acid vectors that can recombine in a cell to reconstitute the full- length OTOF sequence.
  • These compositions and methods can be used to treat subjects having one or more mutations in the OTOF gene, e.g., an OTOF mutation that reduces OTOF expression, reduces OTOF function, or is associated with hearing loss.
  • the polynucleotides encoding the N-terminal and C-terminal portions of OTOF can combine within a cell (e.g., a human cell, e.g., a cochlear hair cell) to form a single nucleic acid molecule that contains the full-length OTOF coding sequence (e.g., through homologous recombination and/or splicing).
  • a cell e.g., a human cell, e.g., a cochlear hair cell
  • nucleic acid vectors used in the compositions and methods described herein include nucleic acid sequences that encode wild-type OTOF, or a variant thereof, such as a nucleic acid sequences that, when combined, encode a protein having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the amino acid sequence of wild-type human or mouse OTOF.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity
  • polynucleotides used in the nucleic acid vectors described herein encode an N-terminal portion and a C-terminal portion of an OTOF amino acid sequence in Table 2 below (e.g., two portions that, when combined, encode a full-length OTOF amino acid sequence listed in Table 2, e.g., any one of SEQ ID NOs: 1 -5).
  • a subject can be administered a composition containing a first nucleic acid vector and a second nucleic acid vector that contain an N-terminal and C- terminal portion, respectively, of a polynucleotide sequence encoding the amino acid sequence of any one of SEQ ID NOs: 1-5, or a polynucleotide sequence encoding an amino acid sequence having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the amino acid sequence of any one of SEQ ID NOs: 1-5, or a polynucleotide sequence encoding an amino acid sequence that contains one or more conservative amino acid substitutions relative to any one of SEQ ID NOs: 1 -5 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more conservative amino acid substitutions), provided that the OTO
  • the OTOF protein may be encoded by a polynucleotide having the sequence of any one of SEQ ID NOs: 10-14.
  • the OTOF protein may also be encoded by a polynucleotide having single nucleotide variants (SNVs) that have been found to be non- pathogenic in human subjects.
  • the OTOF protein may be a human OTOF protein or may be a homolog of the human OTOF protein from another mammalian species (e.g., mouse, rat, cow, horse, goat, sheep, donkey, cat, dog, rabbit, guinea pig, or other mammal).
  • the OTOF protein encoded has the sequence of SEQ ID NO: 1 (OTOF isoform 1).
  • the OTOF protein encoded has the sequence of SEQ ID NO: 5 (OTOF isoform 5).
  • compositions and methods described herein increase the expression of WT OTOF protein through administration a first nucleic acid vector that contains a polynucleotide encoding an N-terminal portion of an OTOF protein and a second nucleic acid vector that contains a polynucleotide encoding a C-terminal portion of an OTOF protein.
  • nucleic acid vectors for therapeutic application in the treatment of sensorineural hearing loss and auditory neuropathy, they can be directed to the interior of the cell, and, in particular, to specific cell types.
  • a wide array of methods has been established for the delivery of proteins to mammalian cells and for the stable expression of genes encoding proteins in mammalian cells.
  • One platform that can be used to achieve therapeutically effective intracellular concentrations of OTOF in mammalian cells is via the stable expression of the gene encoding OTOF (e.g., by integration into the nuclear or mitochondrial genome of a mammalian cell, or by episomal concatemer formation in the nucleus of a mammalian cell).
  • the gene is a polynucleotide that encodes the primary amino acid sequence of the corresponding protein.
  • genes can be incorporated into a vector.
  • Vectors can be Introduced into a ceil by a variety of methods, Including transformation, transfection, transduction, direct uptake, projectile bombardment, and by encapsulation of the vector in a liposome.
  • transfecting or transforming ceils examples include calcium phosphate precipitation, electroporation, microinjection, infection, !ipofection and direct uptake. Such methods are described in more detail, tor example, in Green, et al. , Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014); and Ausubel, et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the disclosures of each of which are incorporated herein by reference.
  • OTOF can also be introduced into a mammalian cell by targeting vectors containing portions of a gene encoding an OTOF protein to cell membrane phospholipids.
  • vectors can be targeted to the phospholipids on the extracellular surface of the cell membrane by linking the vector molecule to a VSV-G protein, a viral protein with affinity for all cell membrane phospholipids.
  • VSV-G protein a viral protein with affinity for all cell membrane phospholipids.
  • RNA polymerase Recognition and binding of the polynucleotide encoding an OTOF protein by mammalian RNA polymerase is important for gene expression.
  • sequence elements within the polynucleotide that exhibit a high affinity for transcription factors that recruit RNA polymerase and promote the assembly of the transcription complex at the transcription initiation site.
  • sequence elements include, e.g., a mammalian promoter, the sequence of which can be recognized and bound by specific transcription initiation factors and ultimately RNA polymerase.
  • Polynucleotides suitable for use in the compositions and methods described herein also include those that encode an OTOF protein downstream of a mammalian promoter (e.g., a polynucleotide that encodes an N-terminal portion of an OTOF protein downstream of a mammalian promoter).
  • Promoters that are useful for the expression of an OTOF protein in mammalian cells include ubiquitous promoters, cochlear hair cell-specific promoters, and inner hair cell-specific promoters.
  • Ubiquitous promoters include the CAG promoter, a cytomegalovirus (CMV) promoter (e.g., the CMV immediate-early enhancer and promoter, a CMVmini promoter, a minCMV promoter, a CMV-TATA+INR promoter, or a min CMV-T6 promoter), the chicken b-actin promoter, the smCBA promoter, the CB7 promoter, the hybrid CMV enhancer/human b-actin promoter, the CASI promoter, the dihydrofolate reductase (DHFR) promoter, the human b-actin promoter, a b-globin promoter (e.g., a minimal b-globin promoter), an HSV promoter (e.g., a minimal HSV ICP0 promoter or a truncated HSV ICP0 promoter), an SV40 promoter (e.g., an SV40 minimal promoter), the EF1a
  • Cochlear hair cell-specific promoters include the Myosin 15 (Myo15) promoter, the Myosin 7 A (Myo7A) promoter, the Myosin 6 (Myo6) promoter, the POU4F3 promoter, the Atonal BHLH Transcription Factor 1 (ATOH1) promoter, the LIM Homeobox 3 (LHX3) promoter, the a9 acetylcholine receptor (a9AChR) promoter, and the a10 acetylcholine receptor (alOAChR) promoter.
  • Inner hair cell-specific promoters include the FGF8 promoter, the VGLUT3 promoter, the OTOF promoter, and the calcium binding protein 2 (CABP2) promoter (described in International Patent Application Publication Number W02021/091940, which is incorporated herein by reference).
  • promoters derived from viral genomes can also be used for the stable expression of these agents in mammalian cells.
  • adenovirus late promoter examples include adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, tk promoter of HSV, mouse mammary tumor virus (MMTV) promoter, LTR promoter of HIV, promoter of moloney virus, Epstein barr virus (EBV) promoter, and the Rous sarcoma virus (RSV) promoter.
  • vaccinia virus 7.5K promoter vaccinia virus 7.5K promoter
  • SV40 promoter tk promoter of HSV
  • MMTV mouse mammary tumor virus
  • LTR promoter of HIV promoter of moloney virus
  • EBV Epstein barr virus
  • RSV Rous sarcoma virus
  • the Myo15 promoter for use in the compositions and methods described herein includes nucleic acid sequences from regions of the murine Myo15 locus that are capable of expressing a transgene specifically in hair cells, or variants thereof, such as a nucleic acid sequences that have at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to regions of the murine Myo15 locus that are capable of expressing a transgene specifically in hair cells.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity
  • These regions include nucleic acid sequences immediately preceding the murine Myo15 translation start site and an upstream regulatory element that is located over 5 kb from the murine Myo15 translation start site.
  • the Myo15 promoter for use in the compositions and methods described herein can optionally include a linker operably linking the regions of the murine Myo15 locus that are capable of expressing a transgene specifically in hair cells, or the regions of the murine Myo15 locus can be joined directly without an intervening linker.
  • the Myo15 promoter for use in the compositions and methods described herein contains a first region (an upstream regulatory element) having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to a region containing the first non-coding exon of the murine Myo15 gene (nucleic acids from -6755 to -7209 with respect to the murine Myo15 translation start site, the sequence of which is set forth in SEQ ID NO: 24) or a functional portion or derivative thereof joined (e.g., operably linked) to a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the nucleic acid
  • the functional portion of SEQ ID NO: 24 may have the sequence of nucleic acids from -7166 to -7091 with respect to the murine Myo15 translation start site (set forth in SEQ ID NO: 26) and/or the sequence of nucleic acids from -7077 to -6983 with respect to the murine Myo15 translation start site (set forth in SEQ ID NO: 27).
  • the first region may contain the nucleic acid sequence of SEQ ID NO: 26 fused to the nucleic acid sequence of SEQ ID NO: 27 with no intervening nucleic acids, as set forth in SEQ ID NO: 28, or the first region may contain the nucleic acid sequence of SEQ ID NO: 27 fused to the nucleic acid sequence of SEQ ID NO: 26 with no intervening nucleic acids, as set forth in SEQ ID NO: 29.
  • the first region may contain the sequences of SEQ ID NO:
  • the first region may have or include the sequence of nucleic acids from -7166 to -6983 with respect to the murine Myo15 translation start site, as set forth in SEQ ID NO: 30 and SEQ ID NO: 50) or a nucleic acid linker.
  • the two sequences can be included in any order (e.g., SEQ ID NO: 26 may be joined to (e.g., precede) SEQ ID NO: 27, or SEQ ID NO: 27 may be joined to (e.g., precede) SEQ ID NO: 26).
  • the functional portion of SEQ ID NO: 25 may have the sequence of nucleic acids from -590 to -509 with respect to the murine Myo15 translation start site (set forth in SEQ ID NO: 31 ) and/or the sequence of nucleic acids from -266 to -161 with respect to the murine Myo15 translation start site (set forth in SEQ ID NO: 32).
  • the sequence containing SEQ ID NO: 31 has the sequence of SEQ ID NO: 51 .
  • the sequence containing SEQ ID NO: 32 has the sequence of SEQ ID NO: 52.
  • the second region may contain the nucleic acid sequence of SEQ ID NO: 31 fused to the nucleic acid sequence of SEQ ID NO: 32 with no intervening nucleic acids, as set forth in SEQ ID NO: 33, or the second region may contain the nucleic acid sequence of SEQ ID NO: 32 fused to the nucleic acid sequence of SEQ ID NO: 31 with no intervening nucleic acids, as set forth in SEQ ID NO: 34.
  • the second region may contain the nucleic acid sequence of SEQ ID NO: 51 fused to the nucleic acid sequence of SEQ ID NO: 52 with no intervening nucleic acids, as set forth in SEQ ID NO: 55, or the second region may contain the nucleic acid sequence of SEQ ID NO: 52 fused to the nucleic acid sequence of SEQ ID NO: 51 with no intervening nucleic acids.
  • the second region may contain the sequences of SEQ ID NO: 31 and SEQ ID NO: 32 joined by the endogenous intervening nucleic acid sequence (e.g., the second region may have the sequence of nucleic acids from -590 to -161 with respect to the murine Myo15 translation start site, as set forth in SEQ ID NO: 35) or a nucleic acid linker.
  • the two sequences can be included in any order (e.g., SEQ ID NO: 31 may be joined to (e.g., precede) SEQ ID NO: 32, or SEQ ID NO: 32 may be joined to (e.g., precede) SEQ ID NO: 31 ).
  • the first region and the second region of the murine Myo15 promoter can be joined directly or can be joined by a nucleic acid linker.
  • the murine Myo15 promoter can contain the sequence of SEQ ID NO: 24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 26-30 and 50, e.g., SEQ ID NOs 26 and 27) fused to the sequence of SEQ ID NO: 25 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 31 -35, 51 , 52, and 55, e.g., SEQ ID NOs 31 and 32) with no intervening nucleic acids.
  • the nucleic acid sequence of the murine Myo15 promoter that results from direct fusion of SEQ ID NO: 24 to SEQ ID NO: 25 is set forth in SEQ ID NO: 36.
  • a linker can be used to join the sequence of SEQ ID NO: 24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 26-30 and 50, e.g., SEQ ID NOs 26 and 27) to the sequence of SEQ ID NO: 25 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 31 -35, 51 , 52, and 55, e.g., SEQ ID NOs 31 and 32).
  • Exemplary Myo15 promoters containing functional portions of both SEQ ID NO: 24 and SEQ ID NO: 25 are provided in SEQ ID NOs: 38, 39, 53, 54, 59, and 60.
  • the length of a nucleic acid linker for use in a murine Myo15 promoter described herein can be about 5 kb or less (e.g., about 5 kb, 4.5, kb, 4, kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1 .5 kb, 1 kb, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, 90 bp, 80 bp,
  • Nucleic acid linkers that can be used in the murine Myo15 promoter described herein do not disrupt the ability of the murine Myo15 promoter of the invention to induce transgene expression in hair cells.
  • sequence of SEQ ID NO: 24 or a functional portion or derivative thereof is joined (e.g., operably linked) to the sequence of SEQ ID NO: 25 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 31 -35, 51 , 52, and 55, e.g., SEQ ID NOs 31 and 32), and, in some embodiments, the order of the regions is reversed (e.g., the sequence of SEQ ID NO: 25 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 31 -35, 51 , 52, and 55, e.g., SEQ ID NOs 31 and 32) is joined (e.g., operably linked) to the sequence of SEQ ID NO: 24 or a functional portion or derivative thereof (e.g., any one
  • nucleic acid sequence of a murine Myo15 promoter that results from direct fusion of SEQ ID NO: 25 to SEQ ID NO: 24 is set forth in SEQ ID NO: 37.
  • An example of a murine Myo15 promoter in which a functional portion or derivative of SEQ ID NO: 25 precedes a functional portion or derivative of SEQ ID NO: 24 is provided in SEQ ID NO: 58.
  • sequence of SEQ ID NO: 24 or a functional portion or derivative thereof and the sequence of SEQ ID NO: 25 or a functional portion or derivative thereof can be joined by direct fusion or a nucleic acid linker, as described above.
