WO2022151352A1 - Hppd mutant protein having herbicide resistance and application thereof - Google Patents

Abstract

Disclosed are a mutant HPPD protein and a nucleic acid or gene encoding the protein or a fragment. The HPPD protein or a biologically active fragment thereof retains or enhances the property of catalyzing conversion of a 4-hydroxyphenylpyruvic acid (4-HPPA) to a homogentisic acid, and is significantly less sensitive to an HPPD inhibitor than a wild-type HPPD. The present invention further relates to a method for obtaining a plant comprising expression vectors and host cells and having reduced sensitivity to HPPD inhibitor herbicides. The mutant protein having a single point mutation or multiple point mutations obtained in the present invention can tolerate four HPPD inhibitor herbicides such as mesotrione, topramezone, isoxaflutole, and tembotrione in Escherichia coli. The transgenic rice having a single point mutation or multiple point mutations in the present invention can tolerate four HPPD inhibitor herbicides such as mesotrione, topramezone, isoxaflutole, and tembotrione.

Description

HPPD mutant protein with herbicide resistance and its application technical field

The invention belongs to the field of plant protein and plant herbicide resistance, and relates to HPPD mutant gene and protein with herbicide resistance and application thereof; in particular, the invention relates to p-hydroxyphenylpyruvate dioxygenase (HPPD) of rice The mutant gene and the mutant HPPD protein it encodes can confer resistance to p-hydroxyphenylpyruvate dioxygenase inhibitor herbicides in plants, especially rice. The invention discloses the nucleotide sequence and amino acid sequence of the mutant protein and their application in the field of plant herbicide resistance.

Background technique

Farmland weeds compete with crops for resources such as living space, light, water and nutrients, and may become intermediate hosts of pests and diseases, seriously disturbing crop growth and causing yield reduction. Traditional manual weeding is labor-intensive, time-consuming and inefficient; mechanical weeding is usually not thorough, and excessive and unreasonable tillage can easily cause soil erosion, nutrient loss, excessive energy consumption, and greenhouse gas emissions. Spraying herbicides for weed control is simple, effective and efficient, and has gradually become the most economical and effective means of controlling weeds in farmland. However, the continuous use of herbicides with a single target of action for many years has resulted in serious drug resistance of many weeds and become malignant weeds. In addition, herbicides such as sulfonylureas have a long residual effect period in the soil, which has a greater impact on the next crop, and may also infiltrate with water, causing environmental pollution.

In the 1990s, 4-hydroxyphenylpyruvate dioxygenase (HPPD) was first identified as the target of herbicides. Since then, a series of HPPD inhibitor herbicides have been developed successively, including isoxazoles, Diketone nitriles, triketones, pyrazole salts, etc. HPPD is a key enzyme in the synthesis pathway of plastid and tocopherol. Plastid Kun is an electron acceptor for the reaction of phytoene desaturase, a key enzyme in the carotenoid synthesis pathway, and an electron acceptor for photosynthetic system II. Both plastidol and tocopherol are important antioxidants that can scavenge reactive oxygen radicals in plant tissues. Inhibiting the activity of HPPD will result in the lack of plastid and tocopherol, affecting the synthesis and photosynthesis of carotenoids, resulting in plant albino death. HPPD inhibitor herbicides can be used as rotation agents and compound agents of ALS inhibitors, amides, synthetic hormones and other herbicides to control malignant weeds in farmland. HPPD inhibitor herbicides generally have the advantages of high efficiency and low toxicity, not easy to produce resistance, good environmental compatibility, and safe for subsequent crops.

Plant resistance to herbicides mainly relies on two mechanisms: target resistance and non-target resistance. Target resistance refers to changes in the target gene or its encoded protein of a herbicide, resulting in plants being able to resist or tolerate a certain concentration of herbicide. The most common form of target resistance is the change in the coding sequence of the herbicide target gene, resulting in the mutation of one or some amino acids of the target protein, which makes the herbicide unable to bind the target protein, but the normal physiological function of the protein is not affected. influences. For example, gene shuffling (DNA family shuffling) between the HPPD-encoding gene of maize and the HPPD-encoding gene of bacteria with resistance or tolerance to HPPD inhibitor herbicides, to obtain mutant maize HPPD with 18 point mutations gene, overexpression of this mutant corn HPPD protein in soybean, conferred resistance to various triketone herbicides in soybean (Siehl et al, 2014). The DNA shuffling method causes mutations at multiple sites, which may change the overall conformation of HPPD; for another example, the HPPD protein sequences of various plants are compared with the HPPD of bacteria that are resistant or tolerant to HPPD inhibitor herbicides. Sequence alignment of the protein, and then single-point and multi-point mutation of the plant HPPD encoding gene, and the mutated plant HPPD protein is transferred into the corresponding plants, which can confer resistance or tolerance to the HPPD inhibitor herbicides in the transgenic plants Another study reported that the direct transfer of the HPPD gene of Pseudomonas fluorescens into the chloroplasts of soybean and tobacco can also improve the resistance of plants to mesotrione (Dufourmantel et al., 2009). In addition, the target protein sequence of the herbicide does not change, but increases the copy number or expression level of the target gene of the herbicide in the plant, produces an excess of wild-type HPPD protein, and can also make the plant tolerant to a certain level of HPPD inhibitor herbicides .

Non-target resistance means that the target protein sequence, gene copy number and expression level have not changed, but due to the less absorption of herbicides by plants, the transfer is slow; or the herbicides entering the body are degraded, modified or passivated, making the herbicide unable to Inhibits the activity of the target protein. At present, research on non-target resistance to HPPD inhibitor herbicides mainly focuses on maize and weeds. A class of HPPD inhibitor herbicides that are widely used at present, mesotrione is mainly used as a herbicide in corn fields. Corn is tolerant to mesotrione and can withstand a certain concentration of mesotrione before and after seedling. oxalone, while the normal growth of maize was not significantly affected. It has been reported that the absorption of mesotrione in maize is relatively slow and the metabolism of mesotrione is relatively fast compared with that of mesotrione-sensitive plants (Mitchell et al., 2001). Another study identified a mesotrione-insensitive weed Amaranthus population (Hausman et al., 2011; Ma et al., 2013), and compared with the sensitive population, the mesotrione-resistant population The absorption rate was not significantly different from that of the sensitive group, even slightly higher than that of the sensitive group, but the half-degradation time (DT50) was significantly shorter than that of the sensitive group. After 24 hours of exposure to ketone, the content of mesotrione in the resistant population was significantly lower than that in the sensitive population (Ma et al., 2013). After the application of malathion or Tetcyclacis in Amaranthus, the mesotrione-insensitive populations became more sensitive to mesotrione, indicating that the mesotrione-insensitive Amaranth might be The ability to metabolize herbicides is stronger (Ma et al., 2013).

To create herbicide-resistant or tolerant crop varieties, transgenic technology has been widely used. However, the safety of genetically modified crops is still controversial on a global scale, and countries have different attitudes towards the commercialization of genetically modified crops. At present, due to the influence of policy and the restriction of the registration cost of genetically modified crops, the application and promotion of genetically modified herbicides have great resistance. The recently developed gene editing technology represented by the CRISPR system is expected to improve the above dilemma. Through CRISPR/Cas9, CRISPR/Cpf1 and other systems-mediated gene site-directed mutagenesis and homologous recombination, plant endogenous herbicide target genes can be modified to confer resistance or tolerance to herbicides in plants. The successful examples reported so far focus on the creation of acetolactate synthase (ALS) inhibitors, acetyl-CoA carboxylase (ACCase) inhibitors, and the creation of plants that are resistant and tolerant to herbicides such as glyphosate. Considering the huge application prospects of HPPD inhibitor herbicides and the lack of non-transgenic HPPD inhibitor herbicides resistant and tolerant plant germplasm, it is necessary for scientists to continuously study to improve the resistance and tolerance of crops to this class of herbicides. Receptive method. Rice is the most important food crop in the world, and its wild-type varieties are sensitive to most HPPD inhibitor herbicides.

Previously, there has been no literature report that single-point or multiple-point mutation of the endogenous HPPD-encoding gene in rice can confer resistance to multiple HPPD inhibitor herbicides in rice at the same time.

SUMMARY OF THE INVENTION

Purpose of the invention: The technical problem to be solved by the present invention is to provide a mutant protein that can confer resistance to herbicides in plants. Further, the technical problem to be solved by the present invention is to provide a rice HPPD mutant protein that can confer resistance (resistance) to p-hydroxyphenylpyruvate dioxygenase inhibitor herbicides in plants.

The technical problem to be solved by the present invention is to provide a mutant gene that can impart herbicide resistance to plants. Further, the technical problem to be solved by the present invention is to provide a rice HPPD mutant gene that can confer resistance (resistance) to p-hydroxyphenylpyruvate dioxygenase inhibitor herbicides in plants.

The technical problem to be solved by the present invention is to provide an expression cassette, a recombinant vector or a cell.

The technical problem to be solved by the present invention is to provide the application of rice HPPD mutant protein, said nucleic acid or gene, said expression cassette, recombinant vector or cell in plant herbicide resistance.

The technical problem to be solved by the present invention is to provide a method for obtaining herbicide-resistant plant cells, plant tissues, plant parts or plants.

The technical problem to be solved by the present invention is to provide a method for identifying plants.

The technical problem to be solved by the present invention is to provide a method for controlling weeds.

The final technical problem to be solved by the present invention is to provide a method for protecting plants from damage caused by herbicides.

Technical solution: In order to solve the above technical problems, the present invention provides a rice HPPD mutant protein, the amino acid sequence of the rice HPPD mutant protein has any one or more of the following mutations: it corresponds to the amino acid of wild-type rice HPPD Sequence 29, 52, 54, 68, 92, 99, 117, 120, 132, 133, 146, 156, 206, 216, 237, 238, 244, 266, 270, 273, 277, 282, 295, 297 , 310, 313, 315, 316, 325, 333, 336, 338, 344, 345, 346, 349, 357, 388, 392, 404, 406, 408, 415 and 423 amino acids were mutated; From proline to valine, from proline to serine at position 336, from aspartic acid to lysine or isoleucine or threonine at position 338, and from arginine at position 346 Mutation to leucine, from methionine to isoleucine at position 392, and from glycine to alanine or asparagine or serine at position 415.

Wherein, the amino acid sequence of the rice HPPD mutant protein corresponds to the amino acid sequence of wild-type rice HPPD and has one or more mutant forms selected from the following: V29A, V52I, L54F, F68S, L92I, P99L, T117I, S120A 、F132S、A133T、R146L、A156V、E206Q、E206V、Y216C、Y237N、I238T、F244L、V266A、N270D、T273S、P277V、V282E、L295Q、H297R、S310C、S310V、S310A、S310G、S310T、V313M、V313I、V313L 、G315A、G315S、G315R、T316K、A325D、A333P、P336S、N338K、N338I、N338T、R344K、R345L、R345Q、R346L、D349G、N357S、F388L、M392I、S404G、S404L、S404T、Q406R、Y408H、G415A、G415N , G415S and E423G.

Wherein, described rice HPPD mutant protein, it comprises:

(a) its amino acid sequence is selected from SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO: 50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:72, SEQ ID NO:74, SEQ ID NO:76, SEQ ID NO:78, SEQ ID NO:80, SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, any one of SEQ ID NO: 118, SEQ ID NO: 120 or SEQ ID NO: 122; or

(b) A protein derived from (a) having the amino acid sequence in (a) substituted and/or deleted and/or added with one or more amino acids and having p-hydroxyphenylpyruvate dioxygenase activity.

Wherein, the amino acid sequence of the mutant HPPD protein has any one of the following amino acid mutations: R345Q/R346L, Y216C/R345Q, P336S/R346L, V29A/R346L, L295Q/S310V, V29A/S310C, S310C/G415A, S310C/G415N, L295Q/R345Q, L295Q/S310C, L54F/R345Q, L54F/R346L, S120A/S310C, F68S/S310C, V266A/S310C, V266A/R345Q, S310C/M392I, S310C/R34 M392I, S310C/V313I, Y216C/P277V/R345Q, Y216C/P336S/R345Q, Y216C/R345Q/R346L, V29A/Y216C/R345Q, Y216C/R345Q/G415A, Y216C/R345Q/VC230/V3G/I92 Y216C/R345Q, Y216C/R345Q/F388L, P336S/R345Q/R346L, L295Q/S310C/G415A, L54F/L295Q/S310C, S120A/L295Q/S310C, L295Q/S310C/F388L, L55Q/L92RI9 R345Q、L295Q/S310C/R345Q、L54F/S310C/G415A、L92I/S310C/G415A、V266A/S310C/G415A、S310C/V313I/G415A、 L54F/P336S/R346L V29A/S310C/V313I, L54F/S310C/V313I, I238T/S310C/V313I, L54F/Y216C/R345Q, V29A/Y216C/P336S/R345Q, Y216C/P336S/R345Q/R346L, V52I/Y216C/Y216YC P336S/R345Q/E423G, Y216C/S310C/R345Q/G415A, L54F/Y216C/S310C/R345Q, Y216C/P277V/S310C/R345Q, V52I/Y216C/S310C/R345Q, Y216C/S310C/R34CL/F36C/R34 R 345Q/R346L, V29A/L295Q/S310C/G415A, V52I/L295Q/S310C/G415A, L54F/L295Q/S310C/G415A, L295Q/S310C/M392I/G415A, Y216C/S310C/P336S/R34 S310C/P336S/R345Q and V52I/Y216C/S310C/P336S/R345Q.

Wherein, the amino acid sequence of the mutant HPPD protein has any one of the following amino acid sequences: SEQ ID NO: 124, SEQ ID NO: 136, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, SEQ ID NO:178, SEQ ID NO:180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO:200, SEQ ID NO:202, SEQ ID NO:204, SEQ ID NO:206, SEQ ID NO:208, SEQ ID NO:210, SEQ ID NO:212, SEQ ID NO:214, SEQ ID NO:216, SEQ ID NO:218, SEQ ID NO:220, SEQ ID NO:222, SEQ ID NO:224, SEQ ID NO:226, SEQ ID NO:228, SEQ ID NO:230, SEQ ID NO: 232, SEQ ID NO:234, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:240, SEQ ID NO:242, SEQ ID NO:244, SEQ ID NO:246, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:252 or SEQ ID NO:254.

