WO2022159712A1 - Compounds and methods for reducing dux4 expression - Google Patents
Compounds and methods for reducing dux4 expression Download PDFInfo
- Publication number
- WO2022159712A1 WO2022159712A1 PCT/US2022/013323 US2022013323W WO2022159712A1 WO 2022159712 A1 WO2022159712 A1 WO 2022159712A1 US 2022013323 W US2022013323 W US 2022013323W WO 2022159712 A1 WO2022159712 A1 WO 2022159712A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- modified
- certain embodiments
- seq
- oligomeric
- modified oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/344—Position-specific modifications, e.g. on every purine, at the 3'-end
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3515—Lipophilic moiety, e.g. cholesterol
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
Definitions
- Such compounds, methods, and pharmaceutical compositions for reducing the amount or activity of DUX4 RNA in a cell or animal, and in certain instances reducing the amount of DUX4 protein in a cell or animal.
- Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a muscular dystrophy or a neuromuscular disorder.
- Such symptoms and hallmarks include muscle weakness and muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and/or lower limbs.
- Such muscular dystrophies include Facioscapulohumeral muscular dystrophy (FSHD).
- FSHD Facioscapulohumeral muscular dystrophy
- Facioscapulohumeral muscular dystrophy is a progressive skeletal muscle disorder affecting the facial, scapular, and/or humeral muscles.
- FSHD is characterized by a clinical variety of symptoms, including but not limited to muscle weakness and muscle wasting in facio, scapula, and/or humeral muscles that can progress to the muscles of the trunk and lower limbs.
- the disorder is caused by the aberrant expression of double homeobox 4 (DUX4) in skeletal muscle cells
- DUX4 RNA compounds, pharmaceutical compositions, and methods of use for reducing the amount or activity of DUX4 RNA, and in certain embodiments reducing the amount of DUX4 protein in a cell or animal.
- the animal has a disease or disorder associated with DUX4.
- the animal has a muscular dystrophy.
- the animal has a neuromuscular disorder.
- the animal has facioscapulohumeral muscular dystrophy (FSHD).
- compounds useful for reducing the amount or activity of DUX4 RNA are oligomeric compounds.
- compounds useful for reducing the amount or activity of DUX4 RNA are modified oligonucleotides.
- the disease or disorder associated with DUX4 is a neuromuscular disorder.
- the disease or disorder associated with DUX4 is a muscular dystrophy.
- the muscular dystrophy is Facioscapulohumeral muscular dystrophy (FSHD).
- the symptom or hallmark includes muscle weakness and/or muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and/or lower limbs.
- 2’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyribosyl sugar moiety.
- a 2’-deoxynucleoside is a 2'-p-D-dcoxy nucleoside and comprises a 2’-(3-D- deoxyribosyl sugar moiety, which has the P-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
- a 2 ’-deoxy nucleoside or a nucleoside comprising an unmodified 2 ’-deoxy ribosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
- 2’-MOE means a 2’-OCH2CH2OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety.
- a “2’-MOE sugar moiety” or a “2’-O-methoxyethyl sugar moiety” means a sugar moiety with a 2’- OCH2CH2OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2’- MOE sugar moiety is in the -D configuration. “MOE” means O-methoxyethyl.
- 2’-MOE nucleoside or “2’- O(CH 2 )2OCH 3 nucleoside” means a nucleoside comprising a 2’-MOE sugar moiety (or 2’-O(CH2)2OCH3 ribosyl sugar moiety).
- 2’-OMe means a 2’-OCH 3 group in place of the 2’-OH group of a ribosyl sugar moiety.
- a “2’-O-methyl sugar moiety” means a sugar moiety with a 2’-OCH 3 group in place of the 2’-OH group of a ribosyl sugar moiety.
- a 2’-OMe has the P-D ribosyl stereochemical configuration.
- 2’-OMe nucleoside means a nucleoside comprising a 2’-OMe sugar moiety.
- 2’-F means a 2’-fluoro group in place of the 2’-OH group of a ribosyl sugar moiety.
- a “2’-F sugar moiety” or “2 ’-fluororibosyl sugar moiety” means a sugar moiety with a 2’-F group in place of the 2’- OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2’-F has the p-D ribosyl stereochemical configuration.
- 2’-F nucleoside means a nucleoside comprising a 2’-F sugar moiety.
- 2’-substituted nucleoside means a nucleoside comprising a 2 ’-substituted furanosyl sugar moiety.
- 2’-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
- 3’ target site refers to the 3 ’-most nucleotide of a target nucleic acid which is complementaiy to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
- 5’ target site refers to the 5’-most nucleotide of a target nucleic acid which is complementaiy to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
- 5-methylcytosine means a cytosine modified with a methyl group attached to the 5 position
- a 5-methylcytosine is a modified nucleobase.
- abasic sugar moiety means a sugar moiety of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as “abasic nucleosides.”
- administering means providing a pharmaceutical agent or composition to an animal.
- “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment.
- amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark.
- the symptom or hallmark is muscle weakness or muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and lower limbs.
- the progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
- animal means a human or non-human animal.
- antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
- antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
- antisense agent means an antisense compound and optionally one or more additional features, such as a sense compound.
- antisense compound means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.
- sense compound means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
- antisense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity.
- Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
- sense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide.
- bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
- bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
- the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety.
- the furanosyl sugar moiety is a ribosyl sugar moiety.
- the bicyclic sugar moiety does not comprise a furanosyl sugar moiety.
- RNAi agent blunt or blunt ended in reference to an oligomeric duplex formed by two oligonucleotides means that there are no terminal unpaired nucleotides (i.e. no overhanging nucleotides). One or both ends of a double-stranded RNAi agent can be blunt.
- cell-targeting moiety means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
- Cerebrospinal fluid or “CSF” means the fluid filling the space around the brain and spinal cord.
- Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e g., osmolarity, pH, and/or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF.
- chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
- the molecules are modified oligonucleotides.
- the molecules are oligomeric compounds comprising modified oligonucleotides.
- cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
- complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
- complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
- Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5- methylcytosine ( m C) and guanine (G).
- Certain modified nucleobases that pair with natural nucleobases or with other modified nucleobases are known in the art.
- inosine can pair with adenosine, cytosine, or uracil.
- Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
- oligonucleotide or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
- complementary region in reference to an oligonucleotide is the range of nucleobases of the oligonucleotide that is complementary with a second oligonucleotide or target nucleic acid.
- conjugate group means a group of atoms that is directly attached to an oligonucleotide.
- Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
- conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
- conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
- oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
- contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
- constrained ethyl or “cEt” or “cEt modified sugar moiety” means a f-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4’ -carbon and the 2’-caibon of the P-D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH 3 )-O-2', and wherein the methyl group of the bridge is in the S configuration.
- cEt nucleoside means a nucleoside comprising a cEt modified sugar moiety.
- deoxy region means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2’-p-D-deoxynucleosides.
- each nucleoside is selected from a 2’- -D- deoxynucleoside, a bicyclic nucleoside, and a 2 ’-substituted nucleoside.
- a deoxy region supports RNase H activity.
- a deoxy region is the gap or internal region of a gapmer.
- diluent means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
- the diluent in an injected composition can be a liquid, e.g. aCSF, PBS, or saline solution.
- double-stranded in reference to a region or an oligonucleotide means a duplex formed by complementary strands of nucleic acids (including, but not limited to oligonucleotides) hybridized to one another.
- the two strands of a double-stranded region are separate molecules.
- the two strands are regions of the same molecule that has folded onto itself (e g., a hairpin structure).
- duplex or “duplex region” means the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.
- gapmer means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
- the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.”
- the internal region is a deoxy region.
- the positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5 ’-end of the internal region.
- each nucleoside of the gap is a 2’-p-D-deoxynucleoside.
- the gap comprises one 2’-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’-p-D-deoxynucleosides.
- MOE gapmer indicates a gapmer having a gap comprising 2’-P-D-deoxynucleosides and wings comprising 2’-MOE nucleosides.
- the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
- hotspot region is a range of nucleobases on a target nucleic acid that is amenable to oligomeric agent or oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
- hybridization means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
- complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.
- intemucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
- modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
- Phosphorothioate intemucleoside linkage or “PS intemucleoside linkage” is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
- inverted nucleoside means a nucleotide having a 3’ to 3’ and/or 5’ to 5’ intemucleoside linkage, as shown herein.
- inverted sugar moiety means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3’ to 3’ and/or 5’ to 5’ intemucleoside linkage.
- linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
- linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
- mismatch or “non-complementary” means a nucleobase of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned in opposing directions.
- motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
- non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
- nucleobase means an unmodified nucleobase or a modified nucleobase.
- an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
- a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
- a “5-methylcytosine” is a modified nucleobase.
- a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
- nucleobase sequence means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
- nucleoside means a compound, or fragment of a compound, comprising a nucleobase and a sugar moiety.
- the nucleobase and sugar moiety are each, independently, unmodified or modified.
- modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
- oligomeric agent means an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound. An oligomeric agent may be a single-stranded oligomeric compound or may be an oligomeric duplex formed by two complementaiy oligomeric compounds.
- oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
- An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
- a “singled- stranded oligomeric compound” is an unpaired oligomeric compound.
- oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
- oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
- modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
- unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
- An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide or it may be unpaired.
- a “single-stranded oligonucleotide” is an unpaired oligonucleotide.
- a “double-stranded oligonucleotide” is an oligonucleotide that is paired with a second oligonucleotide.
- modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
- unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
- pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, symps, slurries, suspension and lozenges for the oral ingestion by an animal.
- a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
- pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
- a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous soludon.
- a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
- prodrug means a therapeutic agent in a first form outside the body that is converted to a second form within an animal or cells thereof.
- conversion of a prodrug within the animal is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
- an enzymes e.g., endogenous or viral enzyme
- the first form of the prodrug is less active than the second form.
- RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
- RNAi agent means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
- RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA, including microRNA mimics.
- RNAi agents may comprise conjugate groups and/or terminal groups.
- an RNAi agent modulates the amount, activity, and/or splicing of a target nucleic acid.
- the term RNAi agent excludes antisense agents that act through RNase H.
- RNase H agent means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
- RNase H agents are singlestranded.
- RNase H agents are double-stranded.
- RNase H agents may comprise conjugate groups and/or terminal groups.
- an RNase H agent modulates the amount and/or activity of a target nucleic acid.
- the term RNase H agent excludes antisense agents that act principally through RISC/Ago2.
- antisense RNase H oligonucleotide means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNase H- mediated nucleic acid reduction.
- RNAi oligonucleotide means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi- mediated nucleic acid reduction.
- oligonucleotide that at least partially hybridizes to itself.
- single-stranded means a nucleic acid (including but not limited to an oligonucleotide) that is unpaired and is not part of a duplex.
- Single-stranded compounds are capable of hybridizing with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded.
- stabilized phosphate group means a 5’-phosphate analog that is metabolically more stable than a 5 ’-phosphate as naturally occurs on DNA or RNA.
- standard in vitro assay means the assay described in Examples 1, 2, or 13 and reasonable variations thereof.
- standard in vitro RNase H assay means an in vitro assay for use with RNase H agents, and can include the assay described in Example 1 or Example 2 and reasonable variations thereof.
- standard in vitro RNAi assay means an in vitro assay for use with RNAi agents, and can include the assay described in Example 13 and reasonable variations thereof.
- standard in vivo assay means the assay described in Example 6 and reasonable variations thereof.
- stereorandom chiral center in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
- the number of molecules having the (.S') configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center.
- the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
- a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.
- subject means a human or non-human animal. In certain embodiments, the subject is a human.
- sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
- unmodified sugar moiety means a 2’-OH(H) P-D-ribosyl sugar moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) -D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”).
- Unmodified sugar moieties have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
- modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
- sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
- Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
- symptom or hallmark means any physical feature or test result that indicates the existence or extent of a disease or disorder.
- a symptom is apparent to a subject or to a medical professional examining or testing said subject.
- a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
- symptoms and hallmarks include muscle weakness and muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and lower limbs.
- target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
- Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
- target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
- terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
- treating means improving a subject’s disease or condition by administering an oligomeric agent or oligomeric compound described herein.
- tearing a subject improves a symptom relative to the same symptom in the absence of the treatment.
- treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
- terapéuticaally effective amount means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease.
- Embodiment 1 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a DUX4 RNA, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
- An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 nucleobases of any of SEQ ID NOs: 20-172, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
- Embodiment 3 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or 16 nucleobases of any of SEQ ID NOs: 173-1171, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
- Embodiment 4 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
- An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases complementary to: nucleobases 2697-2730 of SEQ ID NO: 1; nucleobases 2756-2778 of SEQ ID NO: 1; nucleobases 2732-2760 of SEQ ID NO: 1; nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2; nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2; nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of
- Embodiment 6 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of a sequence selected from:
- Embodiment 7 The oligomeric compound of any of embodiments 1-6, wherein the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1-4 when measured across the entire nucleobase sequence of the modified oligonucleotide.
- Embodiment 8 The oligomeric compound of any of embodiments 1-7, wherein the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
- the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50
- Embodiment 9 The oligomeric compound of any of embodiments 1-8, wherein the modified oligonucleotide comprises at least one modified nucleoside.
- Embodiment 10 The oligomeric compound of embodiment 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
- Embodiment 11 The oligomeric compound of embodiment 10, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
- Embodiment 12. The oligomeric compound of embodiment 11, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH 2 -; and -O-CH(CH 3 )-.
- Embodiment 13 The oligomeric compound of any of embodiments 10-12, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
- Embodiment 14 The oligomeric compound of embodiment 13, wherein the non-bicyclic modified sugar moiety is a 2’-O(CH 2 )JOCH 3 ribosyl sugar moiety, a cEt sugar moiety, a 2’-OMe sugar moiety, or a 2’-F sugar moiety.
- the non-bicyclic modified sugar moiety is a 2’-O(CH 2 )JOCH 3 ribosyl sugar moiety, a cEt sugar moiety, a 2’-OMe sugar moiety, or a 2’-F sugar moiety.
- Embodiment 15 The oligomeric compound of any of embodiments 10-14, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
- Embodiment 16 The oligomeric compound of embodiment 15, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.
- Embodiment 17 The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide has a sugar motif comprising: a 5’-region consisting of 1-6 linked 5’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3 ’-region consisting of 1-6 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-
- Embodiment 18 The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide has a sugar motif comprising: a 5 ’-region consisting of 3 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’-region consisting of 3 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-p-D-deoxyribosyl sugar moiety.