  • the murine Myo15 promoter for use in the compositions and methods described herein contains a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to a region containing the first non-coding exon of the murine Myo15 gene (nucleic acids from -6755 to -7209 with respect to the murine Myo15 translation start site, the sequence of which is set forth in SEQ ID NO: 24) or a functional portion or derivative thereof.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity
  • the functional portion of SEQ ID NO: 24 may have the sequence of nucleic acids from -7166 to -7091 with respect to the murine Myo15 translation start site (set forth in SEQ ID NO: 26) and/or the sequence of nucleic acids from -7077 to -6983 with respect to the murine Myo15 translation start site (set forth in SEQ ID NO: 27).
  • the murine Myo15 promoter may contain the nucleic acid sequence of SEQ ID NO: 26 fused to the nucleic acid sequence of SEQ ID NO: 27 with no intervening nucleic acids, as set forth in SEQ ID NO: 28, or the murine Myo15 promoter may contain the nucleic acid sequence of SEQ ID NO: 27 fused to the nucleic acid sequence of SEQ ID NO:
  • the murine Myo15 promoter may contain the sequences of SEQ ID NO: 26 and SEQ ID NO: 27 joined by the endogenous intervening nucleic acid sequence (e.g., the first region may have or include the sequence of nucleic acids from -7166 to -6983 with respect to the murine Myo15 translation start site, as set forth in SEQ ID NO: 30 and SEQ ID NO: 50) or a nucleic acid linker.
  • a murine Myo15 promoter that contains both SEQ ID NO: 26 and SEQ ID NO: 27, the two sequences can be included in any order (e.g., SEQ ID NO: 26 may be joined to (e.g., precede) SEQ ID NO: 27, or SEQ ID NO: 27 may be joined to (e.g., precede) SEQ ID NO: 26).
  • the murine Myo15 promoter for use in the compositions and methods described herein contains a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the nucleic acid sequence immediately upstream of the murine Myo15 translation start site (nucleic acids from -1 to - 1157 with respect to the murine Myo15 translation start site, the sequence of which is set forth in SEQ ID NO: 25) or a functional portion or derivative thereof.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity
  • the functional portion of SEQ ID NO: 25 may have the sequence of nucleic acids from -590 to -509 with respect to the murine Myo15 translation start site (set forth in SEQ ID NO: 31 ) and/or the sequence of nucleic acids from -266 to -161 with respect to the murine Myo15 translation start site (set forth in SEQ ID NO: 32).
  • the sequence containing SEQ ID NO: 31 has the sequence of SEQ ID NO: 51 .
  • the sequence containing SEQ ID NO: 32 has the sequence of SEQ ID NO: 52.
  • the murine Myo15 promoter may contain the nucleic acid sequence of SEQ ID NO: 31 fused to the nucleic acid sequence of SEQ ID NO:
  • the murine Myo15 promoter may contain the nucleic acid sequence of SEQ ID NO: 32 fused to the nucleic acid sequence of SEQ ID NO:
  • the murine Myo15 promoter may contain the nucleic acid sequence of SEQ ID NO: 51 fused to the nucleic acid sequence of SEQ ID NO:
  • the murine Myo15 promoter may contain the nucleic acid sequence of SEQ ID NO: 52 fused to the nucleic acid sequence of SEQ ID NO:
  • the murine Myo15 promoter may contain the sequences of SEQ ID NO: 31 and SEQ ID NO: 32 joined by the endogenous intervening nucleic acid sequence (e.g., the second region may have the sequence of nucleic acids from -590 to -161 with respect to the murine Myo15 translation start site, as set forth in SEQ ID NO: 35) or a nucleic acid linker.
  • a murine Myo15 promoter that contains both SEQ ID NO: 31 and SEQ ID NO: 32
  • the two sequences can be included in any order (e.g., SEQ ID NO: 31 may be joined to (e.g., precede) SEQ ID NO: 32, or SEQ ID NO: 32 may be joined to (e.g., precede) SEQ ID NO: 31 ).
  • the murine Myo15 promoter for use in the compositions and methods described herein contains a functional portion or derivative of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to a region containing the first non-coding exon of the Myo15 gene (nucleic acids from -6755 to -7209 with respect to the murine Myo15 translation start site, the sequence of which is set forth in SEQ ID NO: 24) flanked on both sides by a functional portion or derivative of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the nucleic acid sequence immediately upstream of the murine
  • a functional portion or derivative of SEQ ID NO: 25, such as SEQ ID NO: 31 or 51 may be directly fused or joined by a nucleic acid linker to a portion of SEQ ID NO: 24, such as any one of SEQ ID NOs: 26-30 and 50, which is directly fused or joined by a nucleic acid linker to a different functional portion of SEQ ID NO: 25, such as SEQ ID NO: 32 or 52.
  • a functional portion or derivative of SEQ ID NO: 25, such as SEQ ID NO: 32 or 52 may be directly fused or joined by a nucleic acid linker to a portion of SEQ ID NO: 24, such as any one of SEQ ID NOs: 26-30 and 50, which is directly fused or joined by a nucleic acid linker to a different functional portion of SEQ ID NO: 25, such as SEQ ID NO: 31 or 51 .
  • polynucleotides having at least 85% sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity
  • polynucleotides having at least 85% sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity
  • polynucleotides having at least 85% sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%,
  • nucleic acid sequence of SEQ ID NOs: 52, 50, and 51 can be fused to produce a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the nucleic acid sequence of SEQ ID NO: 57.
  • the Myo15 promoter for use in the compositions and methods described herein includes nucleic acid sequences from regions of the human Myo15 locus that are capable of expressing a transgene specifically in hair cells, or variants thereof, such as a nucleic acid sequences that have at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to regions of the human Myo15 locus that are capable of expressing a transgene specifically in hair cells.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity
  • the Myo15 promoter for use in the compositions and methods described herein can optionally include a linker operably linking the regions of the human Myo15 locus that are capable of expressing a transgene specifically in hair cells, or the regions of the human Myo15 locus can be joined directly without an intervening linker.
  • the Myo15 promoter for use in the compositions and methods described herein contains a first region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the sequence set forth in SEQ ID NO: 40 or a functional portion or derivative thereof joined (e.g., operably linked) to a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the sequence set forth in SEQ ID NO: 41 or a functional portion or derivative thereof.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 9
  • the functional portion of SEQ ID NO: 40 may have the sequence set forth in SEQ ID NO: 42.
  • the functional portion of SEQ ID NO: 41 may have the sequence set forth in SEQ ID NO: 43 and/or the sequence set forth in SEQ ID NO: 44.
  • the second region may contain the nucleic acid sequence of SEQ ID NO: 43 fused to the nucleic acid sequence of SEQ ID NO: 44 with no intervening nucleic acids, as set forth in SEQ ID NO: 45, or the second region may contain the nucleic acid sequence of SEQ ID NO: 44 fused to the nucleic acid sequence of SEQ ID NO: 43 with no intervening nucleic acids, as set forth in SEQ ID NO: 46.
  • the second region may contain the sequences of SEQ ID NO: 43 and SEQ ID NO: 44 joined by the endogenous intervening nucleic acid sequence (as set forth in SEQ ID NO: 47) or a nucleic acid linker.
  • the two sequences can be included in any order (e.g., SEQ ID NO: 43 may be joined to (e.g., precede) SEQ ID NO: 44, or SEQ ID NO: 44 may be joined to (e.g., precede) SEQ ID NO: 43).
  • the first region and the second region of the human Myo15 promoter can be joined directly or can be joined by a nucleic acid linker.
  • the human Myo15 promoter can contain the sequence of SEQ ID NO: 40 or a functional portion or derivative thereof (e.g., SEQ ID NO: 42) fused to the sequence of SEQ ID NO: 41 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NOs: 43 and/or 44) with no intervening nucleic acids.
  • a linker can be used to join the sequence of SEQ ID NO: 40 or a functional portion or derivative thereof (e.g., SEQ ID NO: 42) to the sequence of SEQ ID NO: 41 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NOs: 43 and/or 44).
  • SEQ ID NOs: 48 and 49 Exemplary human Myo15 promoters containing functional portions of both SEQ ID NO: 40 and SEQ ID NO: 41 are provided in SEQ ID NOs: 48 and 49.
  • sequence of SEQ ID NO: 40 or a functional portion or derivative thereof is joined (e.g., operably linked) to the sequence of SEQ ID NO: 41 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NOs: 43 and 44), and, in some embodiments, the order of the regions is reversed (e.g., the sequence of SEQ ID NO: 41 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NOs: 43 and/or 44) is joined (e.g., operably linked) to the sequence of SEQ ID NO: 40 or a functional portion or derivative thereof (e.g., SEQ ID NO: 42).
  • the human Myo15 promoter for use in the compositions and methods described herein contains a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to a region containing the sequence set forth in SEQ ID NO: 40 or a functional portion or derivative thereof.
  • the functional portion of SEQ ID NO: 40 may have the sequence of nucleic acids set forth in SEQ ID NO: 42.
  • the human Myo15 promoter for use in the compositions and methods described herein contains a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the sequence set forth in SEQ ID NO: 41 or a functional portion or derivative thereof.
  • the functional portion of SEQ ID NO: 41 may have the sequence set forth in SEQ ID NO: 43 and/or the sequence set forth in SEQ ID NO: 44.
  • the human Myo15 promoter may contain the nucleic acid sequence of SEQ ID NO: 43 fused to the nucleic acid sequence of SEQ ID NO: 44 with no intervening nucleic acids, as set forth in SEQ ID NO: 45, or the human Myo15 promoter may contain the nucleic acid sequence of SEQ ID NO: 44 fused to the nucleic acid sequence of SEQ ID NO: 43 with no intervening nucleic acids, as set forth in SEQ ID NO: 46.
  • the human Myo15 promoter may contain the sequences of SEQ ID NO: 43 and SEQ ID NO: 44 joined by the endogenous intervening nucleic acid sequence (e.g., as set forth in SEQ ID NO: 47) or a nucleic acid linker.
  • SEQ ID NO: 43 may be joined to (e.g., precede) SEQ ID NO: 44, or SEQ ID NO: 44 may be joined to (e.g., precede) SEQ ID NO: 43).
  • the length of a nucleic acid linker for use in a human Myo15 promoter described herein can be about 5 kb or less (e.g., about 5 kb, 4.5, kb, 4, kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1 .5 kb, 1 kb, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, 90 bp, 80 bp,
  • Nucleic acid linkers that can be used in the human Myo15 promoters described herein do not disrupt the ability of the human Myo15 promoter of the invention to induce transgene expression in hair cells.
  • the foregoing Myo15 promoter sequences are summarized in Table 3, below.
  • Table 3 Exemplary nucleotide sequences for use in the Myo15 promoter described herein Additional Myo15 promoters useful in conjunction with the compositions and methods described herein include nucleic acid molecules that have at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the nucleic acid sequences set forth in Table 3, as well as functional portions or derivatives of the nucleic acid sequences set forth in Table 3.
  • the Myo15 promoters listed in Table 3 are characterized in International Application Publication Nos. WO2019210181 A1 and W02020163761 A1 , which are incorporated herein by reference.
  • the smCBA promoter may have the sequence of the smCBA promoter described in U.S. Patent No. 8,298,818, which is incorporated herein by reference.
  • the smCBA promoter has the sequence of:
  • the smCBA promoter has the sequence of:
  • the transcription of this polynucleotide can be induced by methods known in the art.
  • expression can be induced by exposing the mammalian cell to an external chemical reagent, such as an agent that modulates the binding of a transcription factor and/or RNA polymerase to the mammalian promoter and thus regulates gene expression.
  • the chemical reagent can serve to facilitate the binding of RNA polymerase and/or transcription factors to the mammalian promoter, e.g., by removing a repressor protein that has bound the promoter.
  • the chemical reagent can serve to enhance the affinity of the mammalian promoter for RNA polymerase and/or transcription factors such that the rate of transcription of the gene located downstream of the promoter is increased in the presence of the chemical reagent.
  • chemical reagents that potentiate polynucleotide transcription by the above mechanisms include tetracycline and doxycycline. These reagents are commercially available (Life Technologies, Carlsbad, CA) and can be administered to a mammalian cell in order to promote gene expression according to established protocols.
  • DNA sequence elements that may be included in the nucleic acid vectors for use in the compositions and methods described herein include enhancer sequences.
  • Enhancers represent another class of regulatory elements that induce a conformational change in the polynucleotide containing the gene of interest such that the DNA adopts a three-dimensional orientation that is favorable for binding of transcription factors and RNA polymerase at the transcription initiation site.
  • polynucleotides for use in the compositions and methods described herein include those that encode an OTOF protein and additionally include a mammalian enhancer sequence.
  • Enhancers for use in the compositions and methods described herein also include those that are derived from the genetic material of a virus capable of infecting a eukaryotic cell. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • Enhancer sequences that induce activation of eukaryotic gene transcription are disclosed in Yaniv, et al., Nature 297:17 (1982).
  • An enhancer may be spliced into a vector containing a polynucleotide encoding an OTOF protein, for example, at a position 5’ or 3’ to this gene. In a preferred orientation, the enhancer is positioned at the 5’ side of the promoter, which in turn is located 5’ relative to the polynucleotide encoding an OTOF protein.
  • the nucleic acid vectors described herein may include a Woodchuck Posttranscriptional Regulatory Element (WPRE).
  • WPRE acts at the mRNA level, by promoting nuclear export of transcripts and/or by increasing the efficiency of polyadenylation of the nascent transcript, thus increasing the total amount of mRNA in the cell.
  • the addition of the WPRE to a vector can result in a substantial improvement in the level of transgene expression from several different promoters, both in vitro and in vivo.
  • the WPRE can be located in the second nucleic acid vector between the polynucleotide encoding a C-terminal portion of an OTOF protein and the poly(A) sequence.
  • the WPRE has the sequence:
  • the WPRE has the sequence:
  • the nucleic acid vectors for use in the compositions and methods described herein include a reporter sequence, which can be useful in verifying OTOF gene expression, for example, in specific cells and tissues (e.g., in cochlear hair cells).
  • Reporter sequences that may be provided in a transgene include DNA sequences encoding b-lactamase, b -galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art.