The content of the present invention also includes a nucleic acid or gene, specifically including:

(i) it encodes a protein of any one of the above mutant HPPDs; or

(ii) a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence of a nucleic acid or gene as defined in (i) and encodes a protein having p-hydroxyphenylpyruvate dioxygenase activity; or

(iii) its nucleotide sequence is selected from SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO: 15. SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO: 65, SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, SEQ ID NO:111, SEQ ID NO:113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO :167, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:181, SEQ ID NO:183 , SEQ ID NO:185, SEQ ID NO:187, SEQ ID NO:189, SEQ ID NO:191, SEQ ID NO:193, SEQ ID NO:195, SEQ ID NO:197, SEQ ID NO:199, SEQ ID NO:199 ID NO:201, SEQ ID NO:203, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:209, SEQ ID NO:211, SEQ ID NO:213, SEQ ID NO:215, SEQ ID NO :217, SEQ ID NO:219, SEQ ID NO:221, SEQ ID NO:223, SEQ ID NO:225, SEQ ID NO:227, SEQ ID NO:229, SEQ ID NO:231, SEQ ID NO:233 , SEQ ID NO:235, SEQ ID NO:237, SEQ ID NO:239, SEQ ID NO:241, SEQ ID NO:243, SEQ ID NO:245, SEQ ID NO:247, SEQ ID NO:249, SEQ ID NO:249 Any one of the nucleotide sequence shown in ID NO: 251 or SEQ ID NO: 253 or its complement.

Specifically, the content of the present invention also includes that the nucleotide sequence of the rice HPPD mutant gene has any one or more of the following mutations: the 86th nucleotide corresponding to the amino acid sequence of wild-type rice HPPD is mutated from T to C, the 154th nucleotide is mutated from G to A, the 160th nucleotide is mutated from C to T, the 203rd nucleotide is mutated from T to C, the 274th nucleotide is mutated from C to A, The 297th nucleotide is mutated from C to G, the 350th nucleotide is mutated from C to T, the 358th nucleotide is mutated from T to G, the 395th nucleotide is mutated from T to C, and the 397th nucleotide is mutated from T to G. The nucleotide at position 437 is mutated from G to A, the nucleotide at position 437 is mutated from G to T, the nucleotide at position 467 is mutated from C to T, the nucleotide at position 616 is mutated from G to C, and the nucleotide at position 617 is mutated from G to C. The nucleotide is mutated from A to T, the 647th nucleotide is mutated from A to G, the 709th nucleotide is mutated from T to A, the 713th nucleotide is mutated from T to C, and the 730th nucleotide Mutation from T to C, nucleotide 797 from T to C, nucleotide 808 from A to G, nucleotide 817 from A to T, nucleotide 829 from C Mutation is G, nucleotide 830 is mutated from C to T, nucleotide 831 is mutated from G to T, nucleotide 845 is mutated from T to A, and nucleotide 884 is mutated from T to A, nucleotide 890 is mutated from A to G, nucleotide 928 is mutated from A to T or G, nucleotide 929 is mutated from G to T or C, nucleotide 930 is mutated from C Mutation to T, Nucleotide 937 from G to A or C, Nucleotide 939 from G to T, Nucleotide 943 from G to A or T, Nucleotide 944 Mutation from G to C, Nucleotide 945 from G to T, Nucleotide 947 from C to A, Nucleotide 974 from C to A, Nucleotide 997 from G Mutation to C, nucleotide 1006 is mutated from C to A, nucleotide 1007 is mutated from C to G, nucleotide 1008 is mutated from G to T, nucleotide 1013 is mutated from A to T or C, nucleotide 1014 is mutated from C to A, nucleotide 1030 is mutated from C to A, nucleotide 1031 is mutated from G to A, and nucleotide 1034 is mutated from G to A or T, nucleotide 1037 is mutated from G to T, nucleotide 1046 is mutated from A to G, nucleotide 1070 is mutated from A to G, and nucleotide 1164 is mutated from T to A, nucleotide 1176 is mutated from G to A, nucleotide 1210 is mutated from A to G or C, nucleotide 1211 is mutated from G to C or T, nucleotide 1216 is mutated from C Mutation to A, nucleotide 1217 from A to G, nucleotide 1222 from T to C, nucleotide 1243 from G to A or T, nucleotide 1244 from G Mutation to C or A, nucleotide 1245 from G to C, nucleotide 1268 from A mutated to G.

The content of the present invention also includes an expression cassette, recombinant vector or cell containing the nucleic acid or gene.

Vectors suitable for use in the present invention include commercially available plasmids, including but not limited to: pBR322, pKK223-3, GEM1pD10, psiX174Bluescript II KS, pNH8A, pNH16A, pNH18A, pNH46A, ptrc99a, pDR540, pRIT5, pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG, pSVK3, pBPV, pMSG and pSVL etc.

The content of the present invention also includes the application of the rice HPPD mutant protein, the nucleic acid or the gene, the expression cassette, the recombinant vector or the cell in the aspect of plant herbicide resistance.

Wherein, the herbicides are HPPD inhibitor herbicides, including triketones, pyrazolones and isoxazolones, preferably, the herbicides are mesotrione, oxaflutole, isoxazone One or more of caroxazone and cyclosulfonone.

The present invention also includes a method for obtaining herbicide-resistant plant cells, plant tissues, plant parts or plants, comprising the steps of:

1) causing the plant to comprise the nucleic acid or gene; or

2) making the plant express the rice HPPD mutant protein;

3) by the method of mutation, obtain the nucleic acid or gene, or the mutant rice HPPD protein or its biologically active fragment; or

(4) Gene editing of plant cells, plant tissues, plant parts or endogenous HPPD genes of plants to express any one of the mutant rice HPPD proteins therein.

Wherein, the method of mutation includes the method of directed mutation, specifically through gene site-directed mutagenesis, error-prone PCR, gene editing (including methods mediated by CRISPR, TALEN, zinc finger enzymes, etc.) and the like.

Wherein, the method includes error-prone PCR, gene editing (including methods mediated by CRISPR, TALEN, zinc finger enzymes, etc.), transgenic, hybridization, backcrossing or asexual reproduction steps.

The present invention also includes a method for identifying a plant, wherein the plant is a plant comprising the nucleic acid or gene, a plant expressing any of the proteins described, or a plant obtained by any of the methods, including the following step:

1) determining whether the plant contains the nucleic acid or gene; or

2) Determine whether the plant expresses the protein.

The content of the present invention also includes a method for controlling weeds, comprising: applying an effective dose of a herbicide to a field where crops are grown, the crops comprising the nucleic acid or gene or the expression cassette, recombinant vector or cell, the The herbicides include triketones, pyrazolones and isoxazolones. Preferably, the herbicides are one of mesotrione, oxaflutole, isoxaflutole, and cyclosulfonone or more.

The present invention also includes a method for protecting plants from herbicide-induced damage, comprising: applying an effective dose of the herbicide to a field in which a crop is grown, the crop comprising the nucleic acid or gene or the The expression cassette and recombinant vector are introduced into plants, and the introduced plants produce herbicide-resistant proteins, and the herbicides include triketones, pyrazolones and isoxazolones. Preferably, the herbicide is nitrosulfan One or more of oxaflutole, oxaflutole, isoxaflutole, and cyclosulfonone.

The plants described in the present invention are food crops and economic crops, including rice, wheat, rape and the like.

Beneficial effect: Compared with the prior art, the present invention has the following advantages:

1) The present invention uses the improved error-prone PCR technology to carry out large-scale random mutation of the HPPD encoding gene of wild-type rice, and screened out a number of new mutations in Escherichia coli that can improve the resistance of Escherichia coli to HPPD inhibitor herbicides Combined with transgenic technology, it was determined that some mutation sites can improve the resistance of rice to mesotrione, isoxaflutole, oxaflutole and cyclosulfonone. The invention expands the range of mutation sites of the rice HPPD gene resistant to HPPD inhibitor herbicides, and provides more flexible and diverse choices for cultivating rice varieties resistant to HPPD inhibitor herbicides; at the same time, the mutation identified by the invention The transgenic plants of the type rice HPPD gene can tolerate certain concentrations of mesotrione, isoxaflutole, and oxaflutole, which expands the range of HPPD inhibitor herbicides that can be selected in rice. Combined with the advantages of gene editing technology, it is of great significance to identify new mutant rice HPPD proteins that confer resistance or tolerance to HPPD inhibitor herbicides in plants.

2) The random mutation of the rice HPPD gene cannot be efficiently performed using a commercially available error-prone PCR kit. The present invention optimizes error-prone PCR components and reaction conditions through a large number of preliminary experiments, and finally controls the mutation rate more accurately within the range of 1-2 bases. This method may provide technical reference for site-directed mutation of other genes. Systematically mutated the wild-type HPPD protein in rice by an optimized error-prone PCR method combined with saturation mutation and tested for resistance or tolerance in E. coli, and obtained a series of HPPD inhibitor herbicides. New mutant proteins. In addition, the present invention uses a variety of HPPD inhibitor herbicides to identify the resistance of transgenic rice expressing mutant HPPD gene, and it is found that some transgenic lines can tolerate mesotrione, oxaflutole and isoxaflutole , cyclosulfonone and other four herbicides, expanding the types of HPPD inhibitor herbicides that can be selected for rice, which has a very broad application prospect for cultivating HPPD inhibitor herbicide-resistant or tolerant plants.

3) The single-point mutation or multi-point mutation mutant protein obtained by the present invention can tolerate HPPD inhibition of up to 300 μM mesotrione, 1000 μM oxaflutole, 800 μM isoxaflutole, etc. in Escherichia coli herbicides. The transgenic rice containing single point or multiple point mutation of the present invention can tolerate up to 12g a.i./mu of mesotrione, 3g a.i./mu of oxaflutole, 12g a.i./mu of isoxaflutole and 3g a.i./mu of mesotrione Mu's cyclosulfonone and other four HPPD inhibitor herbicides.

Description of drawings

Figure 1. Agarose gel electrophoresis results of error-prone PCR pre-experiment.

Figure 2. E. coli expressing wild-type (WT) or partially tolerated single-point mutant rice HPPD gene at the screening concentration of 0-20 μM mesotrione in 48 cells containing culture medium Color reaction in well plate. Under the culture conditions containing the same concentration of herbicides, the darker the color indicates the higher resistance or tolerance of the corresponding mutant HPPD protein to mesotrione. Under the condition of 10 μM mesotrione, the vast majority of mutant HPPD still developed significantly deeper color than wild type HPPD. Among them, including V52I, L54F, T117I, S120A, F132S, Y216C, Y237N, L295Q, H297R, S310A, S310C, S310V, V313I, G315S, G315R, T316K, A333P, P336S, R344K, R345Q, R9346, ML398I, R9346 The wells corresponding to the mutant HPPD of E423G developed the darkest color, indicating that it had the best mesotrione tolerance in E. coli.

Figure 3. Shows the color development of E. coli expressing wild-type (WT) or two-point combination mutant rice HPPD gene in a 48-well plate containing culture medium at the screening concentration of 0-40 μM mesotrione reaction. Under the culture conditions containing the same concentration of herbicides, the darker the color indicates the higher resistance or tolerance of the corresponding mutant HPPD protein to mesotrione. Among them, there are wells corresponding to mutant HPPD of Y216C/R345Q, P336S/R346L, S310C/G415A, L295Q/S310C, L54F/R345Q, S120A/S310C, F68S/S310C, S310C/M392I, S310C/R345Q and S310C/V313I The darkest color indicates that it has the best tolerance to mesotrione in E. coli.

Figure 4. Shows the color development of E. coli expressing wild-type (WT) and three-point combination mutant rice HPPD gene in a 48-well plate containing culture medium at the screening concentration of 0-100 μM mesotrione reaction. Under the culture conditions containing the same concentration of herbicides, the darker the color indicates the higher resistance or tolerance of the corresponding mutant HPPD protein to mesotrione. Among them, the wells corresponding to mutant HPPD containing Y216C/R345Q/P336S, Y216C/R345Q/R346L, L92I/S310C/V313I and P336S/R345Q/R346L developed the deepest color, indicating that it is resistant to mesotrione in E. coli The best receptivity.

Figure 5. Shows the color development of E. coli expressing wild-type (WT) and four-point combination mutant rice HPPD gene in a 48-well plate containing culture medium under the screening conditions of 0-250 μM mesotrione reaction. Under the culture conditions containing the same concentration of herbicides, the darker the color indicates the higher resistance or tolerance of the corresponding mutant HPPD protein to mesotrione. Among them, the wells corresponding to mutant HPPD containing Y216C/R345Q/P336S/R346L, V52I/Y216C/P336S/R345Q and Y216C/P277V/S310C/R345Q developed the deepest color, indicating that it is resistant to mesotrione in E. coli The best receptivity.

Figure 6 shows the expression of Escherichia coli expressing wild-type (WT) and five-point combination mutant rice HPPD gene in a 48-well plate containing culture medium under the screening conditions of 0-500 μM mesotrione color reaction. Under the culture conditions containing the same concentration of herbicides, the darker the color indicates the higher resistance or tolerance of the corresponding mutant HPPD protein to mesotrione. The 3 combinations shown, Y216C/S310C/P336S/R345Q/R346L, V29A/Y216C/S310C/P336S/R345Q and V52I/Y216C/S310C/P336S/R345Q were all tolerant to at least 300 μM mesotrione in E. coli .

Figure 7. Shows the color reaction of E. coli expressing wild-type (WT) or single-point mutant rice HPPD gene in a 48-well plate containing culture medium under the screening conditions of 0-120 μM of oxaflutole . Under the culture conditions containing the same concentration of herbicides, the darker the color, the higher the resistance or tolerance of the corresponding mutant HPPD protein to oxaflutole. Under the condition of 60 μM oxaflutole, the vast majority of mutant HPPD still developed significantly deeper color than wild type HPPD. Among them, the wells corresponding to mutant HPPD containing V52I, F68S, F132S, Y216C, H297R, S310C, S310V, V313I, R345Q, M392I, F388L, S404G and Q406R developed the deepest color, indicating that it has the deepest color in E. coli best tolerated.

