WO2022148388A1 - Multi-amplification method - Google Patents

Abstract

Provided in the present application is a multi-amplification method, mainly comprising two processes of linear amplification induced by a low-concentration capture oligonucleotide and exponential amplification induced by a universal primer. The method comprises: firstly, using a low-concentration specific capture oligonucleotide to bind a target molecule with clear 5'-terminal sequence information and to initiate linear amplification; obtaining a product with a complete hairpin structure by means of self-folding and self-extending of the linear amplification product, and thereby obtaining an amplification intermediate product with a universal sequence being a terminal but comprising a target sequence; and performing an equivalent signal amplification on the amplification intermediate products comprising different target sequences in an exponential amplification manner by means of the same universal primer. The combined linear amplification and universal primer-based exponential amplification detection strategy can finally achieve the purpose of equivalent amplification and detection of multiple target molecules.

Description

A multiplex amplification method technical field

The present application belongs to the field of biotechnology, and relates to a multiplex amplification method.

Background technique

Multiplex PCR (Multiplex polymerase chain reaction, MPCR) refers to the simultaneous amplification of multiple targets through a PCR reaction, and the detection of the amplified products combined with certain detection methods to realize the detection of multiple targets. MPCR has been deeply studied due to its high efficiency, high throughput and low cost, which can not only greatly improve the detection efficiency, but also reduce the detection cost. MPCR has been applied in many fields, including gene mutation and deletion, genotyping and quantification, genetic testing, companion diagnostics, etc. The current MPCR can be mainly divided into liquid-phase MPCR, microfluidic-based MPCR and solid-phase carrier multiplex PCR.

Liquid-phase MPCR uses multiple target-specific primers to amplify multiple targets, but in this way, multiple amplification primers are introduced into the same reaction. With the increase of the number of target molecules to be detected, the number of nucleotide chains in the tube will also increase by 2 times, and the possibility of forming dimers or even multimers between each nucleotide chain greatly increases. This leads to the emergence of non-specific amplification, the reduction of target amplification efficiency, and the reduction of detection sensitivity and specificity. In severe cases, non-specific amplification dominates and target amplification fails. At the same time, this kind of design method also leads to the problem of inconsistent amplification efficiency of each target molecule. There are also reports of multiplex ligation-dependent probe amplification (MLPA), detection strategies based on hairpin structure (PCT/US2002/037238) and two-round amplification (PCT patent WO 96/41012). MLPA first designs corresponding specific ligation primers and universal amplification primers according to the end information of different target molecules, but this technology not only requires ligation reaction to initiate the reaction, but also suffers from ligase specificity, difficulty in preparing ligation primers, primer quantity and concentration, etc. Interference with amplification. PCT/US2002/037238 adopts an amplification mode based on long primers, although in principle, the information type of the 5' end can be detected, but this scheme requires the addition of enzymes or chemical cleavage steps after the first step of amplification And the complicated pre-amplification purification process not only reduces the sensitivity of the reaction, but also increases the complexity of the operation. PCT patent WO 96/41012 discloses a detection strategy of two rounds of amplification, but this scheme not only cannot detect the information type of the 5' end of multiple specific target sequences, but also has a large number of primers and competition in amplification. question.

Microfluidic chip-based MPCR confines each multiple amplification in its own independent space by pre-filling different primer pairs in the micropores of the chip. Due to the particularity of its amplification method, this type of technology uses a dedicated detection instrument, and its technical complexity makes it difficult to implement.

MPCR based on solid phase carrier mainly includes multiplex detection technology based on liquid phase chip. The LC chip uses the encoded microspheres as the matrix for multiplex detection. Although the liquid-phase chip has the characteristics of multi-throughput and high efficiency in detection, it does not substantially solve the problem of many primers and templates in the multiplex amplification because it needs to perform multiplex amplification in liquid phase and then use encoded microspheres for hybridization identification. The problem of mismatch between them.

In conclusion, although MPCR has broad application prospects, the current technology is faced with problems such as decreased amplification efficiency, inconsistent amplification efficiency between templates, and complicated operation steps. Therefore, there is an urgent need to develop a simple, convenient and efficient single-reaction and multiplex nucleic acid equivalent amplification technology.

SUMMARY OF THE INVENTION

In order to overcome the shortcomings of traditional MPCR technology such as decreased amplification efficiency, inconsistent amplification efficiency between templates, and complicated operation steps, the present application proposes a new multiplex amplification method, which includes two steps: the first step , using capture oligonucleotides to bind target molecules and initiate specific linear amplification to obtain intermediate sequences that can be amplified exponentially by universal primers. In the second step, the multiplex exponential amplification initiated by the universal primer is performed on the multiple intermediate sequences obtained by linear amplification of the target molecule in the first step. The capture oligonucleotide proposed in this application, because of the special molecular sequence design, can not only ensure the specific linear amplification of the target molecule, but also ensure that the linear amplification product can be self-folding and self-extending to form a Universal sequences that are exponentially amplified by universal primers and specific sequences corresponding to multiple target molecules. Since the linear amplification process requires only a low concentration (1/20-1/40 of the concentration of ordinary multiplex PCR primers) single-specific capture oligonucleotides, it not only ensures the specificity of amplification, but also effectively reduces the The concentration and quantity of primers required in the MPCR reaction avoid mutual interference between primers; the multiple exponential amplification initiated by universal primers not only significantly improves the efficiency of amplification, ensures the sensitivity of the reaction, but also realizes the Equivalent amplification of different target molecules. The combination of the above two steps enables the present application to effectively solve the key problems existing in the traditional MPCR amplification technology.

For this purpose, the application adopts the following technical solutions:

In a first aspect, the present application provides a capture oligonucleotide for nucleic acid amplification, the capture oligonucleotide sequentially includes a first universal sequence, a folding sequence and a binding capture sequence from the 5' end to the 3' end ;

The folded sequence is at least partially identical to the sequence at the 5' end of the target molecule;

The binding capture sequence binds complementary to the non-5' terminal sequence of the target molecule.

In this application, the capture oligonucleotide mainly includes three regions: the first universal sequence, the folding sequence and the binding capture sequence. The capture oligonucleotide first captures the target molecule with clear 5'-end sequence information by binding the capture sequence, and then uses The target molecule is used as the template to carry out the extension reaction, and the complementary chain of the target molecule is added to the 3' end of the capture oligonucleotide, and the obtained extended capture oligonucleotide has at least part of the folded sequence of complementary base pairing inside the molecule and its extension. The 3'-end sequence induces self-folding within the molecule, and is further extended under the action of polymerase, and the complementary strand of the first universal sequence is added to the 3'-end to finally obtain a product with a complete hairpin structure. Universal primers and / or target molecule-specific primers for PCR amplification detection.