  • the reporter sequences When associated with regulatory elements which drive their expression, the reporter sequences provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry.
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • immunohistochemistry for example, where the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assays for b- galactosidase activity. Where the transgene is green fluorescent protein or luciferase, the vector carrying the signal may be measured visually by color or light production in a luminometer.
  • One approach for expressing large proteins in mammalian cells involves the use of overlapping dual vectors. This approach is based on the use of two nucleic acid vectors, each of which contains a portion of a polynucleotide that encodes a protein of interest and has a defined region of sequence overlap with the other polynucleotide. Homologous recombination can occur at the region of overlap and lead to the formation of a single nucleic acid molecule that encodes the full-length protein of interest.
  • Overlapping dual vectors for use in the methods and compositions described herein contain at least one kilobase (kb) of overlapping sequence (e.g., 1 kb, 1 .5 kb, 2 kb, 2.5 kb, 3 kb or more of overlapping sequence).
  • the nucleic acid vectors are designed such that the overlapping region is centered at an OTOF exon boundary, with an equal amount of overlap on either side of the boundary.
  • the boundaries are chosen based on the size of the promoter and the locations of the portions of the polynucleotide that encode OTOF C2 domains. Overlapping regions are centered on exon boundaries that occur outside of the portion of the polynucleotide that encodes the C2C domain (e.g., after the portion of the polynucleotide that encodes the C2C domain). Exon boundaries within the portion of the polynucleotide that encodes the C2D domain can be selected as the center of the overlapping region, or exon boundaries located after the portion of the polynucleotide that encodes the C2D domain and before the portion of the polynucleotide that encodes the C2E domain can serve as the center of an overlapping region.
  • nucleic acid vectors for use in the methods and compositions described herein are also designed such that approximately half of the OTOF gene is contained within each vector (e.g., each vector contains a polynucleotide that encodes approximately half of the OTOF protein).
  • One exemplary overlapping dual vector system includes a first nucleic acid vector containing a CAG promoter operably linked to exons 1-28 and the 500 base pairs (bp) immediately 3’ of the exon 28/29 boundary of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6); and a second nucleic acid vector containing the 500 bp immediately 5’ of the exon 28/29 boundary and the remaining exons (e.g., exons 29-48 for mouse OTOF, exons 29-45 and 47 or exons 29-46 for human OTOF) of the polynucleotide encoding the OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ
  • Another exemplary overlapping dual vector system includes a first nucleic acid vector containing a CAG promoter operably linked to exons 1-24 and the 500 bp immediately 3’ of the exon 24/25 boundary of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6); and a second nucleic acid vector containing the 500 bp immediately 5’ of the exon 24/25 boundary and the remaining exons (e.g., exons 25-48 for mouse OTOF, exons 25-45 and 47 or exons 25- 46 for human OTOF) the polynucleotide encoding the OTOF protein (e.g., exons 25-48 for mouse OTOF, exons 25-45 and 47 or exons 25- 46 for human OTOF) the polynucleotide
  • the overlapping sequence is centered at the exon 24/25 boundary, which is within the portion of the polynucleotide that encodes the C2D domain.
  • the two exon boundaries described above can be used with any promoter that is a similar size to the CAG promoter (e.g., the CMV promoter or smCBA promoter), such as promoters that are 1 kb or shorter (e.g., approximately 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp 500 bp, 450 bp, 400 bp, 350 bp, 300 bp or shorter).
  • the CMV promoter or the smCBA promoter can be used in the place of the CAG promoter.
  • a Myo15 promoter having a sequence that is 1 kb or shorter e.g., a Myo15 promoter described hereinabove, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60
  • a different exon boundary can be chosen that is within or after the portion of the polynucleotide that encodes the C2D domain and before the portion of the polynucleotide that encodes the C2E domain.
  • the nucleic acid vectors containing promoters of this size can optionally contain OTOF UTRs.
  • the second nucleic acid vector can contain the full length OTOF 3’ UTR (e.g., the 1035 bp human OTOF 3’ UTR in dual vector systems encoding human OTOF, or the 1001 bp mouse OTOF 3’ UTR in dual vector systems encoding mouse OTOF).
  • the first nor the second nucleic acid vector contains an OTOF UTR.
  • the first nucleic acid vector in the overlapping dual vector system contains a long promoter (e.g., a promoter that is longer than 1 kb, e.g., 1 .1 kb, 1 .25 kb, 1 .5 kb, 1 .75 kb, 2 kb, 2.5 kb, 3 kb or longer).
  • a promoter that is longer than 1 kb, e.g., 1 .1 kb, 1 .25 kb, 1 .5 kb, 1 .75 kb, 2 kb, 2.5 kb, 3 kb or longer.
  • the overlapping region can be centered at an exon boundary that is located after the portion of the polynucleotide that encodes the C2C domain and before the portion of the polynucleotide that encodes the C2D domain.
  • an overlapping dual vector system for use in the methods and compositions described herein includes a first nucleic acid vector containing a Myo15 promoter that is longer than 1 kb (e.g., SEQ ID NO: 36) operably linked exons 1-21 and the 500 bp immediately 3’ of the exon 21/22 boundary of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6); and a second nucleic acid vector containing the 500 bp immediately 5’ of the exon 21/22 boundary and the remaining exons (e.g., exons 29-48 for mouse OTOF, exons 22-45 and 47 or exons 22-46 for human OTOF) of the polynucleotide encoding the OTOF protein (e.g., human OTOF, e.g.,
  • the exon 20/21 boundary can also be selected as the center of the overlapping region.
  • neither the first nor the second nucleic acid vector may include an OTOF UTR.
  • a short promoter e.g., a CMV promoter, CAG promoter, smCBA promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60
  • these dual vector systems e.g., a dual vector system in which the overlapping region is centered at the exon 21/22 or exon 20/21 boundary.
  • additional elements such as a 5’ OTOF UTR, can be included in the first vector (e.g., the vector containing exons 1-21 and the 500 bp immediately 3’ of the exon 21/22 boundary or exons 1- 20 and the 500 bp immediately 3’ of the exon 20/21 boundary of a polynucleotide encoding an OTOF protein).
  • a second approach for expressing large proteins in mammalian cells involves the use of trans splicing dual vectors.
  • two nucleic acid vectors are used that contain distinct nucleic acid sequences, and the polynucleotide encoding the N-terminal portion of the protein of interest and the polynucleotide encoding the C-terminal portion of the protein of interest do not overlap.
  • the first nucleic acid vector includes a splice donor sequence 3’ of the polynucleotide encoding the N-terminal portion of the protein of interest
  • the second nucleic acid vector includes a splice acceptor sequence 5’ of the polynucleotide encoding the C-terminal portion of the protein of interest.
  • the first and second nucleic acids When the first and second nucleic acids are present in the same cell, their ITRs can concatemerize, forming a single nucleic acid structure in which the concatemerized ITRs are positioned between the splice donor and splice acceptor. Trans-splicing then occurs during transcription, producing a nucleic acid molecule in which the polynucleotides encoding the N-terminal and C-terminal portions of the protein of interest are contiguous, thereby forming the full-length coding sequence.
  • Trans-splicing dual vectors for use in the methods and compositions described herein are designed such that approximately half of the OTOF gene is contained within each vector (e.g., each vector contains a polynucleotide that encodes approximately half of the OTOF protein).
  • the determination of how to split the polynucleotide sequence between the two nucleic acid vectors is made based on the size of the promoter and the locations of the portions of the polynucleotide that encode the OTOF C2 domains.
  • a short promoter e.g., a promoter that is 1 kb or shorter, e.g., approximately 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp 500 bp, 450 bp, 400 bp, 350 bp, 300 bp or shorter
  • a CAG promoter e.g., a CMV promoter, a smCBA promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter
  • a Myo15 promoter described hereinabove e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60
  • the OTOF polynucleotide sequence can be divided between the two nucleic acid vectors at an exon boundary
  • the nucleic acid vectors containing promoters of this size can optionally contain OTOF UTRs (e.g., both the 5’ and 3’ OTOF UTRs, e.g., full-length UTRs).
  • OTOF UTRs e.g., both the 5’ and 3’ OTOF UTRs, e.g., full-length UTRs.
  • a long promoter is used in the trans-splicing dual vector system (e.g., a promoter that is longer than 1 kb, e.g., 1 .1 kb, 1 .25 kb, 1 .5 kb, 1 .75 kb, 2 kb, 2.5 kb, 3 kb or longer), such as a Myo15 promoter that is longer than 1 kb (e.g., SEQ ID NO: 36), the OTOF polynucleotide sequence can be divided between the two nucleic acid vectors at an exon boundary that occurs after
  • a short promoter e.g., a CMV promoter, smCBA promoter, CAG promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60
  • additional elements e.g., OTOF UTR sequences
  • the first vector e.g., the vector containing the portion of the polynucleotide the encodes the C2C domain.
  • One exemplary trans-splicing dual vector system that uses a short promoter includes a first nucleic acid vector containing a CAG promoter operably linked to exons 1-26 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and a splice donor sequence 3’ of the polynucleotide sequence; and a second nucleic acid vector containing a splice acceptor sequence 5’ of the remaining exons (e.g., exons 27-48 for mouse OTOF, or exons 27-45 and 47 or exons 27-46 of human OTOF) of the polynucleotide encoding the polynucleotide encoding the OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or S
  • An alternative trans-splicing dual vector system includes a first nucleic acid vector containing a CAG promoter operably linked to exons 1-28 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and a splice donor sequence 3’ of the polynucleotide sequence; and a second nucleic acid vector containing a splice acceptor sequence 5’ of the remaining exons (e.g., exons 29-48 of mouse OTOF, or exons 29-45 and 47 or exons 29-46 of human OTOF) of the polynucleotide encoding the polynucleotide encoding the polynucleotide encoding the polynucleotide encoding the polynucleotide encoding the OTOF protein
  • the CMV promoter, smCBA promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter can be used in place of the CAG promoter either of the foregoing dual vector systems.
  • nucleic acid vectors can also contain full length 5’ and 3’ OTOF UTRs in the first and second nucleic acid vectors, respectively (e.g., the first nucleic acid vector can contain the 5’ human OTOF UTR (127 bp) in dual vector systems encoding human OTOF, or the 5’ mouse UTR (134 bp) in dual vector systems encoding mouse OTOF; and the second nucleic acid vector can contain the 3’ human OTOF UTR (1035 bp) in dual vector systems encoding human OTOF, or the 3’ mouse OTOF UTR (1001 bp) in dual vector systems encoding mouse OTOF).
  • the first nucleic acid vector can contain the 5’ human OTOF UTR (127 bp) in dual vector systems encoding human OTOF, or the 5’ mouse UTR (134 bp) in dual vector systems encoding mouse OTOF
  • the second nucleic acid vector can contain the 3’ human OTOF UTR (1035 bp
  • An exemplary trans-splicing dual vector system that uses a long promoter includes a first nucleic acid vector containing a Myo15 promoter that is longer than 1 kb (e.g., SEQ ID NO: 36) operably linked to exons 1-19 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and a splice donor sequence 3’ of the polynucleotide sequence; and a second nucleic acid vector containing a splice acceptor sequence 5’ of the remaining exons (e.g., exons 20-48 of mouse OTOF, or exons 20-45 and 47 or exons 20-46 of human OTOF) of the polynucleotide encoding the polynucleotide encoding the polynucleotide
  • the trans-splicing dual vector system can include a first nucleic acid vector containing a Myo15 promoter that is longer than 1 kb (e.g., SEQ ID NO: 36) operably linked to exons 1-20 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and a splice donor sequence 3’ of the polynucleotide sequence; and a second nucleic acid vector containing a splice acceptor sequence 5’ of the remaining exons (e.g., exons 21 -48 of mouse OTOF, or exons 21 -45 and 47 or exons 21 -46 of human OTOF) of the polynucleotide encoding the polynucleotide encoding the polynucleotide encoding the
  • Neither the first nor the second nucleic acid vector in either of the foregoing Myo15 promoter trans splicing dual vector systems contains an OTOF UTR.
  • a short promoter e.g., a CMV promoter, smCBA promoter, CAG promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60
  • these dual vector systems may also include a 5’ OTOF UTR or another element of a similar size in the first vector.
  • the OTOF coding sequence can be divided in a different position.
  • the first nucleic acid vector contains a Myo15 promoter that is longer than 1 kb (e.g., SEQ ID NO: 36) operably linked to exons 1 -25 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6) and a splice donor sequence 3’ of the polynucleotide sequence; and the second nucleic acid vector contains a splice acceptor sequence 5’ of the remaining exons (e.g., exons 26-48 of mouse OTOF, or exons 26-45 and 47 or 26-46 of human OTOF) of the polynucleotide encoding the OTOF
  • OTOF protein e.g., human OTOF, e.g.
  • the trans-splicing dual vector system can also contain a 3’ UTR if the first nucleic acid vector contains a Myo15 promoter that is longer than 1 kb (e.g., SEQ ID NO: 36) operably linked to exons 1 -24 of a polynucleotide encoding an OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6) and a splice donor sequence 3’ of the polynucleotide sequence; and the second nucleic acid vector contains a splice acceptor sequence 5’ of exons 25-48 of a polynucleotide encoding an OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6) and a poly(A) sequence (e.g., a bGH poly(A) signal sequence).
  • OTOF protein e.g., mouse OTOF, e.g., SEQ ID NO: 6
  • the second nucleic acid can also contain a full length OTOF 3’ UTR (e.g., the 1001 bp mouse OTOF 3’ UTR).
  • a short promoter e.g., a CMV promoter, smCBA promoter, CAG promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60
  • these dual vector systems may also include a 5’ OTOF UTR in the first vector.
  • a third approach for expressing large proteins in mammalian cells involves the use of dual hybrid vectors.
