WO2022166734A1

WO2022166734A1 - Sdc2 methylation detection kit and application thereof

Info

Publication number: WO2022166734A1
Application number: PCT/CN2022/074196
Authority: WO
Inventors: 徐宏; 甄林青; 杨浩; 徐高连; 古宏晨
Original assignee: 上海慧众同康生物科技有限公司
Priority date: 2021-02-03
Filing date: 2022-01-27
Publication date: 2022-08-11
Also published as: CN114854854A

Abstract

The present application provides an SDC2 methylation detection kit and an application thereof. The kit comprises a methylation-dependent restriction enzyme, a capture oligonucleotide, and a universal primer; the capture oligonucleotide comprises, in order from terminal 5' to terminal 3': a first universal sequence, a folding sequence, and a binding capture sequence; the folding sequence is at least partially identical to a 5' end sequence of an SDC2 methylation site subjected to the digestion of the methylation-dependent restriction enzyme; the binding capture sequence specifically binds to a fragment region where a detected SDC2 methylation site is located. According to the present application, on the basis of the methylation-dependent restriction enzyme and a universal primer fluorescence quantitative PCR technology, no bisulfite conversion is required, sensitive and specific SDC2 methylation detection is achieved, and a detection limit is as low as 10 copies/reaction.

Description

A kind of SDC2 methylation detection kit and its application

technical field

The application belongs to the field of biotechnology, and relates to an SDC2 methylation detection kit and application thereof.

Background technique

Colorectal cancer (CRC) is a common malignant tumor of the gastrointestinal tract. With the change of people's living habits, the incidence and mortality of colorectal cancer have increased significantly, which is a serious threat to human health. The symptoms of colorectal cancer are not obvious in the early stage. As the tumor enlarges, it shows symptoms such as changes in bowel habits, blood in the stool, diarrhea, alternating diarrhea and constipation, and local abdominal pain. In the advanced stage, it develops into systemic symptoms such as anemia and weight loss.

Currently, fecal occult blood test (FOBT) and colonoscopy are mainly used for colorectal cancer screening. As a routine screening method, FOBT is susceptible to the influence of food, drugs and other factors, with a high false-positive rate and poor stability. Colonoscopy is an invasive examination method that requires bowel preparation to ensure a good view of the large bowel lumen. At the same time, colonoscopy has a series of complications, such as intestinal perforation and peritonitis at the site of bowel biopsy. Therefore, colonoscopy, patient compliance is poor. There is an urgent need for colorectal cancer detection methods with high compliance, convenient detection, and accurate results to improve the accuracy of screening.

DNA methylation refers to the modification of methylated groups at the 5'-end cytosine of CpG islands without changing the DNA sequence, resulting in silencing of DNA expression. The occurrence of abnormal DNA methylation usually precedes the canceration of cells. Therefore, timely detection of DNA methylation can realize early warning of malignant tumors and provide an important basis for early screening, early diagnosis, prognosis and treatment evaluation of tumors. Heparan sulfate proteoglycan (syndecan-2, SDC2) is a protein involved in cell division and migration, expressed in colon mesenchymal cells. The methylation levels of SDC2 target regions in tumor tissues were significantly higher than those in pairs of adjacent non-tumor tissues. Relevant clinical studies have shown that the methylation level of the transcriptional regulatory region of the SDC2 gene in tumor tissue samples is significantly higher than that in adjacent non-tumor tissue samples. The methylation sites of the SDC2 gene were relatively constant, and mostly occurred in CpG islands in the promoter region.

Although SDC2 methylation can be used as an effective biomarker for early screening of CRC, compared with wild-type genes with normal methylation, the proportion of abnormally methylated SDC2 is lower. The biggest challenge in SDC2 methylation detection is how to Trace amounts of aberrantly methylated genes were detected in a high wild-type background.