In some embodiments of the present application, "the 5' terminal sequence of the target molecule" refers to nucleotides 1 to 4, nucleotides 1 to 5, nucleotides 1 to 6 of the 5' end of the target molecule Nucleotides, 1 to 7 nucleotides, 1 to 8 nucleotides, 1 to 9 nucleotides, 1 to 10 nucleotides, 1 to 11 nucleotides, 1 Nucleotide from position 12, nucleotide from 1 to 13, nucleotide from 1 to 14, nucleotide from 1 to 15, nucleotide from 1 to 16, nucleotide from 1 to 17 A nucleotide, a contiguous sequence of nucleotides from 1 to 18, nucleotides from 1 to 19, nucleotides from 1 to 20, or from 1 to more nucleotides.

In some embodiments of the present application, "the folded sequence is at least partially identical to the 5'-terminal sequence of the target molecule" means that the folded sequence is completely identical, or partially identical, to the 5'-terminal sequence of the target molecule.

For example, in some embodiments, the finger fold sequence is identical to the 5' end sequence of the target molecule. In such an embodiment, the folded sequence is fully complementary to the extended 3' sequence in the extended capture oligonucleotide extended with the target molecule as a template and induces intramolecular self-folding.

For example, in other embodiments, the finger fold sequence is identical to the portion of the 5' end sequence of the target molecule. In such embodiments, the folded sequence is partially complementary to the extended 3' end sequence in the extended capture oligonucleotide extended with the target molecule as a template and induces intramolecular self-folding.

In some embodiments of the present application, "non-5' terminal sequence of the target molecule" refers to 3, 4, 5, 6, 7 distances from the first nucleotide at the 5' end of the target molecule , a stretch of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19, or more nucleotides.

In this application, the first universal sequence is an artificially synthesized sequence, which has nothing to do with the target molecule sequence. Therefore, when detecting different target molecules, it is only necessary to design the folded sequence and binding capture sequence of the capture oligonucleotide according to the target molecule, while maintaining The first general sequence is unchanged.

Preferably, the capture oligonucleotide further comprises a second universal sequence.

Preferably, the second universal sequence is located 5' to the binding capture sequence.

In this application, by setting the second universal sequence between the folding sequence and the binding capture sequence, after the elongation and self-folding of the capture oligonucleotide, the obtained hairpin structure product can adopt the same Two universal primers with the same or partially identical universal sequences are used as upstream and downstream primers to perform PCR amplification detection, which can achieve the effect of equivalent amplification of multiple target molecules.

Preferably, the capture oligonucleotide further comprises a nucleic acid extension blocking site located at the 3' end of the folding sequence for blocking the binding of the capture sequence and the folding sequence.

Preferably, the nucleic acid extension blocking site is located at the 5' end of the second universal sequence for blocking the second universal sequence and the folding sequence.

In the present application, setting the nucleic acid extension blocking site at the 3' end of the folding sequence, or more preferably between the second universal sequence and the folding sequence, not only does not affect the self-folding of the extended capture oligonucleotide, Moreover, after the self-folding of the capture oligonucleotide, self-extension can be carried out using itself as a template, and a complementary strand of the first universal sequence that does not belong to the target molecule is added at the 3' end, thereby forming a product with a complete hairpin structure The hairpin structure product can be used as a template for PCR amplification of universal primers and/or target molecule-specific primers to perform PCR exponential amplification, effectively ensuring the specificity and accuracy of amplification.

Preferably, the nucleic acid extension blocking site is modified with substances that can block DNA (deoxyribonucleic acid) polymerase extension, so that the hairpin structure product is amplified by PCR using universal primers and/or target molecule-specific primers , terminate the extension at the nucleic acid extension blocking site, and then generate a linearized amplification template for subsequent exponential amplification to improve the efficiency of amplification;

Preferably, the substance capable of blocking DNA polymerase extension is any one or a combination of at least two of Spacer, thio group or uracil base.

Preferably, the folding sequence is modified with nucleic acid analogs.

In some embodiments of the present application, Spacer refers to polyethylene glycol, preferably polyethylene glycol 18.

It is worth mentioning that due to the limitations of the existing oligonucleotide synthesis technology, the capture oligonucleotide may produce by-products with incomplete sequence fragments during the synthesis process. However, according to the present application, due to the capture oligonucleotide The sequence of the folding region is derived from the target molecule, and the presence of the above-mentioned by-products may cause non-specific amplification; therefore, in order to further improve the specificity of the detection system, the folding sequence of the capture oligonucleotide is modified with nucleic acid analogs, Under the condition of ensuring the normal base complementary pairing function of the folded sequence, the by-product extension of the synthesized capture oligonucleotide is inhibited, and the non-specific amplification of the original gene fragment or genome is blocked, thereby improving the specificity of the detection system.

Preferably, the nucleic acid analogs include peptide nucleic acids, locked nucleic acids, transposed bases, 2'-O,4'-C-methylene bridge RNA (2'-O,4'-C-methylene bridge ribonucleic acid ), 2'-O-methyl RNA (2'-O-Methyl RNA), or 2'-fluoro RNA (2'-Fluoro RNA), or a combination of at least two.

In this application, a transposed base is a type of base that is in the opposite direction to the normal base, and the 3' end of the base forms a 3-3-phosphodiester bond with the 3' end of the upstream base, which forms a 3-3-phosphodiester bond with the downstream base. The 5' end forms a 5-5-phosphodiester bond, which can inhibit the extension of DNA polymerase and the degradation of exonuclease during the extension process.

In a second aspect, the present application provides a nucleic acid amplification kit, which includes the capture oligonucleotide described in the first aspect.

Preferably, the kit further includes a target nucleic acid pretreatment reagent, which is used to generate a target molecule with a clear type of sequence information at the 5' end.

Preferably, the pretreatment reagent includes any one or a combination of at least two of a nuclease capable of site-specific cleavage, a nucleic acid extension blocker, or a specific primer.

Preferably, the 5' end of the specific primer contains a modification group.

Preferably, the modifying group includes a phosphate group and/or a thio group.

Preferably, the kit further includes universal primers.

Preferably, the nucleic acid sequence of the universal primer is identical or partially identical to the first universal sequence or the second universal sequence.