  • This approach combines elements of the overlapping dual vector strategy and the trans-splicing strategy in that it features both an overlapping region at which homologous recombination can occur and splice donor and splice acceptor sequences.
  • the overlapping region is a recombinogenic region that is contained in both the first and second nucleic acid vectors, rather than a portion of the polynucleotide sequence encoding the protein of interest - the polynucleotide encoding the N-terminal portion of the protein of interest and the polynucleotide encoding the C-terminal portion of the protein of interest do not overlap in this approach.
  • the recombinogenic region is 3’ of the splice donor sequence in the first nucleic acid vector and 5’ of the splice acceptor sequence in the second nucleic acid vector.
  • the first and second polynucleotide sequences can then join to form a single sequence based on one of two mechanisms: 1) recombination at the overlapping region, or 2) concatemerization of the ITRs.
  • the remaining recombinogenic region(s) and/or the concatemerized ITRs can be removed by splicing, leading to the formation of a contiguous polynucleotide sequence that encodes the full-length protein of interest.
  • Recombinogenic regions that can be used in the compositions and methods described herein include the F1 phage AK gene having a sequence of: GGGATTTTGCCGATTTCGGCCTATTGGTTAA AAAATG AG CTG ATTT AAC AAAAATTT AACG CG AATTTT AAC AAAAT (SEQ ID NO: 19) and alkaline phosphatase (AP) gene fragments as described in US Patent No. 8,236,557, which are incorporated herein by reference.
  • the AP gene fragment has the sequence of:
  • the AP gene fragment has the sequence of:
  • the AP gene fragment has the sequence of:
  • the AP gene fragment has the sequence of:
  • the AP gene fragment has the sequence of:
  • the AP gene fragment has the sequence of:
  • An exemplary splice donor sequence for use in the methods and compositions described herein has the sequence: GTAAGTATCAAGGTTACAAGAC AGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAAGACTCTTGCGTTTCT (SEQ ID NO: 20).
  • An exemplary splice acceptor sequence for use in the methods and compositions described herein has the sequence: GATAGGCACCTATTGG T CTT ACTG AC AT CC ACTTTGCCTTT CT CT CC AC AG (SEQ ID NO: 21 ).
  • T AGG C ACCT ATTGGTCTT ACTG AC AT CC ACTTT G CCTTT CT CT CC AC AG (SEQ ID NO: 69) can also be used in the methods and compositions described herein. Additional examples of splice donor and splice acceptor sequences are known in the art.
  • Dual hybrid vectors for use in the methods and compositions described herein are designed such that approximately half of the OTOF gene is contained within each vector (e.g., each vector contains a polynucleotide that encodes approximately half of the OTOF protein).
  • the determination of how to split the polynucleotide sequence between the two nucleic acid vectors is made based on the size of the promoter and the locations of the portions of the polynucleotide that encode the OTOF C2 domains.
  • a short promoter e.g., a promoter that is 1 kb or shorter, e.g., approximately 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp 500 bp, 450 bp, 400 bp, 350 bp, 300 bp or shorter
  • a promoter that is 1 kb or shorter e.g., a Myo15 promoter described hereinabove, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60
  • the OTOF polynucleotide sequence is divided between the two nucleic acid vectors at an exon boundary that occurs after the portion of the polynucleotide that encodes
  • the nucleic acid vectors containing promoters of this size can optionally contain OTOF UTRs (e.g., full-length 5’ and 3’ UTRs).
  • OTOF UTRs e.g., full-length 5’ and 3’ UTRs.
  • a long promoter e.g., a promoter that is longer than 1 kb, e.g., 1 .1 kb, 1 .25 kb, 1 .5 kb, 1 .75 kb, 2 kb, 2.5 kb, 3 kb or longer
  • the OTOF polynucleotide sequence will be divided between the two nucleic acid vectors at an exon boundary that occurs after the portion of the polynucleotide that encodes the C2C domain, and either before the portion of the polynucleotide that encodes the C2D domain, such as the exon 19/20 boundary, the exon 20/21 boundary, or the
  • a short promoter e.g., a CMV promoter, CAG promoter, smCBA promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60
  • additional elements e.g., OTOF UTR sequences
  • the first vector e.g., the vector containing the portion of the polynucleotide the encodes the C2C domain.
  • One exemplary dual hybrid vector system that uses a short promoter includes a first nucleic acid vector containing a CAG promoter operably linked to exons 1 -26 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), a splice donor sequence 3’ of the polynucleotide sequence, and a recombinogenic region 3’ of the splice donor sequence; and a second nucleic acid vector containing a recombinogenic region, a splice acceptor sequence 3’ of the recombinogenic region, a polynucleotide 3’ of the splice acceptor sequence that contains the remaining exons (e.g., exons 27-48 of mouse OTOF, or exons 27-45 and 47 or exons 27-46 of human
  • the first and second nucleic acid vectors can also contain the full length 5’ and 3’ OTOF UTRs, respectively (e.g., the 127 bp human OTOF 5’ UTR can be included in the first nucleic acid vector, and the 1035 bp human OTOF 3’ UTR can be included in the second nucleic acid vector).
  • Another exemplary dual hybrid vector system that uses a short promoter includes a first nucleic acid vector containing a CAG promoter operably linked to exons 1 -28 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), a splice donor sequence 3’ of the polynucleotide sequence, and a recombinogenic region 3’ of the splice donor sequence; and a second nucleic acid vector containing a recombinogenic region, a splice acceptor sequence 3’ of the recombinogenic region, a polynucleotide 3’ of the splice acceptor sequence that contains the remaining exons (e.g., 29-48 for mouse OTOF, or exons 29-45 and 47 or exons 29-46 for human OTOF)
  • the first and second nucleic acid vectors can also contain the full length 5’ and 3’ OTOF UTRs, respectively (e.g., the 134 bp mouse OTOF 5’ UTR can be included in the first nucleic acid vector, and the 1001 bp mouse OTOF 3’ UTR can be included in the second nucleic acid vector).
  • the CMV promoter, smCBA promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter can be used in place of the CAG promoter either of the foregoing dual vector systems.
  • An exemplary dual hybrid vector system that uses a long promoter includes a first nucleic acid vector containing a Myo15 promoter that is longer than 1 kb (e.g., SEQ ID NO: 36) operably linked to exons 1 -19 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), a splice donor sequence 3’ of the polynucleotide sequence, and a recombinogenic region 3’ of the splice donor sequence; and a second nucleic acid vector containing a recombinogenic region, a splice acceptor sequence 3’ of the recombinogenic region, a polynucleotide 3’ of the splice acceptor sequence that contains the remaining exons (e.g., 20-48 exons of mouse OTO
  • Another exemplary dual hybrid vector system that uses a long promoter includes a first nucleic acid vector containing a Myo15 promoter that is longer than 1 kb (e.g., SEQ ID NO: 36) operably linked to exons 1 -20 of a polynucleotide encoding an OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6, or human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5), a splice donor sequence 3’ of the polynucleotide sequence, and a recombinogenic region 3’ of the splice donor sequence; and a second nucleic acid vector containing a recombinogenic region, a splice acceptor sequence 3’ of the recombinogenic region, a polynucleotide 3’ of the splice acceptor sequence that contains the remaining exons (e.g., exons 21 -48 of mouse
  • OTOF UTR a short promoter (e.g., a CMV promoter, smCBA promoter, CAG promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60) can also be used in the foregoing dual vector systems designed for large promoters. If these dual vector systems contain a short promoter, they may also include an additional element (e.g., a 5’ OTOF UTR) in the first vector.
  • a short promoter e.g., a CMV promoter, smCBA promoter, CAG promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60
  • these dual vector systems may also include an additional element (e.g.
  • the OTOF coding sequence can be divided in a different position.
  • the first nucleic acid vector contains a Myo15 promoter that is longer than 1 kb (e.g., SEQ ID NO: 36) operably linked to exons 1 -25 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), a splice donor sequence 3’ of the polynucleotide sequence, and a recombinogenic region 3’ of the splice donor sequence; and the second nucleic acid vector contains a recombinogenic region, a splice acceptor sequence 3’ of the recombinogenic region, a polynucleotide 3’ of the splice acceptor sequence that contains the remaining exon
  • OTOF protein e.g., human OTOF,
  • the dual hybrid vector system can contain a 3’ UTR if the first nucleic acid vector contains a Myo15 promoter that is longer than 1 kb (e.g., SEQ ID NO: 36) operably linked to exons 1 -24 of a polynucleotide encoding an OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6), a splice donor sequence 3’ of the polynucleotide sequence, and a recombinogenic region 3’ of the splice donor sequence; and the second nucleic acid vector contains a recombinogenic region, a splice acceptor sequence 3’ of the recombinogenic region, a polynucleotide 3’ of the splice acceptor sequence that contains exons 25-48 of the polynucleotide encoding the OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO:
  • the second nucleic acid can also contain a full-length OTOF 3’ UTR (e.g., the 1001 bp mouse OTOF UTR).
  • a short promoter e.g., a CMV promoter, smCBA promoter, CAG promoter, or a Myo15 promoter having a sequence that is 1 kb or shorter, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60
  • these dual vector systems may also include an additional element (e.g., a 5’ OTOF UTR) in the first vector.
  • the dual hybrid vectors used in the methods and compositions described herein can optionally include a degradation signal sequence in both the first and second nucleic acid vectors.
  • the degradation signal sequence can be included to prevent or reduce the expression of portions of the OTOF protein from polynucleotides that failed to recombine and/or undergo splicing.
  • the degradation signal sequence is positioned 3’ of the recombinogenic region in the first nucleic acid vector and is positioned between the recombinogenic region and the splice acceptor in the second nucleic acid vector.
  • a degradation signal sequence that can be used in the compositions and methods described herein has the sequence of: GCCTGCAAGAACTGGTTCAGCAGCCTGAGCCACTTCGTGATCCACCTG (SEQ ID NO: 22).
  • Table 4 Exemplary pairs of overlapping, trans-splicing, and dual hybrid vectors are described in Table 4 below. Table 4: Exemplary pairs of overlapping, trans-splicing, and hybrid dual vectors for use in the methods and compositions described herein
  • the polynucleotide sequence encoding an OTOF protein is a cDNA sequence (e.g., a sequence that does not include introns).
  • the first and/or the second nucleic acid vector in the dual vector system can include intronic sequence.
  • the intronic sequence may be included between one or more exons in the OTOF coding sequence, or the intronic sequence can be included between an exon of the coding sequence and another component of the nucleic acid vector (e.g., between an exon of the OTOF coding sequence and the splice donor sequence in the first nucleic acid vector or between an exon of the OTOF coding sequence and the splice acceptor sequence in the second nucleic acid vector).
  • the polynucleotide encoding the OTOF protein is divided between the first and second nucleic acid vectors (e.g., AAV vectors) in the dual vector system at the exon 20/21 boundary.
  • the polynucleotide encoding the OTOF protein encodes OTOF isoform 5 and is divided between the first and second nucleic acid vectors (e.g., AAV vectors) at the exon 20/21 boundary
  • the polynucleotide sequence encoding the N-terminal portion of OTOF has the sequence of:
  • the polynucleotide sequence encoding the C-terminal portion of OTOF has the sequence of:
  • the N-terminal portion of the OTOF polypeptide has the sequence of:
  • GCCRFLSLADKDQGHSSRTRLDRERLKSCMREL (SEQ ID NO: 73). The above sequence also corresponds to the N-terminal portion of the OTOF isoform 1 protein encoded by exons 1-20.
  • the C-terminal portion of the OTOF polypeptide has the sequence of:
  • Transfer plasmids that may be used to produce the nucleic acid vectors for use in the compositions and methods described herein are provided in Table 5. These transfer plasmids are designed for the expression of OTOF isoform 5.
  • a transfer plasmid e.g., a plasmid containing a DNA sequence to be delivered by a nucleic acid vector, e.g., to be delivered by an AAV
  • helper plasmid e.g., a plasmid providing proteins necessary for AAV manufacture
  • Nucleic acid vectors e.g., a nucleic acid vector (e.g., an AAV vector) containing a polynucleotide encoding an N-terminal portion of OTOF and a nucleic acid vector (e.g., an AAV vector) containing a polynucleotide encoding a C-terminal portion of OTOF
  • a nucleic acid vector e.g., an AAV vector
  • Nucleic acid vectors e.g., a nucleic acid vector (e.g., an AAV vector) containing a polynucleotide encoding an N-terminal portion of OTOF
  • a nucleic acid vector e.g., an AAV vector
  • a nucleic acid vector e.g., an AAV vector
  • the following transfer plasmids are designed to produce nucleic acid vectors (e.g., AAV vectors) for co-formulation or co-administration (e.g., administration simultaneously or sequentially) in a dual hybrid vector system: SEQ ID NO: 75 and SEQ ID NO: 76; SEQ ID NO: 77 and SEQ ID NO: 78; SEQ ID NO: 79 and SEQ ID NO: 76; SEQ ID NO: 80 and SEQ ID NO: 78; SEQ ID NO: 81 and SEQ ID NO: 82; and SEQ ID NO: 83 and SEQ ID NO: 82.
  • nucleic acid vectors e.g., AAV vectors
  • stable expression of an exogenous gene in a mammalian cell can be achieved by integration of the polynucleotide containing the gene into the nuclear genome of the mammalian cell.
  • a variety of vectors for the delivery and integration of polynucleotides encoding exogenous proteins into the nuclear DNA of a mammalian cell have been developed. Examples of expression vectors are disclosed in, e.g., WO 1994/011026 and are incorporated herein by reference.
  • Expression vectors for use in the compositions and methods described herein contain a polynucleotide sequence that encodes a portion of OTOF, as well as, e.g., additional sequence elements used for the expression of these agents and/or the integration of these polynucleotide sequences into the genome of a mammalian cell.
  • Certain vectors that can be used for the expression of OTOF include plasmids that contain regulatory sequences, such as promoter and enhancer regions, which direct gene transcription.
  • Other useful vectors for expression of OTOF contain polynucleotide sequences that enhance the rate of translation of these genes or improve the stability or nuclear export of the mRNA that results from gene transcription.
  • sequence elements include, e.g., 5’ and 3’ untranslated regions and a polyadenylation signal site in order to direct efficient transcription of the gene carried on the expression vector.