- Embodiment 19 The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide has a sugar motif comprising: a 5 ’-region consisting of 5 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’-region consisting of 5 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-p-D-deoxyribosyl sugar moiety.
- Embodiment 20 The oligomeric compound of embodiment 17, wherein the modified oligonucleotide has a 5 ’-region consisting of 3 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’-region consisting of 3 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a cEt sugar moiety and each of the central region nucleosides comprises a 2’-p-D-deoxyribosyl sugar moiety.
- Embodiment 21 The oligomeric compound of embodiment 17, wherein the modified oligonucleotide has a 5 ’-region consisting of 5 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’-region consisting of 5 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a 2’-O(CH2)2OCH3 ribosyl sugar moiety and each of the central region nucleosides comprises a 2'- ⁇ -D-deoxy ribosyl sugar moiety.
- each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a 2’-O(CH2)2OCH3 ribosyl sugar moiety and each of the central region nucleosides comprises a 2'- ⁇ -D-deoxy ribosy
- Embodiment 22 The oligomeric compound of any of embodiments 1-21, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
- Embodiment 23 The oligomeric compound of embodiment 22, wherein each intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.
- Embodiment 24 The oligomeric compound of embodiment 22 or embodiment 23, wherein at least one intemucleoside linkage is a phosphorothioate intemucleoside linkage.
- Embodiment 25 The oligomeric compound of embodiment 23, wherein each intemucleoside linkage of the modified oligonucleotide is a phosphorothioate intemucleoside linkage.
- Embodiment 26 The oligomeric compound of embodiment 22 or embodiment 24, wherein each intemucleoside linkage is independently selected from a phosphodiester intemucleoside linkage and a phosphorothioate intemucleoside linkage.
- Embodiment 27 The oligomeric compound of any of embodiments 22-26, wherein the intemucleoside linkage motif of the modified oligonucleotide is selected from: 5’- ssssssssssssssss - 3’ and 5’- ssssssssssssss - 3’, wherein each “s” represents a phosphorothioate intemucleoside linkage.
- Embodiment 28 The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide comprises a modified nucleobase.
- Embodiment 29 The oligomeric compound of embodiment 28, wherein the modified nucleobase is a 5- methylcytosine.
- Embodiment 30 The oligomeric compound of any of embodiments 1-29, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20,14-18, 14-20, 15-17, 15-25, 16-20, 18-22 or 18-20 linked nucleosides, or a pharmaceutically acceptable salt thereof.
- Embodiment 31 The oligomeric compound of embodiment 30, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
- Embodiment 32 The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 16 linked nucleosides.
- Embodiment 33 The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 20 linked nucleosides.
- Embodiment 34 The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 23 linked nucleosides.
- Embodiment 35 The oligomeric compound of any of embodiments 1-33, wherein the oligomeric compound activates RNase H.
- Embodiment 36 The oligomeric compound of any of embodiments 1-35, consisting of the modified oligonucleotide.
- Embodiment 37 The oligomeric compound of any of embodiments 1-35, consisting of the modified oligonucleotide and a conjugate group.
- Embodiment 38 The oligomeric compound of embodiment 37, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
- Embodiment 39 The oligomeric compound of embodiment 38, wherein the conjugate moiety is a lipophilic group.
- Embodiment 40 The oligomeric compound of embodiment 38, wherein the conjugate moiety is selected from a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C
- Embodiment 41 The oligomeric compound of embodiment 38, wherein the conjugate moiety is a 6- palmitamido hexyl conjugate moiety.
- Embodiment 42 The oligomeric compound of any of embodiments 38-41, wherein the conjugate linker is a phosphodiester linker.
- Embodiment 43 The oligomeric compound of any of embodiments 37-42, wherein the conjugate group has the following structure:
- Embodiment 44 The oligomeric compound of any of embodiments 38-43, wherein the conjugate linker consists of a single bond.
- Embodiment 45 The oligomeric compound of any of embodiments 38-44, wherein the conjugate linker is cleavable.
- Embodiment 46 The oligomeric compound of any of embodiments 38-45, wherein the conjugate linker comprises 1-3 linker-nucleosides.
- Embodiment 47 The oligomeric compound of any of embodiments 37-46, wherein the conjugate group is attached to the modified oligonucleotide at the 5 ’-end of the modified oligonucleotide.
- Embodiment 48 The oligomeric compound of any of embodiments 37-46, wherein the conjugate group is attached to the modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
- Embodiment 49 The oligomeric compound of any of embodiments 1-48, comprising a terminal group.
- Embodiment 50 The oligomeric compound of any of embodiments 1-45 or 47-49, wherein the oligomeric compound does not comprise linker-nucleosides.
- Embodiment 51 An oligomeric compound according to the following chemical structure:
- Embodiment 52 The oligomeric compound of embodiment 51, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
- Embodiment 53 An oligomeric compound according to the following chemical structure:
- Embodiment 54 An oligomeric compound comprising a modified oligonucleotide and conjugate group according to the following chemical notation: (6-palmitamidohexyl)- GksGks m CksGdsAdsTdsGds m Cds m Cds m CdsGdsGdsGdsTksAks m Ck (SEQ ID NO:248), wherein:
- A an adenine nucleobase
- mC a 5 -methylcytosine nucleobase
- G a guanine nucleobase
- T a thymine nucleobase
- k a cEt sugar moiety
- d a 2’- ⁇ -D-deoxyribosyl sugar moiety
- s a phosphorothioate intemucleoside linkage.
- Embodiment 55 A chirally enriched population of oligomeric compounds of any of embodiments 1-54, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
- Embodiment 56 The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) configuration.
- Embodiment 57 The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (R p) configuration.
- Embodiment 58 The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
- Embodiment 59 The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having the (A'p) configuration at each phosphorothioate intemucleoside linkage or for modified oligonucleotides having the ( p) configuration at each phosphorothioate intemucleoside linkage.
- Embodiment 60 The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having the (7?p) configuration at one particular phosphorothioate intemucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate intemucleoside linkages.
- Embodiment 61 The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate intemucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction.
- Embodiment 62 A population of oligomeric compounds of any of embodiments 1-54, wherein all of the phosphorothioate intemucleoside linkages of the modified oligonucleotide are stereorandom.
- Embodiment 63 An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-54.
- Embodiment 64 The oligomeric duplex of embodiment 63, wherein the second modified oligonucleotide consists of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
- Embodiment 65 An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1176- 1241, 1308, 1310-1473, or 1638; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
- Embodiment 66 An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1176- 1241, 1308, 1310-1473, or 1638; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases of the nucleobase sequence of any of SEQ ID
- Embodiment 67 An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1242-1307, 1309, 1474-1637, or 1639, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
- Embodiment 68 The oligomeric duplex of any of embodiments 63-67, wherein the modified oligonucleotide of the first oligomeric compound comprises a 5 ’-stabilized phosphate group.
- Embodiment 69 The oligomeric duplex of embodiment 68, wherein the 5’-stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphonate.
- Embodiment 70 The oligomeric duplex of any of embodiments 63-69, wherein at least one nucleoside of the first modified oligonucleotide comprises a modified sugar moiety.
- Embodiment 71 The oligomeric duplex of embodiment 70, wherein the modified sugar moiety of the first modified oligonucleotide comprises a bicyclic sugar moiety.
- Embodiment 72 The oligomeric duplex of embodiment 71, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH 2 -; and -O-CH(CH 3 )-.
- Embodiment 73 The oligomeric duplex of embodiment 70, wherein the modified sugar moiety of the first modified oligonucleotide comprises a non-bicyclic modified sugar moiety.
- Embodiment 74 The oligomeric duplex of embodiment 73, wherein the non-bicyclic modified sugar moiety of the first modified oligonucleotide is a 2’-OMe sugar moiety or a 2’-F sugar moiety.
- Embodiment 75 The oligomeric duplex of any of embodiments 63-74, wherein at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate.
- Embodiment 76 The oligomeric duplex of any of embodiments 63-75, wherein the first modified oligonucleotide comprises at least one modified intemucleoside linkage.
- Embodiment 77 The oligomeric duplex of embodiment 76, wherein at least one modified intemucleoside linkage of the first modified oligonucleotide is a phosphorothioate intemucleoside linkage.
- Embodiment 78 The oligomeric duplex of embodiment 76, wherein each intemucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester and a phosphorothioate intemucleoside linkage.
- Embodiment 79 The oligomeric duplex of any of embodiments 63-78, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.
- Embodiment 80 The oligomeric duplex of embodiment 79, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.
- Embodiment 81 The oligomeric duplex of embodiment 80, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH 2 -; and -O-CH(CH 3 )-.
- Embodiment 82 The oligomeric duplex of embodiment 79, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.
- Embodiment 83 The oligomeric duplex of embodiment 82, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2’-OMe sugar moiety or a 2’-F sugar moiety.
- Embodiment 84 The oligomeric duplex of any of embodiments 63-83, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.
- Embodiment 85 The oligomeric duplex of any of embodiments 63-84, wherein the second modified oligonucleotide comprises at least one modified intemucleoside linkage.
- Embodiment 86 The oligomeric duplex of embodiment 85, wherein at least one modified intemucleoside linkage of the second modified oligonucleotide is a phosphorothioate intemucleoside linkage.
- Embodiment 87 The oligomeric duplex of embodiment 85, wherein each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester and a phosphorothioate intemucleoside linkage.
- Embodiment 88 The oligomeric duplex of any of embodiments 63-87, wherein the intemucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooss and the intemucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooppss, wherein each “o” represents a phosphodiester intemucleoside linkage and each “s” represents a phosphorothioate intemucleoside linkage.
- Embodiment 89 The oligomeric duplex of any of embodiments 63-88, wherein the first modified oligonucleotide has a sugar motif of 5 ’ - yfyfyfyfyfyfyfyfyfyfyyyyy -3 ’ and the second modified oligonucleotide has a sugar motif of 5 ’ - fyfyfyfy fyfyfyfyfyfyfyfyf -3 ’ , wherein each “y ” represents a 2 ’ -OMe sugar moiety and each “f ’ represents a 2’-F sugar moiety.
- Embodiment 90 The oligomeric duplex of any of embodiments 63-89, wherein the first modified oligonucleotide and the second modified oligonucleotide each independently comprises at least one modified nucleobase.
- Embodiment 91 The oligomeric duplex of embodiment 90, wherein the at least one modified nucleobase is 5-methylcytosine.
- Embodiment 92 The oligomeric duplex of any of embodiments 63-91, wherein 1-4 3 ’-most nucleosides of the first modified oligonucleotide are overhanging nucleosides.
- Embodiment 93 The oligomeric duplex of any of embodiments 63-92, wherein the duplex is blunt ended at the 5 ’-end of the first modified oligonucleotide.
- Embodiment 94 The oligomeric duplex of any of embodiments 63-93, wherein the second oligomeric compound comprises a conjugate group comprising a conjugate moiety and a conjugate linker.
- Embodiment 95 The oligomeric duplex of embodiment 94, wherein the conjugate linker consists of a single bond.
- Embodiment 96 The oligomeric duplex of embodiment 94, wherein the conjugate linker is cleavable.
- Embodiment 97 The oligomeric duplex of embodiment 94, wherein the conjugate linker comprises 1-3 linker-nucleo sides .
- Embodiment 98 The oligomeric duplex of any of embodiments 94-97, wherein the conjugate group is attached to the 5 ’-end of the second modified oligonucleotide.
- Embodiment 99 The oligomeric duplex of any of embodiments 94-97, wherein the conjugate group is attached to the 3 ’-end of the second modified oligonucleotide.
- Embodiment 100 The oligomeric duplex of any of embodiments 94-97, wherein the conjugate group is attached via the 2’ position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide.
- Embodiment 101 The oligomeric duplex of any of embodiments 94-101, wherein the conjugate group comprises a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, CH alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
- Embodiment 102 The oligomeric duplex of any of embodiments 94-101, wherein the conjugate moiety is a 6-palmitamidohexyl conjugate moiety.
- Embodiment 103 The oligomeric duplex of any of embodiments 94 or 96-102, wherein the conjugate linker is a phosphodiester linker
- Embodiment 104 The oligomeric duplex of any one of embodiments 94 or 96-100, wherein the conjugate group has the following structure:
- Embodiment 105 The oligomeric duplex of any of embodiments 94-104, wherein the conjugate group comprises a cell-targeting moiety.
- Embodiment 106 The oligomeric duplex of any of embodiments 63-105, wherein the second modified oligonucleotide comprises a terminal group.
- Embodiment 107 The oligomeric duplex of embodiment 106, wherein the terminal group is an abasic sugar moiety.
- Embodiment 108 The oligomeric duplex of any of embodiments 63-107, wherein the second modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
- the second modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25,
- Embodiment 109 The oligomeric duplex of any of embodiments 63-66 or 68-108, wherein the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides.
- Embodiment 110 An antisense agent comprising or consisting of an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 1-54.
- Embodiment 111 An antisense agent, wherein the antisense agent is the oligomeric duplex of any of embodiments 63-109.
- Embodiment 112 The antisense agent of embodiment 110 or embodiment 111, wherein the antisense agent is: i) an RNase H agent capable of reducing the amount of DUX4 nucleic acid through the activation of RNase H; or ii) an RNAi agent capable of reducing the amount of DUX4 nucleic acid through the activation of RISC/Ago2.
- Embodiment 113 The antisense agent of any of embodiments 110-112, wherein the antisense agent comprises a conjugate group, and wherein the conjugate group comprises a cell-targeting moiety.
- Embodiment 114 A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-54, a population of oligomeric compounds of any of embodiments 55-62, an oligomeric duplex of any of embodiments 63-109, or an antisense agent of any of embodiments 110-113, and a pharmaceutically acceptable diluent.
- Embodiment 115 The pharmaceutical composition of embodiment 114, wherein the pharmaceutically acceptable diluent is phosphate buffered saline (PBS).
- PBS phosphate buffered saline
- Embodiment 116 The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists essentially of the oligomeric compound and PBS.
- Embodiment 117 The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists essentially of the population of oligomeric compounds and PBS.
- Embodiment 118 The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists essentially of the oligomeric duplex or the antisense agent and PBS.