The bisulfite conversion method is the most commonly used methylation detection method. The principle is to treat DNA with bisulfite to convert cytosine residues into uracil, while the methylated cytosine residues are not affected. Therefore, only methylated cytosines remain in bisulfite-treated DNA fragments. Based on this principle, bisulfite can reveal DNA methylation at the single nucleotide level. There are a variety of detection methods that can realize the analysis of DNA sequence after bisulfite treatment. The actual problem of analysis is the difference between bases from C to U and finally to T caused by bisulfite.

However, the bisulfite conversion method also has many shortcomings: (1) bisulfite sequencing needs to ensure that the bisulfite conversion reaction is complete, that is, every unmethylated cytosine is converted into uracil. If the transformation reaction is incomplete, false positive results will occur; (2) Since only the cytosine of single-stranded DNA can be attacked by bisulfite, the DNA needs to be denatured and melted before transformation, and factors such as temperature and salt concentration must be strictly controlled , otherwise it will cause conversion failure or incomplete conversion; (3) DNA may be degraded during the conversion reaction. If the incubation time is too long, the temperature and the bisulfite concentration are too high, up to 90% of the DNA may be degraded , the depurinated DNA forms random breaks, which may lead to the failure of PCR amplification or a small number of DNA samples, resulting in low accuracy, resulting in false negative detection; (4) Bisulfite treatment will significantly reduce the complexity of the sample, making the Multiplex PCR primer design is more difficult and error increases.

Therefore, developing a high-sensitivity DNA methylation detection method that does not require bisulfite treatment and does not need to set up a control reaction has become an urgent problem to be solved.

SUMMARY OF THE INVENTION

In view of the deficiencies and actual needs of the prior art, the present application provides an SDC2 methylation detection kit and its application, based on methylation-dependent restriction endonucleases and universal primer fluorescence quantitative PCR technology, detection and colorectal The methylation of the specific site of the SDC2 gene closely related to cancer has the advantages of not requiring bisulfite conversion, simple operation, high accuracy and strong specificity.

For this purpose, the application adopts the following technical solutions:

In a first aspect, the application provides a SDC2 methylation detection kit, the kit includes a methylation-dependent restriction endonuclease, a capture oligonucleotide, and a universal primer;

Wherein, the capture oligonucleotide sequentially includes a first universal sequence, a folding sequence and a binding capture sequence from the 5' end to the 3' end;

Wherein, the folded sequence is at least partially identical to the 5' end sequence of the SDC2 methylation site after being cut by a methylation-dependent restriction endonuclease; and

The binding capture sequence can specifically bind to the fragment region where the detected SDC2 methylation site is located.

In this application, the SDC2 methylation detection kit mainly includes two parts: methylation-dependent restriction endonuclease and fluorescent quantitative PCR detection reagent based on universal primers: methylation-dependent restriction endonuclease The methylation site of the base template is digested to form an intermediate product with a clear 5'-end sequence; the capture oligonucleotide uses the binding capture sequence to capture the intermediate product, and uses this as a template for the extension reaction. A nucleotide complementary to the SDC2 methylation gene is added to the 3' end of the nucleotide, thereby forming an extended capture oligonucleotide, which is fully matched to the folding sequence inside the molecule by the extension sequence or Non-perfect pairings form a half-hairpin structure product, and the half-hairpin structure product undergoes an extension reaction, adding a nucleotide complementary to the first universal sequence inside the molecule at the 3' end to form a complete hairpin structure product The hairpin structure product is amplified by PCR using universal primers and/or specific primers, and combined with detection probes, the fluorescence quantitative PCR detection of SDC2 methylation sites is realized.

In some embodiments of the present application, the "5' terminal sequence" of a target molecule refers to nucleotides 1 to 4, nucleotides 1 to 5, and nucleotides 1 to 5 of the 5' end of the target molecule. 6 nucleotides, 1 to 7 nucleotides, 1 to 8 nucleotides, 1 to 9 nucleotides, 1 to 10 nucleotides, 1 to 11 nucleotides , nucleotides 1 to 12, nucleotides 1 to 13, nucleotides 1 to 14, nucleotides 1 to 15, nucleotides 1 to 16, nucleotides 1 to 17 A contiguous sequence of nucleotides at positions 1 to 18, nucleotides at positions 1 to 19, nucleotides at positions 1 to 20, or nucleotides at positions 1 to 20.