  • the expression vectors suitable for use with the compositions and methods described herein may also contain a polynucleotide encoding a marker for selection of cells that contain such a vector. Examples of a suitable marker include genes that encode resistance to antibiotics, such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.
  • nucleic acids of the compositions and methods described herein are incorporated into recombinant AAV (rAAV) vectors and/or virions in order to facilitate their introduction into a cell.
  • rAAV vectors useful in the compositions and methods described herein are recombinant nucleic acid constructs that include (1) a heterologous sequence to be expressed (e.g., a polynucleotide encoding an N-terminal or C-terminal portion of an OTOF protein) and (2) viral sequences that facilitate stability and expression of the heterologous genes.
  • the viral sequences may include those sequences of AAV that are required in cis for replication and packaging (e.g., functional ITRs) of the DNA into a virion.
  • Such rAAV vectors may also contain marker or reporter genes.
  • Useful rAAV vectors have one or more of the AAV WT genes deleted in whole or in part but retain functional flanking ITR sequences.
  • the AAV ITRs may be of any serotype suitable for a particular application.
  • the ITRs can be AAV2 ITRs. Methods for using rAAV vectors are described, for example, in Tal et al. , J. Biomed. Sci. 7:279 (2000), and Monahan and Samulski, Gene Delivery 7:24 (2000), the disclosures of each of which are incorporated herein by reference as they pertain to AAV vectors for gene delivery.
  • the nucleic acids and vectors described herein can be incorporated into a rAAV virion in order to facilitate introduction of the nucleic acid or vector into a cell.
  • the capsid proteins of AAV compose the exterior, non-nucleic acid portion of the virion and are encoded by the AAV cap gene.
  • the cap gene encodes three viral coat proteins, VP1 , VP2 and VP3, which are required for virion assembly.
  • the construction of rAAV virions has been described, for instance, in US 5,173,414; US 5,139,941 ; US 5,863,541 ; US 5,869,305; US 6,057,152; and US 6,376,237; as well as in Rabinowitz et al., J. Virol.
  • rAAV virions useful in conjunction with the compositions and methods described herein include those derived from a variety of AAV serotypes including AAV1 , AAV2, AAV2quad(Y-F), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ/8, DJ/9, 7m8, PHP.B, PHP.eb, and PHP.S.
  • AAV1 , AAV2, AAV6, AAV9, Anc80, Anc80L65, DJ/9, 7m8, and PFIP.B may be particularly useful.
  • Serotypes evolved for transduction of the retina may also be used in the methods and compositions described herein.
  • the first and second nucleic acid vectors in the compositions and methods described herein may have the same serotype or different serotypes. Construction and use of AAV vectors and AAV proteins of different serotypes are described, for instance, in Chao et al., Mol. Ther. 2:619 (2000); Davidson et al., Proc. Natl. Acad. Sci.
  • pseudotyped rAAV vectors include AAV vectors of a given serotype (e.g., AAV9) pseudotyped with a capsid gene derived from a serotype other than the given serotype (e.g., AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.).
  • AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc. Techniques involving the construction and use of pseudotyped rAAV virions are known in the art and are described, for instance, in Duan et al., J. Virol. 75:7662 (2001); Halbert et al., J. Virol. 74:1524 (2000); Zolotukhin et al., Methods, 28:158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001).
  • AAV virions that have mutations within the virion capsid may be used to infect particular cell types more effectively than non-mutated capsid virions.
  • suitable AAV mutants may have ligand insertion mutations for the facilitation of targeting AAV to specific cell types.
  • the construction and characterization of AAV capsid mutants including insertion mutants, alanine screening mutants, and epitope tag mutants is described in Wu et al., J. Virol. 74:8635 (2000).
  • Other rAAV virions that can be used in methods described herein include those capsid hybrids that are generated by molecular breeding of viruses as well as by exon shuffling. See, e.g., Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).
  • the use of AAV vectors for delivering a functional OTOF protein requires the use of a dual vector system, in in which the first member of the dual vector system encodes an N- terminal portion of an OTOF protein and the second member encodes a C-terminal portion of an OTOF protein such that, upon administration of the dual vector system to a cell, the polynucleotide sequences contained within the two vectors can join to form a single sequence that results in the production of a full- length OTOF protein.
  • the protein is an OTOF isoform 5 protein.
  • the protein is an OTOF isoform 1 protein.
  • the first member of the dual vector system will also include, in 5’ to 3’ order, a first inverted terminal repeat (“ITR”) ; a promoter (e.g., a Myo15 promoter); a Kozak sequence; an N-terminal portion of an OTOF coding sequence; a splice donor sequence; an AP gene fragment (e.g., an AP head sequence); and a second ITR; and the second member of the dual vector system will include, in 5’ to 3’ order, a first ITR; an AP gene fragment (e.g., an AP head sequence); a splice acceptor sequence; a C-terminal portion of an OTOF coding sequence; a polyA sequence; and a second ITR.
  • ITR inverted terminal repeat
  • the N-terminal portion of the OTOF coding sequence and the C-terminal portion of the OTOF coding sequence do not overlap and are joined in a cell (e.g., by recombination at the overlapping region (the AP gene fragment), or by concatemerization of the ITRs) to produce the full-length OTOF amino sequence (e.g., for OTOF isoform 1 , the sequence set forth in SEQ ID NO: 1 , or for OTOF isoform 5, the sequence set forth in SEQ ID NO: 5).
  • the N-terminal portion of the OTOF coding sequence encodes amino acids 1-802 of OTOF (e.g., amino acids 1-802 of SEQ ID NO: 1 or SEQ ID NO: 5, corresponding to SEQ ID NO: 73) and the C-terminal portion of the OTOF coding sequence encodes amino acids 803-1997 of OTOF (e.g., amino acids 803-1997 of SEQ ID NO: 1 , or amino acids 803-1997 of SEQ ID NO: 5, corresponding to SEQ ID NO: 74).
  • amino acids 1-802 of OTOF e.g., amino acids 1-802 of SEQ ID NO: 1 or SEQ ID NO: 5, corresponding to SEQ ID NO: 73
  • amino acids 803-1997 of OTOF e.g., amino acids 803-1997 of SEQ ID NO: 1 , or amino acids 803-1997 of SEQ ID NO: 5, corresponding to SEQ ID NO: 74.
  • the first member of the dual vector system includes the Myo15 promoter of SEQ ID NO: 38 (also represented by nucleotides 235-1199 of SEQ ID NO: 81 ) operably linked to nucleotides that encode the N-terminal 802 amino acids of the OTOF isoform 5 protein (amino acids 1- 802 of SEQ ID NO: 5), which are encoded by exons 1-20 of the native polynucleotide sequence encoding that protein.
  • the nucleotide sequence that encodes the N-terminal amino acids of the OTOF isoform 5 protein is nucleotides 1222-3627 of SEQ ID NO: 81 .
  • the nucleotide sequence that encodes the N-terminal amino acids of the OTOF isoform 5 protein is any nucleotide sequence that, by redundancy of the genetic code, encodes amino acids 1-802 of SEQ ID NO: 5.
  • the nucleotide sequences that encodes the OTOF isoform 5 protein can be partially or fully codon- optimized for expression.
  • the first member of the dual vector system includes the Kozak sequence corresponding to nucleotides 1216-1225 of SEQ ID NO: 81 .
  • the first member of the dual vector system includes the splice donor sequence corresponding to nucleotides 3628-3711 of SEQ ID NO: 81 .
  • the first member of the dual vector system includes the AP head sequence corresponding to nucleotides 3718-4004 of SEQ ID NO: 81 .
  • the first member of the dual vector system includes nucleotides 235-4004 of SEQ ID NO:
  • flanking inverted terminal repeats are any variant of AAV2 inverted terminal repeats that can be encapsidated by a plasmid that carries the AAV2 Rep gene.
  • the 5’ flanking inverted terminal repeat has a sequence corresponding to nucleotides 12-141 of SEQ ID NO: 81 or a sequence having at least 80% sequence identity (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) thereto; and the 3’ flanking inverted terminal repeat has a sequence corresponding to nucleotides 4098-4227 of SEQ ID NO: 81 or a sequence having at least 80% sequence identity (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) thereto.
  • the sequence of the ITR in the transfer plasmid is not necessarily the same sequence that is found in the viral vector prepared therefrom.
  • the first member of the dual vector system includes nucleotides 12-4227 of SEQ ID NO:
  • the second member of the dual vector system includes nucleotides that encode the C-terminal 1195 amino acids of the OTOF isoform 5 protein (amino acids 803-1997 of SEQ ID NO: 5) immediately followed by a stop codon.
  • the nucleotide sequence that encodes the C-terminal amino acids of the OTOF isoform 5 protein is nucleotides 587-4174 of SEQ ID NO: 82.
  • the nucleotide sequence that encodes the C-terminal amino acids of the OTOF isoform 5 protein is any nucleotide sequence that, by redundancy of the genetic code, encodes amino acids 803-1997 of SEQ ID NO: 5.
  • the second member of the dual vector system includes the splice acceptor sequence corresponding to nucleotides 538-586 of SEQ ID NO: 82. In some embodiments, the second member of the dual vector system includes the AP head sequence corresponding to nucleotides 229-515 of SEQ ID NO: 82. In some embodiments, the second member of the dual vector system includes the poly(A) sequence corresponding to nucleotides 4217-4438 of SEQ ID NO: 82.
  • the second member of the dual vector system includes nucleotides 229-4438 of SEQ ID NO: 82 flanked on each of the 5’ and 3’ sides by an inverted terminal repeat.
  • the flanking inverted terminal repeats are any variant of AAV2 inverted terminal repeats that can be encapsidated by a plasmid that carries the AAV2 Rep gene.
  • the 5’ flanking inverted terminal repeat has a sequence corresponding to nucleotides 12-141 of SEQ ID NO: 82 or a sequence having at least 80% sequence identity (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) thereto; and the 3’ flanking inverted terminal repeat has a sequence corresponding to nucleotides 4526-4655 of SEQ ID NO: 82 or a sequence having at least 80% sequence identity (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) thereto.
  • the sequence of the ITR in the transfer plasmid is not necessarily the same sequence that is found in the viral vector prepared therefrom.
  • the first member of the dual vector system includes nucleotides 12-4655 of SEQ ID NO: 82.
  • the dual vector system is an AAV1 dual vector system.
  • the dual vector system is an AAV9 dual vector system.
  • the nucleic acid vectors may be incorporated into a vehicle for administration into a patient, such as a human patient suffering from biallelic OTOF mutations, as described herein.
  • Pharmaceutical compositions containing vectors, such as viral vectors, that contain a polynucleotide encoding a portion of an OTOF protein can be prepared using methods known in the art.
  • such compositions can be prepared using, e.g., physiologically acceptable carriers, excipients, or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980); incorporated herein by reference), and in a desired form, e.g., in the form of lyophilized formulations or aqueous solutions.
  • nucleic acid vectors e.g., AAV vectors
  • AAV vectors AAV vectors
  • Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (described in US 5,466,468, the disclosure of which is incorporated herein by reference).
  • the formulation may be sterile and may be fluid to the extent that easy syringability exists. Formulations may be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • polyol e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • suitable mixtures thereof e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • a solution containing a pharmaceutical composition described herein may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration.
  • sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage may be dissolved in 1 ml of isotonic NaCI solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion. Some variation in dosage will necessarily occur depending on the condition of the subject being treated.
  • the composition may be formulated to contain a synthetic perilymph solution.
  • An exemplary synthetic perilymph solution includes 20-200 mM NaCI, 1 -5 mM KCI, 0.1 -10 mM CaCl2, 1 -10 mM glucose, and 2-50 mM HEPEs, with a pH between about 6 and 9 and an osmolality of about 300 mOsm/kg.
  • the person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • preparations may meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologies standards.
  • compositions described herein may be administered to a subject with biallelic OTOF mutations by a variety of routes, such as local administration to the inner ear (e.g., administration into the perilymph or endolymph, e.g., to or through the oval window, round window, or horizontal canal, e.g., administration to a cochlear hair cell), intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration.
  • routes such as local administration to the inner ear (e.g., administration into the perilymph or endolymph, e.g., to or through the oval window, round window, or horizontal canal, e.g., administration to a cochlear hair cell), intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, percutaneous
  • compositions may be administered once, or more than once (e.g., once annually, twice annually, three times annually, bi-monthly, monthly, or bi-weekly).
  • first and second nucleic acid vectors are administered simultaneously (e.g., in one composition).
  • the first and second nucleic acid vectors are administered sequentially (e.g., the second nucleic acid vector is administered immediately after the first nucleic acid vector, or 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 8 hours, 12 hours, 1 day, 2 days, 7 days, two weeks, 1 month or more after the first nucleic acid vector).
  • the first and second nucleic acid vector can have the same serotype or different serotypes (e.g., AAV serotypes).
  • Subjects that may be treated as described herein are subjects having or at risk of developing sensorineural hearing loss or auditory neuropathy due to biallelic OTOF mutations that are 25 years of age or older (e.g., 25-50, 25-45, 25-40, 25-35, 25-30, 30-50, 30-45, 30-40, 30-35, 35-50, 35-45, 35-40, 40-50, 40-45, or 45-50 years old, e.g., 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 ,
  • Subjects may also be treated as described herein if they have biallelic OTOF mutations and are identified as having detectable indicators of outer hair cell integrity (the presence of otoacoustic emissions and/or cochlear microphonics) and/or inner hair cell integrity (the presence of a summating potential) (e.g., identified as having detectable otoacoustic emissions, cochlear microphonics, and/or summating potential prior to treatment). Accordingly, the methods described herein may include a step of assessing outer hair cell integrity and inner hair cell integrity prior to treatment of a subject.