- Embodiment 119 A method comprising administering to a subject an oligomeric compound of any of embodiments 1-54, a population of oligomeric compounds of any of embodiments 55-62, an oligomeric duplex of any of embodiments 63-109, an antisense agent of any of embodiments 110-113, or a pharmaceutical composition of any of embodiments 114-118.
- Embodiment 120 A method of treating a disease or disorder associated with DUX4 comprising administering to a subject having or at risk for developing a disease or disorder associated with DUX4 a therapeutically effective amount of an oligomeric compound of any of embodiments 1-54, a population of oligomeric compounds of any of embodiments 55-62, an oligomeric duplex of any of embodiments 63-109, an antisense agent of any of embodiments 110-113, or a pharmaceutical composition of any of embodiments 114-118; and thereby treating the disease or disorder associated with DUX4.
- Embodiment 121 The method of embodiment 120, where the disease or disorder associated with DUX4 is a muscle dystrophy.
- Embodiment 122 The method of embodiment 120, wherein the disease or disorder associated with DUX4 is facioscapulohumeral muscular dystrophy (FSHD).
- FSHD facioscapulohumeral muscular dystrophy
- Embodiment 123 The method of any of embodiments 120-122, wherein at least one symptom or hallmark of the disease or disorder associated with DUX4 is ameliorated.
- Embodiment 124 The method of embodiment 123, wherein the symptom or hallmark is muscle weakness or muscle wasting in facio, scapula, and/or humeral muscle.
- Embodiment 125 The method of embodiment 124, wherein administering the oligomeric compound of any of embodiments 1-54, the population of oligomeric compounds of any of embodiments 55-62, the oligomeric duplex of any of embodiments 63-109, the antisense agent of any of embodiments 110-113, or the pharmaceutical composition of any of embodiments 114-118 reduces or delays the onset or progression of muscle weakness or muscle wasting in the subject.
- Embodiment 126 The method of any of embodiments 119-125, wherein the oligomeric compound of any of embodiments 1-54, the population of oligomeric compounds of any of embodiments 55-62, the oligomeric duplex of any of embodiments 63-109, the antisense agent of any of embodiments 110-113, or the pharmaceutical composition of any of embodiments 114-118 is administered systemically.
- Embodiment 127 The method of any of embodiments 119-126, wherein the subject is a human.
- Embodiment 128. A method of reducing expression of DUX4 in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-54, a population of oligomeric compounds of any of embodiments 55-62, an oligomeric duplex of any of embodiments 63-109, an antisense agent of any of embodiments 110-113, or a pharmaceutical composition of any of embodiments 114-118.
- Embodiment 129 The method of embodiment 128, wherein the cell is a muscle cell.
- Embodiment 130 The method of embodiment 128 or embodiment 129, wherein the cell is a human cell.
- Embodiment 131 Use of the oligomeric compound of any of embodiments 1-54, the population of oligomeric compounds of any of embodiments 55-62, the oligomeric duplex of any of embodiments 63-109, the antisense agent of any of embodiments 110-113, or the pharmaceutical composition of any of embodiments 114- 118 for treating a disease or disorder associated with DUX4.
- Embodiment 132 Use of the oligomeric compound of any of embodiments 1-54, the population of oligomeric compounds of any of embodiments 55-62, the oligomeric duplex of any of embodiments 63-109, the antisense agent of any of embodiments 110-113, or the pharmaceutical composition of any of embodiments 114- 118 in the manufacture of a medicament for treating a disease or disorder associated with DUX4.
- Embodiment 133 The use of embodiment 131 or embodiment 132, wherein the disease or disorder associated with DUX4 is FSHD.
- the DUX4 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NC 000004.12, truncated from nucleotides 190171001 to 190187000), SEQ ID NO: 2 (GENBANK Accession No.
- the oligomeric agent is a single -stranded oligomeric compound. In certain embodiments, the oligomeric agent is oligomeric duplex.
- an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementaiy to an equal length portion of a DUX4 RNA, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
- the DUX4 nucleic acid has the nucleobase sequence of SEQ ID NO: 1, 2, 3, or 4.
- an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 nucleobases of any of SEQ ID NOs: 20-172.
- an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or 16 nucleobases of any of SEQ ID NOs: 173-1171.
- an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleobases of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638.
- the nucleobase sequence of the modified oligonucleotide can be at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a DUX4 nucleic acid, wherein the DUX4 nucleic acid has the nucleobase sequences of any of SEQ ID NOs: 1-4.
- the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to
- the modified sugar moiety comprises a bicyclic sugar moiety, such as a 2’-4’ bridge selected from -O-CH 2 -; and -O-CH(CH 3 )-.
- the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2’-M0E sugar moiety, a cEt sugar moiety, a 2’-OMe sugar moiety, or a 2’-F sugar moiety.
- At least one nucleoside of the modified oligonucleotide compound can comprise a sugar surrogate.
- At least one intemucleoside linkage of the modified oligonucleotide can comprise a modified intemucleoside linkage, such as a phosphorothioate intemucleoside linkage.
- each intemucleoside linkage of the modified oligonucleotide can be a modified intemucleoside linkage or each intemucleoside linkage of the modified oligonucleotide can be a phosphorothioate intemucleoside linkage.
- at least one intemucleoside linkage of the modified oligonucleotide can be a phosphodiester intemucleoside linkage.
- each intemucleoside linkage of the modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
- at least 2, at least 3, at least 4, at least 5, or at least 6 intemucleoside linkages of the modified oligonucleotide can be phosphodiester intemucleoside linkages.
- at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 intemucleoside linkages of the modified oligonucleotide can be phosphorothioate intemucleoside linkages.
- At least one nucleobase of the modified oligonucleotide can be a modified nucleobase, such as 5-methylcytosine.
- each cytosine is 5 -methylcytosine.
- the modified oligonucleotide can comprise a deoxy region consisting of 5-12 contiguous 2’-deoxynucleosides.
- each nucleoside of the deoxy region is a 2’-p-D-deoxynucleoside.
- the deoxy region consists of 7, 8, 9, 10, or 7-10 linked nucleosides.
- each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
- the deoxy region is flanked on the 5 ’-side by a 5 ’-region consisting of 1-6 linked 5’-region nucleosides and on the 3 ’-side by a 3 ’-region consisting of 1-6 linked 3 ’-region nucleosides; wherein the 3’- most nucleoside of the 5 ’-region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’-region comprises a modified sugar moiety.
- each nucleoside of the 3’-region comprises a modified sugar moiety.
- each nucleoside of the 5 ’-region comprises a modified sugar moiety.
- a compound comprises or consists of a modified oligonucleotide consisting of 16 to 50 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 20-172, wherein the modified oligonucleotide has: a 5 ’-region consisting of 5 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’-region consisting of 5 linked 3 ’-region nucleosides; wherein each of the 5 ’-region nucleosides and each of the 3 ’-region nucleosides comprises a 2 ’-MOE sugar moiety, each of the central region nucleosides comprises a 2’-p-D-deoxyribosyl sugar moiety, and wherein each cytosine is a 5-methylcytosine.
- the modified oligonucleotide consists of 16 to 50 linked nucle
- a compound comprises or consists of a modified oligonucleotide consisting of 16 to 50 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 173-1171, wherein the modified oligonucleotide has: a 5 ’-region consisting of 3 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’-region consisting of 3 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3 ’-region nucleosides comprises a 2’-cEt sugar moiety, each of the central region nucleosides comprises a 2’-p-D-deoxyribosyl sugar moiety, and wherein each cytosine is a 5-methylcytosine.
- the modified oligonucleotide consists of 16 to 50 linked nucle
- an oligomeric compound comprises a conjugate group.
- the conjugate group comprises a conjugate linker and a conjugate moiety.
- the conjugate linker consists of a single bond, the conjugate linker is cleavable, the conjugate linker comprises 1-3 linker- nucleosides, the conjugate linker does not comprise any linker nucleosides, the conjugate group is attached to the modified oligonucleotide at the 5 ’-end of the modified oligonucleotide, or the conjugate group is attached to the modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
- the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TIR), also known as TIR1 and CD71.
- TIR transferrin receptor
- the conjugate group comprises an anti-TfR1 antibody or fragment thereof.
- the conjugate group comprises a protein or peptide capable of binding TfRl.
- the conjugate group comprises an aptamer capable of binding TfRl.
- conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl l alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
- conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl l alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
- the conjugate group has the following structure: Certain Oligomeric Duplexes
- Certain embodiments are directed to oligomeric duplexes comprising a first oligomeric compound and a second oligomeric compound.
- an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases sequence of any of SEQ ID NOs: 20-1171; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
- an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-1171, wherein each thymine is replaced by uracil; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
- the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
- an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 16 to 50 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 20-1171, wherein each thymine is replaced by uracil; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 16 to 50 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
- the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
- an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
- the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
- an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contig
- the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
- an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1176-1241, 1308, 1310-1473, or 1638; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1242-1307, 1309, 1474-1637, or 1639, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
- the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
- an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide each comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the following pairs of nucleobase sequences recited in: SEQ ID NOs: 1176-1639, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleo
- the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
- an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide comprise any of the following pairs of nucleobase sequences recited in: SEQ ID NOs: 1176-1639, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.
- the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
- an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide consist of any of the following pairs of nucleobase sequences recited in: SEQ ID NOs: 1176-1639, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.
- the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
- At least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified sugar moiety.
- suitable modified sugar moieties include, but are not limited to, a bicyclic sugar moiety, such as a 2’-4’ bridge selected from -O-CH2-; and -O-CH(CH3)-, and a non-bicyclic sugar moiety, such as a 2’-MOE sugar moiety, a 2’- F sugar moiety, a 2’-OMe sugar moiety, or a 2’-NMA sugar moiety.
- At least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from 2’-F and 2’-OMe.
- at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a sugar surrogate.
- suitable sugar surrogates include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid (GNA), and unlocked nucleic acid (UNA).
- at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, which can be a GNA.
- At least one intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified intemucleoside linkage.
- the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
- at least one of the first, second, or third intemucleoside linkages from the 5’ end and/or the 3’ end of the first modified oligonucleotide comprises a phosphorothioate linkage.
- at least one of the first, second, or third intemucleoside linkages from the 5’ end and/or the 3 ’ end of the second modified oligonucleotide comprises a phosphorothioate linkage.
- At least one intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a phosphodiester intemucleoside linkage.
- each intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
- the intemucleoside linkage motif of the first modified oligonucleotide can be ssooooooooooooooooooss and the intemucleoside linkage motif of the second modified oligonucleotide can be ssooooooooooooooooss, wherein each “o” represents a phosphodiester intemucleoside linkage and each “s” represents a phosphorothioate intemucleoside linkage.
- At least one nucleobase of the first modified oligonucleotide and/or the second modified oligonucleotide can be modified nucleobase.
- the modified nucleobase is 5-methylcytosine.
- the first modified oligonucleotide can comprise a stabilized phosphate group attached to the 5’ position of the 5 ’-most nucleoside.
- the stabilized phosphate group comprises a cyclopropyl phosphonate or an (EJ-vinyl phosphonate.
- the first modified oligonucleotide can comprise a conjugate group.
- the conjugate group comprises a conjugate linker and a conjugate moiety.
- the conjugate group is attached to the first modified oligonucleotide at the 5 ’-end of the modified oligonucleotide.
- the conjugate group is attached to the first modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
- the conjugate group comprises N-acetyl galactosamine.
- the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfRl and CD71.
- TfR transferrin receptor
- the conjugate group comprises an anti-TfRl antibody or fragment thereof.
- the conjugate group comprises a protein or peptide capable of binding TfRl.
- the conjugate group comprises an aptamer capable of binding TfRl.
- conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl l alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
- conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, Cl 5 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
- the second modified oligonucleotide can comprise a conjugate group.
- the conjugate group comprises a conjugate linker and a conjugate moiety.
- the conjugate group is atached to the second modified oligonucleotide at the 5 ’-end of the modified oligonucleotide.
- the conjugate group is attached to the second modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
- the conjugate group comprises N-acetyl galactosamine.
- the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfRl and CD71.
- TfR transferrin receptor
- the conjugate group comprises an anti-TfRl antibody or fragment thereof.
- the conjugate group comprises a protein or peptide capable of binding TfRl.
- the conjugate group comprises an aptamer capable of binding TfRl.
- conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl l alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
- conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, Cl 5 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
- an antisense agent comprises an antisense compound, which comprises an oligomeric compound or an oligomeric duplex described herein.
- an antisense agent which can comprise an oligomeric compound or an oligomeric duplex described herein, is an RNAi agent capable of reducing the amount of DUX4 nucleic acid through the activation of RISC/Ago2.
- an oligomeric agent comprising two or more oligomeric duplexes.
- an oligomeric agent comprises two or more of any of the oligomeric duplexes described herein.
- an oligomeric agent comprises two or more of the same oligomeric duplex, which can be any of the oligomeric duplexes described herein.
- the two or more oligomeric duplexes are linked together.
- the two or more oligomeric duplexes are covalently linked together.
- the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together.
- the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at their 3 ’ ends.
- the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker. Certain such compounds are described in, e.g., Alterman, et al., Nature Biotech., 37:844-894, 2019.
- oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
- Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
- Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage. Certain modified nucleosides and modified intemucleoside linkages suitable for use in modified oligonucleotides are described below.
- Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.
- modified nucleosides comprising the following modified sugar moieties and/or the following modified nucleobases may be incorporated into antisense oligonucleotides.
- modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
- modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including, but not limited, to substituents at the 2’, 3 ’, 4’, and/or 5’ positions.
- the furanosyl sugar moiety is a ribosyl sugar moiety.
- one or more acychc substituent of non-bicyclic modified sugar moieties is branched.
- non-bicyclic modifed sugar moieties comprise a substituent group at the 2’- position.
- substituent groups suitable for the 2’-position of modified sugar moieties include but are not limited to: -F, -OCH 3 (“OMe” or “O-methyl”), and -O(CH 2 ) 2 OCH 3 (“MOE”).
- 2’- substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O-C1-C10 alkoxy, O-Ci-Cw substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S- alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O- alkaiyl, O-aralkyl, O(CH 2 ) 2 SCH 3 , 0(CH 2 ) 2 ON(R m )(R remedy) or OCH 2 C
- these 2'- substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
- a non-bridging 2’-substituent group selected from:
- a non-bridging 2 ’-substituent group selected from: F, OCF 3, OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2
- a 2 ’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCH 3 , and OCH2CH2OCH3.
- modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
- a 2 ’-deoxy furanosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring p-D-deoxyribosyl configuration.
- modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
- a 2’- modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
- 2’-modified sugar moieties described herein are in the P-D-ribosyl isomeric configuration unless otherwise specified.
- non-bicyclic modifed sugar moieties comprise a substituent group at the 4’- position
- substituent groups suitable for the 4’-position of modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
- non-bicyclic modifed sugar moieties comprise a substituent group at the 3’- position.
- substituent groups suitable for the 3 ’-position of modified sugar moieties include but are not limited to alkoxy (e.g, methoxy), alkyl (e.g., methyl, ethyl).
- non-bicyclic modifed sugar moieties comprise a substituent group at the 5’- position.
- substituent groups suitable for the 5 ’-position of modified sugar moieties include but are not limited to vinyl, alkoxy (e.g. , methoxy), alkyl (e.g., methyl (R or S), ethyl).
- non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836).
- oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2’ position or inverted 5’ to 3’.
- the linkage is at the 2’ position
- the 2 ’-substituent groups may instead be at the 3 ’-position.
- modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
- the bicyclic sugar moiety comprises abridge between the 4' and the 2' furanose ring atoms.
- Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH2-2', 4'-(CH2)J-2', 4'-(CH 2 )3-2', 4'-CH2-O-2' (“LNA”), 4'-CH 2 -S-2', 4'-(CH 2 )2-O-2' (“ENA”), 4'-CH(CH 3 )-O-2' (referred to as “constrained ethyl” or“cEt”), 4’-CH 2 -O-CH 2 -2’, 4’-CH 2 - N(R)-2’, 4'-CH(CH2OCH 3 )-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.
- each R, R a , and Ri is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).
- bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
- an LNA nucleoside (described herein) may be in the a- L configuration or in the ⁇ -D configuration.
- a-L-methyleneoxy (4’-CH 2 -O-2’) or a-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al. Nucleic Acids Research, 2003, 21, 6365-6372).
- the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off- target effects (Elmen, J.
- bicyclic nucleosides include both isomeric configurations.
- positions of specific bicyclic nucleosides e.g., LNA or cEt
- they are in the 0-D configuration, unless otherwise specified.
- modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4’-2’ bridged sugars).
- modified sugar moieties are sugar surrogates.
- the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom
- such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
- certain sugar surrogates comprise a 4 ’-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.
- sugar surrogates comprise rings having other than 5 atoms.
- a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
- THP tetrahydropyran
- Such tetrahydropyrans may be further modified or substituted.
- Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
- F-HNA see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and Swayze et al., U.S. 9,005,906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside:
- Bx is a nucleobase moiety
- T 3 and T 4 are each, independently, an intemucleoside Unking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T- and Ti is an intemucleoside linking group Unking tUe modified THP nucleoside to the remainder of an oligonucleotide and die otUer of T 3 and T 4 is H, a Uydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, q 2 , q 3 , q 4 , q 5 , q 6 and q7 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl.
- modified THP nucleosides are provided wherein q 3 , q 2 , q 3 , q 4 , q 5 , q6 and q7 are each H. In certain embodiments, at least one of q 4 , q 2 , q 3 , q 4 , q 5 , q6 and q7 is other than H. In certain embodiments, at least one of q 2 , q 2 . q 2 , q4, q5, q6 and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R 2 is F. In certain embodiments, Ri is F and R 2 is H, in certain embodiments, Ri is methoxy and R 2 is H, and in certain embodiments, Ri is methoxyethoxy and R 2 is H.
- sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
- nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et ai., U.S. 5,166,315; Summerton et ai., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506).
- morpholino means a sugar surrogate having the following structure:
- morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
- sugar surrogates are referred to herein as “modified morpholinos.”
- sugar surrogates comprise acyclic moieties.
- nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
- sugar surrogates comprise acyclic moieties.
- nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378
- Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262. Additional PNA compounds suitable foruse in the oligonucleotides of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
- sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides.
- UNA is an unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar surrogate.
- Representative U.S. publications that teach the preparation of UNA include, but are not limited to, US Patent No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.
- sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below:
- modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase).
- modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimi- dines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
- modified nucleobases are selected from: 5 -methylcytosine, 2-aminopropyladenine, 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2- propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C-C-CH ’.J uracil, 5-propynylcytosine,
- 6-azouracil 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5- halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine,
- nucleobases include tricyclic pyrimidines, such as 1,3 -diazapheno xazine-2 -one, 1,3 -diazapheno thiazine -2 -one and 9-(2- aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp).
- Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone.
- Further nucleobases include those disclosed in Merigan et al, U.S.
- nucleosides of modified oligonucleotides may be linked together using one or more modified intemucleoside linkages.
- the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphorus atom.
- Modified intemucleoside linkages compared to naturally occurring phosphodiester intemucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
- intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
- a modified intemucleoside linkage is any of those described in WO/2021/030778, incorporated by reference herein.
- a modified intemucleoside linkage comprises the formula: wherein independently for each intemucleoside linking group of the modified oligonucleotide:
- X is selected from O or S
- Ri is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl
- R 2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-Ce alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted Ci-Ce alkyl, substituted C1-C6 alkenyl substituted C1-C66lkynyl, and a conjugate group;
- R 3 is selected from an aryl, a substituted aryl, CH 3 , N(CH 3 ) 2 , OCH 3 and a conjugate group;
- R4 is selected from OCH 3 , OH, C1-C6 alkyl, substituted C1-C6 alkyl and a conjugate group;
- Rs is selected from OCH 3 , OH, C1-C6 alkyl, and substituted C1-C6 alkyl.
- a modified intemucleoside linkage comprises a mesyl phosphoramidate linking group having a formula:
- a mesyl phosphoramidate intemucleoside linkage may comprise a chiral center.
- modified oligonucleotides comprising (Rp) and/or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
- Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
- Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations.
- populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom.
- modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
- populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration.
- the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population.
- the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population.
- modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
- a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (.S'p) configuration.
- a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration.
- modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
- chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
- Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research', Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
- modified oligonucleotides comprise one or more inverted nucleoside, as shown below: wherein each Bx independently represents any nucleobase.
- an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage depicted above will be present.
- additional features such as a conjugate group may be attached to the inverted nucleoside.
- Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide.
- such groups lack a nucleobase and are referred to herein as inverted sugar moieties.
- an inverted sugar moiety is terminal (i.e., attached to the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage above will be present.
- additional features such as a conjugate group may be attached to the inverted sugar moiety.
- Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide.
- nucleic acids can be linked 2 ’ to 5 ’ rather than the standard 3 ’ to 5 ’ linkage Such a linkage is illustrated below. wherein each Bx represents any nucleobase.
- modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another.
- a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
- oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif.
- sugar motifs include but are not limited to any of the sugar modifications discussed herein.
- modified oligonucleotides comprise or consist of a region having a fully modified sugar motif.
- each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety.
- each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
- modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
- a fully modified oligonucleotide is a uniformly modified oligonucleotide.
- each nucleoside of a uniformly modified nucleotide comprises the same 2 ’-modification.
- modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
- the three regions of a gapmer motif (the 5 ’-wing, the gap, and the 3 ’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
- the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
- the sugar moieties within the gap are the same as one another.
- the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
- the sugar motifs of the two wings are the same as one another (symmetric gapmer).
- the sugar motif of the 5 '-wing differs from the sugar motif of the 3 '-wing (asymmetric gapmer).
- the wings of a gapmer comprise 1-6 nucleosides.
- each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
- at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety.
- at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety.
- at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety.
- at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety.
- at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety.
- the gap of a gapmer comprises 7-12 nucleosides.
- each nucleoside of the gap of a gapmer comprises a 2’-
- at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
- the gapmer is a deoxy gapmer.
- the nucleosides on the gap side of each wing/gap junction comprise 2’-
- each nucleoside of the gap comprises a 2’-p-D-deoxyribosyl sugar moiety.
- each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
- at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
- at least one nucleoside of the gap of a gapmer comprises a 2’-OMe sugar moiety.
- modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif.
- each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety.
- each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
- modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
- a fully modified oligonucleotide is a uniformly modified oligonucleotide.
- each nucleoside of a uniformly modified oligonucleotide comprises the same 2 ’-modification.
- the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5 ’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3 ’-wing] .
- a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2’-P-D-deoxyribosyl sugar moieties.
- a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-wing, 10 linked 2’- p-D-deoxynucleosides in the gap, and 5 linked 2’-MOE nucleosides in the 3’-wing.
- a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’- wing, 10 linked 2’- p-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3 ’-wing.
- a 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5 ’-wing, 8 linked 2’ -p-D- deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3 ’-wing.
- a 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5 ’- and/or the 3 ’-wing.
- modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.
- modified oligonucleotides have a sugar motif selected from 5’- eeeeeddddddddddeeeee -3’ or 5’- kkkdddddddddkkk -3’, wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, each “e” represents a 2’-MOE sugar moiety, and each “k” represents a cEt sugar moiety.
- modified oligonucleotides have the following sugar motif: 5 ’- eeeeeddddddddddeeeee -3 ’, wherein each “d” represents a 2’- -D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety.
- modified oligonucleotides have the following sugar motif: 5’- kkkdddddddddddkkk -3’, wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety and each “k” represents a cEt sugar moiety.
- the sugar moiety of at least one nucleoside of an antisense RNAi oligonucleotide is a modified sugar moiety.
- At least one nucleoside of the antisense RNAi oligonucleotide comprises a 2’- OMe sugar moiety.
- at least 2 nucleosides comprise 2’-OMe sugar moieties.
- at least 3 nucleosides comprise 2’-OMe sugar moieties.
- at least 4 nucleosides comprise 2’-OMe sugar moieties.
- at least 5 nucleosides comprise 2’-OMe sugar moieties.
- at least 6 nucleosides comprise 2’-OMe sugar moieties.
- at least 7 nucleosides comprise 2’-OMe sugar moieties.
- At least 8 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 9 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 11 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 12 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 13 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 14 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 15 nucleosides comprise 2’-OMe sugar moieties.
- nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 18 nucleosides comprise 2’- OMe sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 21 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1 or 2 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-4 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-5 nucleosides comprise 2’-OMe sugar moieties.
- nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-10 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-12 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-13 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 13 nucleosides comprise 2’-OMe sugar moieties and 3 of those 2’-OMe nucleosides are contiguous. In certain such embodiments, the remainder of the nucleosides are 2’-F modified.
- At least one nucleoside of the antisense RNAi oligonucleotide comprises a 2’-F sugar moiety.
- at least 2 nucleosides comprise 2’-F sugar moieties.
- at least 3 nucleosides comprise 2’-F sugar moieties.
- at least 4 nucleosides comprise 2’-F sugar moieties.
- at least 5 nucleosides comprise 2’-F sugar moieties.
- at least 6 nucleosides comprise 2’-F sugar moieties.
- at least 7 nucleosides comprise 2’-F sugar moieties.
- At least 8 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 9 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 11 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 12 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 13 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 14 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 16 nucleosides comprise 2’-F sugar moieties.
- nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 20 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 21 nucleosides comprise 2’-F sugar moieties. In certain embodiments, 1 or 2 nucleosides comprise 2’-F sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 1-4 nucleosides comprise 2’-F sugar moieties. In certain embodiments, 1-5 nucleosides comprise 2’-F sugar moieties. In certain embodiments, 1-7 nucleosides comprise 2’-F sugar moieties.
- 1-10 nucleosides comprise 2’-F sugar moieties.
- every other nucleosides of an antisense RNAi oligonucleotide are 2’-F nucleosides.
- the remainder of the nucleosides are 2’-OMe modified.
- At least one nucleoside of the antisense RNAi oligonucleotide comprises a 2’- OMe sugar moiety and at least one nucleoside comprises a 2’-F sugar moiety.
- at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleosides comprises a 2’-OMe sugar moiety and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides comprises a 2’-F sugar moiety.
- the antisense RNAi oligonucleotide comprises a sugar motif of fyf or yfy, wherein each “f ’ represents a 2’-F sugar moiety and each “y” represents a 2’- OMe sugar moiety.
- the antisense RNAi oligonucleotide has a sugar motif of yfylylyfyfylylyfylyyy, wherein each “f ’ represents a 2’-F sugar moiety and each “y” represents a 2’-OMe sugar moiety.
- one nucleoside of an antisense RNAi oligonucleotide is a UNA. In certain embodiments, one nucleoside of an antisense RNAi oligonucleotide is a GNA. In certain embodiments, 1-4 nucleosides of an antisense RNAi oligonucleotide is/are DNA. In certain such embodiments, the 1-4 DNA nucleosides are at one or both ends of the antisense RNAi oligonucleotide.
- the sugar moiety of at least one nucleoside of a sense RNAi oligonucleotide is a modified sugar moiety.
- At least one nucleoside of the sense RNAi oligonucleotide comprises a 2’- OMe sugar moiety.
- at least 2 nucleosides comprise 2’-OMe sugar moieties.
- at least 3 nucleosides comprise 2’-OMe sugar moieties.
- at least 4 nucleosides comprise 2’-OMe sugar moieties.
- at least 5 nucleosides comprise 2’-OMe sugar moieties.
- at least 6 nucleosides comprise 2’-OMe sugar moieties.
- at least 7 nucleosides comprise 2’-OMe sugar moieties.
- At least 8 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 9 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 12 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 14 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 15 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 17 nucleosides comprise 2’-OMe sugar moieties.
- nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1 or 2 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-4 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-5 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-7 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, 1-10 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, every other nucleosides of a sense RNAi oligonucleotide are 2’-OMe nucleosides. In certain such embodiments, the remainder of the nucleosides are 2’-F modified.
- At least one nucleoside of the sense RNAi oligonucleotide comprises a 2’-F sugar moiety.
- at least 2 nucleosides comprise 2’-F sugar moieties.
- at least 3 nucleosides comprise 2’-F sugar moieties.
- at least 4 nucleosides comprise 2’-F sugar moieties.
- at least 5 nucleosides comprise 2’-F sugar moieties.
- at least 6 nucleosides comprise 2’-F sugar moieties.
- at least 7 nucleosides comprise 2’-F sugar moieties.
- At least 8 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 9 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 11 nucleosides comprise 2’-F sugar moieties. In certain embodiments, 1 or 2 nucleosides comprise 2’-F sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 1-4 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 1-5 nucleosides comprise 2’-F sugar moieties.
- nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 1-10 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 1-11 nucleosides comprise 2’-F sugar moieties. In certain embodiments, every other nucleosides of a sense RNAi oligonucleotide are 2’-F nucleosides. In certain embodiments, the remainder of the nucleosides are 2’OMe modified.
- At least one nucleoside of the sense RNAi oligonucleotide comprises a 2’-OMe sugar moiety and at least one nucleoside comprises a 2’-F sugar moiety.
- at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides comprises a 2’-OMe sugar moiety and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 nucleosides comprises a 2’-F sugar moiety.
- the sense RNAi oligonucleotide comprises a sugar motif of fyf or yfy, wherein each “f ’ represents a 2’-F sugar moiety and each “y” represents a 2’-OMe sugar moiety.
- the sense RNAi oligonucleotide has a sugar motif of fyfyfyfyfylyfyfyfyfyfyf, wherein each “f ’ represents a 2’-F sugar moiety and each “y” represents a 2’-OMe sugar moiety.
- one nucleoside of a sense RNAi oligonucleotide is a UNA. In certain embodiments, one nucleoside of a sense RNAi oligonucleotide is a GNA. In certain embodiments, 1-4 nucleosides of a sense RNAi oligonucleotide is/are DNA. In certain such embodiments, the 1-4 DNA nucleosides are at one or both ends of the sense RNAi oligonucleotide.
- oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif.
- each nucleobase is modified.
- none of the nucleobases are modified.
- each purine or each pyrimidine is modified.
- each adenine is modified.
- each guanine is modified.
- each thymine is modified.
- each uracil is modified.
- each cytosine is modified.
- cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
- modified oligonucleotides comprise a block of modified nucleobases.
- the block is at the 3 ’-end of the oligonucleotide.
- the block is within 3 nucleosides of the 3 ’-end of the oligonucleotide.
- the block is at the 5’-end of the oligonucleotide.
- the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
- oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
- one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
- the sugar moiety of said nucleoside is a 2’- p-D-deoxyribosyl sugar moiety.
- the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.
- oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
- each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage.
- each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate a (Sp) phosphorothioate, and a (7?p) phosphorothioate.
- the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified.
- the sugar motif of a modified oligonucleotide is a gapmer
- the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages.
- all of the phosphorothioate linkages are stereorandom.
- all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates
- the gap comprises at least one Sp, Sp, or Rp motif.
- populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
- modified oligonucleotides have an intemucleoside linkage motif of sssssssssssssssss or sssssssssssssssssssssss, wherein each “s” represents a phosphorothioate intemucleoside linkage.
- modified oligonucleotides have an intemucleoside linkage motif of sssssssssssssssssssssssss.
- modified oligonucleotides have an intemucleoside linkage motif of sssssssssssssssssssssssssssssss.
- modified oligonucleotides have an intemucleoside linkage motif comprising one or more mesyl phosphoramidate linking groups.
- one or more phosphorothioate intemucleoside linkages or one or more phosphodiester intemucleoside linkages of the intemucleoside linkage motifs herein is substituted with a mesyl phosphoramidates linking group.
- At least one linkage of the antisense RNAi oligonucleotide is a modified linkage.
- the 5’-most linkage i.e. , linking the first nucleoside from the 5’-end to the second nucleoside from the 5 ’-end
- the two 5 ’-most linkages are modified.
- the first one or 2 linkages from the 3 ’-end are modified.
- the modified linkage is a phosphorothioate linkage.
- the remaining linkages are all unmodified phosphodiester linkages.
- antisense RNAi oligonucleotides have an intemucleoside linkage motif of ssooooooooooooooooooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- At least one linkage of the antisense RNAi oligonucleotide is an inverted linkage.
- At least one linkage of the sense RNAi oligonucleotides is a modified linkage.
- the 5’-most linkage i.e., linking the first nucleoside from the 5’-end to the second nucleoside from the 5’-end
- the two 5’-most linkages are modified.
- the first one or 2 linkages from the 3 ’-end are modified.
- the modified linkage is a phosphorothioate linkage.
- the remaining linkages are all unmodified phosphodiester linkages.
- sense RNAi oligonucleotides have an intemucleoside linkage motif of ssooooooooooooooooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
- At least one linkage of the sense RNAi oligonucleotides is an inverted linkage.
- oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
- Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992
- a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
- Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
- target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
- oligonucleotides can have any of a variety of ranges of lengths.
- oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
- X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
- oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to
- oligonucleotides consist of 16 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 17 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 19 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides.
- a modified oligonucleotide is a gapmer.
- the gapmer consists of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
- X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
- gapmers consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to
- a gapmer consists of 16 linked nucleosides. In certain embodiments, a gapmer consists of 17 linked nucleosides. In certain embodiments, a gapmer consists consist of 18 linked nucleosides. In certain embodiments, a gapmer consists of 19 linked nucleosides. In certain embodiments, a gapmer consists of 20 linked nucleosides.
- antisense RNAi oligonucleotides consist of 17-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-23 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 20-30 linked nucleosides.
- antisense RNAi oligonucleotides consist of 21-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 20-22 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23-24 linked nucleosides.
- antisense RNAi oligonucleotides consist of 20 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 21 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 22 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23 linked nucleosides.
- sense RNAi oligonucleotides consist of 17-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-23 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 20-30 linked nucleosides.
- sense RNAi oligonucleotides consist of 21-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 20-22 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23-24 linked nucleosides.
- sense RNAi oligonucleotides consist of 20 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 21 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 22 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23 linked nucleosides.
- modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
- the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
- sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
- Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population.
- the modified oligonucleotides of a chirally enriched population are enriched for f-D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom.
- the modified oligonucleotides of a chirally enriched population are enriched for both
- oligonucleotides are further described by their nucleobase sequence.
- oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
- a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
- the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
- oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
- Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
- conjugate groups or terminal groups are attached at the 3 ’ and/or 5 ’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3 ’ -end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’ -end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides. Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
- oligonucleotides are covalently attached to one or more conjugate groups.
- conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
- conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide.
- the carbohydrate moiety is attached to a modified subunit of the modified oligo nucleotide.
- the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g. a noncarbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand.
- a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety.
- RRMS ribose replacement modification subunit
- a cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur.
- the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e g. fused rings.
- the cyclic carrier may be a hilly saturated ring system, or it may contain one or more double bonds.
- the modified oligonucleotide is a gapmer.
- conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
- Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
- conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cll alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
- conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
- a conjugate group is a lipid having the following structure:
- Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e g., GalNAc), antibodies, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
- intercalators include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e g., GalNAc), antibodies, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospho
- a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fmgolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
- an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen,
- Conjugate moieties are attached to oligonucleotides through conjugate linkers.
- the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
- the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
- a conjugate linker comprises pyrrolidine.
- a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
- conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to compounds, such as the oligonucleotides provided herein.
- a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
- bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
- conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1 -carboxylate (SMCC) and 6 -aminohexanoic acid (AHEX or AHA).
- ADO 8-amino-3,6-dioxaoctanoic acid
- SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1 -carboxylate
- AHEX or AHA 6 -aminohexanoic acid
- conjugate linkers include but are not limited to substituted or unsubstituted Ci-Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
- conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker- nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
- a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N- benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
- linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker- nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
- an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
- the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
- an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
- conjugate linkers comprise no more than 10 linker- nucleosides.
- conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
- a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
- oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
- certain conjugate linkers may comprise one or more cleavable moieties.
- a cleavable moiety is a cleavable bond.
- a cleavable moiety is a group of atoms comprising at least one cleavable bond.
- a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
- a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
- a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
- a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide.
- a cleavable bond is one or both of the esters of a phosphodiester.
- a cleavable moiety comprises a phosphate or phosphodiester.
- the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
- a cleavable moiety comprises or consists of one or more linker-nucleosides.
- the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
- such cleavable bonds are unmodified phosphodiester bonds.
- a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
- the cleavable moiety is 2'-deoxyadenosine.
- a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula:
- n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0. In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3,
- conjugate groups comprise cell-targeting moieties that have at least one tethered ligand.
- cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
- cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.
- each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate.
- a conjugate group comprises a cell-targeting conjugate moiety.
- a conjugate group has the general formula:
- n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
- n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1 In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
- conjugate groups comprise cell-targeting moieties that have at least one tethered ligand.
- cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
- cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.
- the cell-targeting moiety targets neurons. In certain embodiments, the celltargeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011/131693, WO 2014/064257.
- conjugate groups comprise cell-targeting moieties that have affinities for transferrin receptor (TfR) (also referred to herein as TfRl and CD71).
- TfR transferrin receptor
- a conjugate group described herein comprises an anti-TfRl antibody or fragment thereof.
- the conjugate group comprises a protein or peptide capable of binding TfRl.
- the conjugate group comprises an aptamer capable of binding TfRl.
- the anti-TfRl antibody or fragment thereof can be any known in the art including but not limited to those described in WO1991/004753; WO2013/103800;
- a fragment of an anti-TfRl antibody is F(ab')2, Fab, Fab', Fv, or scFv.
- the conjugate group comprises a protein or peptide capable of binding TfRl .
- the protein or peptide capable of binding TfRl can be any known in the art including but not limited to those described in W02019/140050; W02020/037150; W02020/124032; and US 10,138,483.
- the conjugate group comprises an aptamer capable of binding TfRl.
- the aptamer capable of binding TfRl can be any known in the art including but not limited to those described in WO2013/163303; W02019/033051; and WO2020/245198.
- oligomeric compounds comprise one or more terminal groups.
- oligomeric compounds comprise a stabilized 5’-phosphate.
- Stabilized 5’-phosphates include, but are not limited to 5 ’-phosphonates, including, but not limited to 5’-vinylphosphonates.
- terminal groups comprise one or more abasic sugar moieties and/or inverted nucleosides.
- terminal groups comprise one or more 2’-linked nucleosides or sugar moieties.
- the 2’- linked group is an abasic sugar moiety.
- oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
- antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
- Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
- hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
- certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
- RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
- the DNA in such an RNA:DNA duplex need not be unmodified DNA.
- described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity.
- one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
- an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
- RISC RNA-induced silencing complex
- certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
- Antisense compounds that are loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA or dsRNAi) or singlestranded (ssRNAi).
- hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
- Antisense activities may be observed directly or indirectly.
- observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid.
- the target nucleic acid is an endogenous RNA molecule.
- the target nucleic acid encodes a protein.
- the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
- the target RNA is a mature mRNA.
- the target nucleic acid is a pre-mRNA.
- the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction.
- the target region is at least 50% within an intron.
- the target nucleic acid is the RNA transcriptional product of a retrogene.
- the target nucleic acid is a non-coding RNA.
- the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.
- oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or hilly complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.
- Gautschi et al (I. Natl. Cancer Inst. 93 :463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of bothbcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.
- oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
- antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
- selectivity of the oligonucleotide is improved.
- a mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
- the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region.
- the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 ’-end of the gap region.
- the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region.
- the mismatch is at position 4, 3, 2, or 1 from the 3 ’-end of the wing region.
- antisense RNAi oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
- RNAi activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
- selectivity of the antisense RNAi oligonucleotides is improved.
- antisense RNAi oligonucleotides comprise a targeting region complementary to the target nucleic acid.
- the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides.
- the targeting region constitutes 70%, 80%, 85%, 90%, or 95% of the nucleosides of the antisense RNAi oligonucleotide.
- the targeting region constitutes all of the nucleosides of the antisense RNAi oligonucleotide.
- the targeting region of the antisense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the targeting region of the antisense RNAi oligonucleotide is 100% complementary to the target nucleic acid.
- RNAi agents comprise a sense RNAi oligonucleotide.
- sense RNAi oligonucleotides comprise a region complementary to the antisense RNAi oligonucleotide.
- the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides.
- the complementary region constitutes 70%, 80%, 85%, 90%, or 95% of the nucleosides of the sense RNAi oligonucleotide.
- the complementary region constitutes all of the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the complementary region of the sense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the antisense RNAi oligonucleotide. In certain embodiments, the complementary region of the sense RNAi oligonucleotide is 100% complementary to the antisense RNAi oligonucleotide.
- a duplex region comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 hybridized pairs.
- each nucleoside of antisense RNAi oligonucleotide is within the duplex region (i.e., the antisense RNAi oligonucleotide has no overhanging nucleosides).
- the antisense RNAi oligonucleotide includes unpaired nucleosides at the 3 ’-end and/or the 5 ’end (overhanging nucleosides).
- each nucleoside of sense RNAi oligonucleotide is within the duplex region (i.e., the sense RNAi oligonucleotide has no overhanging nucleosides).
- the sense RNAi oligonucleotide includes unpaired nucleosides at the 3’-end and/or the 5’end (overhanging nucleosides).
- duplexes formed by the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide do not include any overhangs at one or both ends. Such ends without overhangs are referred to as blunt ends.
- the antisense RNAi oligonucleotide has overhanging nucleosides, one or more of those overhanging nucleosides are complementary to the target nucleic acid.
- the antisense RNAi oligonucleotide has overhanging nucleosides, one or more of those overhanging nucleosides are not complementary to the target nucleic acid.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is DUX4.
- DUX4 nucleic acid has the sequence set forth SEQ ID NO: 1 (GENBANK Accession No. NC_000004.12, truncated from nucleotides 190171001 to 190187000) or SEQ ID NO: 2 (GENBANK Accession No. NM 001306068.2).
- DUX4 nucleic acid has the sequence set forth in any of the known splice variants of DUX4, including but not limited to SEQ ID NO: 3 (GENBANK AccessionNo.
- contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 reduces the amount of DUX4 RNA, and in certain embodiments reduces the amount of DUX4 protein.
- the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.
- contacting a cell with an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 reduces the amount of DUX4 RNA in a cell. In certain embodiments, contacting a cell with an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 reduces the amount of DUX4 protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.
- contacting a cell in a subject with an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 ameliorates one or more symptoms or hallmarks of a disease or disorder associated with DUX4.
- the disease or disorder associated DUX4 is a neuromuscular disorder.
- the disease or disorder associated DUX4 is a muscular dystrophy.
- the muscular dystrophy is Facioscapulohumeral muscular dystrophy (FSHD).
- an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the among of DUX4 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vitro assay.
- an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the amount of DUX4 RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay.
- an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the among of DUX4 protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vitro assay.