In this application, the amplification reaction based on universal primers uses the target molecule determined by the 5' end sequence information as the template. The resulting 5'-end sequence information is type-specific for the target molecule.

In this application, the types of nucleic acid sequences with clear 5'-end sequence information include normal nucleic acid sequences, modified nucleic acid sequences, single nucleotide mutations, sequence transposition, sequence deletion, sequence recombination and other different types.

Preferably, a target molecule with clear sequence information at its 5' end, such as a mature microRNA, a microRNA precursor, cfDNA (cell free DNA), and the like.

Preferably, the target molecule with clear 5'-end sequence information can be obtained by the method of cleaving or blocking by chemical factors, including polypeptide nucleic acid (PNA) modified short oligonucleotide chain complementary to the target sequence, locked nucleic acid (LNA) Modified short oligonucleotide chain complementary to target sequence, Methoxy modified short oligonucleotide chain complementary to target sequence, RNA modified short oligonucleotide chain complementary to target sequence, 2-fluoro modified short oligonucleotide chains complementary to the target sequence, reverse base modified short oligonucleotide chains complementary to the target sequence, phosphate group modified short oligonucleotide chains complementary to the target sequence, thiols Any one or a combination of at least two of the group-modified short oligonucleotide chains that are complementary to the target sequence, and the like.

Preferably, the target molecule intermediate product with clear 5'-end sequence information can be obtained by cutting or blocking biological methods, including AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG) ), nucleic acid restriction endonucleases, methylation-dependent nucleic acid restriction endonucleases, methylation-sensitive nucleic acid restriction endonucleases, nickases, giant nucleases, zinc finger nucleases (ZFNs), transcriptional activation Any one or a combination of at least two of T-like effector nucleases (TALENs), CRISPR-Cas, and the like.

In this application, the amplification reaction can only occur with the participation of the capture oligonucleotide, the universal primer and/or the specific primer, which is briefly described as follows: In the dual universal primer amplification system, the nucleic acid sequence of the universal primer used The PCR amplification reaction cannot be initiated in the absence of the target molecule defined by the 5' end sequence that is identical or partially identical to the first universal sequence or the second universal sequence of the capture oligonucleotide. When there is a target molecule with a defined 5'-end sequence in the system, the extension reaction initiated by the capture oligonucleotide will be triggered to form an intermediate product with a hairpin structure, which will be used as a template for the universal primer amplification reaction At the same time, since the extended capture oligonucleotide can self-fold and form a hairpin structure only when the extension sequence and the folding sequence of the extension reaction can form a complementary pairing, the specificity of the reaction is effectively ensured. The extension sequence and the folded sequence may be perfectly complementary or incompletely complementary.

Preferably, the kit further includes specific primers.

In this application, when the capture oligonucleotide only includes the first universal sequence, the folding sequence and the binding capture sequence, but does not include the second universal sequence, that is, in a single universal primer amplification system, a universal primer and a target are used. Molecular-specific primers are used as the upstream and downstream primers of PCR, which further improves the specificity and sensitivity of the reaction; the method of the present application is used to detect target molecules of the same concentration and different sequences, and the obtained Ct values are basically the same, which proves this method. Equivalent amplification performance can also be guaranteed for different target molecules.

Preferably, the kit further includes detection probes.

Preferably, the detection probe is labeled with a fluorophore and/or a quencher group.

In the present application, a detection probe labeled with a fluorescent group and/or a quenching group is used for hybridization and complementation with the amplification product, which is beneficial to realize real-time quantitative detection of the amplification product.

Preferably, the fluorophore is labeled at the 5' end of the detection probe.

Preferably, the quencher group is labeled at the 3' end of the detection probe.

Preferably, the fluorescent groups include FAM ^TM (carboxyfluorescein), VIC ^TM (green fluorescent protein), JOE ^TM (2,7-dimethyl-4,5-dichloro-6-6 carboxyl fluorescence), TET ^TM (tetrachloro-6-carboxyfluorescein), CY ^TM 3 (maleimide 3), CY ^TM 5 (maleimide 5), ROX ^TM (rhodamine X maleimide), Either Texas Red ^™ (sulfonated rhodamine 101 chloric acid) or LC RED460 ^™ .

Preferably, the quenching group includes any one of BHQ1 ^™ (Black Hole Quencher1), BHQ2 ^™ , BHQ3 ^™ , Dabcyl or Tamra (carboxytetramethylrhodamine).

In a third aspect, the present application provides a nucleic acid detection method, which comprises using a capture oligonucleotide to bind a target molecule and initiate specific linear amplification and universal primer-based nucleic acid amplification detection.

Preferably, the capture oligonucleotide binds to the target molecule and initiates specific linear amplification comprising the following steps:

(1) The target molecule determined by the 5' end sequence is combined with the binding capture sequence of the capture oligonucleotide;

(2) The capture oligonucleotide uses the target molecule as a template to carry out an extension reaction, and a nucleotide complementary to the target molecule is added to the 3' end of the capture oligonucleotide to form an extended capture oligonucleotide;

(3) The extended capture oligonucleotide is combined with the folding sequence inside the molecule through the extended sequence to form a half-hairpin structure product;

(4) The half-hairpin structure product is then subjected to an extension reaction, and a nucleotide complementary to the first universal sequence inside the molecule is added to the 3' end to form a complete hairpin structure product.

Preferably, the nucleic acid amplification detection based on universal primers comprises the following steps:

Using the intact hairpin structure product as a template, using universal primers and/or specific primers to perform exponential amplification to obtain an amplification product.

Preferably, the nucleic acid sequence of the universal primer is identical or partially identical to the first universal sequence or the second universal sequence of the capture oligonucleotide.

Preferably, the exponential amplification includes polymerase chain reaction, such as any one of ordinary PCR, qPCR or digital PCR.

Preferably, the method further includes the step of combining the amplification product with the detection probe for detection.

The application also provides a nucleic acid amplification method, comprising:

(1) contacting a target molecule whose 5'-end sequence is determined with the capture oligonucleotide provided by the present application, whereby the binding capture sequence of the capture oligonucleotide binds to the target molecule;

(2) The capture oligonucleotide is subjected to an extension reaction using the target molecule as a template, whereby a nucleotide complementary to the target molecule is added to the 3' end of the capture oligonucleotide to form an extended capture oligonucleotide ;

(3) Incubating the extended capture oligonucleotide under conditions that allow intramolecular self-folding, whereby the extended capture oligonucleotide undergoes complementary base pairing with the folded sequence through the extension sequence to form a half-hairpin structure product ;and

(4) subjecting the half-hairpin structure product to an extension reaction, thereby adding a nucleotide complementary to the first universal sequence at the 3' end, thereby forming a complete hairpin structure product.