In some embodiments of the present application, the binding capture sequence and the SDC2 methylation site are cleaved with a methylation-dependent restriction endonuclease with a well-defined 5' end of the cleavage product (eg, single-stranded DNA ) specific binding.

In some specific embodiments, the binding capture sequence specifically binds to the product of the methylation-dependent restriction endonuclease GlaI digestion of the sequence shown in SEQ ID NO: 5. In such an embodiment, SEQ ID NO:5 is:

AGCCCG C // G CACACGAATCCGGAGCAGAGTACCGCAGCGATTGCGGCTCAGGCTCGGGGACTCGGGCT (wherein, the underline is the methylation position, // is the enzyme cleavage position).

In other specific embodiments, the binding capture sequence specifically binds to the product of the sequence shown in SEQ ID NO: 9 after being digested by the methylation-dependent restriction endonuclease FspEI. In such embodiments, SEQ ID NO:9 is:

AGCC CG CAGGGAATAGG//GGAGCGCCACCTGGGGAACCCCCAGTCCCCAAGTATACACCGGAGATCCGCTGGGACAAATGCGCTCGTCCGGTCACCCTTTCCCCCT (wherein, the underline is the methylation position, // is the enzyme cleavage position).

Preferably, the capture oligonucleotide further comprises a second universal sequence.

Preferably, the second universal sequence is located 5' to the binding capture sequence.

Preferably, the capture oligonucleotide further comprises a nucleic acid extension blocking modification.

Preferably, the nucleic acid extension blocking site is located at the 3' end of the folded sequence.

Preferably, the nucleic acid extension blocking is modified with any one or a combination of at least two of Spacer, thio group or uracil base.

In some embodiments of the present application, Spacer refers to polyethylene glycol, preferably polyethylene glycol 18.

Preferably, the folding sequence is modified with nucleic acid analogs, which can inhibit the extension of synthetic by-products of the primers under the condition of ensuring the complementary pairing of bases in the folding region, thereby improving the detection specificity.

Preferably, the nucleic acid analogs include peptide nucleic acids, locked nucleic acids, transposed bases, 2'-O,4'-C-methylene bridge RNA (2'-O,4'-C-methylene bridge RNA) , 2'-O-methyl RNA (2'-O-Methyl RNA) or 2'-Fluoro RNA (2'-Fluoro RNA) any one or a combination of at least two.

Preferably, the nucleic acid sequence of the universal primer is identical or partially identical to the first universal sequence of the capture oligonucleotide.

Preferably, the methylation-dependent restriction endonuclease comprises any one or a combination of at least two of GlaI, FspEI, MspJI, LpnPI, AspBHI or MseI.

Preferably, the kit further includes detection probes.

Preferably, the detection probe is labeled with a fluorophore and/or a quencher group.

Preferably, the fluorophore is labeled at the 5' end of the detection probe.

Preferably, the quencher group is labeled at the 3' end of the detection probe.

Preferably, the fluorescent groups include FAM ^TM (carboxyfluorescein), VIC ^TM (green fluorescent protein), JOE ^TM (2,7-dimethyl-4,5-dichloro-6-6 carboxyl fluorescence), TET ^TM (tetrachloro-6-carboxyfluorescein), CY ^TM 3 (maleimide 3), CY ^TM 5 (maleimide 5), ROX ^TM (rhodamine X maleimide), Either Texas Red ^™ (sulfonated rhodamine 101 chloric acid) or LC RED460 ^™ .

Preferably, the quenching group includes any one of BHQ1 ^™ (Black Hole Quencher1), BHQ2 ^™ , BHQ3 ^™ , Dabcyl or Tamra.

Preferably, the kit further comprises any one or a combination of at least two of DNA polymerase, UDGase, dNTPs or Mg ²⁺ .

Preferably, the kit further includes an enzyme digestion buffer and/or a PCR buffer.