- an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the amount of DUX4 protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay.
- an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the among of DUX4 RNA in the muscle of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to any one of SEQ ID NOs: 1-4 is capable of reducing the amount of DUX4 protein in the muscle of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
- the pharmacologically relevant tissues are muscle cells and muscle tissues. Such muscle tissues include all skeletal muscles including, but not limited to, upper and lower limbs, trunk, head, and neck.
- Certain embodiments provided herein relate to methods of reducing or inhibiting DUX4 expression or activity, which can be useful for treating, preventing, or ameliorating a disease or disorder associated with DUX4.
- the disease or disorder associated DUX4 is a neuromuscular disorder.
- the disease or disorder associated DUX4 is a muscular dystrophy.
- the muscular dystrophy is Facioscapulohumeral muscular dystrophy (FSHD).
- a method comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a DUX4 nucleic acid.
- the subject has or is at risk for developing a disease or disorder associated with DUX4.
- the subject has a neuromuscular disorder
- the subject has a muscular dystrophy.
- the subject has Facioscapulohumeral muscular dystrophy (FSHD).
- a method for treating a disease or disorder associated with DUX4 comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a DUX4 nucleic acid.
- the subject has or is at risk for developing a disease or disorder associated with DUX4.
- the subject has a neuromuscular disorder.
- the subject has a muscular dystrophy.
- the subject has Facioscapulohumeral muscular dystrophy (FSHD).
- at least one symptom or hallmark of the disease or disorder associated with DUX4 is ameliorated.
- the at least one symptom or hallmark is muscle weakness or muscle wasting in facio, scapula, and/or humeral muscle that can progress to the muscles of the trunk and/or lower limbs.
- administration of the oligomeric compound, the modified oligonucleotide, the oligomeric duplex, or the antisense agent to the subject reduces or delays the onset or progression of muscle weakness or muscle wasting in facio, scapula, and/or humeral muscle or further reduces or delays the onset or progression of muscle weakness or muscle wasting into the muscles of the trunk and/or lower limbs.
- a method of reducing expression of DUX4 nucleic acid, for example RNA, or reducing expression of DUX4 protein in a cell comprises contacting the cell with an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a DUX4 nucleic acid.
- the subject has or is at risk for developing a disease or disorder associated with DUX4.
- the subject has or is at risk for developing a neuromuscular disorder.
- the subject has or is at risk for developing a muscular dystrophy.
- the subject has or is at risk for developing Facioscapulohumeral muscular dystrophy (FSHD).
- the cell is a muscle cell.
- the cell is a human cell.
- Certain embodiments are drawn to an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a DUX4 nucleic acid, for use in treating a disease or disorder associated with DUX4 or for use in the manufacture of a medicament for treating a disease or disorder associated with DUX4.
- the disease or disorder associated with DUX4 is a neuromuscular disorder.
- the disease or disorder associated with DUX4 is a muscular dystrophy.
- the disease or disorder associated with DUX4 is Facioscapulohumeral muscular dystrophy (FSHD).
- the oligomeric compound, the modified oligonucleotide, the oligomeric duplex, or the antisense agent can be any described herein.
- compositions comprising one or more oligomeric compounds.
- the one or more oligomeric compounds each consists of a modified oligonucleotide.
- the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
- a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
- the sterile saline is pharmaceutical grade saline.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
- the sterile water is pharmaceutical grade water.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS).
- PBS phosphate-buffered saline
- the sterile PBS is pharmaceutical grade PBS.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”).
- artificial cerebrospinal fluid is pharmaceutical grade.
- a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF).
- a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid.
- a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid.
- the artificial cerebrospinal fluid is pharmaceutical grade.
- aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate.
- the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2.
- compositions comprise one or more oligomeric compound and one or more excipients.
- excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
- oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
- Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
- compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
- pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
- the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
- pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts.
- Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts.
- prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
- oligomeric compounds are lyophilized and isolated as sodium salts.
- the sodium salt of an oligomeric compound is mixed with a pharmaceutically acceptable diluent.
- the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF.
- the sodium salt of an oligomeric compound is mixed with PBS.
- the sodium salt of an oligomeric compound is mixed with aCSF.
- Lipid moieties have been used in nucleic acid therapies in a variety of methods.
- the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
- DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
- compositions comprise a delivery system.
- delivery systems include, but are not limited to, liposomes and emulsions Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
- certain organic solvents such as dimethylsulfoxide are used.
- compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
- pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
- compositions comprise a co-solvent system.
- cosolvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
- co-solvent systems are used for hydrophobic compounds.
- a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
- the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
- co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
- compositions are prepared for oral administration.
- pharmaceutical compositions are prepared for buccal administration.
- a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.).
- a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
- injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
- compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
- Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Under certain conditions, certain compounds disclosed herein act as acids.
- aqueous solutions of such compounds exist in equilibrium among such forms.
- a phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms.
- compounds described herein are intended to include all such forms.
- certain oligonucleotides have several such linkages, each of which is in equilibrium.
- oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium.
- the term “oligonucleotide” is intended to include all such forms.
- Drawn structures necessarily depict a single form.
- a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof’ expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with one or more cations selected from sodium, potassium, calcium, and magnesium.
- modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH.
- a dose may be in the form of a dosage unit.
- a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound.
- the free acid is in equilibrium with anionic and salt forms.
- the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.
- a modified oligonucleotide or an oligomeric compound may be partially or fully de-protonated and in association with sodium ions.
- the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium ions is not counted toward the weight of the dose.
- a dose, or dosage unit, of 10 mg of Compound No. 541106 or Compound No. 613801 equals the number of fully protonated molecules that weighs 10 mg.
- a modified oligonucleotide or oligomeric compound where a modified oligonucleotide or oligomeric compound is in a solution, such as aCSF, comprising sodium, potassium, calcium, and magnesium, the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium, potassium, calcium, and/or magnesium.
- the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted toward the weight of the dose.
- the mass of the conjugate group may be included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.
- nucleobases 2697-2730 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 2697-2730 of SEQ ID NO: 1.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- modified oligonucleotides are 5-10-5 or 3-10-3 gapmers.
- the gapmers are MOE gapmers.
- the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3 ’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’- -D- deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety.
- the sugar motif for the gapmers is (from 5’ to 3 ’): kkkdddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5 -methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 24, 98, 318-320, 359-361, 398-400, 438-440, 852, and 857 are complementary within nucleobases 2697-2730 of SEQ ID NO: 1.
- Compounds 541110, 541187, 1099107-1099118, 1582921, and 1582472 are complementary within nucleobases 2697-2730 of SEQ ID NO: 1.
- modified oligonucleotides complementary within nucleobases 2697-2730 of SEQ ID NO: 1 achieve at least 27% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementaiy within nucleobases 2697-2730 of SEQ ID NO: 1 achieve an average of 56% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 2756-2778 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementaiy within nucleobases 2756-2778 of SEQ ID NO: 1.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are gapmers.
- modified oligonucleotides are 3-10-3 gapmers.
- the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 323, 324, 364, 404, 443, and 444 are complementary within nucleobases 2756-2778 of SEQ ID NO: 1
- modified oligonucleotides complementary within nucleobases 2756-2778 of SEQ ID NO: 1 achieve at least 25% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- modified oligonucleotides complementary within nucleobases 2756-2778 of SEQ ID NO: 1 achieve an average of 57% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- modified oligonucleotides comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 4103- 4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- modified oligonucleotides are 5-10-5 or 3-10-3 gapmers. In certain embodiments, the gapmers are MOE gapmers.
- the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety.
- the sugar motif for the gapmers is (from 5’ to 3 ’): kkkddddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 73, 148, 327, 367, 407, 408, 208, and 447 are complementary within nucleobases 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2.
- Compounds 541160, 541238, 613853, and 1099147-1099151 are complementary within nucleobases 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2 achieve at least 14% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4103-4134 of SEQ ID NO: 1 and/or 1330-1361 of SEQ ID NO: 2 achieve an average of 52% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 4503-4522 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementaiy within nucleobases 4503-4522 of SEQ ID NO: 1.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are gapmers.
- modified oligonucleotides are 3-10-3 gapmers.
- the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 299, 340, 379, and 420-421 are complementaiy within nucleobases 4503-4522 of SEQ ID NO: 1.
- modified oligonucleotides complementary within nucleobases 4503-4522 of SEQ ID NO: 1 achieve at least 34% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- modified oligonucleotides complementary within nucleobases 4503-4522 of SEQ ID NO: 1 achieve an average of 55% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 4509-4530 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 4509-4530 of SEQ ID NO: 1.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are gapmers.
- modified oligonucleotides are 3-10-3 gapmers.
- the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3 ’): kkkddddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 300-301, 341-342, 380, 422, and 1002 are complementary within nucleobases 4509-4530 of SEQ ID NO: 1.
- modified oligonucleotides complementary within nucleobases 4509-4530 of SEQ ID NO: 1 achieve at least 43% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementaiy within nucleobases 4509-4530 of SEQ ID NO: 1 achieve an average of 61% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 4828- 4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are gapmers.
- modified oligonucleotides are 3-10-3 gapmers.
- the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3 ’): kkkddddddddddkkk; wherein each “d” represents a 2’-P-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5- methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 331, 332, 370, 371, 412, 413, 451, and 452 are complementary within nucleobases 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2.
- Compounds 1099177-1099184 are complementary within nucleobases 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2.
- modified oligonucleotides complementaiy within nucleobases 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2 achieve at least 44% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementaiy within nucleobases 4828-4850 of SEQ ID NO: 1 and/or 1693-1710 of SEQ ID NO: 2 achieve an average of 55% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 768-787 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 768-787 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a 2’-P-D- deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5- methylcytosine
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 326, 366, 406, 446, and 777 are complementaiy within nucleobases 768-787 of SEQ ID NO: 2.
- Compounds 1099138-1099141 and 1582913 are complementary within nucleobases 768-787 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 768-787 of SEQ ID NO: 2 achieve at least 53% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 768-787 of SEQ ID NO: 2 achieve an average of 65% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 2732-2760 of SEQ ID NO: 1 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 2732-2760 of SEQ ID NO: 1.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- modified oligonucleotides are 5-10-5 or 3-10-3 gapmers.
- the gapmers are MOE gapmers.
- the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3 ’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’- -D- deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety.
- the sugar motif for the gapmers is (from 5’ to 3 ’): kkkdddddddddkkk; wherein each “d” represents a 2’-P-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5 -methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 100, 186, 321, 362, 645, 719, 791, 796, 867, 873, 943, 946, and 1019 are complementary within nucleobases 2732-2760 of SEQ ID NO: 1.
- Compounds 541189, 613830, 1099121-1099122, 1582534-1582535, 1582543, 1582548-1582549, 1582551, 1582557, 1582566, and 1582568 are complementary within nucleobases 2732-2760 of SEQ ID NO: 1.
- modified oligonucleotides complementaiy within nucleobases 2732-2760 of SEQ ID NO: 1 achieve at least 13% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2732-2760 of SEQ ID NO: 1 achieve an average of 69% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 802, 880, 1088-1090 are complementary within nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2.
- Compounds 1582611-1582612 and 1604089-1604091 are complementary within nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2 achieve at least 71% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2783-2806 of SEQ ID NO: 1 and/or nucleobases 10-33 of SEQ ID NO: 2 achieve an average of 79% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 2833-2853 of SEO ID NO: 1 and/or nucleobases 60-80 of SEO ID NO: 2 are 10. Nucleobases 2833-2853 of SEO ID NO: 1 and/or nucleobases 60-80 of SEO ID NO: 2
- nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 668, 742, 815, 893, 966, and 1040 are complementary within nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2.
- Compounds 1582702-1582707 are complementary within nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2 achieve at least 59% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- modified oligonucleotides complementaiy within nucleobases 2833-2853 of SEQ ID NO: 1 and/or nucleobases 60-80 of SEQ ID NO: 2 achieve an average of 79% reduction of DUX4 RNA in the standard in vitro RNase H assay. 11.
- nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementaiy within nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 673, 747-748, 822, 898, 971, and 1045 are complementary within nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2.
- Compounds 1582734-1582740 are complementary within nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2 achieve at least 73% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 2953-2975 of SEQ ID NO: 1 and/or nucleobases 180-202 of SEQ ID NO: 2 achieve an average of 78% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers.
- the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeee; wherein each “d” represents a 2’- -D-deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety.
- the sugar motif for the gapmers is (from 5’ to 3 ’): kkkddddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 39, 678-681, 753-755, 827-829, 903-905, 976-978, 1050-1052, and 1135-1136 are complementaiy within nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2.
- Compounds 541125, 1582765-1582783, and 1604144-1604145 are complementaiy within nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2 achieve at least 30% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3097-3136 of SEQ ID NO: 1 and/or nucleobases 324-363 of SEQ ID NO: 2 achieve an average of 76% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers.
- the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’-
- the sugar motif for the gapmers is (from 5’ to 3 ’): kkkddddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 117, 684, 758, 1056, and 1141-1144 are complementary within nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2.
- Compounds 541206, 1582800-1582802, and 1604150-1604153 are complementary within nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2 achieve at least 53% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3174-3210 of SEQ ID NO: 1 and/or nucleobases 401-437 of SEQ ID NO: 2 achieve an average of 84% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are 5-10-5 or 3-10-3 gapmers.
- the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeee; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety.
- the sugar motif for the gapmers is (from 5’ to 3 ’): kkkddddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- the nucleobase sequences of SEQ ID NOs: 123, 695-697, 769-771, 843, 844, 919, 920, 992, 993, 1066, and 1067 are complementary within nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2.
- Compounds 541212, 1582863-1582873, and 1582875-1582877 are complementary within nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2 achieve at least 37% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3361-3400 of SEQ ID NO: 1 and/or nucleobases 588-627 of SEQ ID NO: 2 achieve an average of 70% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- modified oligonucleotides are 5-10-5 or 3-10-3 gapmers.
- the gapmers are MOE gapmers.
- the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3 ’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’- -D- deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety.
- the sugar motif for the gapmers is (from 5’ to 3 ’): kkkddddddddddkkk; wherein each “d” represents a 2’-P-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5 -methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 67, 141, 646-647, 720-721, 793-794, 870-871, 945, 947-948, and 1020-1021 are complementary within nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2.