In some specific embodiments, the method further comprises using the intact hairpin structure product as a template, and using universal primers and/or specific primers to perform exponential amplification to obtain an amplification product. In some more specific embodiments, the nucleic acid sequence of the universal primer is the same or partially the same as the first universal sequence or the second universal sequence of the capture oligonucleotide.

Compared with the prior art, the present application has the following beneficial effects:

(1) The nucleic acid detection kit of the present application does not require additional steps such as ligation reaction and chemical treatment of the amplified product, and as long as the sequence information at the 5' end of the target molecule is clear, multiple detection of nucleic acid with high specificity and high sensitivity can be realized;

(2) In the nucleic acid detection kit of the present application, the capture oligonucleotide and the universal primer are specially designed to cooperate with each other. In the presence of the target molecule, the target molecule triggers the extension reaction triggered by the capture oligonucleotide, forming a The hairpin structure product is used as the template for the amplification reaction of universal primers and/or specific primers. Since the amplification reaction is based on the product determined by the 5' sequence, the problem of false positives is effectively avoided;

(3) In this application, when the 3' extension sequence of the capture oligonucleotide and the folded sequence can form a complementary pairing, the self-folding of the capture oligonucleotide can be triggered to form a hairpin structure, which effectively ensures the specificity of the reaction;

(4) When the nucleic acid detection kit of the present application detects different target molecules, it only needs to design the folding sequence and binding capture sequence of the capture oligonucleotide according to the target molecule, while keeping the first general sequence unchanged, to a great extent Reduce the interference between multiple primers in multiple target amplification and improve the sensitivity of amplification;

(5) The nucleic acid detection kit of the present application achieves the purpose of signal amplification through the exponential amplification process, which not only can well meet the demand for sensitivity during DNA/RNA detection, but also uses only extended capture oligos in the exponential amplification process. Nucleotides and universal primers can be used to achieve equivalent amplification of multiple target molecules on the premise of keeping the number and concentration of universal primers unchanged, avoiding the deviation of amplification efficiency caused by sequence differences;

(6) The nucleic acid detection kit of the present application is easy to operate.

Description of drawings

Fig. 1(A) is a schematic diagram of double universal primer amplification, and Fig. 1(B) is a schematic diagram of single universal primer amplification;

Fig. 2 is a schematic diagram of constructing a target molecule with a clear 5'-end sequence;

Figure 3 shows the results of qPCR detection of miRNA27a and let-7a;

Figure 4 is a graph showing the results of agarose gel detection of multiple human genes;

Figure 5 is a graph showing the results of detection of rifampicin 526 resistance mutation of Mycobacterium tuberculosis;

Fig. 6 is the result diagram of qPCR detection Septin 9 gene;

Fig. 7 is the result diagram of ddPCR detection Septin 9 gene;

Figure 8(A) shows the sensitivity detection results of Septin 9 gene in methylated samples with different concentrations, and Figure 8(B) shows the sensitivity detection results of RASS-F1 gene in methylated samples with different concentrations;

Figure 9(A) shows the detection specificity results of common capture oligonucleotides, and Figure 9(B) shows the detection specificity results of LNA modified capture oligonucleotides;

Figure 10 is a graph showing the results of qPCR detection of RASS-F1 gene.

Detailed ways

In order to further illustrate the technical means adopted in the present application and its effects, the present application will be further described below with reference to the embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are only used to explain the present application, but not to limit the present application.

If no specific technique or condition is indicated in the examples, the technique or condition described in the consensus literature in the field or the product specification is used. The reagents or instruments used without the manufacturer's indication are conventional products that can be purchased through regular channels.

Example 1 The basic principle of the amplification of the present application

This application includes two modes: double universal primer mode and single universal primer mode, the principle is shown in Figure 1 (A) and Figure 1 (B).

In the dual universal primer amplification, the capture oligonucleotide includes four regions: the first universal sequence U1s, the folding sequence T1s, the second universal sequence U2s and the binding capture sequence T2a, the capture oligonucleotide first passes through the binding capture sequence T2a The target molecule whose 5'-end sequence is determined is captured, and then the target molecule is used as a template to carry out an extension reaction, and the complementary strand T1a of the folded sequence T1s is added to the 3'-end to obtain an extended capture oligonucleotide. T1a and T1s can be completely complementary or incomplete, as long as T1a and T1s can induce intramolecular self-folding and form a half-hairpin structure product. The half-hairpin structure product continues to be further extended under the action of polymerase, and the complementary chain U1a of the first universal sequence U1s is added to the 3' end to obtain a hairpin structure product, which can be the same as the first universal sequence U1s. PCR amplification detection is carried out with universal primers identical to or partially identical to the second universal sequence U2s. The specific method is that the universal primer U1s (here is referred to by U1s for the convenience of illustration, the actual sequence may not be completely the same as U1s) is combined with the U1a region of the hairpin structure product in the annealing stage and extended, when the hairpin structure product is When there is a nucleic acid extension blocking site between the second universal sequence and the folding sequence, the extension stops at the nucleic acid extension blocking site, forming a local double-stranded structure. The PCR template of U2s can use the universal primers U1s and U2s for subsequent PCR amplification detection. When there is no nucleic acid extension blocking site between the second universal sequence of the hairpin structure product and the folding sequence, the universal primer U1s is extended to form a complete double-stranded structure, and the local area of the newly generated double-stranded structure is the universal primer U1s and U2s PCR template, you can use the universal primers U1s and U2s for subsequent PCR amplification detection.