  • compositions and methods described herein can be used to treat subjects having a mutation in OTOF (e.g., a mutation that reduces OTOF function or expression, or an OTOF mutation associated with sensorineural hearing loss or auditory neuropathy), subjects having a family history of autosomal recessive sensorineural hearing loss or auditory neuropathy (e.g., a family history of OTOF- related hearing loss) or subjects whose OTOF mutational status and/or OTOF activity level is unknown.
  • the methods described herein may include a step of screening a subject for a mutation in OTOF prior to treatment with or administration of the compositions described herein.
  • a subject can be screened for an OTOF mutation using standard methods known to those of skill in the art (e.g., genetic testing).
  • the methods described herein may also include a step of assessing hearing in a subject prior to treatment with or administration of the compositions described herein. Flearing can be assessed using standard tests, such as audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions.
  • the compositions and methods described herein may also be administered as a preventative treatment to patients at risk of developing hearing loss or auditory neuropathy, e.g., patients who have a family history of inherited hearing loss or patients carrying an OTOF mutation who do not yet exhibit hearing loss or impairment.
  • Treatment may include administration of a composition containing the nucleic acid vectors (e.g., AAV viral vectors) described herein in various unit doses.
  • Each unit dose will ordinarily contain a predetermined quantity of the therapeutic composition.
  • the quantity to be administered, and the particular route of administration and formulation, are within the skill of those in the clinical arts.
  • a unit dose need not be administered as a single injection but may include continuous infusion over a set period of time. Dosing may be performed using a syringe pump to control infusion rate in order to minimize damage to the cochlea.
  • the nucleic acid vectors are AAV vectors (e.g., AAV1 , AAV2, AAV2quad(Y-F), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ/8, DJ/9, 7m8, PHP.B, PHP.eb, or PHP.S vectors), the AAV vectors may have a titer of, for example, from about 1 x 10 9 vector genomes (VG)/mL to about 1 x 10 16 VG/mL (e.g., 1 x 10 9 VG/mL, 2 x 10 9 VG/mL, 3 x 10 9 VG/mL, 4 x 10 9 VG/mL, 5 x 10 9 VG/mL, 6 x 10 9 VG/mL, 7 x 10 9 VG/m
  • VG/mL 3 x 10 11 VG/mL, 4 x 10 11 VG/mL, 5 x 10 11 VG/mL, 6 x 10 11 VG/mL, 7 x 10 11 VG/mL, 8 x 10 11 VG/mL, 9 x 10 11 VG/mL, 1 x 10 12 VG/mL, 2 x 10 12 VG/mL, 3 x 10 12 VG/mL, 4 x 10 12 VG/mL, 5 x 10 12
  • VG/mL 9 x 10 15 VG/mL, or 1 x 10 16 VG/mL
  • a volume of 1 pL to 200 pL e.g., 1 , 2, 3, 5, 6, 7, 8, 9, 10,
  • the AAV vectors may be administered to the subject at a dose of about 1 x 10 7 VG/ear to about 2 x 10 15 VG/ear (e.g., 1 x 10 7 VG/ear, 2 x 10 7 VG/ear, 3 x 10 7 VG/ear, 4 x 10 7 VG/ear, 5 x 10 7 VG/ear, 6 x 10 7 VG/ear, 7 x 10 7 VG/ear, 8 x 10 7 VG/ear, 9 x 10 7 VG/ear, 1 x 10 8 VG/ear, 2 x 10 8 VG/ear, 3 x 10 8 VG/ear, 4 x 10 8 VG/ear, 5 x 10 8 VG/ear, 6 x 10 8 VG/ear, 7 x 10 8 VG/ear, 8 x 10 8 VG/ear, 9 x 10 8 VG/ear, 1 x 10 9 VG/ear, 2 x 10 9 VG/ear, 3
  • VG/ear 2 x 10 13 VG/ear, 3 x 10 13 VG/ear, 4 x 10 13 VG/ear, 5 x 10 13 VG/ear, 6 x 10 13 VG/ear, 7 x 10 13 VG/ear, 8 x 10 13 VG/ear, 9 x 10 13 VG/ear, 1 x 10 14 VG/ear, 2 x 10 14 VG/ear, 3 x 10 14 VG/ear, 4 x 10 14
  • the nucleic acid vectors are administered in an amount sufficient to transduce at least 20% of the subject’s inner hair cells with both the first vector and the second vector (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the subject’s inner hair cells are transduced with both vectors of the dual vector system).
  • compositions described herein are administered in an amount sufficient to improve hearing, improve speech discrimination, increase WT OTOF expression (e.g., expression in a cochlear hair cell, e.g., an inner hair cell), or increase OTOF function.
  • Hearing may be evaluated using standard hearing tests (e.g., audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions) and may be improved by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more) compared to hearing measurements obtained prior to treatment.
  • the compositions are administered in an amount sufficient to improve the subject’s ability to understand speech.
  • compositions described herein may also be administered in an amount sufficient to slow or prevent the development or progression of sensorineural hearing loss or auditory neuropathy (e.g., in subjects who carry a mutation in OTOF or have a family history of autosomal recessive hearing loss but do not exhibit hearing impairment, or in subjects exhibiting mild to moderate hearing loss).
  • OTOF expression may be evaluated using immunohistochemistry, Western blot analysis, quantitative real-time PCR, or other methods known in the art for detection protein or mRNA, and may be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more) compared to OTOF expression prior to administration of the compositions described herein.
  • OTOF function may be evaluated directly (e.g., using electrophysiological methods or imaging methods to assess exocytosis) or indirectly based on hearing tests, and may be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more) compared to OTOF function prior to administration of the compositions described herein. These effects may occur, for example, within 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks, or more, following administration of the compositions described herein.
  • the patient may be evaluated 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or more following administration of the composition depending on the dose and route of administration used for treatment. Depending on the outcome of the evaluation, the patient may receive additional treatments. Kits
  • compositions described herein can be provided in a kit for use in treating a subject 25 years of age or older with biallelic OTOF mutations (e.g., to treat sensorineural hearing loss or auditory neuropathy in such a subject), or for use in treating a subject having biallelic OTOF mutations that is identified as having detectable otoacoustic emissions, detectable cochlear microphonics, and/or detectable summating potential (e.g., to treat sensorineural hearing loss or auditory neuropathy in such a subject).
  • biallelic OTOF mutations e.g., to treat sensorineural hearing loss or auditory neuropathy in such a subject
  • detectable summating potential e.g., to treat sensorineural hearing loss or auditory neuropathy in such a subject.
  • compositions may include nucleic acid vectors (e.g., AAV vectors) described herein (e.g., a first nucleic acid vector containing a polynucleotide that encodes an N-terminal portion of an OTOF protein and a second nucleic acid vector containing a polynucleotide that encodes a C-terminal portion of an OTOF protein), optionally packaged in an AAV virus capsid (e.g., AAV1 , AAV9, AAV2, AAV8, Anc80, Anc80L65, DJ/9, or 7m8).
  • the kit can further include a package insert that instructs a user of the kit, such as a physician, to perform the methods described herein.
  • the kit may optionally include a syringe or other device for administering the composition.
  • Example 1 ABR recovery in 32- and 52-week-old OTOF deficient mice treated with OTOF dual vectors
  • Otoferlin deficient animals have absent ABRs (inner hair cell function) but present distortion product otoacoustic emissions (DPOAEs) (outer hair cell function). Like other aging animals, otoferlin null animals lose outer hair cell function and DPOAEs with age.
  • ABRs inner hair cell function
  • DPOAEs distortion product otoacoustic emissions
  • Older OTOF homozygous mutant (OTOF-Q828X) animals up to 52 weeks of age were dosed with dual hybrid AAV1 -Myo15-hOTOF vectors at a dose of 3.9 x 10 10 vg/ear to test the treatment window of efficacy considering possible outer hair cell loss and DPOAE elevation at later ages.
  • the first vector contained the Myo15 promoter of SEQ ID NO: 38 operably linked to a polynucleotide containing exons 1- 20 of a polynucleotide encoding an OTOF isoform 5 protein (SEQ ID NO: 71 ), a splice donor sequence 3’ of the polynucleotide sequence, and an AP recombinogenic region (SEQ ID NO: 65) 3’ of the splice donor sequence; and the second vector contained an AP recombinogenic region (SEQ ID NO: 65), a splice acceptor sequence 3’ of the recombinogenic region, a polynucleotide 3’ of the splice acceptor sequence containing exons 21-45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein (SEQ ID NO: 71 ), a splice donor sequence 3’ of the polynucleotide sequence, and an AP recombinogenic region
  • ABR recovery was seen in 10/10 of the 32-week-old virus-treated animals and 9/10 of the 52- week-old virus-treated animals, including the animals that had baseline DPOAE elevation at both four and eight weeks post-op.
  • ABR recovery at four weeks post-treatment is shown in FIG. 1 .
  • the best recovery was seen at 22.6 kHz tone frequency and was similar to what is seen in younger animals.
  • the OTOF-Q828X mouse model was developed to mimic human congenital deafness resulting from otoferlin loss.
  • the human otoferlin Q829X mutation (reference SNP rs80356593) is a well-studied stop-gain mutation in exon 22, resulting in truncation of the otoferlin protein after 828 amino acids of the 1997 amino acid coding sequence.
  • CRISPR-mediated knock-in was used to generate the Otof-Q828X mouse line on an FVB strain background with a targeted mutation in mouse OTOF (mOtof) that mimics this human allele.
  • IHC counts in Otof-828X horn and het animals were stable up to 16 weeks (FIG. 2A). Beginning after 16 weeks, Otof-Q828X horn animals showed a decrease in IHC counts starting at 22.6 - 45.2 kHz and after 24 weeks at lower frequencies (8 - 16 kHz). Loss of IHC counts in Otof-Q828X het mice started after 24 weeks for 16 and 32 kHz. After 32 weeks, there were over 75% of IHCs retained for most tested frequencies ( ⁇ 45.2 kHz) (FIG. 2A).
  • ABR thresholds were measured 4 to 34 weeks later when mice were between 10- weeks-old and 44-weeks-old.
  • ABR thresholds entered the normal range (mean ⁇ 2 SDs) when about 20% of IHCs expressed otoferlin (FIG. 3). Thresholds did not improve further with higher proportions of IHCs expressing otoferlin.
  • Example 4 Administration of an OTOF dual vector system to a subject over 25 years old with biallelic OTOF mutations
  • a physician of skill in the art can treat a patient with biallelic OTOF mutations who is over 25 years old (e.g., 25-50, 25-45, 25-40, 25-35, 25-30, 30-50, 30-45, 30-40, 30-35, 35-50, 35-45, 35-40, 40-50, 40-45, or 45-50 years old, e.g., 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50 years old) so as to prevent, reduce, or treat hearing loss or auditory neuropathy.
  • 25 years old e.g., 25-50, 25-45, 25-40, 25-35, 25-30, 30-50, 30-45, 30-40, 30-35, 35-50, 35-45, 35-40, 40-50, 40-45, or 45-50 years old, e.g., 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39,
  • a physician of skill in the art can administer to the human patient a composition containing a first nucleic acid vector (e.g., an AAV1 or AAV9 vector) containing a promoter operably linked to a polynucleotide encoding an N-terminal portion of an OTOF protein (e.g., human OTOF, e.g., an N-terminal portion of SEQ ID NO: 1 or SEQ ID NO: 5), and a second nucleic acid vector (e.g., an AAV1 or AAV9 vector) containing a polynucleotide encoding a C-terminal portion of an OTOF protein (e.g., human OTOF, e.g., a C-terminal portion of SEQ ID NO: 1 or SEQ ID NO: 5) and a poly(A) sequence.
  • a first nucleic acid vector e.g., an AAV1 or AAV9 vector
  • the dual vectors may be overlapping dual vectors, trans-splicing dual vectors, or dual hybrid vectors as described herein.
  • the vectors may be dual hybrid vectors in which the first vector contains a Myo15 promoter (e.g., SEQ ID NO: 36, 38, 39, 48, or 49) operably linked to exons 1-20 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO: 5, e.g., a polynucleotide having the sequence of SEQ ID NO: 71), a splice donor sequence 3’ of the polynucleotide sequence, and an AP recombinogenic region (e.g., an AP gene fragment, such as any one of SEQ ID NOs: 62-67, e.g., SEQ ID NO: 65) 3’ of the splice donor sequence, and in which the second vector contains an AP
  • composition containing the overlapping dual AAV vectors may be administered to the patient, for example, by local administration to the inner ear (e.g., injection through the round window membrane), to treat or prevent the development of sensorineural hearing loss or auditory neuropathy related to biallelic OTOF mutations.
  • a practitioner of skill in the art can monitor the patient’s improvement in response to the therapy, by a variety of methods. For example, a physician can monitor the patient’s hearing by performing standard tests, such as audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions following administration of the composition. A finding that the patient exhibits improved hearing in one or more of the tests following administration of the composition compared to hearing test results prior to administration of the composition indicates that the patient is responding favorably to the treatment. Subsequent doses can be determined and administered as needed.
  • a method of treating a human subject 25 years of age or older having biallelic otoferlin (OTOF) mutations comprising administering to the subject a therapeutically effective amount of a dual vector system comprising: a first nucleic acid vector comprising a promoter operably linked to a first coding polynucleotide that encodes an N-terminal portion of an OTOF protein; and a second nucleic acid vector comprising a second coding polynucleotide that encodes a C- terminal portion of an OTOF protein and a poly(A) sequence positioned 3’ of the second coding polynucleotide; wherein neither the first nor the second nucleic acid vector encodes a full-length OTOF protein.
  • E2. The method of E1 wherein the first coding polynucleotide and the second coding polynucleotide do not overlap.
  • E3 The method of E1 or E2, wherein the first nucleic acid vector comprises a splice donor signal sequence positioned 3’ of the first coding polynucleotide and the second nucleic acid vector comprises a splice acceptor signal sequence positioned 5’ of the second coding polynucleotide.
  • E4. The method of E3, wherein the first nucleic acid vector comprises a first recombinogenic region positioned 3’ of the splice donor signal sequence and the second nucleic acid vector comprises a second recombinogenic region positioned 5’ of the splice acceptor signal sequence.
  • E6 The method of E4 or E5, wherein the first or second recombinogenic region is an AP gene fragment or an F1 phage AK gene.
  • E7 The method of E6, wherein the F1 phage AK gene comprises or consists of the sequence of SEQ ID NO: 19.
  • E8 The method of E6, wherein the AP gene fragment comprises or consists of the sequence of any one of SEQ ID NOs: 62-67.
  • E9 The method of E8, wherein the AP gene fragment comprises or consists of the sequence of SEQ ID NO: 65.
  • E10 The method of any one of E3-E9, wherein the splice donor sequence comprises or consists of the sequence of SEQ ID NO: 20 or SEQ ID NO: 68.
  • E11 The method of any one of E3-E10, wherein the splice acceptor sequence comprises or consists of the sequence of SEQ ID NO: 21 or SEQ ID NO: 69.