Figure 8 shows the color development of Escherichia coli expressing wild-type (WT) or two-point combination mutant rice HPPD gene in a 48-well plate containing culture medium under the screening conditions of 0-120 μM of oxaflutole reaction. Under the culture conditions containing the same concentration of herbicides, the darker the color, the higher the resistance or tolerance of the corresponding mutant HPPD protein to oxaflutole. Among them, the mutant HP/V310C containing R345Q/R346L, Y216C/R345Q, P336S/R346L, V29A/R346L, S310C/G415A, S310C/G415N, L295Q/R345Q, F68S/S310C, V266A/S310C, V266A/R345I and SPD310C The corresponding well developed the darkest color, indicating that it had the best tolerance to oxaflutole in E. coli.

Figure 9. Shows the color development of E. coli expressing wild-type (WT) and three-point combination mutant rice HPPD gene in a 48-well plate containing culture medium under the screening conditions of 0-250 μM oxaflutole reaction. Under the culture conditions containing the same concentration of herbicides, the darker the color, the higher the resistance or tolerance of the corresponding mutant HPPD protein to oxaflutole. Among them, Y216C/P336S/R345Q, Y216C/R345Q/R346L, V29A/Y216C/R345Q, L92I/S310C/V313I, P336S/R345Q/R346L, L54F/L295Q/S310C, L92I/L295Q/R36S/P345Q/ and The hole corresponding to the mutant HPPD of R346L developed the darkest color, indicating that it has the best tolerance to oxaflutole in E. coli.

Figure 10. The color development of Escherichia coli expressing wild-type (WT) and four-point combination mutant rice HPPD gene in a 48-well plate containing culture medium under the screening conditions of 0-500 μM oxaflutole reaction. Under the culture conditions containing the same concentration of herbicides, the darker the color, the higher the resistance or tolerance of the corresponding mutant HPPD protein to oxaflutole. Among them, there are wells corresponding to mutant HPPD of Y216C/P336S/R345Q/R346L, V52I/Y216C/P336S/R345Q, S310C/P336S/R345Q/R346L, V29A/L295Q/S310C/G415A and V52I/L295Q/S310C/G415A The darkest color indicates that it has the best tolerance to oxaflutole in E. coli.

Figure 11. Shows the color development of E. coli expressing wild-type (WT) and five-point combination mutant rice HPPD gene in a 48-well plate containing culture medium under the screening conditions of 0-1000 μM oxaflutole reaction. Under the culture conditions containing the same concentration of herbicides, the darker the color, the higher the resistance or tolerance of the corresponding mutant HPPD protein to oxaflutole. Among them, the combination of Y216C/S310C/P336S/R345Q/R346L has the best tolerance, and can develop color under the screening condition of 1000μM oxaflutole. The screening conditions of oxaflutole can develop color, and V29A/Y216C/S310C/P336S/R345Q can tolerate 600μM oxaflutole.

Figure 12. Shows the color reaction of E. coli expressing wild-type (WT) and single-point combination mutant rice HPPD gene in a 48-well plate containing culture medium under the screening conditions of 0-5 μM cyclosulfonone . Under the culture conditions containing the same concentration of herbicides, the darker the color, the higher the resistance or tolerance of the corresponding mutant HPPD protein to oxaflutole. Under the condition of 2μM cyclosulfonone, the vast majority of mutant HPPD still developed significantly deeper color than wild-type HPPD. Among them, the wells corresponding to mutant HPPD containing F68S, Y216C, V266A, H297R, V313I, P336S, R345Q, R346L, and M392I developed the deepest color, indicating that it has the best tolerance to cyclosulfonone in E. coli.

Figure 13. Shows the expression of Escherichia coli expressing wild-type (WT) and single-point combination mutant rice HPPD gene in a 48-well plate containing culture medium under the screening conditions of 0-160 μM isoxaflutole color reaction. Under the culture conditions containing the same concentration of herbicide, the darker the color indicates the higher resistance or tolerance of the corresponding mutant HPPD protein to isoxaflutole. Under the condition of 100 μM isoxaflutole, the vast majority of mutant HPPD still developed significantly deeper color than wild type HPPD. Among them, the wells corresponding to the mutant HPPD containing V52I, 68S, P99L, F132S, Y216C, H297R, V313I, S310V, P336S, R345Q, R346L and M392I developed the deepest color, indicating that it has the strongest effect on isoxaflutole in E. coli Best tolerated.

Figure 14 shows the expression of Escherichia coli expressing wild-type (WT) and five-point combination mutant rice HPPD gene in a 48-well plate containing culture medium under the screening conditions of 0-1000 μM isoxaflutole color reaction. Under the culture conditions containing the same concentration of herbicides, the darker the color, the higher the resistance or tolerance of the corresponding mutant HPPD protein to oxaflutole. Among them, the combination of Y216C/S310C/P336S/R345Q/R346L and V29A/Y216C/S310C/P336S/R345Q has the best tolerance, and can develop color under the screening condition of 800 μM isoxaflutole, V52I/Y216C/S310C/P336S /R345Q was able to tolerate isoxaflutole at 600 μM.

Figure 15. A diagram showing the construction of the wild-type or mutant-type HPPD transgene expression vector for rice transformation. ZmpUBI: maize UBI gene promoter; OsHPPD: wild-type or mutant rice HPPD gene; 6×His Tag: histidine tag in series 6 times; NOS Ter: NOS terminator; p35S: cauliflower mosaic virus 35S promoter ; HygR: hygromycin resistance gene; 35S Ter: 35S terminator; LB: T-DNA left border, RB: T-DNA right border.

Figure 16. Tolerance of wild-type and mutant HPPD transgenic rice to mesotrione. Among them, HPPD transgenic plants containing V266A, S310C, V313I and R345Q mutant forms can tolerate 6 g a.i./mu of mesotrione. Y216C/R345Q, P336S/R346L, L295Q/S310C, F68S/S310C, S310C/R345Q, S310C/G415A, S310C/V313I, Y216C/P336S/R345Q, Y216C/R345Q/R346L, L910C/V313I, Y2/S31 P336S/R345Q/R346L, V29A/Y216C/S310C/P336S/R345Q and V52I/Y216C/S310C/P336S/R345Q can tolerate 12g a.i./mu of mesotrione.

Figure 17. Tolerance of wild-type and mutant HPPD transgenic rice to oxaflutole. Among them, the HPPD transgenic plants containing the mutant forms of F68S, F132S, V313I, S310C, R345Q and M392I were able to tolerate oxaflutole (1.5 g a.i./mu) with varying degrees of tolerance. Y216C/R345Q, P336S/R346L, S310C/G415A, S310C/V313I, F68S/S310C, L295Q/R345Q, Y216C/R345Q/R346L, L92I/S310C/V313I, Y216C/P336S/R331S30C/P6/Y216S/R345Q/R345Q R346L, V29A/Y216C/S310C/P336S/R345Q and V52I/Y216C/S310C/P336S/R345Q can tolerate 3g a.i./mu of oxaflutole.

Figure 18. Tolerance of wild-type and mutant HPPD transgenic rice to isoxaflutole. Among them, HPPD transgenic plants containing mutant forms of F68S, F132S, V313I, S310C and P336S had different degrees of tolerance to isoxaflutole (6 g a.i./mu). Y216C/R345Q, P336S/R346L, L295Q/S310C, F68S/S310C, S310C/R345Q, S310C/M392I, Y216C/P336S/R345Q, Y216C/R345Q/R346L, L92I/S310C/V310C/R310SCC/P3/Y2 R346L, V29A/Y216C/S310C/P336S/R345Q and V52I/Y216C/S310C/P336S/R345Q can tolerate isoxaflutole at a concentration of 12g a.i./mu.

Figure 19. Tolerance of wild-type and mutant HPPD transgenic rice to cyclophanone. Among them, the HPPD transgenic plants containing the mutant forms of F68S, V266A, S310C, R345Q and M392I were able to tolerate a concentration of 1.5 g a.i./mu of cyclopentanone. Y216C/R345Q, L295Q/S310C, L295Q/R345Q, S310C/M345Q, S310C/M392I, Y216C/S310C/P336S/R345Q/R346L, V29A/Y216C/S310C/P336S/R345Q and V545S31616C/S310C/P336S/R345Q/R346L Tolerant to 3g a.i./mu concentration of cyclopentanone.

Detailed ways

The embodiments of the present invention will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only used to illustrate the present invention, and should not be regarded as limiting the scope of the present invention. If the specific conditions are not indicated in the examples, it is carried out according to the conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments used without the manufacturer's indication are conventional products that can be obtained from the market.

Example 1. Cloning of rice HPPD (OsHPPD) gene

Based on the coding region sequence of rice (Oryza sativa Japonica) HPPD gene (gene ID: LOC_Os02g07160) and the sequence of pET-28a vector, primers were designed and synthesized (GenScript, China): 28a-OsHPPD-F: TGGGTCGCGGATCCGAATTCATGCCTCCCACTCCCACC and 28a-OsHPPD- R: TGGTGGTGGTGGGTGCTCGAGCTAGGATCCTTGAACTGTAGGGGC. Using this pair of primers, the rice HPPD gene was amplified with Phanta Max high-fidelity DNA polymerase (P505-d1, Novozan, China) using the cDNA of rice variety Nipponbare as a template. The reaction system is: PCR amplification conditions are as follows:

The PCR products were electrophoresed on a 1% agarose gel, and the agarose strip containing the target band of about 1.4Kb was cut under UV light. The band was purified; the concentration of purified product was determined to be 31 ng/μL using a microspectrophotometer (Nanodrop). The pET-28a vector is preserved in this laboratory at a concentration of 124ng/μL.

The 1.4Kb PCR product and pET-28a vector were double digested with restriction enzymes EcoR I and Xho I (TaKaRa, Japan), respectively. The reaction system and reaction conditions were: PCR product or pET-28a vector, 30 μL; 10×H buffer, 5 μL; EcoR I (15 U/μL), 1 μL; Xho I (10 U/μL), 1 μL; ddH ₂ O, 13 μL; 37° C., 2 h. According to the instructions of the DNA purification kit (Axygen, USA), the HPPD gene fragment of about 1.4Kb and the pET-28a vector fragment of 5.4Kb were recovered to obtain the HPPD gene fragment and linearized vector fragment containing the same sticky ends. The concentration of purified product of HPPD fragment measured by spectrophotometer (Nanodrop) was 20 ng/μL, and the concentration of purified product of pET-28a vector was 35 ng/μL. The above two purified fragments were ligated together with T4 DNA ligase (Takara, Japan). The reaction system and reaction conditions were: 5×T4 DNA ligase buffer, 2 μL; HPPD fragment, 2 μL; pET-28a vector fragment, 2 μL; T4 DNA ligase (350U/μl), 1 μL; ddH ₂ O, 3 μL; 22° C., 1 h. Transfer all the ligation products into 100 μL of slowly thawed DH5α competent cells (Qingke, China), gently pipette and mix, let stand on ice for 30 min, 42 ℃ water bath for 45 s, stand on ice for 2 min, add 500 μL Antibiotic liquid LB medium, 37 ℃ 220rpm recovery culture for 1h, spread on the solid LB medium plate containing 50μg/mL kanamycin, placed in a 37 ℃ incubator for 12h inverted culture, autoclaved at 121 ℃ after sterilization The toothpick picks monoclonal colonies, and uses the vector and gene-specific primers (forward primer pET28a-SF: TAATACGACTCACTATAGG, reverse primer OsHPPD-CR: CTAGGATCCTTGAACTGTAGGGGC) to identify positive clones by colony PCR. The PCR reaction system and reaction conditions are:

A total of 8 clones were picked by colony PCR reaction, and 7 of them could amplify the target band of about 500bp as positive clones. Select clones No. 2 and No. 5 with brighter amplification bands, inoculate them in liquid LB medium containing 50 μg/mL kanamycin, respectively, and culture with shaking at 37°C for 12 hours. , China), the plasmids were extracted to obtain pET28a-OsHPPD-2 and pET28a-OsHPPD-5, and the plasmid concentrations of pET28a-OsHPPD-2 were 345 ng/μL and pET28a-OsHPPD-5 were 288 ng/μL using a microspectrophotometer (Nanodrop). The primers pET28a-SF: TAATACGACTCACTATAGG and pET28a-SR: GCTAGTTATTGCTCAGCGG were used to verify the plasmid by Sanger sequencing (Qingke, China).

Example 2. Random mutation of rice HPPD gene (OsHPPD) using error-prone PCR

The GC content of wild-type rice HPPD gene (shown in SEQ ID NO: 1) is 70.8%, and the amino acid sequence is shown in SEQ ID NO: 2. The present invention first attempts to use a tunable error-prone PCR kit (Tian Enze, CAT #:101005-100, China), error-prone PCR was performed with the diluted pET28a-OsHPPD-2 plasmid as a template, and no amplified band was obtained. To this end, the present invention tries different PCR reagents and reaction conditions to optimize the error-prone PCR system. Due to the high GC content of rice HPPD gene, the present invention uses 2×GC I buffer (Takara, CAT#: 9154) specially suitable for gene amplification with high GC content as PCR buffer, and uses Taq DNA polymerase with strong amplification ability (5U/μl) (Takara, CAT#: R500A) to perform error _- prone PCR, and optimize the usage of dATP, dTTP, dCTP, dGTP (Table ₁ ), MnCl and MgCl in the amplification system, and test the amplification Efficiency and mutation rate. The use concentration combinations of different dNTPs are shown in Table 1:

Table 1 Pre-experiment of dNTP concentration in error-prone system

The numbers in the first row of the table correspond to lanes 2-21 in the electrophoresis below; the unit of dNTP concentration is mM.

The results of agarose gel electrophoresis showed that when any dNTP concentration was 0, no band could be amplified. When the dNTP concentration is 0.07-0.8 mM, that is, 0.35-4 times the normal amplification concentration, the target band can be amplified. When the concentration of MnCl ₂ is below 0.2 mM, the target product can be amplified; when the concentration of MnCl ₂ is above 0.2 mM, the target band of HPPD gene gradually weakens with the increase of the concentration of MnCl _{2 ; when the concentration of MnCl 2} is above 0.4 mM, No amplified band was detected. _The concentration of MgCl did not affect the amount of amplified product. The experimental results are shown in Figure 1.