In the single universal primer amplification, the capture oligonucleotide mainly includes three regions: the first universal sequence U1s, the folding sequence T1s and the binding capture sequence T3a, the capture oligonucleotide first captures the 5'-end sequence by binding the capture sequence T3a identified target molecules. Then, the target molecule is used as a template to carry out an extension reaction, and the complementary strand T1a of the folded sequence T1s is added to the 3' end to obtain an extended capture oligonucleotide. T1a and T1s can be completely complementary or incomplete, as long as T1a and T1s can induce intramolecular self-folding and form a half-hairpin structure product. The half-hairpin structure product continues to be further extended under the action of the polymerase, and the complementary chain U1a of the first universal sequence U1s is added to the 3' end to obtain an intermediate product of the hairpin structure, and the intermediate product can be used with the first universal sequence U1a. The universal primers with the same or partially the same universal sequence U1s and the specific primers of the target molecule are used for PCR amplification detection. The specific method is that the universal primer U1s (here is referred to by U1s for the convenience of illustration, the actual sequence may not be completely the same as U1s) is combined with the U1a region of the hairpin structure product in the annealing stage and extended, when the hairpin structure product is When there is a nucleic acid extension blocking site between the binding capture sequence and the folding sequence, the extension stops at the nucleic acid extension blocking site, forming a local double-stranded structure. The product formed by the extension of the universal primer U1s happens to be the universal primer U1s and specific The PCR template of the sexual primer T2a can be used for subsequent PCR amplification detection using the universal primer U1s and the specific primer T2a. When there is no nucleic acid extension blocking site between the binding capture sequence and the folding sequence of the hairpin structure product, the universal primer U1s is extended to form a complete double-stranded structure, and the local area of the newly generated double-stranded structure is the universal primer U1s and The PCR template of the specific primer T2a can use the universal primer U1s and the specific primer T2a for subsequent PCR amplification detection.

Example 2 Construction of 5'-end sequence-defined products

The method of the present application requires the use of a sample with a well-defined 5'-end sequence to initiate the extension reaction mediated by the capture oligonucleotide. The strategy for constructing a product with a well-defined 5'-end sequence is shown in Figure 2: ① For example, designing nucleic acids for target molecules An extension blocker is used to block the extension of DNA polymerase to obtain a product with a 5'-end sequence. ② A specific enzyme cleavage site in the target molecule is used for cleavage reaction with different cleavage enzymes to obtain a 5'-end sequence. Determine the product, ③ or design low-concentration specific primers for the target molecule for specific amplification, so as to obtain a product with a determined 5'-end sequence.

Example 3 qPCR detection of miRNA27a and let-7a

MicroRNAs (miRNAs) are a class of endogenous non-coding single-stranded small RNAs with a length of 19-25 nucleotides, which are ubiquitous in eukaryotic cells and control the activity of more than 50% of coding genes.

In this example, miRNA27a and let-7a are detected, and the steps are as follows:

(1) Synthesize miRNA27a and let-7a sequences;

(2) The capture oligonucleotides, universal primers and detection probes of miRNA27a and let-7a genes were added to the reaction system containing miRNA27a and let-7a sequences at the same time, and the PCR detection of miRNA27a and let-7a was carried out by PCR amplification The system is template RNA, 5nM capture oligonucleotide, 150nM first universal primer, 150nM second universal primer, 150nM detection probe, 1U reverse transcriptase, 1U Taq polymerase, 200μM dNTP, 4.5mM MgCl and ₂ × PCR buffer, the final volume is 20μL; PCR reaction program is 42°C for 1h, 94°C for inactivation, and pre-denaturation for 15min; 94°C for 10s, 66°C for 90s, 10 cycles; 94°C for 10s, 65°C for 20s, 40 cycles; Real-time PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values were collected.

The combination of universal primers, capture oligonucleotides, and detection probes used includes:

First Universal Primer (SEQ ID NO: 1)

5-GCGATCCGCACCGTCAATTCG;

Second Universal Primer (SEQ ID NO:2)

5-GAGGTCCGATCCATCCAGACC;

Capture oligonucleotide used by let-7a (SEQ ID NO:3)

5-CCGCACCGTCAATTCGTGAGGTAGTAGG-spacer-CCGATCCATCCAGACCTTTAACTATACAAC;

let-7a detection probe (SEQ ID NO:4)

5-FAM-TGAGGTAGTAGGT-MGB;

Capture oligonucleotide used for miRNA27a (SEQ ID NO:5)

5-CCGCACCGTCAATTCGTTCACAGTGGC-spacer-CCGATCCATCCAGACCTTTGCGGAACTTAG;

miRNA27a detection probe (SEQ ID NO:6)

5-ROX-GTTCACAGTGGC-MGB.

The detection results are shown in Figure 3, the curve miRNA27a is the amplification curve of miRNA27a, and the curve let 7a is the amplification curve of let 7a. This shows that the application can use universal primers to detect miRNA 27a and let-7a at the same time, and the Ct value is the same, that is, the equivalent amplification of the two miRNAs is achieved.

Example 4 Multiplex detection of human genes

The present embodiment detects human gene DNA, and the steps are as follows:

(1) Extract the genomic DNA of Hela cell line, and use it as a template after gradient dilution;

(2) The genome was digested with nucleic acid restriction endonuclease AluI. The reaction system was 2 μL of 10× digestion buffer, genomic DNA of different concentrations, and the system was 20 μL in total; the reaction conditions were incubated at 37°C for 1 hour; After the reaction, the system was heated to 85°C and incubated for 10 minutes to heat inactivate AluI;

(3) Add each gene capture oligonucleotide and universal primer to the above-mentioned enzyme digestion reaction system respectively, and carry out PCR amplification. The PCR amplification system adopted includes enzyme digestion DNA template, 5nM capture oligonucleotide, 150nM first Universal primer, 150nM second universal primer, 1U Taq polymerase, 200μM dNTP, 4.5mM MgCl ₂ and 2× PCR buffer, final volume is 20μL; PCR reaction program is 94°C pre-denaturation for 5min; 94°C 10s, 66°C 90s , 10 cycles; 94°C for 10s, 65°C for 20s, 40 cycles; real-time PCR was performed on a ROCHE instrument (480), and the PCR products were subjected to agarose gel electrophoresis.

Capture oligonucleotides and universal primer combinations used include:

First Universal Primer (SEQ ID NO:7)

5-ACTGGACGAGCTGATTTACG;

Second Universal Primer (SEQ ID NO:8)

5-CGCAATCAGGCAATACCATAGC;

Capture oligonucleotide 1 (SEQ ID NO: 9) used for IL4 (template length: 86 bp)

5-ACTGGACGAGCTGATTTACGCTGCTAGAGAAGTTGA-spacer-CGCAATCAGGCAATACCATAGCGGCTGCCACTGACCACCA;

Capture oligonucleotide 2 (SEQ ID NO: 10) used by GAPDH (template length: 104 bp)

5-ACTGGACGAGCTGATTTACGCTGCTTAGACGCTGGA-spacer-CGCAATCAGGCAATACCATAGCGTCGCGGGAGGCTGCT;

Capture oligonucleotide 3 (SEQ ID NO: 11) used for Homo sapiens actin alpha 1 (template length: 137bp)

5-ACTGGACGAGCTGATTTACGCTTCCCGTTCTCAGCCTTGACGCAATCAGGCAATACCATAGCCATTGACCTCAACTACATGG;