Preferably, the kit further includes internal reference gene PCR primers and/or detection probes.

Preferably, the internal reference gene includes β-actin.

Preferably, the capture oligonucleotide comprises the nucleic acid sequence shown in SEQ ID NO:1 or SEQ ID NO:6.

Preferably, the universal primer comprises the nucleic acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3.

Preferably, the SDC2 methylation-specific primer comprises the nucleic acid sequence shown in SEQ ID NO:7.

Preferably, the detection probe comprises the nucleic acid sequence shown in SEQ ID NO:4 or SEQ ID NO:8.

Preferably, the internal reference gene PCR primers include the nucleic acid sequences shown in SEQ ID NOs: 10-11.

Preferably, the internal reference gene detection probe comprises the nucleic acid sequence shown in SEQ ID NO: 12.

In the second aspect, the application provides an SDC2 methylation detection system, the system includes 1-20 nM capture oligonucleotide, 100-400 nM universal primer, 100-300 nM detection probe, 1-2 U/μL Taq polymer Enzyme, 1-2 U/μL UDG enzyme, 100-300 μM dNTP, 1-5 mM MgCl ₂ and PCR buffer.

Preferably, the system further comprises 100-300 nM SDC2 methylation-specific primers.

In a third aspect, the application provides a method for SDC2 methylation detection, the method comprising:

The methylation-dependent restriction endonuclease is used to digest the SDC2 methylation template to be tested, and the product after the enzyme cleavage treatment is added to the system described in the second aspect to perform fluorescence quantitative PCR.

Preferably, the temperature of the enzymatic cleavage treatment is 30 to 40°C, such as 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C °C, preferably 37 °C.

Preferably, the time of the enzyme digestion treatment is 0.5-2 h, for example, it may be 0.5 h, 1 h, 1.5 h or 2 h, preferably 1 h.

Preferably, the fluorescent quantitative PCR program is pre-denaturation at 92-95°C for 2-5 minutes; denaturation at 92-95°C for 10-20s, annealing at 65-70°C for 80-100s, 10-15 cycles; denaturation at 92-95°C for 10-15 cycles 10～20s, annealing at 65～70℃ for 20～30s, 30～50 cycles.

In a fourth aspect, the application provides a SDC2 methylation detection device, the device comprising:

Enzymatic digestion processing unit: The methylation-dependent restriction endonuclease is used to digest the SDC2 methylation template to be tested to obtain a pretreatment product with a clear 5'-end sequence;

Fluorescence quantitative PCR unit: use a fluorescent quantitative PCR system containing capture oligonucleotides, universal primers and detection probes to perform fluorescent quantitative PCR detection on the pretreated products.

Preferably, the enzymatic cleavage treatment temperature provided by the enzymatic cleavage treatment unit is 30 to 40°C, for example, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C, preferably 37°C.

Preferably, the enzymatic cleavage treatment time provided by the enzymatic cleavage treatment unit is 0.5-2 h, for example, it may be 0.5 h, 1 h, 1.5 h or 2 h, preferably 1 h.

Preferably, the fluorescent quantitative PCR program provided by the fluorescent quantitative PCR unit is pre-denaturation at 92-95°C for 2-5 minutes; denaturation at 92-95°C for 10-20s, annealing at 65-70°C for 80-100s, 10-15 cycles; Denaturation at 92～95℃ for 10～20s, annealing at 65～70℃ for 20～30s, 30～50 cycles.

Preferably, the fluorescent quantitative PCR unit further comprises using SDC2 methylation specific primers to perform fluorescent quantitative PCR detection on the pretreated product.

In a fifth aspect, the present application provides applications of the kit described in the first aspect, the system described in the second aspect, or the device described in the fourth aspect in the preparation of reagents and/or equipment for early diagnosis of diseases.

Preferably, the disease comprises a tumor.

Preferably, the tumor comprises any one or a combination of at least two of colorectal cancer, liver cancer or esophageal cancer.