  • E12 The method of any one of E4-E11 , wherein the first nucleic acid vector further comprises a degradation signal sequence positioned 3’ of the recombinogenic region; and wherein the second nucleic acid vector further comprises a degradation signal sequence positioned between the recombinogenic region and the splice acceptor signal sequence.
  • E13 The method of E12, wherein the degradation signal sequence comprises or consists of the sequence of SEQ ID NO: 22.
  • E14 The method of any one of E1-E13, wherein the first and second coding polynucleotides are divided at an OTOF exon boundary.
  • E15 The method of E14, wherein the OTOF exon boundary is not within a portion of the first coding polynucleotide or second coding polynucleotide that encodes a C2 domain.
  • E16 The method of E1 , wherein the first coding polynucleotide partially overlaps with the second coding polynucleotide.
  • E17 The method of E16, wherein the first coding polynucleotide overlaps with the second coding polynucleotide by at least 1 kilobase (kb).
  • E18 The method of E16 or E17, wherein the region of overlap between the first and second coding polynucleotides is centered at an OTOF exon boundary.
  • E19 The method of E18, wherein the first coding polynucleotide encodes an N-terminal portion of the OTOF protein and comprises an OTOF N-terminus to 500 bp 3’ of the exon boundary at the center of the overlap region; and the second coding polynucleotide encodes a C-terminal portion of the OTOF protein and comprises 500 bp 5’ of the exon boundary at the center of the overlap region to the OTOF C-terminus.
  • E20 The method of E18 or E19, wherein the OTOF exon boundary at the center of the overlap region is not within a portion of the first coding polynucleotide or second coding polynucleotide that encodes a C2 domain.
  • E21 The method of any one of E14, E15, and E18-E20, wherein the OTOF exon boundary is selected such that the first coding polynucleotide encodes an entire C2C domain and the second coding polynucleotide encodes an entire C2D domain.
  • E22 The method of any one of E14, E15, and E18-E21 , wherein the OTOF exon boundary is an exon 19/20 boundary, an exon 20/21 boundary, or an exon 21/22 boundary.
  • E23 The method of any one of E14, E15, and E18-E20, wherein the OTOF exon boundary is selected such that the first coding polynucleotide encodes an entire C2D domain and the second coding polynucleotide encodes an entire C2E domain.
  • E24 The method of any one of E14, E15, E18-E20, and E23, wherein the OTOF exon boundary is an exon 26/27 boundary or an exon 28/29 boundary.
  • E25 The method of any one of E14, E18, and E19, wherein the OTOF exon boundary is within a portion of the first coding polynucleotide and the second coding polynucleotide that encodes a C2D domain.
  • E26 The method of any one of E14, E18, E19, and E25, wherein the OTOF exon boundary is an exon 24/25 boundary or an exon 25/26 boundary.
  • E27 The method of any one of E1 -E26, wherein each of the first and second coding polynucleotides encode about half of the OTOF protein sequence.
  • E28 The method of any one of E1 -E27, wherein the first nucleic acid vector and the second nucleic acid vector do not comprise OTOF untranslated regions (UTRs).
  • UTRs OTOF untranslated regions
  • E29 The method of any one of E1 -E27, wherein the first nucleic acid vector comprises an OTOF 5’ UTR.
  • E30 The method of any one of E1 -E27 and E29, wherein the second nucleic acid vector comprises an OTOF 3’ UTR.
  • E31 The method of any one of E1 -E30, wherein the first and second coding polynucleotides that encode the OTOF protein do not comprise introns.
  • E32 The method of any one of E1 -E31 , wherein the OTOF protein is a mammalian OTOF protein.
  • E33 The method of E32, wherein the OTOF protein is a human OTOF protein.
  • E34 The method of any one of E1 -E33, wherein the OTOF protein has at least 85% sequence identity
  • SEQ ID NO: 1 SEQ ID NO: 2
  • SEQ ID NO:3 SEQ ID NO: 4
  • SEQ ID NO: 5 SEQ ID NO: 5
  • E35 The method of E34, wherein the OTOF protein has the sequence of SEQ ID NO: 1 .
  • E36 The method of E34, wherein the OTOF protein has the sequence of SEQ ID NO: 5.
  • SEQ ID NO: 1 SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, or SEQ ID NO: 5 or a variant thereof having one or more conservative amino acid substitutions.
  • E38 The method of E37, wherein no more than 10% (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the OTOF protein variant are conservative amino acid substitutions.
  • E39 The method of any one of E1 -E33, wherein the OTOF protein is encoded by any one of SEQ ID NOs: 10-14.
  • E40 The method of any one of E1 -E33, wherein the first coding polynucleotide encodes amino acids 1-802 of SEQ ID NO: 1 or SEQ ID NO: 5 and the second coding polynucleotide encodes amino acids 803-1997 of SEQ ID NO: 1 or SEQ ID NO: 5.
  • E41 The method of any one of E1 -E33, wherein the N-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 73 or a variant thereof having one or more conservative amino acid substitutions.
  • E42 The method of E41 , wherein no more than 10% (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the N-terminal portion of the OTOF protein variant are conservative amino acid substitutions.
  • 10% e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less
  • E43 The method of E41 , wherein the N-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 73.
  • E44 The method of any one of E1 -E33 and E43, the N-terminal portion of the OTOF protein is encoded by the sequence of SEQ ID NO: 71 .
  • E45 The method of any one of E1 -E33 and E41 -E44, wherein the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 74 or a variant thereof having one or more conservative amino acid substitutions.
  • E46 The method of E45, wherein no more than 10% (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the C-terminal portion of the OTOF protein variant are conservative amino acid substitutions.
  • 10% e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less
  • E47 The method of E45, wherein the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 74.
  • E48. The method of any one of E1 -E33, E41 -E44, and E47, wherein the C-terminal portion of the OTOF protein is encoded by the sequence of SEQ ID NO: 72.
  • E49 The method of any one of E1 -E48, wherein the first nucleic acid vector comprises a Kozak sequence 3’ of the promoter and 5’ of the first coding polynucleotide that encodes the N-terminal portion of the OTOF protein.
  • E50 The method of any one of E1 -E49, wherein the promoter is a ubiquitous promoter.
  • E51 The method of E50, wherein the ubiquitous promoter is a CAG promoter, a cytomegalovirus
  • CMV CMV-chicken b-actin promoter
  • smCBA truncated CMV-chicken b-actin promoter
  • CB7 CB7 promoter
  • hybrid CMV enhancer/human b-actin promoter a human b-actin promoter
  • EF1a elongation factor-1 a
  • PGK phosphoglycerate kinase
  • E52 The method of any one of E1 -E49, wherein the promoter is a cochlear hair cell-specific promoter.
  • E53 The method of E52, wherein the cochlear hair cell-specific promoter is a myosin 15 (Myo15) promoter, a myosin 7 A (Myo7A) promoter, a myosin 6 (Myo6) promoter, a POU class 4 homeobox 3 (POU4F3) promoter, an atonal BHLH transcription factor 1 (ATOH1) promoter, a LIM homeobox 3 (LHX3) promoter, an a9 acetylcholine receptor (a9AChR) promoter, or an a10 acetylcholine receptor (cdOAChR) promoter.
  • Myo15 myosin 15
  • Myo7A myosin 7 A
  • Myo6 Myosin 6
  • POU4F3 POU class 4 homeobox 3
  • ATOH1 atonal BHLH transcription factor 1
  • LHX3 LIM homeobox 3
  • a9AChR a9 acetylcholine
  • E54 The method of any one of E1 -E49, wherein the promoter is an inner hair cell-specific promoter.
  • E55 The method of E54, wherein the inner hair cell-specific promoter is a fibroblast growth factor 8
  • FGF8 promoter a vesicular glutamate transporter 3 (VGLUT3) promoter, an OTOF promoter, or a calcium binding protein 2 (CABP2) promoter.
  • VGLUT3 vesicular glutamate transporter 3
  • OTOF promoter OTOF promoter
  • CABP2 calcium binding protein 2
  • E56 The method of E1 , wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2272 to 6041 of SEQ ID NO: 75.
  • E57 The method of E1 or E56, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 2049 to 6264 of SEQ ID NO: 75.
  • E58 The method of E1 , wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 182 to 3949 of SEQ ID NO: 77.
  • E59 The method of E1 or E58, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 19 to 4115 of SEQ ID NO: 77.
  • E60 The method of E1 , wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6014 of SEQ ID NO: 79.
  • E61 The method of E1 or E60, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 2049 to 6237 of SEQ ID NO: 79.
  • E62 The method of E1 , wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 177 to 3924 of SEQ ID NO: 80.
  • E63 The method of E1 or E62, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 19 to 4090 of SEQ ID NO: 80.
  • E64 The method of any one of E1 , E56, E57, E60, and E61 , wherein the second nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6476 of SEQ ID NO: 76.
  • E65 The method of any one of E1 , E56, E57, E60, E61 , and E64, wherein the second nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 2049 to 6693 of SEQ ID NO: 76.
  • E66 The method of any one of E1 , E58, E59, E62, and E63, wherein the second nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 187 to 4396 of SEQ ID NO: 78.
  • E67 The method of any one of E1 , E58, E59, E62, E63, and E66, wherein the second nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 19 to 4589 of SEQ ID NO: 78.
  • E68 The method of E1 , wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 235 to 4004 of SEQ ID NO: 81 .
  • E69 The method of E1 or E62, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4227 of SEQ ID NO: 81 .
  • E70 The method of E1 , wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 230 to 3977 of SEQ ID NO: 83.
  • E71 The method of E1 or E70, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4200 of SEQ ID NO: 83.
  • E72 The method of any one of E1 and E68-E71 , wherein the second nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 229 to 4438 of SEQ ID NO: 82.
  • E73 The method of any one of E1 and E68-E72, wherein the second nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4655 of SEQ ID NO: 82.
  • E74 The method of any one of E1 -E73, wherein the first and second nucleic acid vectors comprise an inverted terminal repeat (ITR) at each end of the nucleic acid sequence.
  • ITR inverted terminal repeat
  • E75 The method of E74, wherein the ITR is an AAV2 ITR or has at least 80% sequence identity (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%,
  • E76 The method of any one of E1 -E75, wherein the poly(A) sequence is a bovine growth hormone (bGH) poly(A) signal sequence.
  • bGH bovine growth hormone
  • E77 The method of any one of E1 -E76, wherein the second nucleic acid vector comprises a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE).
  • WPRE Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element
  • E78 The method of E77, wherein the WPRE comprises or consists of the sequence of SEQ ID NO: 23 or SEQ ID NO: 61.
  • E79 The method of any one of E1 -E78, wherein the first and second nucleic acid vectors are adeno- associated virus (AAV) vectors.
  • AAV adeno- associated virus
  • E80 The method of E79, wherein the AAV vectors have AAV1 , AAV2, AAV2quad(Y-F), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ/8, DJ/9, 7m8, PHP.B, PHP.eb, or PHP.S capsids.
  • E81 The method of any one of E1 -E80, wherein the subject is 30 years of age or older.
  • E82 The method of any one of E1 -E81 , wherein the subject is 35 years of age or older.
  • E83 The method of any one of E1 -E82, wherein the subject is 40 years of age or older.
  • E84 The method of any one of E1 -E83, wherein the subject is 45 years of age or older.
  • E85 The method of any one of E1 -E84, wherein the subject is no older than 50 years old.
  • E87 The method of any one of E1 -E85, wherein the method further comprises identifying the subject as having biallelic OTOF mutations prior to administering the dual vector system.
  • E88 The method of any one of E1 -E87, wherein the subject is identified as having detectable otoacoustic emissions.
  • E89 The method of any one of E1 -E88, wherein the subject is identified as having detectable cochlear microphonics.
  • E90 The method of any one of E1 -E89, wherein the subject is identified as having a detectable summating potential.
  • E91 The method of any one of E1 -E90, wherein the subject has or is identified as having Deafness, Autosomal Recessive 9 (DFNB9).
  • DFNB9 Autosomal Recessive 9
  • E92 The method of any one of E1 -E91 , wherein the method further comprises evaluating the hearing of the subject prior to administering the dual vector system.
  • E93 The method of any one of E1 -E92, wherein the dual vector system is administered to the inner ear.
  • E94 The method of E93, wherein the dual vector system is administered by injection through the round window membrane, injection into a semicircular canal, canalostomy, insertion of a catheter through the round window membrane, transtympanic injection, or intratympanic injection.
  • E95 The method of any one of E1 -E94, wherein the method further comprises evaluating the hearing of the subject after administering the dual vector system.
  • E96 The method of any one of E1 -E95, wherein the dual vector system is administered in an amount sufficient to prevent or reduce hearing loss, delay the development of hearing loss, slow the progression of hearing loss, improve hearing, improve speech discrimination, or improve hair cell function.
  • E97 The method of any one of E1 -E96, wherein the first vector and the second vector are administered concurrently.
  • E98 The method of any one of E1 -E96, wherein the first vector and the second vector are administered sequentially.
  • E99 The method of any one of E1 -E98, wherein the first vector and the second vector are administered at a concentration of about 1 x 10 7 vector genomes (VG)/ear to about 2 x 10 15 VG/ear.
  • E100 The method of any one of E1 -E99, wherein the first vector and the second vector are administered in amounts that together are sufficient to transduce at least 20% of the subject’s inner hair cells with both the first vector and the second vector.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Environmental Sciences (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/US2022/017058 2021-02-19 2022-02-18 Methods for treating sensorineural hearing loss using otoferlin dual vector systems Ceased WO2022178298A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
KR1020237031961A KR20240004253A (ko) 2021-02-19 2022-02-18 오토펄린 듀얼 벡터 시스템을 사용한 감각신경성 난청을 치료하기 위한 방법
US18/277,858 US20240148905A1 (en) 2021-02-19 2022-02-18 Methods for treating sensorineural hearing loss using otoferlin dual vector systems
JP2023550062A JP2024507837A (ja) 2021-02-19 2022-02-18 オトフェリン二重ベクター系を使用して、感音難聴を治療するための組成物
MX2023009714A MX2023009714A (es) 2021-02-19 2022-02-18 Metodos para el tratamiento de la perdida auditiva neurosensorial mediante el uso de sistemas de vectores duales de otoferlina.
CN202280028998.9A CN117295529A (zh) 2021-02-19 2022-02-18 使用耳畸蛋白双载体系统治疗感觉神经性听力损失的方法
EP22757028.0A EP4294460A4 (en) 2021-02-19 2022-02-18 Methods for treating sensorineural hearing loss using otoferlin dual vector systems