Capture oligonucleotide 4 (SEQ ID NO: 12) used for 18S ribosomal 1 (template length: 200bp)

5-ACTGGACGAGCTGATTTACGCTCTTTCTCGATTCCGTGGG-spacer-ATCAGGCAATACCATAGCGTCCCTCTAAGAAGTTGG;

Capture oligonucleotide 5 (SEQ ID NO: 13) used for 18S ribosomal 2 (template length: 300bp)

5-ACTGGACGAGCTGATTTACGCTACCCGCCCAGAAAACTAGA-spacer-CGCAATCAGGCAATACCATAGCCACCAGGCCGGAGCCATTG;

The results are shown in Figure 4, lane 1 is the 20bp ladder, lane 2 is the amplification product of Saimiri sciureus interleukin 4 (IL4) gene, lane 3 is the amplification product of Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene, and lane 4 is the amplification product of the gene Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Homo sapiens actin alpha 1 gene amplification product, lane 5 is the 18S ribosomal 1 amplification product, lane 6 is the 18S ribosomal 2 amplification product, and lane 7 is the multiplex amplification result, all of which are positive.

This shows that the present application utilizes universal primers for sensitive and specific multiplex detection of different human genes.

Example 5 Detection of rifampicin-resistant mutation of Mycobacterium tuberculosis

Aiming at the rifampicin resistance mutation of Mycobacterium tuberculosis (the 526-site mutation of rpoB gene), the combination of mismatch repair enzyme and universal primer is used for multi-site multiple detection of drug resistance mutation.

Proceed as follows:

(1) Add an artificial sequence fully complementary to the wild genome into the synthesized Mycobacterium tuberculosis mutant plasmid at a concentration of 100 nM, heat the system to 95°C, incubate for 10 minutes, lower the temperature to 60°C for hybridization and incubate for 30 minutes, artificially The hybridization of the sequence and the mutant plasmid produces a mismatch, and the temperature is slowly lowered to room temperature to obtain a product of hybridization between the artificial sequence and the genome;

(2) The hybridization products obtained in step (1) were digested with mismatch enzyme T7E1. The reaction system was 2 μL of 10× digestion buffer, and the hybridization products of different concentrations were 20 μL in total. The reaction conditions were incubation at 37°C. 1 hour; after the end of the enzyme cleavage reaction, heat the system to 85°C and incubate for 10 minutes to heat inactivate the mismatched enzymes;

(3) The corresponding capture oligonucleotides, universal primers and detection probes were added to the above-mentioned restriction enzyme digestion reaction system and the wild plasmid system without restriction enzyme digestion treatment respectively, and the 526-site mutation state was detected by PCR. The PCR amplification system adopted Includes digested DNA template, 5nM capture oligonucleotide, 150nM first universal primer, 150nM second universal primer, 150nM detection probe, 1U Taq polymerase, 200μM dNTP, 4.5mM MgCl2, and 2x PCR buffer, final volume The PCR reaction program is 94°C pre-denaturation for 5min; 94°C 10s, 66°C 90s, 10 cycles; 94°C 10s, 65°C 20s, 40 cycles; real-time PCR was performed on a ROCHE instrument (480), and the corresponding The fluorescence values were collected.

First Universal Primer (SEQ ID NO:8)

5-CGCAATCAGGCAATACCATAGC;

Second Universal Primer (SEQ ID NO: 14)

5-GAGCGCAGGTCGTACTCG;

526 Mutation Capture Oligonucleotide (SEQ ID NO: 15)

5-CAGGCAATACATAGCTTGTGGGTCAACCCCGACAGAGCGCAGGTCGTACTCGTGCACCAGCCAGCTGAG;

526 Mutation Detection Probe (SEQ ID NO: 16)

5-FAM-CCAATTCATGGACCAGAACAAC-MGB;

Artificial sequence (SEQ ID NO: 17)

5-GGGGTTGACCCACAAGCGCCGACTGTCG.

The results are shown in Figure 5, curve A is the amplification curve of the mutant plasmid, and curve a is the amplification curve of the wild plasmid.

This shows that the present application can sensitively and specifically detect the rifampicin-resistant mutation of Mycobacterium tuberculosis using universal primers with the help of suitable artificial sequences.

Example 6 qPCR detection of methylation of human Septin 9 gene

The Septin 9 gene is located on human chromosome 17q25.3 and is a member of the Septin gene family, which is involved in the regulation of cellular biological processes such as cytokinesis and cell cycle.

Due to the diversity of constituent cells, the DNA of biological samples obtained by the existing technology is often a mixture of unmethylated DNA and methylated DNA. For example, the source of DNA in cancer tissues includes cancer cells with DNA methylation and DNA without DNA methylation. Methylated normal cells; the main source of circulating cell-free DNA (cfDNA) in peripheral blood is normal white blood cells without DNA methylation. The content of cellular DNA is generally less than 0.1%. Therefore, a method for detecting methylated DNA of Septin 9 gene needs to be able to effectively distinguish methylated DNA from unmethylated DNA, and to specifically detect methylated DNA in a sample.

The present embodiment detects the methylated DNA of the human Septin 9 gene, and the steps are as follows:

(1) The genomic DNAs of Jurkat cell line and Hela cell line were extracted respectively, and the methylation status of Septin 9 gene was identified by sequencing;

(2) The methylation-dependent restriction endonuclease GlaI was used to digest the genomic DNA of Jurkat cell line, Hela cell line, and negative control NC, respectively. The reaction system was 10× digestion buffer 2 μL, different concentrations of The total amount of genomic DNA in the system is 20 μL; the reaction conditions are incubated at 37°C for 1 hour; after the enzyme digestion reaction, the system is heated to 85°C and incubated for 10 minutes to heat inactivate GlaI;

(3) Add Septin 9 gene capture oligonucleotides, universal primers and detection probes to the above-mentioned enzyme digestion reaction system respectively, and PCR detects the methylation state of the Septin 9 gene. The PCR amplification system adopted includes the enzyme digestion DNA template , 5nM capture oligonucleotides, 150nM universal primers, 150nM specific primers, 150nM detection probes, 1U Taq polymerase, 200μM dNTPs, 4.5mM MgCl ₂ and 2× PCR buffer in a final volume of 20μL; the PCR reaction program is Pre-denaturation at 94°C for 5 min; 94°C for 10s, 66°C for 90s, 10 cycles; 94°C for 10s, 65°C for 20s, 40 cycles; real-time PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values were collected.