Compared with the prior art, the present application has the following beneficial effects:

(1) The SDC2 methylation detection kit of this application mainly includes two parts: methylation-dependent restriction endonucleases and fluorescent quantitative PCR detection reagents based on universal primers. For additional steps such as processing, it is only necessary to preprocess the sample before PCR detection to obtain a sample with a clear 5'-end sequence, which realizes the multiple detection of nucleic acid with high specificity and high sensitivity;

(2) In the SDC2 methylation detection kit of the present application, the capture oligonucleotide and the universal primer are specially designed to cooperate with each other. In the presence of the target molecule, the target molecule triggers the capture oligonucleotide-mediated reaction The extension reaction forms a hairpin structure product, which is used as a template for the universal primer amplification reaction. Since the amplification reaction is based on the enzyme cleavage product determined by the 5' sequence, the problem of false positives is effectively avoided;

(3) In this application, when the 3' extension sequence of the capture oligonucleotide and the folded sequence can form a complementary pairing, the self-folding of the capture oligonucleotide can be triggered to form a hairpin structure, which effectively ensures the specificity of the reaction;

(4) The folding sequence of the capture oligonucleotide of the present application is modified with nucleic acid analogs, which can inhibit the extension of synthetic by-products of the primers under the condition of ensuring the base pairing in the folding region, thereby improving the detection specificity, especially suitable for Detection of target fragments in a high-concentration unmethylated background;

(5) When the SDC2 methylation detection kit of the present application detects different target molecules, it only needs to design the folding sequence and binding capture sequence of the capture oligonucleotide according to the target molecule, while keeping the first universal sequence unchanged, It greatly reduces the interference between multiple primers in multiple target amplification and improves the sensitivity of amplification;

(6) The SDC2 methylation detection kit of the present application achieves the purpose of signal amplification through the exponential amplification process, which can not only well meet the demand for sensitivity during DNA/RNA detection, but also the exponential amplification process only uses extended It can achieve the purpose of equivalent amplification of multiple target molecules under the premise of keeping the number and concentration of universal primers unchanged, avoiding the deviation of amplification efficiency caused by sequence differences;

(7) The SDC2 methylation detection method of the present application is easy to operate, can detect as low as 10 copies of SDC2 methylated DNA, and has high analytical sensitivity.

Description of drawings

Fig. 1 is the analytical sensitivity detection result of SDC2 gene in methylated samples of different concentrations based on GlaI;

Fig. 2 is the analytical sensitivity detection result of SDC2 gene in methylated samples of different concentrations based on FspEI;

Figure 3 shows the SDC2 target amplification signal in the dual amplification system;

Figure 4 shows the amplification signal of β-actin internal reference in the double amplification system;

Figure 5 shows the experimental results of sensitivity analysis of the human SDC2 gene methylation detection kit in the background of fecal DNA.

Detailed ways

In order to further illustrate the technical means adopted in the present application and its effects, the present application will be further described below with reference to the embodiments and the accompanying drawings. It should be understood that the specific embodiments described herein are only used to explain the present application, but not to limit the present application.

If no specific technique or condition is indicated in the examples, the technique or condition described in the literature in the field or the product specification is used. The reagents or instruments used without the manufacturer's indication are conventional products that can be purchased through regular channels.

Example 1 Hypermethylation detection of related sites in the human SDC2 gene

In this example, Jurkat DNA treated with methyltransferase was used as a positive standard for methylation of human SDC2 gene, and nuclease-free water was used as a negative control, wherein the CG site was 5mCG, and the specific methylation site of SDC2 gene was detected. . Proceed as follows:

(1) The positive standard and negative control were digested with methylation-dependent restriction endonuclease GlaI, and the reaction system was 1× PCR buffer (Nanjing Novizan, P122-d1), 5U GlaI, Genomic DNA of different concentrations, a total of 10 μL in the system; the reaction conditions were incubated at 37 °C for 1 hour; after the enzyme digestion reaction, the system was heated to 85 °C and incubated for 10 min to heat inactivate GlaI;