Subsequently, the HPPD error-prone PCR amplification products under different reaction conditions were purified by gel cutting and cloned into pClone007Simple vector (Qingke, China). The reaction system was: HPPD purified fragment, 2 μL; pClone007Simple vector, 1 μL; 10×TOPO Mixture, 1 μL; ddH ₂ O, 6 μL. Transfer all the ligation products into 50 μL of slowly thawed DH5α competent cells (Qingke, China), gently pipette and mix, let stand on ice for 30 min, water bath at 42°C for 45 s, stand on ice for 2 min, add 500 μL without Antibiotic liquid LB medium, 37 ℃ 220rpm recovery culture for 1h, spread on the solid LB medium plate containing 50μg/mL kanamycin, placed in a 37 ℃ incubator for 12h inverted culture, autoclaved at 121 ℃ after sterilization The toothpick picks monoclonal colonies, and uses the vector and gene-specific primers (forward primer pET28a-SF, reverse primer OsHPPD-CR) to carry out colony PCR to identify positive clones. 20 single clones were picked for Sanger sequencing, and the results showed that when the dNTP concentration was 0.4 mM, when the addition amount of MnCI ₂ was 0.2 mM, and the addition amount of MgCI ₂ was 2.5 mM, the mutation rate was 1-2 bp/clone. The present invention adopts the above PCR system, and uses the 100-fold diluted pET28a-OsHPPD-2 plasmid as a template to perform error-prone PCR.

In the present invention, a total of 4 independent error-prone PCR amplifications are carried out, each time an additional specific dNTP is added, so that the final concentration of this dNTP is 0.4 mM, and the final concentration of the other 3 dNTPs is maintained at 0.2 mM.

Error-prone PCR reaction system:

2×GC I PCR buffer (MgCI 2 Plus)	15μL
dATP or dTTP or dCTP or dGTP (2.5mM)	2.4μL
10x dNTPs for error-prone PCR (2.5mM each)	2.4μL
MnCl 2 for error-prone PCR (10mM)	0.6μL
100-fold diluted pET28a-OsHPPD-2 plasmid	0.5μL
10μM amplification forward primer (28a-OsHPPD-F)	1μL
10 μM Amplification Reverse Primer (28a-OsHPPD-R)	1μL
rTaq DNA polymerase	0.5μL
ddH 2 O	6.6μL

Error-prone PCR reaction procedure:

Example 3. Screening of HPPD-resistant mutants based on color reaction

The tyrosine aminotransferase in Escherichia coli can catalyze tyrosine to generate p-hydroxyphenylpyruvate (4-HPP), which is catalyzed by HPPD to generate homogentisic acid (HGA), and then generates brown pigment through autoxidation. HPPD inhibitors can inhibit the catalytic reaction of HPPD, thereby inhibiting the production of brown pigment. Therefore, the intensity of HPPD activity or the degree of inhibition can be preliminarily judged according to the shade of brown pigment.

In order to explore the stable color reaction conditions, this study firstly tested the critical concentration of mesotrione tolerance of wild-type rice HPPD in E. coli. First, take 1 μL of pET28a-OsHPPD-2 plasmid, add it to 50 μL of slowly thawed BL21-Gold(DE3) competent cells (Youbao Bio, China), gently pipette and mix, let stand on ice for 30 min, water bath at 42°C Heat shock for 45 s, stand on ice for 2 min, resume culture at 37 °C for 1 h, spread on solid LB medium plates containing 50 μg/mL kanamycin, and invert at 37 °C for 12 h. Pick a single clone with a sterilized toothpick, streak the strain on a new solid LB medium plate containing 50 μg/mL kanamycin, and perform colony PCR with primers (forward primer pET28a-SF: TAATACGACTCACTATAGG, reverse primer OsHPPD-CR: CTAGGATCCTTGAACTGTAGGGGC) to screen for positive clones. Pick positive single colonies and inoculate them with 11 concentrations of mesotrione, 1 g/L tyrosine substrate and In liquid LB medium of IPTG inducer, 37°C, 150 rpm shaking culture for 24 hours; IPTG concentrations were set to 7 concentrations of 0.01 mM, 0.02 mM, 0.05 mM, 0.1 mM, 0.2 mM, 0.5 mM and 1 mM. The results showed that when IPTG was 0.02 mM, the pores corresponding to 0 mM mesotrione had the deepest color development, the pores corresponding to 2 μM mesotrione had no color at all, and the pores corresponding to 1 μM mesotrione had very weak color development. Color rendering. Then, under the condition of 0.02mM IPTG, the color development experiment was repeated 3 times, and the same results as the first pre-experiment were obtained, indicating that this condition is relatively stable and can be used for the subsequent color development reaction, that is, 0.02mM IPTG inducer, 2 μM mesotrione was the critical concentration for wild-type rice HPPD to fail to develop color.

A total of 4 independent error-prone PCR amplification reactions (DATP, DTTP, DCTP, DGTP) were performed in this study. All error-prone PCR amplification products were ligated into the pET-28a vector to obtain pET28a corresponding to the mutation. -mHPPD plasmid, transformed into BL21-Gold(DE3) competent cells, about 201300 single clones were picked in total, and the color reaction was carried out in a 24-well plate. The specific experimental process is as follows:

For each independent error-prone PCR reaction, 100 μL of the product was taken into 2 tubes for double digestion with restriction enzymes EcoR I and Xho I (TaKaRa, Japan). The reaction system and reaction conditions were: error-prone PCR product, 50 μL ; 10×H buffer, 8 μL; EcoR I, 1 μL; Xho I, 1 μL; ddH ₂ O, 20 μL; 37°C, 2 h. According to the instructions of the DNA purification kit (Axygen, USA), the error-prone HPPD fragment of about 1.4 Kb after PCR was recovered, and the concentration of the purified product of the HPPD fragment was measured by a microspectrophotometer (Nanodrop). The concentrations of the four independent error-prone PCR products tested were 27 ng/μL, 25 ng/μL, 32 ng/μL and 30 ng/μL, respectively. The purified HPPD error-prone PCR products were ligated with the previously purified pET-28a vector. The reaction system and reaction conditions were: 5×T4 DNA ligase buffer, 2 μL; HPPD fragment, 2 μL; pET-28a vector fragment, 2 μL ; T4 DNA ligase, 1 μL; ddH ₂ O, 3 μL; 22°C, 1 h. For the ligation product of each error-prone PCR fragment, 5 ligation reactions were performed simultaneously. For each tube of ligation products, add all the products to 100 μL of slowly thawed BL21-Gold(DE3) competent cells (prepared in this laboratory, suitable for electroshock transformation), and mix them by gently blowing with a pipette tip. The mixture of competent cells and plasmids was all transferred into a pre-cooled electric shock cup (BIO-RAD, USA) at -20°C. The electric shock cup was inserted into the well of an electric shock transforming instrument (Eppendorf, Germany), and the electric shock cup was taken out and added 500 μL The liquid LB medium without antibiotics was gently pipetted and mixed, and the bacterial liquid was aspirated and transferred to a 1.5 mL centrifuge tube, shaken at 37°C, 200 rpm, and cultured for 1 h; On a solid LB medium plate, invert at 37°C for 12 hours, pick all monoclonal colonies as much as possible with an autoclaved toothpick, and inoculate it into an LB liquid culture containing 2 μM mesotrione and 1 g/L tyrosine substrate In a 24-well plate, 28°C, shaking at 150rpm for 24h. The activity of mutant HPPD was then evaluated according to the shade of brown pigment they produced during tyrosine metabolism.

Under the condition containing 2μM mesotrione, a total of 1017 clones with different degrees of color development were identified, and the bacterial solution in the colored wells was dipped and inoculated into liquid LB medium containing 50μg/mL kanamycin After culturing at 37°C and 220rpm for 12h, the plasmid pET28a-mHPPD was extracted, and the plasmid pET28a-mHPPD was verified by Sanger sequencing using the primers pET28a-SF: TAATACGACTCACTATAGG and pET28a-SR: GCTAGTTATTGCTCAGCGG, and the sequencing results were verified by Vector NTI software and wild-type A total of 60 single point mutations and 2 different double point mutations with different amino acid changes were identified, including: V29A, V52I, L54F, F68S, L92I, P99L, T117I, S120A, F132S, A133T 、R146L、A156V、E206Q、E206V、Y216C、Y237N、I238T、F244L、V266A、N270D、T273S、P277V、V282E、L295Q、H297R、S310C、S310V、S310A、S310G、S310T、V313M、V313I、V313L、G315A、G315S 、G315R、T316K、A325D、A333P、P336S、N338K、N338I、N338T、R344K、R345L、R345Q、R346L、D349G、N357S、F388L、M392I、S404G、S404L、S404T、Q406R、Y408H、G415A、G415N、G415S、E423G , R345Q/R346L and S310C/V313I.

Further, according to all single-site and double-point mutation forms, 60 pairs of specific mutation primers were designed using a site-directed mutagenesis kit: "mHPPD-mutant-form-F" and "mHPPD-mutant-form-R" (see site-directed mutagenesis for the sequence). The primer list is shown in Table 2), using the pET28a-OsHPPD-2 plasmid as a template, PCR amplification was performed to construct a pET28a vector containing the corresponding mutant HPPD gene, and then transferred into BL21-Gold (DE3) competent cells. The results of the large-scale screening were verified at the concentration of oxalone. It was confirmed that the above-mentioned 62 mutant HPPDs could indeed develop color at a concentration of 2 μM mesotrione. For the single-point and double-point mutant HPPD proteins screened by 2 μM mesotrione that can develop color, use the same color development method as above to further increase the concentration of mesotrione to detect whether the identified mutant HPPD protein is Can tolerate higher concentrations of mesotrione in E. coli. A total of 4 concentrations of 5 μM, 10 μM, 15 μM and 20 μM were further set, while 0 μM and 2 μM were set as controls. The color development results show that V52I, F68S, L92I, T117I, F132S, Y216C, H297R, S310V, S310A, S310C, S310T, V313I, P336S, R345Q, R346L, M392I, V29A, L54F, S120A, Y266A, I9Q238T , G315R, G315S, T316K, A333P, R344K, D349G, F388L and E423G, a total of 31 mutations (Figure 2), S310C/V313I and R345Q/R346L, a total of 2 double-point mutations (Figure 3), with the most obvious color rendering effect.

Table 2 Site-directed mutagenesis primer sequences

Numbering	primer name	Sequence (5' to 3')
1	mHPPD-V29A-F		GGGCACCGCCGCTTCGTC
2	mHPPD-V29A-R		CGGACGAAGCGGCGGTGCCCGGCGAGGCGG
3	mHPPD-V52I-F		CGAGCTCTGGTGCGCCGA
4	mHPPD-V52I-R		TCGGCGCACCAGAGCTCGATGTGGTGGA
5	mHPPD-L54F-F	CTGGTGCGCCGACGCCGCG
6	mHPPD-L54F-R	CGCGGCGTCGGCGCACCAGAACTCGACGT
7	mHPPD-F68S-F	GCCGCGGGCCGGTTCGCCTCCGCCCTGGGCGCGCCGCTC
8	mHPPD-F68S-R	GGCGAACCGGCCCGCGGC
9	mHPPD-L92I-F		GCTCCGCCTCCGTCGCGTTCCT
10	mHPPD-L92I-R	ACGCGACGGAGGCGGAGCCGGATGAGGA
11	mHPPD-P99L-F	TCTTCACCGCCCCCTACGG
12	mHPPD-P99L-R	CCGTAGGGGGCGGTGAAGAGCAACGC
13	mHPPD-T117I-F	CCGCCTCCATCCCTTCCTT
14	mHPPD-T117I-R		AGGAAGGGATGGAGGCGGTGATGGCC
15	mHPPD-S120A-F	TCCCTTCCTTCTCCCCAGG
16	mHPPD-S120A-R	CTGGGGAGAAGGAAGGGATGGCGG
17	mHPPD-F132S-F	CCGCGGACCACGGCCTCGCGGT
18	mHPPD-F132S-R	CGAGGCCGTGGTCCGCGGCGGACCT
19	mHPPD-A133T-F		GGCGCCGCGCGGAGGTTCACCGCGGACCACGGCCTCGCG
20	mHPPD-A133T-R	GAACCTCCGCGCGGCGCC
twenty one	mHPPD-R146L-F	TCGCCGACGCGGCCGACGCCT

twenty two	mHPPD-R146L-R	CGTCGGCCGCGTCGGCGACGAGCAG
twenty three	mHPPD-A156V-F	GCGGCCGACGCCTTCCGCGTCAGCGTCGCGGCCGGTGCG
twenty four	mHPPD-A156V-R	GCGGAAGGCGTCGGCCGC
25	mHPPD-E206Q-F	TTCCTCCCGGGTTTCCAGGGCGTCAGCAACCCGGGC
26	mHPPD-E206Q-R	GAAACCCGGGAGGAAGGG
27	mHPPD-E206V-F	TTCCTCCCGGGTTTCGTGGGCGTCAGCAACCCGGGC
28	mHPPD-E206V-R	GAAACCCGGGAGGAAGGG
29	mHPPD-Y216C-F		CGTGGACTGCGGCCTCCGCCGGTTCGACCACG
30	mHPPD-Y216C-R	GGAGGCCGCAGTCCACGGCGCCCGGGTTGCTG
31	mHPPD-Y237N-F	GAACATCTCCGGGTTCACCGGGTTCCACGAGT
32	mHPPD-Y237N-R	TGAACCCGGAGATGTTCGCGGCTACCGGAGCGAG
33	mHPPD-I238T-F	CCGGTAGCCGCGTACACCTCCGGGTTCACCGGGTTC
34	mHPPD-I238T-R	GTACGCGGCTACCGGAGC
35	mHPPD-F244L-F	ACCGGGCTCCACGAGTTCGCCGAGTTCACCGC
36	mHPPD-F244L-R	AACTCGTGGAGCCCGGTGAACCCGGAGATGTA
37	mHPPD-V266A-F	TCAACTCGGTGGCCCTCGCCAACAACGCGGAG
38	mHPPD-V266A-R	GAGGGCCACCGAGTTGAGGCCGCTCTCGGCGG
39	mHPPD-N270D-F		AACGACGCGGAGACCGTGCTGCTGCCGCTCAA
40	mHPPD-N270D-R	ACGGTCTCCGCGTCGTTGGCGAGCACCACCGA
41	mHPPD-T273S-F	AACAACGCGGAGTCCGTGCTGCTGCCGCTCAAC
42	mHPPD-T273S-R	ACGGACTCCGCGTTTGTTGGCGAGCACCACCGA
43	mHPPD-P277V-F	TCAACGAGCCGGTGCACG
44	mHPPD-P277V-R	CGTGCACCGGCTCGTTGAGAACCAGCA
45	mHPPD-V282E-F	CTGCCGCTCAACGAGCCGGAGCACGGCACCAAGCGGCGG
46	mHPPD-V282E-R	CGGCTCGTTGAGCGGCAG
47	mHPPD-L295Q-F	GGAGCCAGATACAGACGTACCAGGACCACCACGGCGGCCC
48	mHPPD-L295Q-R	GTACGTCTGTATCTGGCTCC
49	mHPPD-H297R-F		ACGTACCTGGACCGCCACGGCGGCCCGGGGGTG
50	mHPPD-H297R-R	TGGCGGTCCAGGTACGTCTGTATCTGGCTCCG
51	mHPPD-S310C-F	CGCGCTGGCCTGCGACGACGTGCTCGGGAC
52	mHPPD-S310C-R	ACGTCGTCGCAGGCCAGCGCGATGTGCTGC
53	mHPPD-S310V-F	CGCGCTGGCCGTTGACGACGTGCTCGGGACG
54	mHPPD-S310V-R	GCACGTCGTCAACGGCCAGCGCGATGTGCTG
55	mHPPD-S310A-F	CGCGCTGGCCGCTGACGACGTGCTCGGGACG