The combination of capture oligonucleotides, universal primers, and detection probes used includes:

Capture oligonucleotide (SEQ ID NO: 18)

5-TGTCAGCCAACGGTATTCGTTGACCGCGGGCTCGCCGCTGCCCTCCGC;

Universal primer (SEQ ID NO: 19)

5-GCCTGTCAGCCAACGGTATTC;

Specific primer (SEQ ID NO:20)

5-CGACCCGCTGCCCACCAG;

Detection probe (SEQ ID NO:21)

5-FAM-CCATCATGTCGGACCC-MGB;

The human Septin 9 gene is shown in SEQ ID NO: 22:

5-GCG C // G TTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGCGCGGAGGGGCAGCGGCGAGGAA;

The underline is the methylation position, // is the enzyme cleavage position.

After sequencing, it was found that the Septin 9 gene in the Jurkat cell line genome was unmethylated, while the Septin 9 gene in the Hela cell line genome was methylated. qPCR was used to detect the methylation status of Septin 9 gene in methylated samples and non-methylated samples with different concentrations, as shown in Figure 6, 140 copies (140 copies) and 28 copies (28 copies) were Septin 9 methylated samples The amplification curves of 140 copies/reaction and 28 copies/reaction of Septin 9 methylated gene samples, 16000 copies (16000 copies) are the amplification curves of non-methylated samples, and NC is the amplification curve of ddH ₂ O .

This shows that the present application can sensitively and specifically detect methylated DNA in the SEPTIN 9 gene.

Embodiment 7 ddPCR detection of Septin 9 gene methylation

Compared with Example 6, the methylation detection of Septin 9 gene was carried out on the Naica ^TM crystal digital PCR instrument of STILLA Company, and GlaI was used as the methylation-dependent restriction endonuclease, and other conditions were the same as those in Example 6.

The results are shown in Figure 7 for the number of copies of Septin 9 gene in methylated samples with different concentrations, the left is the 100 copies/reaction scatter plot, and the right is the 10 copies/reaction scatter plot. Among them, the dots above the dotted line are positive droplets, and the dots below the dotted line are negative droplets.

It can be seen that the present application can realize the detection of methylated DNA in the highly sensitive Septin 9 gene on a digital PCR instrument.

Example 8 Double detection of methylation of human Septin 9 and RASS-F1 genes

In this example, the methyltransferase-treated Jurkat DNA was used as the methylation positive standard, and the CG site was 5mCG, and the methylation double detection of Septin 9 and RASS-F1 genes was carried out. The methylation-dependent restriction The endonuclease used GlaI, and the negative control was nuclease-free water. Wherein, the capture oligonucleotide for the Septin 9 gene is SEQ ID NO: 18, the universal primer is SEQ ID NO: 19, the specific primer is SEQ ID NO: 20, and the detection probe is SEQ ID NO: 21, for RASS The capture oligonucleotide of the F1 gene is SEQ ID NO: 23, the universal primer is SEQ ID NO: 19, the specific primer is SEQ ID NO: 24, and the detection probe is SEQ ID NO: 25.

Capture oligonucleotide (SEQ ID NO:23)

5-TGTCAGCCAACGGTATTCGCCCAGCGGGTGCGAAGCACGGGCCCAAC;

Specific primer (SEQ ID NO:24)

5-CCATGTCGGGGGAGCCTG;

Detection probe (SEQ ID NO:21)

5-VIC-CCATCATGTCGGACCC-MGB;

Detection probe (SEQ ID NO:25)

5-FAM-CTCCCGCAGCTCAATG-MGB.

The results are shown in Figure 8(A) for the sensitivity detection of the Septin 9 gene in methylated samples with different concentrations, from left to right, 140 copies/reaction and 28 copies/reaction; Figure 8(B) shows the methylation levels of different concentrations Sensitivity detection of RASS-F1 gene in chemical samples, from left to right, 140 copies/reaction and 28 copies/reaction, respectively.

This shows that the present application can simultaneously achieve sensitive and specific detection of methylated DNA in Septin 9 and RASS-F1 genes.

Example 9 Specific optimization of detection of methylation sites of human Septin 9 gene

In this example, methyltransferase-treated Jurkat DNA was used as the positive standard for methylation of the human Septin 9 gene, Jurkat DNA was used as the negative standard for methylation of the human Septin 9 gene, and the negative control nc was nuclease-free water. The samples were digested with methylation-dependent restriction endonuclease GlaI, and common capture oligonucleotides or LNA modified capture oligonucleotides, universal primers (SEQ ID NO: 19), specific primers ( SEQ ID NO: 20) and detection probe (SEQ ID NO: 21) (normal capture oligonucleotides use FAM channel; LNA modified capture oligonucleotides use VIC channel) for amplification detection.

Capture oligonucleotides used include:

Common capture oligonucleotide (SEQ ID NO:26)

5-GCCTGTCAGCCAACGGTATTCGTTGACCGCGGGCTCGCCGCTGCCCTCCGC;

LNA-modified capture oligonucleotide (SEQ ID NO:27)

5-GCCTGTCAGCCAACGGTATTCGTTGACC+G+CGCTCGCCGCTGCCCTCCGC (the base behind + represents this base modification locked nucleic acid);

The human Septin 9 gene is shown in SEQ ID NO: 22.

The results are shown in Figure 9(A) and Figure 9(B), both capture oligonucleotides can show positive results in 120 copies and 12 copies of the positive template; but in the common capture oligonucleotide system, When the unmethylated genome (jurkat DNA) is added to 100ng, the common capture oligonucleotide group produces non-specific amplification, which is caused by the binding and extension of the synthetic by-product of the capture oligonucleotide and the target molecule; in After the folded sequence of the capture oligonucleotide is introduced into LNA modification, it can not only ensure the amplification efficiency (120 copies and 12 copies can be detected as positive), but also in the high concentration of unmethylated genome (100ng), it will not cause non-specific Heterogeneous amplification, the mechanism of inhibiting non-specific amplification is that when the folding sequence is modified by introducing nucleic acid analogs, it can inhibit the extension of synthetic by-products of primers under the condition of ensuring the base pairing of the folding region. Therefore, it can be seen from the results that the modification of nucleic acid analogs of the folding sequence can improve the specificity of the detection system.