(2) Add SDC2 gene capture oligonucleotides, universal primers, specific primers and detection probes to the above enzyme digestion reaction system respectively, and PCR detects the methylation state of the SDC2 gene. The PCR amplification system adopted includes enzyme digestion DNA template, 5nM capture oligonucleotides, 150nM universal primers, 150nM specific primers, 150nM detection probes, 0.8U/μL Taq polymerase, 1U/μL UDG enzyme, 300μM dNTPs, and 1× PCR buffer in a final volume of 20 μL; PCR reaction program was pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 10 s, annealing at 63 °C for 90 s, 10 cycles; denaturation at 94 °C for 10 s, annealing at 60 °C for 30 s, 40 cycles; real-time PCR was performed on a ROCHE instrument (480). , to collect the corresponding fluorescence values;

Capture oligonucleotide (SEQ ID NO: 1):

Universal Primer 1 (SEQ ID NO:2):

Universal Primer 2 (SEQ ID NO:3):

Detection probe (SEQ ID NO:4):

The human SDC2 gene is shown in SEQ ID NO:5, wherein, the underline is the methylation position, and // is the restriction enzyme cutting position:

Figure 1 shows the sensitivity detection of SDC2 gene in methylated samples with different concentrations, from left to right, DNA methylation positive samples with 1200 copies/reaction, 120 copies/reaction and 12 copies/reaction, respectively, by qPCR It can be seen from the curve that the amplification has an obvious concentration gradient, and DNA methylation templates as low as about 10 copies can be detected by enzyme digestion amplification, indicating that the system has high sensitivity.

Example 2 SDC2 genome FspEI digestion and amplification results

(1) The positive standard and negative control were digested with methylation-dependent restriction enzyme FspEI. The reaction system was as follows:

Buffer (NEB, R0662S), 1×Enzyme Activator Solution, 5U FspEI, different concentrations of genomic DNA, a total of 10 μL of the system; the reaction conditions were incubated at 37°C for 1 hour; after the digestion reaction, the system was heated to 85°C and incubated for 10min , heat inactivation of FspEI;

(2) Add SDC2 gene capture oligonucleotides, universal primers, specific primers and detection probes to the above enzyme digestion reaction system respectively, and PCR detects the methylation state of the SDC2 gene. The PCR amplification system adopted includes enzyme digestion DNA template, 5nM capture oligonucleotides, 150nM universal primers, 150nM specific primers, 150nM detection probes, 0.8U/μL Taq polymerase, 1U/μL UDG enzyme, 300μM dNTPs, and 1× PCR buffer in a final volume of 20 μL; PCR reaction program: 94°C pre-denaturation for 5 min; 94°C denaturation for 10s, 66°C annealing for 90s, 10 cycles; 94°C denaturation for 10s, 65°C annealing for 30s, 40 cycles; real-time PCR was performed on a ROCHE instrument (480) , to collect the corresponding fluorescence values;

Capture oligonucleotide (SEQ ID NO:6):

TGTCAGCCAACGGTATTCATCGGAGCGCCACC+TG+GG/spacer18/AAG GGTGACCGGACGAGCGCA (the base after + represents the base modification locked nucleic acid);

Universal Primer 1 (SEQ ID NO:2):

SDC2 specific primer (SEQ ID NO:7):

Detection probe (SEQ ID NO: 8):

The human SDC2 gene is shown in SEQ ID NO: 9, wherein, the underline is the methylation position, and // is the restriction enzyme cutting position:

As shown in Figure 2, the methylation-positive genome was digested with FspEI and then amplified, and the methylation-positive genomes of 1200 copies, 120 copies and 40 copies could be amplified, indicating that the FspEI system can also Enzyme cleavage detection for specific methylation sites with high sensitivity. The methylation detection model is suitable for a variety of enzyme digestion systems.