56	mHPPD-S310A-R	GCACGTCGTCAGCGGCCAGCGCGATGTGCTG
57	mHPPD-S310G-F	CGCGCTGGCCGGTGACGACGTGCTCGGGACG
58	mHPPD-S310G-R	GCACGTCGTCACCGGCCAGCGCGATGTGCTG
59	mHPPD-S310T-F		CGCGCTGGCCACTGACGACGTGCTCGGGACG
60	mHPPD-S310T-R	GCACGTCGTCAGTGGCCAGCGCGATGTGCTG
61	mHPPD-V313M-F	CAGCGACGACATGCTCGGGACGCTGAGGGAGAT
62	mHPPD-V313M-R	GTCCCGAGCATGTCGTCGCTGGCCAGCGCG
63	mHPPD-V313I-F	CAGCGACGACATTCTCGGGACGCTGAGGGAGAT
64	mHPPD-V313I-R	GTCCCGAGAATGTCGTCGCTGGCCAGCGCG
65	mHPPD-V313L-F	CAGCGACGACCTGCTCGGGACGCTGAGGGAGAT
66	mHPPD-V313L-R	GTCCCGAGCAGGTCGTCGCTGGCCAGCGCG
67	mHPPD-G315A-F	CGACGTGCTCGCTACGCTGAGGGAGATGC
68	mHPPD-G315A-R	CTCAGCGTAGCGAGCACGTCGTCGCTGGCC
69	mHPPD-G315S-F	CGACGTGCTCTCGACGCTGAGGGAGATGC
70	mHPPD-G315S-R	CTCAGCGTCGAGAGCACGTCGTCGCAGGCC
71	mHPPD-G315R-F	CGACGTGCTCAGGACGCTGAGGGAGATGC
72	mHPPD-G315R-R	CTCAGCGTCCTGAGCACGTCGTCGCAGGCC
73	mHPPD-T316K-F	GACGACGTGCTCGGGAAGCTGAGGGAGATGCGGGCG
74	mHPPD-T316K-R	CCCGAGCACGTCGTCGCT
75	mHPPD-A325D-F	TCCGACATGGGCGGCTTCGAGTTCTTGGCGCC
76	mHPPD-A325D-R	AAGCCGCCCATGTCGGAGCGCGCCCCGCATCTC
77	mHPPD-A333P-F	GCCGCCGCCCAACTACTACGA
78	mHPPD-A333P-R	TAGTAGTTGGGCGGCGGCGGCGGCAAAGAA
79	mHPPD-P336S-F		CCAACTACTACGACGGCGTGCG
80	mHPPD-P336S-R	CGCACGCCGTCGTAGTAGTTGGGACTCGGCGGCGCCA
81	mHPPD-N338K-F	TTGGCGCCGCCGCCGCCCAAATACTACGACGGCGTGCGG
82	mHPPD-N338K-R	GGGCGGCGGCGGCGCCAA
83	mHPPD-N338I-F	TTGGCGCCGCCGCCGCCCATCTACTACGACGGCGTGCGG
84	mHPPD-N338I-R	GGGCGGCGGCGGCGCCAA
85	mHPPD-N338T-F	TTGGCGCCGCCGCCGCCCACCTACTACGACGGCGTGCGG
86	mHPPD-N338T-R	GGGCGGCGGCGGCGCCAA
87	mHPPD-R344K-F	AACTACTACGACGGCGTGAAGCGGCGCGCCGGGGACGTG
88	mHPPD-R344K-R	CACGCCGTCGTAGTAGTTGG
89	mHPPD-R345L-F	TACGACGGCGTGCGGCTGCGCGCCGGGGACGTGCTC

90	mHPPD-R345L-R	CCGCACGCCGTCGTAGTA
91	mHPPD-R345Q-F	TACGACGGCGTGCGGCAGCGCGCCGGGGACGTGCTC
92	mHPPD-R345Q-R	CCGCACGCCGTCGTAGTA
93	mHPPD-R346L-F	CCGGGGACGTGCTCTCGGA
94	mHPPD-R346L-R	CGAGAGCACGTCCCCGGCGAGCCGCCGCACG
95	mHPPD-D349G-F	GGCGTGCTCTCGGAGGAGCAGATCAACGAGTG
96	mHPPD-D349G-R	TCCTCCGAGAGCACGCCCCCGGCGCGCCGCCGCAC
97	mHPPD-N357S-F	AGCAGATCAGCGAGTGCCAGGAGCTCGGGGTG
98	mHPPD-N357S-R	GCACTCGCTGATCTGCTCCTCCGAGAGCACGT
99	mHPPD-F388L-F		GCCAACCTTATTCTTGGAGATGAT
100	mHPPD-F388L-R	CCAAGAATAAGGTTGGCCTGTCTCCTACTGGC
101	mHPPD-M392I-F	ACCTTTTTCTTGGAGATAATACAAAGGATTGGGTGCA
102	mHPPD-M392I-R	CTCCAAGAAAAAGGTTTGGCC
103	mHPPD-S404G-F	ATGGAGAAGGATGAGGGTGGGCAGGAGTACCAGAAG
104	mHPPD-S404G-R	CTCATCCTTCTCCATGCACC
105	mHPPD-S404L-F	ATGGAGAAGGATGAGCTTGGGCAGGAGTACCAGAAG
106	mHPPD-S404L-R	CTCATCCTTCTCCATGCACC
107	mHPPD-S404T-F	ATGGAGAAGGATGAGACTGGGCAGGAGTACCAGAAG
108	mHPPD-S404T-R	CTCATCCTTCTCCATGCACC
109	mHPPD-Q406R-F	AAGGATGAGAGTGGGCGGGAGTACCAGAAGGGCGGC
110	mHPPD-Q406R-R	CCCACTCTCATCCTTCTC
111	mHPPD-Y408H-F	GAGAGTGGGCAGGAGCACCAGAAGGGCGGCTGCGGC
112	mHPPD-Y408H-R	CTCCTGCCCACTCTCATCC
113	mHPPD-G415A-F	GGCTGCGGCGCGTTTGGGAAGGGCAACTTC
114	mHPPD-G415A-R	CTTCCCAAACGCGCCGCAGCCGCCCTTCTGG
115	mHPPD-G415N-F	CGGCTGCGGCAATTTTGGGAAGGGCAACTTC
116	mHPPD-G415N-R	CCTTCCCAAAATTGCCGCAGCCGCCCTTCTG
117	mHPPD-G415S-F	CGGCTGCGGCAGTTTTGGGAAGGGCAACTTC
118	mHPPD-G415S-R	CCTTCCCAAAACTGCCGCAGCCGCCCTTCTG
119	mHPPD-E423G-F		TTCTCGGGGCTGTTCAAGTCCATTGAGGAGTATG
120	mHPPD-E423G-R	TTGAACAGCCCCGAGAAGTTGCCCTTCCCAAA

On the basis of the screening and identification results of mesotrione, the present invention also tested the tolerance of the above 60 single-point mutant HPPDs to other types of HPPD inhibitor herbicides, including oxaflutole, cyclosulfonone and Isoxaflutole. Using the same color development method described above, firstly, the critical concentration of wild-type rice HPPD that can tolerate oxaflutole, cyclosulfonone and isoxaflutole was determined and gradient experiments were carried out. The results showed that the critical concentrations of oxaflutole, cyclosulfonone and isoxaflutole were 40 μM, 1 μM and 80 μM, respectively. The gradient experiment results showed that the above 60 single-point mutant HPPDs had different effects on the three herbicides. degree of tolerance (Figures 7, 12, 13). Among them, V52I, F68S, L92I, T117I, F132S, Y216C, H297R, S310V, S310A, S310C, S310T, V313I, P336S, R345Q, R346L, M392I have a certain degree of tolerance to these four herbicides, while other Spots have differences in tolerance to different herbicides. For example, L54F, S120A, Y237N, I238T, L295Q, A333P, R344K, D349G and E423G are only tolerant to mesotrione; S404G, Q406R and Y408H are tolerant to mesotrione and mesotrione ; S310G, G415A, G415N, V29A, V266A, G315S and T316K were mesotrione and cyclosulfonone tolerant; A133T, A156V and V282E were mesotrione and isoxaflutole tolerant. P99L is tolerant to mesotrione, oxaflutole and isoxaflutole; E206Q, E206V and G415S are tolerant to mesotrione, isoxaflutole and cyclosulfonone; F388L is nitroxazone Sulcotrione, oxaflutole, and cyclofenone were tolerated.

Example 4. Combining single-site HPPD gene mutations by site-directed mutagenesis PCR

Considering that multiple point mutation may improve the resistance of mutant HPPD protein to HPPD inhibitor herbicides, the present invention adopts the method of site-directed mutation PCR on the basis of single point mutation to detect the color development in the first round of color development screening. The 60 single-point mutations of 60 single-point mutations were superimposed, and the purpose was to screen the double-point mutant HPPD with stronger tolerance than single-point mutation. Therefore, this round of screening used 5 μM mesotrione as the starting point.

Specifically, the corresponding pET28a-mHPPD gene containing the single point mutation of the rice HPPD gene was used as the template (60 vectors constructed during the verification of the color development results, the plasmid concentrations were all between 200ng/μL and 350ng/μL), plasmid 100 After doubling dilution, equal volumes were mixed and used as templates for site-directed mutagenesis. The primers were amplified using the 60 pairs of primers in Example 3; Phanta high-fidelity DNA polymerase (P505-d1, Novozymes, China) was used for amplification. PCR reaction system: 2 × Phanta Max buffer, 25 μL; dNTP Mix (10 mM each), 1 μl; 10 μM site-directed mutagenesis forward primer, 2 μL; 10 μM site-directed mutagenesis reverse primer, 2 μL; Phanta Max Super-Fidelity DNA polymerase (1U /uL), 1 μL; 100-fold diluted pET28a-mHPPD mixed plasmid template, 2 μL; ddH ₂ O, 17 μL.

PCR reaction conditions are:

Take 20 μL of the amplified product and digest it with restriction enzyme Dpn I (10 U/μl, TaKaRa, Japan) to remove the methylated plasmid template. Reaction system and conditions: point mutation amplification product, 20 μL; 10×T buffer solution, 4 μL; Dpn I, 1 μL; ddH ₂ O, 15 μL; 37°C, 6h; 70°C, 15min. Add the heat-inactivated enzyme digestion product to 100 μL of slowly thawed BL21-Gold(DE3) competent cells, gently pipette and mix, let stand on ice for 30 min, heat shock in a 42°C water bath for 45 s, and let stand on ice For 2 min, add 500 μL of liquid LB medium without antibiotics, resume the culture at 37 °C for 1 h, spread on 5 solid LB medium plates containing 50 μg/mL kanamycin, and invert at 37 °C for 12 h. A toothpick of bacteria was used to pick all the monoclonal colonies as much as possible, inoculated into a 24-well plate in LB liquid medium containing 5 μM mesotrione, and cultured with shaking at 150 rpm at 28° C. for 24 h. The activity of mutant HPPD was then evaluated according to the shade of brown pigment they produced during tyrosine metabolism. Similar to the process described in Example 3, the bacterial liquid in the colored wells was dipped, inoculated into liquid LB medium containing 50 μg/mL kanamycin, and incubated at 37 ° C and 220 rpm for 12 h, and the plasmid was extracted. , using primers pET28a-SF: TAATACGACTCACTATAGG and pET28a-SR: GCTAGTTATTGCTCAGCGG to verify the obtained plasmid by Sanger sequencing, and use Vector NTI software to compare the sequencing results with wild-type rice HPPD gene. A total of about 26,000 single clones were picked in this round of screening, and the color reaction was carried out in a 24-well plate. The screening conditions were the same as those described in Example 3. A total of 19 new double-point mutant HPPDs resistant to 5μM mesotrione were obtained, including: Y216C/R345Q, P336S/R346L, V29A/R346L, L295Q/S310V, V29A/S310C, S310C/G415A, S310C/G415N , L295Q/R345Q, L295Q/S310C, L54F/R345Q, L54F/R346L, S120A/S310C, F68S/S310C, V266A/S310C, V266A/R345Q, S310C/M392I, S310C/R345Q, L21C0/M392, together with T21C0/M392 The two double point mutations R345Q/R346L and S310C/V313I screened by error-prone PCR, the present invention identified a total of 21 double point mutant HPPDs that were tolerant to 5 μM mesotrione (Figures 3 and 8). The double-point mutant plasmid obtained after this sequencing will continue to be used as a template for the identification of herbicide tolerance at higher concentrations and the subsequent screening of more point mutant HPPD.