- Compounds 541153, 541230, 1582550, 1582552-1582556, and 1582558-1582564 are complementary within nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2 achieve at least 27% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 3883-3926 of SEQ ID NO: 1 and/or nucleobases 1110-1153 of SEQ ID NO: 2 achieve an average of 71% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a 2’- -D- deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5- methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID NOs: 652, 726, 799, 876, 953, 1026, and 1079 are complementary within nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2.
- Compounds 1582589-1582594 and 1604080 are complementary within nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2 achieve at least 65% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4007-4029 of SEQ ID NO: 1 and/or nucleobases 1234-1256 of SEQ ID NO: 2 achieve an average of 82% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary within nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2.
- modified oligonucleotides are 16 nucleobases in length.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are gapmers.
- modified oligonucleotides are 5-10-5 or 3-10-3 gapmers.
- the gapmers are MOE gapmers.
- the gapmers are cEt gapmers.
- the sugar motif for the gapmers is (from 5’ to 3 ’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’-p-D- deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety.
- the sugar motif for the gapmers is (from 5’ to 3 ’): kkkddddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- Each cytosine residue is a 5 -methylcytosine.
- nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages.
- nucleobase sequences of SEQ ID Nos: 163, 658, 732, 883, 957, 1031, and 1105-1112 are complementary within nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2.
- Compounds 541256, 1582645-1582649, and 1604114-1604121 are complementary within nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2 achieve at least 63% reduction of DUX4 RNA in the standard in vitro RNase H assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 4667-4694 of SEQ ID NO: 1 and/or nucleobases 1532-1559 of SEQ ID NO: 2 achieve an average of 83% reduction of DUX4 RNA in the standard in vitro RNase H assay.
- nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2 are 18. Nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2
- nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides e.g., antisense RNAi oligonucleotides
- modified oligonucleotides are 23 nucleobases in length.
- modified oligonucleotides comprise one or more sugar modifications.
- modified oligonucleotides e.g., antisense RNAi oligonucleotides
- the sugar motif of the modified oligonucleotides is (from 5’ to 3’): yfyf fyfylyf fyfylyfyyyy, wherein each “y” represents a 2’- OMe sugar moiety and each “f ’ represents a 2’-F sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- the nucleosides of the modified oligonucleotides are linked by an intemucleoside linkage selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 1425 and 1424 are complementary within nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2.
- RNAi agents are complementary within nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2.
- modified oligonucleotides within nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182-211 of SEQ ID NO: 2 achieve at least 87% reduction of DUX4 RNA in the standard in vitro RNAi assay.
- modified oligonucleotides within nucleobases 2955-2984 of SEQ ID NO: 1 and/or nucleobases 182- 211 of SEQ ID NO: 2 achieve an average of 90% reduction of DUX4 RNA in the standard in vitro RNAi assay.
- nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2 are 19. Nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2
- nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides e.g., antisense RNAi oligonucleotides
- modified oligonucleotides are 23 nucleobases in length.
- modified oligonucleotides comprise one or more sugar modifications.
- modified oligonucleotides e.g., antisense RNAi oligonucleotides
- the sugar motif of the modified oligonucleotides is (from 5’ to 3’): yfylyfyfyfylyfylylyyy, wherein each “y” represents a 2’- OMe sugar moiety and each “f ’ represents a 2’-F sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- the nucleosides of the modified oligonucleotides are linked by an intemucleoside linkage selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 1214 and 1410 are complementary within nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2.
- RNAi agents are complementary within nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2.
- modified oligonucleotides within nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326-355 of SEQ ID NO: 2 achieve at least 63% reduction of DUX4 RNA in the standard in vitro RNAi assay.
- modified oligonucleotides within nucleobases 3099-3128 of SEQ ID NO: 1 and/or nucleobases 326- 355 of SEQ ID NO: 2 achieve an average of 77% reduction of DUX4 RNA in the standard in vitro RNAi assay.
- nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides e.g., antisense RNAi oligonucleotides
- modified oligonucleotides are 23 nucleobases in length.
- modified oligonucleotides comprise one or more sugar modifications.
- modified oligonucleotides e.g., antisense RNAi oligonucleotides
- the sugar motif of the modified oligonucleotides is (from 5’ to 3’): yfylyfyfyfylyfylyyyy, wherein each “y” represents a 2’- OMe sugar moiety and each “f ’ represents a 2’-F sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- the nucleosides of the modified oligonucleotides are linked by an intemucleoside linkage selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 1405, 1210, and 1209 are complementary within nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2.
- RNAi agents are complementary within nucleobases 3171- 3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2.
- modified oligonucleotides within nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398-436 of SEQ ID NO: 2 achieve at least 64% reduction of DUX4 RNA in the standard in vitro RNAi assay.
- modified oligonucleotides within nucleobases 3171-3209 of SEQ ID NO: 1 and/or nucleobases 398- 436 of SEQ ID NO: 2 achieve an average of 83% reduction of DUX4 RNA in the standard in vitro RNAi assay.
- nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides e.g., antisense RNAi oligonucleotides
- modified oligonucleotides are 23 nucleobases in length.
- modified oligonucleotides comprise one or more sugar modifications.
- modified oligonucleotides e.g., antisense RNAi oligonucleotides
- the sugar motif of the modified oligonucleotides is (from 5’ to 3’): yfyfyfyfyfyfyfyfyfyfyyyy, wherein each “y” represents a 2’- OMe sugar moiety and each “f ’ represents a 2’-F sugar moiety.
- Each cytosine residue is a 5-methylcytosine.
- the nucleosides of the modified oligonucleotides are linked by an intemucleoside linkage selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
- the nucleobase sequences of SEQ ID NOs: 1197 and 1335 are complementary within nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2.
- RNAi agents are complementary within nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2.
- modified oligonucleotides within nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086-1115 of SEQ ID NO: 2 achieve at least 60% reduction of DUX4 RNA in the standard in vitro RNAi assay.
- modified oligonucleotides within nucleobases 3859-3888 of SEQ ID NO: 1 and/or nucleobases 1086- 1115 of SEQ ID NO: 2 achieve an average of 70% reduction of DUX4 RNA in the standard in vitro RNAi assay.
- RNA nucleoside comprising a 2’ -OH sugar moiety and a thymine base
- nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
- an oligomeric compound having the nucleobase sequence “ ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5 -position.
- Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or 0 such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
- Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
- Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
- tautomeric forms of the compounds herein are also included unless otherwise indicated.
- compounds described herein are intended to include corresponding salt forms.
- the compounds described herein include variations in which one or more atoms are replaced with a nonradioactive isotope or radioactive isotope of the indicated element.
- compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1 H hydrogen atoms.
- Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 1 H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
- non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
- radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
- Example 1 Effect of 5-10-5 MOE uniform phospho rothioate modified oligonucleotides on human DUX4 RNA in vitro, single dose
- Modified oligonucleotides complementary to human DUX4 nucleic acid were designed and tested for their single dose effects on DUX4 RNA in vitro.
- the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
- the modified oligonucleotides in the table below are 5-10-5 MOE gapmers with uniform phosphorothioate intemucleoside linkages.
- the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2’-p-D-deoxynucleosides, and wherein the 5’ and 3’ wing segments each consist of five 2’-MOE nucleosides.
- the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeee; wherein each “d” represents a 2’-f-D- deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety.
- the intemucleoside linkage motif for the gapmers is (from 5’ to 3’): ssssssssssssssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage.
- Each cytosine residue is a 5-methylcytosine.
- “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
- Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (GENBANK AccessionNo. NC 000004.12, truncated from nucleotides 190171001 to 190187000), to SEQ ID NO: 2 (GENBANK Accession No. NM 001306068.2), to SEQ ID NO: 3 (GENBANK Accession No. FJ439133.1), or to any combination of these SEQ ID NOs.
- “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
- DUX4 RNA levels were measured by human primer-probe set RTS3502 (forward sequence CCCGGCTGACGTGCAA, designated herein as SEQ ID NO: 11; reverse sequence AGCCAGAATTTCACGGAAGAAC, designated herein as SEQ ID NO: 12; probe sequence
- DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DUX4 RNA is presented in the tables below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC). The values marked with an “f” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
- Modified oligonucleotides complementary to human DUX4 nucleic acid were designed and tested for their single dose effects on DUX4 RNA in vitro.
- the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
- the modified oligonucleotides in the tables below are 3-10-3 cEt gapmers with uniform phosphorothioate intemucleoside linkages.
- the gapmers are 16 nucleosides in length, wherein the central gap segment consists of ten 2’-p-D-deoxynucleosides, and wherein the 5’ and 3’ wing segments each consist of three cEt nucleosides.
- the sugar motif for the gapmers is (from 5’ to 3’): kkkddddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
- the intemucleoside linkage motif for the gapmers is (from 5’ to 3’): ssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage.
- Each cytosine residue is a 5-methylcytosine.
- “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
- Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), to SEQ ID NO: 3 (described herein above), or to any combination of these SEQ ID NOs.
- “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
- DUX4 RNA levels were measured by quantitative real-time RTPCR.
- DUX4 RNA levels were measured by human primer-probe set RTS3502 (described herein in Example 1).
- DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DUX4 RNA is presented in the tables below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC).
- the values marked with an “f” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
- Example 3 Dose-dependent inhibition of human DUX4 in 54-2 cells by modified oligonucleotides
- Modified oligonucleotides selected from the examples above were tested at various doses in 54-2 cells (described herein above).
- 54-2 cells plated at a density of 6,000 cells per well were differentiated (as described herein above) and treated using cytofectin with various concentrations of modified oligonucleotide as specified in the table below.
- total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR.
- Human DUX4 primer-probe setRTS3502 (described herein above) was used to measure RNA levels as described above.
- DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DUX4 RNA is presented in the table below as percent DUX4 RNA, relative to the amount of DUX4 RNA in untreated control cells (% UTC).
- IC50 half maximal inhibitory concentration
- Example 4 Dose-dependent inhibition of human DUX4 in 54-2 cells by modified oligonucleotides
- Modified oligonucleotides selected from the examples above were tested at various doses in 54-2 cells (described herein above).
- 54-2 cells plated at a density of 10,000 cells per well, were differentiated (as described herein above) and treated using cytofectin with various concentrations of modified oligonucleotide as specified in the tables below.
- total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR.
- Human DUX4 primer-probe set RTS3502 (described herein above) was used to measure RNA levels as described above.
- DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.
- DUX4 RNA Reduction of DUX4 RNA is presented in the tables below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC).
- the modified oligonucleotides were tested in a series of experiments that had the same culture conditions, and the results for each experiment are presented in separate tables below.
- IC50 half maximal inhibitoiy concentration
- a modified oligonucleotide complementary to a human DUX4 nucleic acid was designed, as described in the table below.
- the modified oligonucleotide in Table 10 is a 3-10-3 cEt gapmer conjugated to a 6-palmitamidohexyl conjugate moiety attached to the 5 ’-OH of the oligonucleotide through a phosphodiester linker.
- the structure for the conjugate group is:
- the gapmer is 16 nucleosides in length, wherein the central gap segment consists of ten 2’- ⁇ -D- deoxynucleosides and the 5’ and 3’ wings each consists of three cEt nucleosides.
- the sugar motif for the gapmer is (from 5’ to 3’): kkkdddddddddkkk; wherein ‘d’ represents a 2’- ⁇ -D-deoxyribosyl sugar moiety; and ‘k’ represents a cEt sugar moiety.
- Each intemucleoside linkages is a phosphorothioate intemucleoside linkage.
- Each cytosine residue is a 5-methylcytosine.
- “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
- the modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), and to SEQ ID NO: 2 (described herein above).
- Example 6 Activity of modified oligonucleotides complementary to human DUX4 in transgenic mice
- Transgenic mice expressing human DUX4 were used to test activity of modified oligonucleotides described above.
- the transgenic mouse model was developed using random integration of a linearized modified human DUX4 gene.
- the clone was digested at Asel and Xhol restriction sites to produce a region containing Mck (muscle specific) promoter driven human DUX4 transgene with a single amino acid mutation of F67A.
- the gene fragment was introduced into fertilized eggs from C57BL6NJ strain mice by pronuclear injection to produce 7 founder lines. Line 9111 was used in the experiments described herein. Human DUX4 RNA expression is found in the muscle in this model.
- Each animal in a group of 4 transgenic mice was administered 50 mg/kg of Compound No. 941806 by subcutaneous injection twice a week for a total of six injections.
- a group of 4 mice received PBS as a negative control.
- mice were sacrificed 72 hours after the final dose, and RNA was extracted from the quadriceps muscle, transverse abdominal muscle (TA), and gastrocnemius muscle for RTPCR analysis to measure amount of DUX4 RNA using human primer probe set RTS3502 (described herein above). Results are presented as percent human DUX4 RNA relative to PBS control, normalized to mouse GAPDH (% control).
- Mouse GAPDH RNA was amplified using mouse prime probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 14; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 15; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 16).
- Example 7 Effect of 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate internucleoside linkages on human DUX4 RNA in vitro, single dose
- Modified oligonucleotides complementary to human DUX4 nucleic acid were designed and tested for their single dose effects on human DUX4 RNA in vitro.
- the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
- the modified oligonucleotides in the table below are 3-10-3 cET modified oligonucleotides with uniform phosphorothioate intemucleoside linkages.
- the modified oligonucleotides are 16 nucleosides in length.
- the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a D-deoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety.
- the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3 ’): sssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage.
- Each cytosine residue is a 5-methylcytosine.
- Start site indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
- “Stop site” indicates the 3 ’ -most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
- Each modified oligonucleotide listed in the tables below is 100% complementary to one or more of the following SEQ ID NOs: SEQ ID NO: 1 (described hereinabove), to SEQ ID NO: 2 (describe hereinabove), to SEQ ID NO: 3 (described herein above). “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
- Human DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of human DUX4 RNA is presented in the tables below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC). The values marked with a “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. “N.D.” in the tables below refers to instances where the value was Not Defined.
- Example 8 Dose-dependent inhibition of human DUX4 in 54-2 cells by modified oligonucleotides
- Modified oligonucleotides selected from the example above were tested at various doses in 54-2 cells (described herein above).
- 54-2 cells plated at a density of 20,000 cells per well were differentiated (as described herein above) and treated using cytofectin with various concentrations of modified oligonucleotide as specified in the table below.
- total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR.
- Human DUX4 primer-probe set RTS40199 (described herein above) was used to measure RNA levels as described above.
- DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DUX4 RNA is presented in the table below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC).
- Example 9 Design of an RNAi compound that targets a human DUX4 nucleic acid
- RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human DUX4 nucleic acid, and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.
- “Start site” indicates the 5'-most nucleoside to which the antisense RNAi oligonucleotide is complementaiy in the human gene sequence. “Stop site” indicates the 3 '-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), and to SEQ ID NO: 2 (described herein above).
- the antisense RNAi oligonucleotide in the table below is 25 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5’ to 3’): rrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr. wherein each “r” represents a ribosyl sugar moiety.
- the intemucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5’ to 3 ’): oooooooooooooooooooooooo, wherein each “o” represents a phosphodiester intemucleoside linkage.
- the sense RNAi oligonucleotide in the table below is 25 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5’ to 3’): rrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr, wherein each “r” represents a ribosyl sugar moiety.
- the intemucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5’ to 3’): oooooooooooooooooooooooo, wherein each “o” represents a phosphodiester intemucleoside linkage.
- the sense RNAi oligonucleotide is 100% complementary to the antisense RNAi oligonucleotide (from 5’ to 3’).
- Example 10 Design of an RNAi compound that targets a human DUX4 nucleic acid
- RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human DUX4 nucleic acid, and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.
- “Start site” indicates the 5'-most nucleoside to which the antisense RNAi oligonucleotide is complementaiy in the human gene sequence. “Stop site” indicates the 3 '-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), and to SEQ ID NO: 2 (described herein above).
- the antisense RNAi oligonucleotide in the table below is 19 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5’ to 3’): rrrrrrrrrrrrrrrrrrrrrrrr, wherein each “r” represents a ribosyl sugar moiety.
- the intemucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5’ to 3’): oooooooooooooooooo, wherein each “o” represents a phosphodiester intemucleoside linkage.
- the sense RNAi oligonucleotide in the table below is 19 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5’ to 3’): rrrrrrrrrrrrrrrrrrrrrrrr, wherein each “r” represents a ribosyl sugar moiety.
- the intemucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5’ to 3’): oooooooooooooooooo, wherein each “o” represents a phosphodiester intemucleoside linkage.
- the sense RNAi oligonucleotide is 100% complementary to the antisense RNAi oligonucleotide (from 5’ to 3’).
- RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human DUX4 nucleic acid, and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.
- “Start site” indicates the 5'-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3 '-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. “N/A” indicates that the antisense RNAi oligonucleotide is not 100% complementary to that particular target nucleic acid sequence
- the antisense RNAi oligonucleotide in the table below is 23 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5’ to 3’ yfyfyfyfyfylyfyfyfylyyy, wherein each “y” represents a 2'- O-methylribosyl sugar moiety, and each “f” represents a 2'-fluororibosyl sugar moiety.
- the intemucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5 ’ to 3 ’ ssooooooooooooooooooss, wherein each “o” represents a phosphodiester intemucleoside linkage, and each “s” represents a phosphorothioate intemucleoside linkage.
- the sense RNAi oligonucleotide in the table below is 21 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5’ to 3’): fyfyfyfyfyfylyfyfyfyf, wherein each “y” represents a 2'-O- methylribosyl sugar moiety, and each “f ’ represents a 2 '-fluoro ribosyl sugar moiety.
- the intemucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5 ’ to 3 ’): ssooooooooooooooooss, wherein each “o” represents a phosphodiester intemucleoside linkage, and each “s” represents a phosphorothioate intemucleoside linkage.
- Each sense RNAi oligonucleotide is complementary to the first of the 21 nucleosides of the antisense RNAi oligonucleotide (from 5 ’ to 3 ’ ) wherein the last two 3 ’ -nucleosides of the antisense RNAi oligonucleotides are unpaired overhanging nucleosides.
- “Start site” indicates the 5'-most nucleoside to which the antisense RNAi oligonucleotide is complementaiy in the human gene sequence. “Stop site” indicates the 3 '-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence.
- the antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 4 (GENBANK Accession No. NM 001293798.2).
- Example 12 Design of an RNAi compound that targets a human DUX4 nucleic acid
- RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human DUX4 nucleic acid, and sense RNAi oligonucleotides complementaiy to the antisense RNAi oligonucleotides were designed as follows. “Start site” indicates the 5'-most nucleoside to which the antisense RNAi oligonucleotide is complementaiy in the human gene sequence. “Stop site” indicates the 3 '-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence.
- Each antisense RNAi oligonucleotide listed in the table below is complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both, with the exception of a single mismatch at position 1 (from 5’ to 3’) of the antisense RNAi oligonucleotide.
- N/A indicates that the modified oligonucleotide has two or more mismatches to that particular target nucleic acid sequence in the table below.
- the antisense RNAi oligonucleotide in the table below is 23 nucleosides in length; wherein the sugar motif for the antisense RNAi oligonucleotide is (from 5’ to 3’ yfylylyfyfylylyfylyyy, wherein each “y” represents a 2'- O-methylribosyl sugar moiety, and each “f” represents a 2'-fluororibosyl sugar moiety.
- the intemucleoside linkage motif for the antisense RNAi oligonucleotides is (from 5 ’ to 3 ’ ssooooooooooooooooooss, wherein each “o” represents a phosphodiester intemucleoside linkage, and each “s” represents a phosphorothioate intemucleoside linkage.
- “Start site” indicates the 5'-most nucleoside to which the antisense RNAi oligonucleotide is complementaiy in the human gene sequence. “Stop site” indicates the 3 '-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence.
- the antisense RNAi oligonucleotide listed in the table below is complementary to SEQ ID NO: 4 (GENBANK Accession No. NM 001293798.2), with the exception of a single mismatch at position 1 (from 5’ to 3’) of the antisense RNAi oligonucleotide.
- Example 13 Effect of RNAi compounds on human DUX4 RNA in vitro, single dose
- RNAi compounds described herein above were tested in 54-2 cells (Resnick et al., 2019, Cell Reports 29, 1812-1820). The RNAi compounds were tested in a series of experiments that had the same culture conditions.
- RNAi compounds were differentiated as described herein above and transfected with RNAi compounds at a concentration of 200 nM using Lipofectin. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and DUX4 RNA levels were measured by quantitative real-time RTPCR.
- DUX4 RNA was measured by primer probe set RTS40199 (described herein above). DUX4 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. The level of DUX4 RNA is presented in the tables below as percent DUX4 RNA relative to the amount of DUX4 RNA in untreated control cells (% UTC). Each table represents results from an individual assay plate. The values marked with a “f” indicate that the RNAi compound is complementary to the amplicon region of the primer probe set.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Epidemiology (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Neurology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Saccharide Compounds (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP22743253.1A EP4281084A4 (en) | 2021-01-22 | 2022-01-21 | Compounds and methods for reducing Dux4 expression |
| US18/262,438 US20240336915A1 (en) | 2021-01-22 | 2022-01-21 | Compounds and methods for reducing dux4 expression |
| JP2023544331A JP2024504377A (ja) | 2021-01-22 | 2022-01-21 | Dux4の発現を低減するための化合物及び方法 |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163140674P | 2021-01-22 | 2021-01-22 | |
| US63/140,674 | 2021-01-22 | ||
| US202163217624P | 2021-07-01 | 2021-07-01 | |
| US63/217,624 | 2021-07-01 | ||
| US202163231559P | 2021-08-10 | 2021-08-10 | |
| US63/231,559 | 2021-08-10 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022159712A1 true WO2022159712A1 (en) | 2022-07-28 |
Family
ID=82549881
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2022/013323 Ceased WO2022159712A1 (en) | 2021-01-22 | 2022-01-21 | Compounds and methods for reducing dux4 expression |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20240336915A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4281084A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2024504377A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2022159712A1 (cg-RX-API-DMAC7.html) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11518816B2 (en) | 2018-08-02 | 2022-12-06 | Dyne Therapeutics, Inc. | Methods of delivering an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy |
| WO2023288289A3 (en) * | 2021-07-14 | 2023-04-13 | Mirecule, Inc. | Oligonucleotides and compositions thereof for neuromuscular disorders |
| US11638761B2 (en) | 2021-07-09 | 2023-05-02 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy |
| US11969475B2 (en) | 2021-07-09 | 2024-04-30 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| WO2024064854A3 (en) * | 2022-09-23 | 2024-05-23 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing mecp2 expression |
| US12152052B2 (en) | 2022-09-23 | 2024-11-26 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing MECP2 expression |
| US12428487B2 (en) | 2018-08-02 | 2025-09-30 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonicleotide and method of delivering oligonucleotide to a subject |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140322169A1 (en) * | 2011-07-25 | 2014-10-30 | Nationwide Children's Hospital, Inc. | Recombinant Virus Products and Methods for Inhibition of Expression of DUX4 |
| US20180273942A1 (en) * | 2015-01-16 | 2018-09-27 | Ionis Pharmaceuticals, Inc. | Compounds and methods for modulation of dux4 |
| WO2020172559A1 (en) * | 2019-02-22 | 2020-08-27 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing atxn3 expression |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2596977T3 (es) * | 2010-09-02 | 2017-01-13 | Université de Mons | Agentes útiles en el tratamiento de la distrofia muscular facioescapulohumeral |
| US20180237775A1 (en) * | 2015-09-21 | 2018-08-23 | Association Institut De Myologie | Antisense oligonucleotides and uses thereof |
| WO2019060432A2 (en) * | 2017-09-19 | 2019-03-28 | Children's National Medical Center | GAPMERS AND METHODS OF USING THE SAME FOR THE TREATMENT OF MUSCLE DYSTROPHY |
| WO2019157531A1 (en) * | 2018-02-12 | 2019-08-15 | Ionis Pharmaceuticals, Inc. | Modified compounds and uses thereof |
| WO2020203880A1 (ja) * | 2019-03-29 | 2020-10-08 | 田辺三菱製薬株式会社 | Dux4の発現を調節するための化合物、方法及び医薬組成物 |
-
2022
- 2022-01-21 US US18/262,438 patent/US20240336915A1/en active Pending
- 2022-01-21 EP EP22743253.1A patent/EP4281084A4/en active Pending
- 2022-01-21 JP JP2023544331A patent/JP2024504377A/ja active Pending
- 2022-01-21 WO PCT/US2022/013323 patent/WO2022159712A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140322169A1 (en) * | 2011-07-25 | 2014-10-30 | Nationwide Children's Hospital, Inc. | Recombinant Virus Products and Methods for Inhibition of Expression of DUX4 |
| US20180273942A1 (en) * | 2015-01-16 | 2018-09-27 | Ionis Pharmaceuticals, Inc. | Compounds and methods for modulation of dux4 |
| WO2020172559A1 (en) * | 2019-02-22 | 2020-08-27 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing atxn3 expression |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP4281084A4 * |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11518816B2 (en) | 2018-08-02 | 2022-12-06 | Dyne Therapeutics, Inc. | Methods of delivering an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy |
| US12428487B2 (en) | 2018-08-02 | 2025-09-30 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonicleotide and method of delivering oligonucleotide to a subject |
| US12325753B2 (en) | 2018-08-02 | 2025-06-10 | Dyne Therapeutics, Inc. | Method of using an anti-transferrin receptor antibody to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy |
| US12173079B2 (en) | 2018-08-02 | 2024-12-24 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US12012460B2 (en) | 2018-08-02 | 2024-06-18 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US11787869B2 (en) | 2018-08-02 | 2023-10-17 | Dyne Therapeutics, Inc. | Methods of using muscle targeting complexes to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy or a disease associated with muscle weakness |
| US11795234B2 (en) | 2018-08-02 | 2023-10-24 | Dyne Therapeutics, Inc. | Methods of producing muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US11795233B2 (en) | 2018-08-02 | 2023-10-24 | Dyne Therapeutics, Inc. | Muscle-targeting complex comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US11844843B2 (en) | 2021-07-09 | 2023-12-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US11969475B2 (en) | 2021-07-09 | 2024-04-30 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US11759525B1 (en) | 2021-07-09 | 2023-09-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US11679161B2 (en) | 2021-07-09 | 2023-06-20 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US11638761B2 (en) | 2021-07-09 | 2023-05-02 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy |
| WO2023288289A3 (en) * | 2021-07-14 | 2023-04-13 | Mirecule, Inc. | Oligonucleotides and compositions thereof for neuromuscular disorders |
| WO2024064854A3 (en) * | 2022-09-23 | 2024-05-23 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing mecp2 expression |
| US12152052B2 (en) | 2022-09-23 | 2024-11-26 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing MECP2 expression |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4281084A4 (en) | 2025-05-21 |
| EP4281084A1 (en) | 2023-11-29 |
| JP2024504377A (ja) | 2024-01-31 |
| US20240336915A1 (en) | 2024-10-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP4341406A2 (en) | Compounds for modulating unc13a expression | |
| WO2022159712A1 (en) | Compounds and methods for reducing dux4 expression | |
| WO2020160163A1 (en) | Compounds and methods for reducing app expression | |
| US20220031731A1 (en) | Compositions and methods for modulation of lmna expression | |
| EP4189090A1 (en) | Compounds and methods for reducing app expression | |
| IL300258A (en) | Compounds and methods for modulating SCN2A | |
| EP4433591A1 (en) | Compounds and methods for modulating progranulin expression | |
| EP4284504A1 (en) | Compounds and methods for modulating huntingtin | |
| WO2020132558A1 (en) | Compounds and methods for reducing pmp22 expression | |
| US20240279654A1 (en) | Compounds for reducing ptbp1 expression | |
| WO2022066956A1 (en) | Compounds and methods for reducing apoe expression | |
| EP4590308A2 (en) | Compounds and methods for reducing mecp2 expression | |
| WO2024173783A2 (en) | Allele-selective compounds and methods for modulating huntingtin expression | |
| IL322701A (en) | Compounds and methods for regulating alpha-synuclein expression | |
| WO2023164656A2 (en) | Compounds and methods for modulating atn1 expression | |
| WO2023215863A2 (en) | Rnai agents for modulating snca | |
| EP4222261A1 (en) | Compounds for modulating chmp7 | |
| AU2022377400A1 (en) | Compounds and methods for reducing psd3 expression | |
| US20250340874A1 (en) | Compounds and methods for reducing pcdh19 expression | |
| WO2021102341A2 (en) | Compounds for modulating beta globin expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22743253 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023544331 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022743253 Country of ref document: EP Effective date: 20230822 |