Example 3 Human SDC2 gene methylation detection kit

In this example, the methyltransferase-treated Jurkat DNA was used as the positive standard for methylation of the human SDC2 gene, and the nuclease-free water was used as a template-free control. SDC2 gene methylation site detection. Proceed as follows:

(1) Methylation-dependent restriction endonuclease GlaI was used to digest the mixed samples and no-template control. The reaction system was 1× PCR buffer (purchased from Nanjing Novizan, P122-d1), 5U GlaI 10 μL of genomic DNA with different concentrations; the reaction conditions were incubation at 37°C for 1 hour; after the digestion reaction, the system was heated to 85°C and incubated for 10 minutes to heat inactivate GlaI;

(2) SDC2 gene capture oligonucleotides, universal primers, SDC2 specific primers, SDC2 detection probes, β-actin gene primer pairs and β-actin detection probes were added to the above enzyme digestion reaction system respectively, and PCR was used to detect SDC2 The methylation status of the gene and the expression level of β-actin, the PCR amplification system used includes enzyme-digested DNA template, 5nM SDC2 capture oligonucleotide, 150nM universal primer, 150nM SDC2 specific primer, 150nM SDC2 detection probe, 150nMβ -actin-specific primer pair, 150nMβ-actin detection probe, 1U/μL Taq polymerase, 1U/μL UDG enzyme, 300μM dNTP and 1×PCR buffer, the final volume is 20μL; the PCR reaction program is pre-denaturation at 94°C for 5min ; Denaturation at 94°C for 10s, annealing at 66°C for 90s, 10 cycles; denaturation at 94°C for 10s, annealing at 65°C for 30s, 40 cycles; real-time PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values were collected;

SDC2 gene capture oligonucleotide (SEQ ID NO: 1):

Universal Primer 1 (SEQ ID NO:2):

Universal Primer 2 (SEQ ID NO:3):

SDC2 detection probe (SEQ ID NO: 4):

β-actin-F (SEQ ID NO: 10):

β-actin-R (SEQ ID NO: 11):

β-actin detection probe (SEQ ID NO: 12):

Figure 3 and Figure 4 show the methylation detection results. After 80 copies of the sample was spiked with 200 ng of fecal DNA methylation positive template, it could be found in the system containing the β-actin reference gene and without the β-actin reference gene. Stable amplification indicates that the kit and detection system described in this application can be used in a dual PCR system containing the β-actin internal reference gene without affecting the amplification efficiency.

Example 4 Sensitivity analysis experiment of human SDC2 gene methylation detection kit

In this example, methylated DNA with different proportions of 80 copies (6.7‰), 60 copies (5.0‰) and 40 copies (3.3‰) was put into the 400ng fecal DNA background as the samples to be tested, and the human SDC2 gene of Example 3 was used. The methylation detection kit was used for detection, and the sensitivity of the kit was analyzed.

The detection results are shown in Table 1 and Figure 5. It can be seen that the kit can detect as low as 40 copies of methylated host DNA in the background of 400ng of fecal DNA, which confirms that the kit has high analytical sensitivity.

Table 1

In summary, the present application adopts a combination of methylation-dependent restriction endonucleases and PCR amplification based on universal primers, without bisulfite treatment and without setting a control reaction, to achieve SDC2 methylation. The precise quantitative detection of chemical DNA has high detection sensitivity and good specificity, and is suitable for popularization and application.

The applicant declares that the present application illustrates the detailed method of the present application through the above-mentioned embodiments, but the present application is not limited to the above-mentioned detailed method, which does not mean that the present application must rely on the above-mentioned detailed method for implementation. Those skilled in the art should understand that any improvement to the application, the equivalent replacement of each raw material of the product of the application, the addition of auxiliary components, the selection of specific methods, etc., all fall within the scope of protection and disclosure of the application.