Specifically, first take 1 μL of the obtained double-point mutant plasmids, respectively, add 25 μL of slowly thawed BL21-Gold (DE3) competent cells, gently pipette and mix, let stand on ice for 30 min, and heat shock in a 42°C water bath. 45s, stand on ice for 2min, add 500μL of liquid LB medium without antibiotics, resume culture at 37°C for 1h, spread on solid LB medium plates containing 50μg/mL kanamycin, and invert at 37°C for 12h . Colony PCR was performed using the primer pair pET28a-SF and OsHPPD-CR (pET28a-SF: TAATACGACTCACTATAGG, OsHPPD-CR: CTAGGATCCTTGAACTGTAGGGGC) and 8 single clones were detected per vector. For each individual plasmid transformation event, 3 single clones were picked and inoculated into liquid LB medium containing a higher concentration of mesotrione. In this round of screening, a total of 4 concentrations of 10 μM, 20 μM, 30 μM and 40 μM were set. Both 0 μM and 5 μM were set as controls. The chromogenic results showed that the tested 21 double point mutation forms, including: R345Q/R346L, Y216C/R345Q, P336S/R346L, V29A/R346L, L295Q/S310V, V29A/S310C, S310C/G415A, S310C/G415N, L295Q /R345Q, L295Q/S310C, L54F/R345Q, L54F/R346L, S120A/S310C, F68S/S310C, V266A/S310C, V266A/R345Q, S310C/M392I, S310C/R345Q, T273S/S310C, L9 Mesotrione at or above 5 μM was tolerated to some extent. Among them, there are wells corresponding to mutant HPPD of Y216C/R345Q, P336S/R346L, S310C/G415A, L295Q/S310C, L54F/R345Q, S120A/S310C, F68S/S310C, S310C/M392I, S310C/R345Q and S310C/V313I The darkest color indicates that it has the best tolerance to mesotrione in E. coli. Using the same mutation and screening strategy as above, the present invention further superimposes the mutation sites, that is, all double-point mutant HPPD vectors that can develop color at a concentration of 5 μM mesotrione are used as templates, and 60 pairs of primers are used to amplify the The three-point mutant HPPD with better tolerance should be screened additionally, and so on, until the five-point mutant HPPD. A total of about 25,000 single clones were screened for three-point mutation, about 18,000 single clones were screened for four-point mutation, and about 9,500 single clones were screened for five-point mutation. In the present invention, the initial mesotrione screening concentration that increases round by round is used to screen the mutant rice HPPD with better tolerance, that is, the initial mesotrione screening concentration for three-point mutation is 20 μM, and the initial mesotrione screening concentration for four-point mutation is 50 μM , the five-point mutation was 100 μM. After obtaining a new mutant HPPD using the initial screening concentration, a higher mesotrione concentration gradient was further set to identify the upper limit of the mesotrione tolerance of the mutant HPPD. A total of 28 three-point mutant HPPDs that can tolerate at least 20μM mesotrione were screened in this study, including: Y216C/P277V/R345Q, Y216C/P336S/R345Q, Y216C/R345Q/R346L, V29A/Y216C/R345Q, Y216C /R345Q/G415A, Y216C/R345Q/E423G, L92I/S310C/V313I, V52I/Y216C/R345Q, Y216C/R345Q/F388L, P336S/R345Q/R346L, L295Q/S310C/G415A, L295S310, L54SQF/L29 /S310C, L295Q/S310C/F388L, L54F/L295Q/R345Q, L92I/L295Q/R345Q, L295Q/S310C/R345Q, L54F/S310C/G415A, L92I/S310G/G415A, V266A, S3105S/G41 , L54F/P336S/R346L, L92I/P336S/R346L, S310C/P336S/R346L, V29A/S310C/V313I, L54F/S310C/V313I, I238T/S310C/V313I, L54F/Y216C/R345Q can withstand at least 14; Four-point mutant HPPD of mesotrione, including: V29A/Y216C/P336S/R345Q, Y216C/P336S/R345Q/R346L, V52I/Y216C/P336S/R345Q, Y216C/P336S/R345Q/E423G, Y216C/S310C/R345Q /G415A, L54F/Y216C/S310C/R345Q, Y216C/P277V/S310C/R345Q, V52I/Y216C/S310C/R345Q, Y216C/S310C/R345Q/F388L, S310C/P336S/R345Q/R35Q/L346L, V29G/R35Q/S1029 , V52I/L295Q/S310C/G415A, L54F/L295Q/S310C/G415A, L295Q/S310C/M392I/G415A; 3 five-point mutant HPPDs that can tolerate at least 300μM mesotrione, including: Y216C/S310C/P336S /R345Q/R346L, V29A/Y216C/S310C/P336S/R345Q and V52I/Y216C/S310C/P33 6S/R345Q (Figure 4-6).

Among the four-point mutant HPPDs identified in the present invention, 14 four-point mutant HPPDs can tolerate at least 50 μM mesotrione, and the single three-point mutant HPPD can tolerate up to 20 μM mesotrione, and Compared with other single-point mutant HPPDs that can tolerate up to 10 μM mesotrione, the effect of the 14 four-point mutant HPPDs is far better than the sum of the three-point mutant and single-point mutants tolerance; at the same time, five The point mutants Y216C/S310C/P336S/R345Q/R346L and V29A/Y216C/S310C/P336S/R345Q were able to tolerate 300 μM mesotrione, among which the four point mutants Y216C/P336S/R345Q/R346L and V29A/Y216C/ P336S/R345Q can tolerate 150 μM mesotrione, while the single point mutant S310C can only tolerate 10 μM mesotrione. Therefore, the five point mutants Y216C/S310C/P336S/R345Q/R346L and V29A/Y216C/ The effect of S310C/P336S/R345Q is far better than the sum of the two.

The above two-point and multi-point combinations were used to verify the resistance of oxaflutole. The double point mutation was developed at five concentrations of 40 μM, 60 μM, 80 μM, 100 μM and 120 μM, and the results showed that R345Q/R346L, Y216C/R345Q, P336S/R346L, V29A/R346L, S310C/G415A, S310C/G415N, L295Q/R345Q , F68S/S310C, V266A/S310C, V266A/R345Q and S310C/V313I mutant HPPD corresponding to the darkest wells, indicating that it has the best tolerance to oxaflutole in E. coli. The three-point mutation was developed at five concentrations of 50 μM, 100 μM, 150 μM, 200 μM and 250 μM. /R346L, L54F/L295Q/S310C, L92I/L295Q/R345Q/ and L54F/P336S/R346L were the best tolerated; the four-point mutation was developed at five concentrations of 100 μM, 200 μM, 300 μM, 400 μM and 500 μM. The holes corresponding to mutant HPPDs of Y216C/P336S/R345Q/R346L, V52I/Y216C/P336S/R345Q, S310C/P336S/R345Q/R346L, V29A/L295Q/S310C/G415A and V52I/L295Q/S310C/G415A have the deepest color rendering. It showed that it had the best tolerance to oxaflutole in Escherichia coli; the five-point mutation was developed at five concentrations of 200 μM, 400 μM, 600 μM, 800 μM and 1000 μM. Also set 0 μM as a control. The results showed that the combination Y216C/S310C/P336S/R345Q/R346L and V52I/Y216C/S310C/P336S/R345Q were well tolerated (Figures 8-11). In addition, the resistance of the above five-point combination was verified by isoxaflutole, and the results showed that the combination Y216C/S310C/P336S/R345Q/R346L and V29A/Y216C/S310C/P336S/R345Q had the best tolerance, at 800 μM isotope. The screening conditions for oxaflutole were able to develop color, and V52I/Y216C/S310C/P336S/R345Q could tolerate isoxaflutole at 600 μM ( FIG. 14 ).

Example 5. Expression and purification of HPPD protein

Add 100ng of the wild-type rice HPPD gene expression vector plasmid pET28a-HPPD-2 and the corresponding single-point or double-point or multi-point rice mutant HPPD expression vector plasmid pET-mHPPD to 100 μL of slowly thawed E. coli strain BL21, respectively. -Gold(DE3) competent cells (Novizan, China), placed on ice for 30min, water bath at 42°C for 60s, placed on ice for 2min, added 500μL of liquid LB medium without antibiotics, and recovered with shaking at 37°C for 1h , take 100 μL of the recovery culture product, spread it evenly on a solid LB medium plate containing 50 μg/mL kanamycin, place it in a 37 °C incubator and invert for 12 h, pick 8 monoclonal colonies, and use the primer pET- SF and OsHPPD-CR were subjected to colony PCR (forward primer pET28a-SF: TAATACGACTCACTATAGG, reverse primer OsHPPD-CR: CTAGGATCCTTGAACTGTAGGGGC), the correct amplified product size was about 1.4kb, and then used 1% agarose gel electrophoresis to identify The PCR product is detected. If a specific amplified band is detected, the corresponding single colony is a positive transformant containing the target plasmid. Pick a single colony that is verified to be correct with a sterilized toothpick, transfer it to a test tube containing 3 mL of liquid LB medium containing 50 μg/mL kanamycin, place it on a shaker at 37 °C, and cultivate it with horizontal shaking at 180 rpm for 5 h , transfer 1 mL of bacterial liquid to a conical flask containing 100 mL of liquid LB medium containing 50 μg/mL kanamycin, place it on a shaker at 37 °C, and horizontally shake at 180 rpm until the OD ₆₀₀ is between 0.4-0.6. Add 25 μL of 1M IPTG, transfer to a shaker at 16 °C, induce horizontal shaking at 180 rpm for 15 h, centrifuge at 8000 rpm for 2 min to collect the cells, wash the cells twice with 10 mM pH7. 4 of PBS buffer to resuspend the cells, and ultrasonically disrupt them on ice for 10 min. The ultrasonic conditions are: power 15%, ultrasonic for 1 s, interval for 2 s, and ultrasonic for 10 min; after ultrasonication, centrifuge at 12,000 rpm for 30 min to remove the precipitate, and the supernatant is the crude enzyme liquid. The crude enzyme solution was purified by Co ²⁺ chromatography column (GE, USA) according to the instructions. The column was washed with a buffer containing 10 mM imidazole to remove impurities, and eluted with an elution buffer containing 500 mM imidazole to obtain the objective protein.

The purity of the purified protein was checked by SDS-PAGE. The purified protein was electrophoresed on an 8% denaturing polyacrylamide gel (GenScript, China), and the electrophoresis condition was 120 V under constant pressure for 120 min. After electrophoresis, the gel was removed, placed in a clean glass petri dish, washed once with distilled water, and stained with 0.05% Coomassie brilliant blue (50% v/v methanol, 10% v/v glacial acetic acid, 0.05% m /v Coomassie Brilliant Blue R-250) was stained for 4h, and decolorized with decolorizing solution (30%v/v methanol, 10%v/v glacial acetic acid) for about 6h (with two new decolorizing solutions in between), both the dyeing and decolorization process were Shake slowly on a horizontal shaker at 60 rpm at room temperature. If a single band of the correct size is detected, it means that the protein purification effect is good, and the subsequent experiments are continued.

The purified protein was put into a dialysis bag (Yuanye, China) for dialysis at 4°C. The dialysate was 10 mM PBS (pH 7.4) buffer, and dialyzed for 10-12 h, during which the dialysate was replaced twice. The protein concentration after dialysis was determined using BCA protein quantification kit (Sangong, China). The corresponding concentrations of mutant HPPD proteins are: WT 138.5ng/μL; V52I 237.8ng/μL; F68S 148.2ng/μL; L92I 176.0ng/μL; T117I 215.9ng/μL; F132S 157.0ng/μL; μL; V266A 180.7ng/μL; L295Q 163.5ng/μL; H297R 265.0ng/μL; S310A 251.3ng/μL; S310C 243.7ng/μL; S310V 263.5ng/μL; P336S 195.0ng/μL; R345Q 168.4ng/μL; G415A 244.2ng/μL; R346L 332.7ng/μL; M392I 140.4ng/μL; Y216C/R345Q 112.8ng/μL; ng/μL; L295Q/R345Q 233.5ng/μL; S310C/G415A 233.0ng/μL; S310C/R345Q 378.9ng/μL; F68S/S310C 212.6ng/μL; S310C/V313I 235.8ng/μL; μL; L92I/M392I 285.1ng/μL; Y216C/P336S/R345Q 352.6ng/μL; Y216C/R345Q/R346L 284.9ng/μL; L295Q/S310C/R345Q 192.5ng/μL; S310C/V313I/μL; L92I/S310C/V313I 182.3ng/μL; Y216C/P336S/R345Q/R346L 167.9ng/μL; V52I/Y216C/P336S/R345Q 295.2ng/μL; V52I/L295Q/S310C/G415A 302.7ng/μL; M392I/G415A 285.2ng/μL; Y216C/S310C/P336S/R345Q/R346L 266.3ng/μL; V52I/Y216C/S310C/P336S/R345Q 234.6ng/μL.

Example 6. Determination of HPPD enzyme activity and enzyme kinetic parameters

1) Set the substrate concentration of p-hydroxyphenylpyruvate (4-HPP) to 5.0-100 μM (including 5, 10, 20, 40, 60, 80, and 100 μM, respectively), and prepare 1 mL of standard enzymatic reaction system: 1 mM Ascorbic acid, 10 μM Fe ²⁺ , 10 mM PBS (pH 7.4), an appropriate amount of HPPD protein, 10% (v/v) TFA was used to terminate the reaction after the reaction at 30°C for 1 min, and the substrate conversion rate was controlled not to exceed 10%. The production of homogentisic acid (HGA) was detected by high performance liquid chromatography (HPLC), the Michaelis Menten equation was nonlinearly fitted by Origin Pro 8.0 software, and the kinetic parameters of the enzyme were calculated.

2) Determination of the ability of HPPD inhibitor herbicides to inhibit HPPD protein IC50

First, different concentrations of mesotrione, oxaflutole, isoxaflutole (0, 2, 4, 6, 10 μM) and cyclosulfonone (0, 0.2, 0.4, 0.5, 0.8 μM) were mixed with The HPPD protein was pre-incubated at 30°C for 30min to reach equilibrium, then added to the enzymatic reaction system as in step 1), and the enzymatic reaction was terminated with 10% (v/v) TFA after the reaction was carried out at 30°C for another 10min. . The results of product HGA production were detected by HPLC, and the relative enzyme activities at other inhibitor concentrations were calculated relative to the inhibitor concentration of 0 μM. The half inhibitory concentration (IC50) value of the final HPPD was calculated by nonlinear regression fitting of the following equation:

y=100/[1+10^(x-lgIC50)]

where y is the relative enzyme activity at different inhibitor concentrations and x is the logarithm of the inhibitor concentration value.