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163151589P 2021-02-19 2021-02-19
US63/151,589 2021-02-19

Publications (1)

Publication Number Publication Date
WO2022178298A1 true WO2022178298A1 (en) 2022-08-25

Family

ID=82931783

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/017058 Ceased WO2022178298A1 (en) 2021-02-19 2022-02-18 Methods for treating sensorineural hearing loss using otoferlin dual vector systems

Country Status (7)

Country Link
US (1) US20240148905A1 (https=)
EP (1) EP4294460A4 (https=)
JP (1) JP2024507837A (https=)
KR (1) KR20240004253A (https=)
CN (1) CN117295529A (https=)
MX (1) MX2023009714A (https=)
WO (1) WO2022178298A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023036966A1 (en) * 2021-09-10 2023-03-16 Institut Pasteur Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof
US11807867B2 (en) 2020-02-21 2023-11-07 Akouos, Inc. Compositions and methods for treating non-age-associated hearing impairment in a human subject
CN117305367A (zh) * 2023-08-21 2023-12-29 复旦大学附属眼耳鼻喉科医院 一种表达全长耳畸蛋白的双aav载体系统及其应用
WO2025221253A1 (en) * 2024-04-17 2025-10-23 Decibel Therapeutics, Inc. Methods for treating sensorineural hearing loss using otoferlin dual vector systems

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112703016B (zh) 2018-04-27 2024-11-22 分贝治疗公司 肌球蛋白15启动子及其用途
US20220054640A1 (en) * 2018-12-11 2022-02-24 Decibel Therapeutics, Inc. Compositions and methods for the delivery of therapeutic agents across the round window membrane
CA3129422A1 (en) 2019-02-08 2020-08-13 Decibel Therapeutics, Inc. Myosin 15 promoters and uses thereof
EP3921032A4 (en) 2019-02-08 2022-11-30 Decibel Therapeutics, Inc. COMPOSITIONS AND METHODS FOR TREATMENT OF SENSORINEURAL HEARING LOSS USING OTOFERLIN DOUBLE VECTOR SYSTEMS
KR20220130093A (ko) 2019-10-30 2022-09-26 데시벨 테라퓨틱스, 인크. 오토펄린 듀얼 벡터 시스템을 사용한 감각신경성 난청을 치료하기 위한 조성물 및 방법
WO2025201333A1 (zh) * 2024-03-28 2025-10-02 苏州星奥拓维生物技术有限公司 递送Otof基因的双载体系统和其用途

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200155705A1 (en) * 2018-04-27 2020-05-21 Decibel Therapeutics, Inc. Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems
WO2020148458A1 (en) * 2019-01-18 2020-07-23 Institut Pasteur Aav-mediated gene therapy restoring the otoferlin gene

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3510161A4 (en) * 2016-08-23 2020-04-22 Akouos, Inc. COMPOSITIONS AND METHODS FOR TREATING PERSONAL HEARING LOSS IN A PERSON
IL325122A (en) * 2018-02-22 2026-02-01 Akouos Inc Compositions and methods for treating non-age-related hearing impairment in humans
WO2020093018A1 (en) * 2018-11-01 2020-05-07 University Of Florida Research Foundation, Incorporated A codon optimized otoferlin aav dual vector gene therapy
EP3921032A4 (en) * 2019-02-08 2022-11-30 Decibel Therapeutics, Inc. COMPOSITIONS AND METHODS FOR TREATMENT OF SENSORINEURAL HEARING LOSS USING OTOFERLIN DOUBLE VECTOR SYSTEMS

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200155705A1 (en) * 2018-04-27 2020-05-21 Decibel Therapeutics, Inc. Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems
WO2020148458A1 (en) * 2019-01-18 2020-07-23 Institut Pasteur Aav-mediated gene therapy restoring the otoferlin gene

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4294460A4 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11807867B2 (en) 2020-02-21 2023-11-07 Akouos, Inc. Compositions and methods for treating non-age-associated hearing impairment in a human subject
US12077773B2 (en) 2020-02-21 2024-09-03 Akouos, Inc. Compositions and methods for treating non-age-associated hearing impairment in a human subject
US12305191B2 (en) 2020-02-21 2025-05-20 Akouos, Inc. Compositions and methods for treating non-age-associated hearing impairment in a human subject
WO2023036966A1 (en) * 2021-09-10 2023-03-16 Institut Pasteur Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof
CN117305367A (zh) * 2023-08-21 2023-12-29 复旦大学附属眼耳鼻喉科医院 一种表达全长耳畸蛋白的双aav载体系统及其应用
WO2025040112A1 (zh) * 2023-08-21 2025-02-27 复旦大学附属眼耳鼻喉科医院 一种表达全长耳畸蛋白的双aav载体系统及其应用
WO2025221253A1 (en) * 2024-04-17 2025-10-23 Decibel Therapeutics, Inc. Methods for treating sensorineural hearing loss using otoferlin dual vector systems

Also Published As

Publication number Publication date
EP4294460A1 (en) 2023-12-27
CN117295529A (zh) 2023-12-26
MX2023009714A (es) 2023-10-03
EP4294460A4 (en) 2025-06-25
KR20240004253A (ko) 2024-01-11
US20240148905A1 (en) 2024-05-09
JP2024507837A (ja) 2024-02-21

Similar Documents

Publication Publication Date Title
US20240148905A1 (en) Methods for treating sensorineural hearing loss using otoferlin dual vector systems
US12589168B2 (en) Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems
US20240131186A1 (en) Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems
US20260035716A1 (en) Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems
JP7686709B2 (ja) ミオシン15プロモーター及びその使用
WO2020163761A1 (en) Myosin 15 promoters and uses thereof
JP2024538076A (ja) ステレオシリンプロモーター及びその使用
CN115066432B (zh) 使用耳畸蛋白双载体系统治疗感觉神经性听力损失的组合物和方法
JP2021513871A (ja) F8遺伝子機能を回復させるためのアデノ随伴ウイルス組成物及びその使用の方法
EP4713463A1 (en) Compositions and methods for treating gjb2-related hearing loss
WO2025221253A1 (en) Methods for treating sensorineural hearing loss using otoferlin dual vector systems
EA053066B1 (ru) Промоторы стереоцилина и варианты их применения

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22757028

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023550062

Country of ref document: JP

Ref document number: MX/A/2023/009714

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2022757028

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022757028

Country of ref document: EP

Effective date: 20230919

WWE Wipo information: entry into national phase

Ref document number: 202280028998.9

Country of ref document: CN