Claims

An SDC2 methylation detection kit, comprising a methylation-dependent restriction endonuclease, a capture oligonucleotide and a universal primer;

Wherein, the capture oligonucleotide sequentially includes a first universal sequence, a folding sequence and a binding capture sequence from the 5' end to the 3' end;

Wherein, the folded sequence is at least partially identical to the 5' end sequence of the SDC2 methylation site after being cut by a methylation-dependent restriction endonuclease; and

The binding capture sequence specifically binds to the fragment region where the detected SDC2 methylation site is located.
The kit of claim 1, wherein the capture oligonucleotide further comprises a second universal sequence;

Preferably, the second universal sequence is located at the 5' end of the binding capture sequence;

Preferably, the capture oligonucleotide further comprises a nucleic acid extension blocking site;

Preferably, the nucleic acid extension blocking site is located at the 3' end of the folded sequence;

Preferably, the nucleic acid extension blocking site is modified with any one or a combination of at least two of Spacer, thio group or uracil base;

Preferably, the folding sequence is modified with nucleic acid analogs;

Preferably, the nucleic acid analogs include peptide nucleic acids, locked nucleic acids, transposed bases, 2'-O,4'-C-methylene bridge RNA, 2'-O-methyl RNA or 2'-fluoro RNA any one or a combination of at least two.
The kit according to claim 1 or 2, wherein the nucleic acid sequence of the universal primer is identical or partially identical to the first universal sequence of the capture oligonucleotide;

Preferably, the methylation-dependent restriction endonuclease comprises any one or a combination of at least two of GlaI, FspEI, MspJI, LpnPI, AspBHI or MseI.
The kit according to any one of claims 1-3, wherein the kit further comprises a SDC2 methylation-specific primer;

Preferably, the kit further comprises detection probes;

Preferably, the detection probe is labeled with a fluorescent group and/or a quenching group;

Preferably, the fluorophore is labeled at the 5' end of the detection probe;

Preferably, the quenching group is labeled at the 3' end of the detection probe;

Preferably, the fluorescent group includes any one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460;

Preferably, the quenching group includes any one of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.
The kit according to any one of claims 1-4, wherein the kit further comprises any one or a combination of at least two of DNA polymerase, UDG enzyme, dNTPs or Mg 2+ ;

Preferably, the kit further includes an enzyme digestion buffer and/or a PCR buffer.
The kit according to any one of claims 1-5, wherein the kit further comprises an internal reference gene PCR primer and/or a detection probe;

Preferably, the internal reference gene includes β-actin.
The kit according to any one of claims 1-6, wherein the capture oligonucleotide comprises the nucleic acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 6;

Preferably, the universal primer comprises the nucleic acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3;

Preferably, the SDC2 methylation-specific primer comprises the nucleic acid sequence shown in SEQ ID NO: 7;

Preferably, the detection probe comprises the nucleic acid sequence shown in SEQ ID NO:4 or SEQ ID NO:8;

Preferably, the internal reference gene PCR primers comprise the nucleic acid sequences shown in SEQ ID NOs: 10-11;

Preferably, the internal reference gene detection probe comprises the nucleic acid sequence shown in SEQ ID NO: 12.
An SDC2 methylation detection system, comprising 1-20nM capture oligonucleotide, 100-400nM universal primer, 100-300nM detection probe, 1-2U/μL Taq polymerase, 1-2U/μL UDG enzyme, 100-300 μM dNTP, 1-5 mM MgCl 2 and PCR buffer;

Preferably, the system further comprises 100-300 nM SDC2 methylation-specific primers.
A kind of SDC2 methylation detection method, it comprises:

The SDC2 methylation template to be tested is digested with a methylation-dependent restriction endonuclease, and the digested product is added to the system according to claim 8, and quantitative PCR is performed;

Preferably, the temperature of the enzymatic cleavage treatment is 30-40°C;

Preferably, the time of the enzyme digestion treatment is 0.5-2h;

Preferably, the procedure of the fluorescence quantitative PCR is: 92-95°C pre-denaturation for 2-5 min; 92-95°C denaturation for 10-20s, 65-70°C annealing for 80-100s, 10-15 cycles; 92-95°C denaturation 10～20s, annealing at 65～70℃ for 20～30s, 30～50 cycles.
The application of the kit according to any one of claims 1-7 or the system according to claim 8 in the preparation of reagents and/or equipment for early diagnosis of diseases;

Preferably, the disease comprises a tumor;

Preferably, the tumor comprises any one or a combination of at least two of colorectal cancer, liver cancer or esophageal cancer.