After the enzymatic reaction was completed, an equal volume of chromatographic methanol was added to terminate the reaction, and after filtration with a 0.22 μm organic filter membrane, high-performance liquid phase analysis was performed to detect the production of the product HGA. The model of the high performance liquid chromatograph is Alliance e2695 (Waters, USA), and the chromatographic column used is a ZORBAX SB-Aq 5μ4.6×250mm (Aglient, USA) reversed-phase chromatographic column. The injection volume was 20 μL, and the analysis conditions of HPLC were as follows: firstly, 5% to 50% methanol water (buffer A was water containing 0.1% formic acid, buffer B was methanol) gradient for 10 minutes, and then 5% methanol water was isocratic for 5 minutes; The flow rate was 1 mL/min; the column temperature was 30°C. The detection wavelength of HGA is 292 nm.

See Table 3 for the data related to the above enzyme activity detection.

table 3

It can be seen from the measurement results of the above parameters related to enzyme kinetics that compared with the wild type (WT), the relative IC50 values of most mutant HPPD and HPPD inhibitor herbicides are significantly improved. Although the enzymatic catalytic activity of some mutant HPPDs may be affected to a certain extent, the increase of IC50 can still confer tolerance to the corresponding HPPD inhibitor herbicides in mutant HPPDs, which is based on the results of the chromogenic experiments of Escherichia coli and the The improved tolerance of transgenic rice with mutant HPPD to different kinds of HPPD inhibitor herbicides can be seen from two aspects.

Specifically, among them, more than 50% of the single-point mutant HPPDs have IC50s that are at least 10% higher than wild-type HPPDs. In particular, S310C and R345Q single-point mutant HPPD showed the largest increase in IC50 relative to mesotrione, exceeding 20%; F68S and S310C single-point mutant HPPD had the largest increase in IC50 relative to oxaflutole, exceeding 30%; R345Q And R346L single-point mutant HPPD had the largest increase in IC50 relative to isoxaflutole, more than 20%; wild-type rice HPPD was very sensitive to cyclosulfonone, and most single-point mutant HPPDs had higher IC50 than cyclosulfonone. There are varying degrees of improvement.

Compared with different HPPD inhibitor herbicides, the increase of IC50 of double-point mutant HPPD was significantly higher than that of single-point mutant HPPD. Among them, S310C/R345Q has the largest increase in IC50 relative to mesotrione, reaching 1.8 times that of the wild type; L295Q/R345Q has the largest increase in IC50 relative to oxaflutole and cyclosulfonone, reaching 2.94 times that of the wild type, respectively. Compared with isoxaflutole, the IC50 of P336S/R346L increased the most, reaching 1.67 times that of the wild type, respectively. The increase in IC50 of the three-point mutant HPPD relative to different HPPD inhibitor herbicides was similar to that of the two-point mutant HPPD, and was also significantly higher than that of the single-point mutant.

The increase in IC50 of four-point and five-point mutant HPPD was more obvious than that of different HPPD inhibitor herbicides. Among them, the IC50 of Y216C/R345Q/P336S/R346L was 2.5 times and 3.8 times higher than that of the wild type compared to mesotrione and oxaflutole, respectively, and the IC50 of the five-point mutant HPPD of Y216C/R345Q/P336S/R346L/S310C The increase was even greater, reaching 2.8 times and 4.6 times that of the wild type, respectively. For cyclosulfonone and isoxaflutole, the four- and five-point mutant HPPD did not increase significantly in IC50 compared with two- and three-point mutants.

To sum up, it can be seen that for different types of HPPD inhibitor herbicides, the tolerance of different mutant forms of HPPD is different. In general, with the accumulation of the number of mutation sites, the IC50 values of mutant HPPD to HPPD inhibitor herbicides gradually increased, reflecting the gradual increase in the tolerance of the corresponding mutant HPPD to herbicides. Among them, the tolerance of four- and five-point mutations for cyclosulfonone and isoxaflutole was significantly better than that of single-point, double-point and three-point mutations; for cyclosulfonone and isoxaflutole, the two- and three-point mutations The tolerance of point mutation is obviously better than that of single point mutation, but further increasing the number of mutation sites has little effect on the increase of tolerance. The above results provide a valuable reference for subsequent transgenic experiments and applications.

In addition, it is worth noting that in addition to the increase in IC50 value of HPPD containing M392I single point mutation and double point mutation, the catalytic rate of background enzyme is also significantly higher than that of wild type, which is about 2 times that of wild type, indicating that M392I is a The mutant form has good application potential even at the expression level equivalent to that of the wild-type HPPD, and is especially suitable for in situ transformation of the HPPD gene using techniques such as gene editing.

Example 7. Construction of rice expression vector of mutant HPPD gene and transformation of Agrobacterium

According to the coding region sequence of the rice HPPD gene, gene-specific primers with restriction sites added at both ends were designed, HPPD-1: GTTACTTCTGCACTAGGTACCATGCCTCCCACTCCCACC and HPPD-2: CTTAGAATTCCCGGGGATCCCTAGGATCCTTGAACTGTAGGGGC, 8 kinds of single-point to five-point color development results were comprehensively selected. Point mutant HPPD (F68S, F132S, V266A, S310C, V313I, P336S, R345Q and M392I), 9 double point mutant HPPDs (Y216C/R345Q, P336S/R346L, L295Q/S310C, F68S/S310C, S310C/R345Q, S310C/G415A, S310C/V313I, L295Q/R345Q, S310C/M392I), three three-point mutant HPPD (Y216C/P336S/R345Q, Y216C/R345Q/R346L, L92I/S310C/V313I) and three five-point mutants HPPD (Y216C/S310C/P336S/R345Q/R346L, V29A/Y216C/S310C/P336S/R345Q and V52I/Y216C/S310C/P336S/R345Q), using the pET28a-mHPPD vector containing the corresponding mutation as a template, amplify the corresponding mutation Type HPPD gene coding region DNA sequence, after 1% agarose gel electrophoresis, use the aforementioned kit to cut the gel and purify it, and carry out double digestion with restriction enzymes BamHI and Kpn I; Weizan, China), the HPPD fragment was ligated into the pCambia1390-ZmPUBI vector (ZmPUBI, the promoter of the maize Ubiquitin 1 gene) (Figure 15), using primers PUBI-SF and OsHPPD-CR (PUBI-SF: GCCCTGCCTTCATACGCT and OsHPPD-CR: CTAGGATCCTTGAACTGTAGGGGC) carried out colony PCR on the monoclonal colonies, picked 8 monoclones from each transformed plasmid for colony PCR detection, picked 1 positive clone from them, extracted the plasmids with a plasmid mini-extraction kit, and used primers PUBI-SF and Sanger sequencing was performed on NOST-SR (PUBI-SF: GCCCTGCCTTCATACGCT, NOST-SR: TGCCAAATGTTTGAACGATC), and Vector NIT software was used to compare with the wild-type rice HPPD gene sequence to verify the correctness of the HPPD gene mutation site and the linker with the promoter , construct the expression vector pC to obtain the mutant rice HPPD gene corresponding to the mutation site 1390-PUBI-mHPPD, the concentration of the correctly sequenced plasmid was determined by microspectrophotometer, and the determination results were pC1390-UBI-mHPPD-F68S, 313ng/μL; pC1390-UBI-mHPPD-F132S, 225ng/μL; pC1390-UBI -mHPPD-V266A, 374ng/μL; pC1390-UBI-mHPPD-S310C, 295ng/μL; pC1390-UBI-mHPPD-V313I, 303ng/μL; pC1390-UBI-mHPPD-P336S, 280ng/μL; pC1390-UBI-mHPPD -R345Q, 357ng/μL; pC1390-UBI-mHPPD-M392I, 257ng/μL; pC1390-UBI-mHPPD-Y216C/R345Q, 378ng/μL; pC1390-UBI-mHPPD-P336S/R346L, 296ng/μL; pC1390-UBI -mHPPD-L295Q/S310C, 295ng/μL; pC1390-UBI-mHPPD-F68S/S310C, 340ng/μL; pC1390-UBI-mHPPD-S310C/R345Q, 288ng/μL; pC1390-UBI-mHPPD-S310C/G415A, 346ng /μL; pC1390-UBI-mHPPD-S310C/V313I, 246ng/μL; pC1390-UBI-mHPPD-L295Q/R345Q, 298ng/μL; pC1390-UBI-mHPPD-S310C/M392I, 269ng/μL; -Y216C/P336S/R345Q, 215ng/μL, pC1390-UBI-mHPPD-Y216C/R345Q/R346L, 266ng/μL, pC1390-UBI-mHPPD-L92I/S310C/V313I, 224ng/μL, pC1390-UBI-mHPPD-Y216C /S310C/P336S/R345Q/R346L, 227ng/μL; pC1390-UBI-mHPPD-V29A/Y216C/S310C/P336S/R345Q, 309ng/μL; pC1390-UBI-mHPPD-V52I/Y216C/S310C/P336S/R345Q, 482ng/μL /μL.

Using the heat shock method, 1 μL of the above-mentioned rice HPPD gene expression vector plasmid was added to 100 μL of slowly thawed competent cells of Agrobacterium strain EHA105 (Vedida, China), frozen in liquid nitrogen for 5 min, water bath at 42°C for 5 min, iced Place on the plate for 5 min, add 500 μL of LB liquid medium, and shake at 28°C for 3 hours of recovery culture. Take 100 μL of the recovery culture product and spread it evenly on a solid LB medium plate containing 50 μg/mL rifampicin and 50 μg/mL kanamycin. , placed in an incubator at 28°C for 36h upside-down culture, picked monoclonal colonies, and performed colony PCR using primers PUBI-SF and OsHPPD-CR. For the transformation product of each plasmid, identify 8 Agrobacterium monoclones, and if a specific band of 1.4 kb can be amplified, it is a positive colony containing the target plasmid. In order to prevent the low infection activity of individual single colonies, 3 single clones of each plasmid were picked for Agrobacterium-mediated rice genetic transformation.

Example 8. Agrobacterium-mediated rice genetic transformation and identification of transgenic positive plants

1) Obtainment of callus: choose plump and healthy rice variety Nipponbare seeds to remove hulls; sterilize the surface in 70% ethanol for 1 min with constant shaking; then disinfect with 3% sodium hypochlorite containing 1 drop of Tween-20 for 30 minutes , in the meantime, shake on a shaker; wash 5 times with sterilized distilled water, about 2min each time, and shake continuously during the period; then use tweezers to pick out the washed seeds and place them in a petri dish covered with 5 layers of sterile filter paper , spread the seeds evenly on the filter paper, and then cover it with 5 layers of filter paper to dry the seeds; place 15 seeds on the callus induction solid medium (N6 salt, 4 g; inositol, 0.1 g; proline, 2.8g; hydrolyzed casein, 0.3g; sucrose, 30g; 2g/mL 2,4-D, 1mL; phytogel, 4g; add deionized water to 1L; autoclave) to bury the endosperm into the medium Inside, the embryos are exposed on the surface of the medium, so that the scutellum is just in contact with the medium; the culture dish is placed in a 28°C culture room and cultured under long-day light conditions (16h light/8h dark) for about 4 weeks, until a large amount of texture grows. Hard and bright yellow callus;

2) Agrobacterium preparation and co-cultivation: Dip 3 single colonies containing the corresponding HPPD expression vector with a sterile toothpick and inoculate them in 20 mL of liquid LB medium containing 50 μg/mL rifampicin and 50 μg/mL kanamycin , shake culture for 36h; centrifuge at 5000rpm for 2min, add 1mL liquid N6 medium (N6 salt, 4g; inositol, 0.1g; hydrolyzed casein, 1g; glucose, 10g; sucrose, 30g; 2g/mL 2,4-D, 1mL; add deionized water to 1L; autoclave; after cooling, add 100mM acetosyringone, 1mL) to resuspend the bacteria, use a UV spectrophotometer to measure the concentration of the bacteria solution, and then use liquid N6 medium to resuspend the Agrobacterium Dilute to OD ₆₀₀ = 0.08; use tweezers that have been sterilized at 300°C and then aired to cool, pick up the rice callus block, soak it in the diluted Agrobacterium solution, and let it stand for 20 minutes; pour out the Agrobacterium solution, Use sterile tweezers to pick up the rice callus, place it in a petri dish covered with 5 layers of sterile filter paper, spread the callus, then cover it with 5 layers of filter paper, and dry the callus for 2 hours; Add 500 μL of liquid N6 medium to the top, place a sterile filter paper with a diameter equivalent to that of the petri dish on the surface of the medium, make the liquid evenly infiltrate the filter paper, and place the dried callus on the co-cultivation medium ( N6 salt, 4g; inositol, 0.1g; hydrolyzed casein, 1g; glucose, 10g; sucrose, 30g; 2g/mL 2,4-D, 1mL; Sterilize; add 100 mM acetosyringone, 1 mL) after cooling; seal the petri dish containing the callus with breathable tape (3M, USA), then wrap the medium with tin foil, and co-cultivate at 25°C for 3 days in the dark ;

3) Screening of positive callus: use sterile forceps to wash the co-cultured callus with sterile water for 5 times, and then wash once with sterile distilled water containing 500 μg/mL carbenicillin sodium; The tissue is placed in a petri dish covered with 5 layers of sterile filter paper, the callus is spread out, and then covered with 5 layers of filter paper on it to dry, and then the dried callus is transferred to recovery medium (N6 salts). , 4g; inositol, 0.1g; hydrolyzed casein, 1g; glucose, 10g; sucrose, 30g; 2g/mL 2,4-D, 1mL; add deionized water to 1L; autoclave; add 250mg/mL after cooling mL carbenicillin, 1 mL), placed in a 28°C culture room, and cultured for 3 days under long-day light conditions (16h light/8h dark); use sterile tweezers to transfer the recovered callus to a medium containing 50 μg/mL Selection medium for hygromycin (N6 salt, 4g; inositol, 0.1g; hydrolyzed casein, 1g; glucose, 10g; sucrose, 30g; 2g/mL 2,4-D, 1mL; add deionized water to 1L ; high pressure sterilization; after cooling, add 200mg/mL carbenicillin sodium, 1mL; add 50mg/mL hygromycin B, 1mL), and cultivate under long-day conditions for 2 to 4 weeks, until there is a new firm and tender tender yellow callus grows;

4) Regeneration and culture of transgenic plants: The newly grown hygromycin-resistant callus on the selection medium was transferred to regeneration medium (MS salt, 4.33 g; hydrolyzed casein, 2 g; sorbose) with sterile tweezers Alcohol, 30g; sucrose, 30g; 2g/mL 2,4-D, 1mL; add deionized water to 1L; autoclave; after cooling, add 200mg/mL carbenicillin sodium, 1mL; add 50mg/mL hygromycin B, 1mL; 1mg/mL NAA, 20μL; 1mg/mL Kinetin, 2mL), cultured under long-day conditions (16h light/8h dark) for 2 to 4 weeks, until green seedlings grew; The green seedlings were clipped and placed in solid 1/2MS medium containing 25 μg/mL hygromycin until the seedlings grew to 5-8 cm; the seedlings were taken out, washed and placed in clean water, cultured at 28°C in a long day Condition the seedlings for 3 to 5 days; transplant the transgenic seedlings into the soil and plant them in a greenhouse at 32°C under long-day light conditions;

When the transgenic plants grow to the 4-5 leaf stage, use the kit to extract the DNA of the surviving transgenic seedlings (Kang Weijie, China) as a template, and use the primers PUBI-SF and OsHPPD-CR to carry out PCR amplification, which can be amplified. The single plant that produces the target band is the HPPD transgenic positive plant. The present invention obtains 11 single-point mutation HPPD genes and 3 five-point mutation HPPD genes corresponding to transgenic plants, and each transformation event identifies at least 23 independent of transgenic lines.

Example 9. Herbicide treatment of transgenic plants expressing mutant HPPD

For 23 different mutant HPPD transgenic plants (pC1390-UBI-mHPPD-F68S; pC1390-UBI-mHPPD-F132S; pC1390-UBI-mHPPD-V266A; pC1390-UBI-mHPPD-S310C; pC1390-UBI-mHPPD-V313I pC1390-UBI-mHPPD-P336S; pC1390-UBI-mHPPD-R345Q; pC1390-UBI-mHPPD-M392I; pC1390-UBI-mHPPD-Y216C/R345Q; pC1390-UBI-mHPPD-P336S/R346L; -L295Q/S310C; pC1390-UBI-mHPPD-F68S/S310C; pC1390-UBI-mHPPD-S310C/R345Q; pC1390-UBI-mHPPD-S310C/G415A; pC1390-UBI-mHPPD-S310C/V313I; -L295Q/R345Q; pC1390-UBI-mHPPD-S310C/M392I; pC1390-UBI-mHPPD-Y216C/P336S/R345Q; pC1390-UBI-mHPPD-Y216C/R345Q/R346L; ; pC1390-UBI-mHPPD-Y216C/S310C/P336S/R345Q/R346L; pC1390-UBI-mHPPD-V29A/Y216C/S310C/P336S/R345Q; For progeny, 10 to 15 offspring of transgene-positive individual plants were selected for each and planted in soil seeds. When the seedlings grew to the 3-leaf stage, each individual plant was extracted as a template, and the primers PUBI-SF and OsHPPD-CR were used for PCR amplification. Increase (PUBI-SF: GCCCTGCCTTCATACGCT and OsHPPD-CR: CTAGGATCCTTGAACTGTAGGGGC), according to the Mendelian segregation ratio of 1:3 (plants without the target band: plants with the target band), select the transgenic lines containing a single copy insertion Line, keep and continue to plant to the 4-5 leaf stage, use 1 times of mesotrione (6g a.i./mu as 1 times), 1 times of oxaflutole (1.5g a.i./mu as 1 times), 1 times of isotrizone Oxaflutole (6g a.i./mu as 1x) and 1x Cyclofenone (1.5g a.i. /mu as 1 times) transgenic plants treated with single point mutant HPPD gene. The transgenic plants of the multi-point mutant HPPD gene were treated with 2 times of mesotrione, oxaflutole, isoxaflutole and cyclopentazone. Use a pneumatic sprayer (GARDENA, Germany) to spray the transgenic positive plants on the foliar surface, so that the droplets are evenly distributed on the surface of the leaves, and the transformed recipient variety is used as a control; in a 28 °C culture room, under long-day conditions, continue to After culturing for 2 weeks, the growth status of the corresponding plants was observed, and the individual plants of 3 representative independent lines were selected for photographing and recording (Figures 16-19). Among them, the wild-type control plants either no longer grow new leaves, or the new leaves that grow are completely albino, most of the old leaves are dry, and the plants grow slowly; transgenic plants that are tolerant to the corresponding HPPD inhibitor herbicides can New leaves grow, and the new leaves are still green, and the plants can continue to grow to a certain extent; the herbicides used are mesotrione (Shengbang Luye, China), oxaflutole (BASF, Germany), cyclohuang ketone, isoxaflutole (prepared by our laboratory).

Claims (15)

1. A rice HPPD mutant protein, characterized in that the amino acid sequence of the rice HPPD mutant protein has any one or more of the following mutations: it corresponds to the 29th, 52nd, 54th, 68, 92, 99, 117, 120, 132, 133, 146, 156, 206, 216, 237, 238, 244, 266, 270, 273, 277, 282, 295, 297, 310, 313, 315, 316, 325, 333, 336, 338, 344, 345, 346, 349, 357, 388, 392, 404, 406, 408, 415 and 423 amino acids were mutated; wherein, the 277th position was mutated from proline to valine , 336 from proline to serine, 338 from aspartic acid to lysine or isoleucine or threonine, 346 from arginine to leucine, 392 From methionine to isoleucine, and from glycine to alanine or asparagine or serine at position 415.
2. The rice HPPD mutant protein according to claim 1, wherein the amino acid sequence of the rice HPPD mutant protein corresponds to the amino acid sequence of wild-type rice HPPD, and has one or more mutant forms selected from the following : V29A, V52I, L54F, F68S, L92I, P99L, T117I, S120A, F132S, A133T, R146L, A156V, E206Q, E206V, Y216C, Y237N, I238T, F244L, V266A, N270D, T21S, HC L295Q, V297R 、S310V、S310A、S310G、S310T、V313M、V313I、V313L、G315A、G315S、G315R、T316K、A325D、A333P、R344K、R345L、R345Q、D349G、N357S、F388L、S404G、S404L、S404T、Q406R、Y408H和E423G .
3. The rice HPPD mutant protein according to claim 1 or 2, characterized in that it comprises:

   (a) its amino acid sequence is selected from SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO: 50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:72, SEQ ID NO:74, SEQ ID NO:76, SEQ ID NO:78, SEQ ID NO:80, SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120 or SEQ ID NO: 122; or

   (b) A protein derived from (a) having the amino acid sequence in (a) substituted and/or deleted and/or added with one or more amino acids and having p-hydroxyphenylpyruvate dioxygenase activity.
4. The rice HPPD mutant protein according to any one of claims 1 to 3, wherein the amino acid sequence of the mutant HPPD protein has any one of the following amino acid mutations: R345Q/R346L, Y216C/R345Q , P336S/R346L, V29A/R346L, L295Q/S310V, V29A/S310C, S310C/G415A, S310C/G415N, L295Q/R345Q, L295Q/S310C, L54F/R345Q, L54F/R346L, S12660A/S3 /S310C, V266A/R345Q, S310C/M392I, S310C/R345Q, T273S/S310C, L92I/M392I, S310C/V313I, Y216C/P277V/R345Q, Y216C/P336S/R345Q, Y216C/R329A/R345Y1R , Y216C/R345Q/G415A, Y216C/R345Q/E423G, L92I/S310C/V313I, V52I/Y216C/R345Q, Y216C/R345Q/F388L, P336S/R345Q/R346L, L295Q/S310C/G420/S310C /L295Q/S310C, L295Q/S310C/F388L, L54F/L295Q/R345Q, L92I/L295Q/R345Q, L295Q/S310C/R345Q, L54F/S310C/G415A, L92V/S310C/G415A, V2615C/G415C/S300I /G415A, L54F/P336S/R346L, L92I/P336S/R346L, S310C/P336S/R346L, V29A/S310C/V313I, L54F/S310C/V313I, I238T/S310C/V313I, L54F/Y316C/R354 /R345Q, Y216C/P336S/R345Q/R346L, V52I/Y216C/P336S/R345Q, Y216C/P336S/R345Q/E423G, Y216C/S310C/R345Q/G415A, L54F/Y216C/S310C/R3645Q/S10210C/R3345Q/YR , V52I/Y216C/S310C/R345Q, Y216C/ S310C/R345Q/F388L, S310C/P336S/R345Q/R346L, V29A/L295Q/S310C/G415A, V52I/L295Q/S310C/G415A, L54F/L295Q/S310C/G415A, L295Q/S310C/G410C/16C/M39 P336S/R345Q/R346L, V29A/Y216C/S310C/P336S/R345Q and V52I/Y216C/S310C/P336S/R345Q.
5. The rice HPPD mutant protein according to claim 4, wherein the amino acid sequence of the mutant HPPD protein has any one of the following amino acid sequences: SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:126, ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO :144, SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160 , SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, SEQ ID NO:176 ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO :194, SEQ ID NO:196, SEQ ID NO:198, SEQ ID NO:200, SEQ ID NO:202, SEQ ID NO:204, SEQ ID NO:206, SEQ ID NO:208, SEQ ID NO:210 , SEQ ID NO:212, SEQ ID NO:214, SEQ ID NO:216, SEQ ID NO:218, SEQ ID NO:220, SEQ ID NO:222, SEQ ID NO:224, SEQ ID NO:226, SEQ ID NO:226 ID NO:228, SEQ ID NO:230, SEQ ID NO:232, SEQ ID NO:234, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:240, SEQ ID NO:242, SEQ ID NO :244, SEQ ID NO:246, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:252 or SEQ ID NO:254.
6. A nucleic acid or gene encoding the mutant protein according to any one of claims 1 to 5.
7. The nucleic acid or gene according to claim 6, characterized in that it comprises:

   (i) it encodes the protein of any one of claims 1 to 5; or

   (ii) a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence of a nucleic acid or gene as defined in (i) and encodes a protein having p-hydroxyphenylpyruvate dioxygenase activity; or

   (iii) its nucleotide sequence is selected from any one of the following nucleotide sequences or their complementary sequences: SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 , SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:19 ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO :43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59 , SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:69 ID NO:77, SEQ ID NO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO :93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109 , SEQ ID NO:111, SEQ ID NO:113, SEQ ID NO:115, SEQ ID NO:117, SEQ ID NO:119, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:125, SEQ ID NO:125 ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO : 143, SEQ ID NO: 145, SEQ ID NO :147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:153, SEQ ID NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163 , SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:179 ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO :197, SEQ ID NO:199, SEQ ID NO:201, SEQ ID NO:203, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:209, SEQ ID NO:211, SEQ ID NO:213 , SEQ ID NO:215, SEQ ID NO:217, SEQ ID NO:219, SEQ ID NO:221, SEQ ID NO:223, SEQ ID NO:225, SEQ ID NO:227, SEQ ID NO:229, SEQ ID NO:229 ID NO:231, SEQ ID NO:233, SEQ ID NO:235, SEQ ID NO:237, SEQ ID NO:239, SEQ ID NO:241, SEQ ID NO:243, SEQ ID NO:245, SEQ ID NO :247, SEQ ID NO:249, SEQ ID NO:251 or SEQ ID NO:253.
8. An expression cassette, recombinant vector or cell, characterized in that it contains the nucleic acid or gene according to claim 6 or 7.
9. Application of the rice HPPD mutant protein according to any one of claims 1 to 5, the nucleic acid or gene according to claim 6 or 7, and the expression cassette, recombinant vector or cell according to claim 8 in plant herbicide resistance .
10. The application according to claim 9, wherein the herbicide comprises one or more of triketones, pyrazolones and isoxazolones.
11. A method for obtaining herbicide-resistant plant cells, plant tissues, plant parts or plants, comprising the steps of:

    1) causing the plant to comprise the nucleic acid or gene of claim 6 or 7; or

    2) expressing the mutant rice HPPD protein of claims 1 to 5 in a plant; or

    3) Obtain the nucleic acid or gene according to claim 6 or 7, or the mutant rice HPPD protein according to any one of claims 1 to 5 or a biologically active fragment thereof by a method of mutation; or

    4) Gene editing of plant cells, plant tissues, plant parts or endogenous HPPD genes of plants to express the mutant rice HPPD protein according to any one of claims 1 to 5 therein.
12. 12. The method of claim 11, comprising the steps of error-prone PCR, gene editing, transgenic, cross-breeding, backcrossing, or asexual reproduction.
13. A method for identifying a plant, wherein the plant is a plant comprising the nucleic acid or gene of claim 6 or 7, a plant expressing the protein of any one of claims 1 to 5, or a plant composed of any of claims 11 to 12. The plant that any described method obtains, is characterized in that, comprises the following steps:

    1) determining whether the plant comprises the nucleic acid or gene of claim 6 or 7; or

    2) Determining whether the plant expresses the mutant protein of any one of claims 1-5.
14. A method for controlling weeds, comprising: applying an effective dose of herbicide to the field of planting crops, the crops comprising the nucleic acid or gene according to claim 6 or 7 or the expression cassette according to claim 8 , a recombinant vector or cell, and the herbicide is an HPPD inhibitor herbicide, including one or more of triketones, pyrazolones and isoxazolones.
15. A method for protecting plants from damage caused by herbicides, comprising: applying an effective dose of herbicides to a field where crops are grown, the crops comprising the nucleic acid or gene according to claim 6 or 7 Or introduce the expression cassette and the recombinant vector of claim 8 into a plant, and the plant after the introduction produces a herbicide-resistant protein, and the herbicide includes one of triketones, pyrazolones and isoxazolones or variety.

Images