Example 10 Amplification results with different folded region sequences

In this embodiment, the methylated DNA of the human RASS-F1 gene is detected, and the steps are as follows:

(1) The Jurkat DNA was treated with methyltransferase to construct a fully methylated positive genome, and the methylation status of the RASS-F1 gene was identified by sequencing;

(2) The methylation-dependent restriction endonuclease GlaI was used to digest the methylation-positive Jurkat genomic DNA and the negative control, respectively. The reaction system was 10× digestion buffer 2 μL, genomic DNA of different concentrations, and the system A total of 20 μL; the reaction conditions were incubated at 37 °C for 1 hour; after the enzyme digestion reaction, the system was heated to 85 °C and incubated for 10 minutes to heat inactivate GlaI;

(3) Add RASS-F1 gene capture oligonucleotide, universal primer, specific reverse primer and detection probe to the above enzyme digestion reaction system respectively, and PCR detects the methylation state of RASS-F1 gene. The amplification system includes enzyme-digested DNA template, 5nM capture oligonucleotides, 150nM universal primers, 150nM specific primers, 150nM detection probes, 1U Taq polymerase, 200μM dNTPs, 4.5mM MgCl ₂ and 2× PCR buffer, and finally The volume was 20 μL; the PCR reaction program was pre-denaturation at 94 °C for 5 min; 94 °C for 10 s, 66 °C for 90 s, 10 cycles; 94 °C for 10 s, 65 °C for 20 s, 40 cycles; real-time PCR was performed on a ROCHE instrument (480). The corresponding fluorescence values were collected.

The combination of capture oligonucleotides, universal primers, and detection probes used includes:

Capture oligonucleotide (SEQ ID NO:28)

5-GCCTGTCAGCCAACGGTATTCGCCCAG+C+GGTTTTTGCCAG/spacer 18/GCGAAGCACGGGCCCAAC (the base behind + represents the base modification locked nucleic acid);

Universal primer (SEQ ID NO: 19)

5-GCCTGTCAGCCAACGGTATTC;

Specific primer (SEQ ID NO:29)

5-CCATGTCGGGGGAGCCTGAG;

Detection probe (SEQ ID NO:30)

5-FAM-CTCCCGCAGCTCAATG-MGB;

The human RASS-F1 gene is shown in SEQ ID NO: 31:

5-GCG C // G CCCAGCGGGTGCCAGCTCCCGCAGCTCAATGAGCTCAGGCTCCCCCGACATGGCCCGTTGGGCCCGTGCTTCGCTGG;

The underline is the methylation position, // is the enzyme cleavage position.

In this embodiment, the folded region of the capture oligonucleotide is not exactly the same as the 5' end sequence of the target molecule. qPCR was used to detect the methylation status of RASS-F1 gene in methylation-positive samples with different concentrations. As shown in Figure 10, curves 1, 2, and 3 are the amplification curves of RASS-F1 methylated samples, with 120 copies respectively. /reaction, 40 copies/reaction and 28 copies/reaction of RASS-F1 methylated gene samples, and the negative control is the amplification curve of adding ddH ₂ O.

This shows that the folded region of the capture oligonucleotide of the present application and the 5'-end sequence of the target molecule only need to have a partial sequence identical to achieve amplification.

To sum up, in this application, specially designed capture oligonucleotides are used to amplify samples with clear 5'-end sequences to form hairpin structure products, which are used as templates for the amplification reaction of universal primers to realize multiplexing using universal primers. PCR amplification detects the effect of different target molecules, avoids the deviation of amplification efficiency caused by sequence differences, has good specificity, and is suitable for popularization and application.

The applicant declares that the present application illustrates the detailed method of the present application through the above-mentioned embodiments, but the present application is not limited to the above-mentioned detailed method, which does not mean that the present application must rely on the above-mentioned detailed method for implementation. Those skilled in the art should understand that any improvement to the application, the equivalent replacement of each raw material of the product of the application, the addition of auxiliary components, the selection of specific methods, etc., all fall within the scope of protection and disclosure of the application.

Claims (10)

1. A capture oligonucleotide for nucleic acid amplification, comprising a first universal sequence, a folding sequence and a binding capture sequence from the 5' end to the 3' end in order;

   in,

   the folded sequence is at least partially identical to the sequence at the 5' end of the target molecule; and

   The binding capture sequence binds complementary to the non-5' terminal sequence of the target molecule.
2. The capture oligonucleotide of claim 1, wherein the capture oligonucleotide further comprises a second universal sequence;

   Preferably, the second universal sequence is located 5' to the binding capture sequence.
3. The capture oligonucleotide of claim 1 or 2, wherein the capture oligonucleotide further comprises a nucleic acid extension blocking site;

   Preferably, the nucleic acid extension blocking site is located at the 3' end of the folded sequence;

   Preferably, the nucleic acid extension blocking site is located at the 5' end of the second universal sequence;

   Preferably, the nucleic acid extension blocking site is modified with any one or a combination of at least two of Spacer, thio group or uracil base.
4. The capture oligonucleotide of any one of claims 1-3, wherein the folding sequence is modified with a nucleic acid analog;

   Preferably, the nucleic acid analogs include peptide nucleic acids, locked nucleic acids, transposed bases, 2'-O,4'-C-methylene bridge RNA, 2'-O-methyl RNA or 2'-fluoro RNA any one or a combination of at least two.
5. A kit for nucleic acid amplification, comprising the capture oligonucleotide of any one of claims 1-4.
6. The kit according to claim 5, wherein the kit further comprises a target molecule pretreatment reagent;

   Preferably, the target molecule pretreatment reagent includes any one or a combination of at least two of a nuclease for site-specific cleavage, a nucleic acid extension blocker or a specific primer;

   Preferably, the nuclease for site-specific cleavage includes exonuclease and/or endonuclease;

   Preferably, the endonuclease includes any one or a combination of at least two of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease or a mismatch repair enzyme;

   Preferably, the nucleic acid extension blocker comprises peptide nucleic acid and/or locked nucleic acid;

   Preferably, the 5' end of the specific primer contains a modification group;

   Preferably, the modifying group includes a phosphate group and/or a thio group.
7. The kit according to claim 5 or 6, wherein the kit further comprises a universal primer;

   Preferably, the nucleic acid sequence of the universal primer is identical or partially identical to the first universal sequence or the second universal sequence of the capture oligonucleotide;

   Preferably, the kit further includes specific primers.
8. The kit according to any one of claims 5-7, wherein the kit further comprises a detection probe;

   Preferably, the detection probe is labeled with a fluorescent group and/or a quenching group;

   Preferably, the fluorophore is labeled at the 5' end of the detection probe;

   Preferably, the quenching group is labeled at the 3' end of the detection probe;

   Preferably, the fluorescent group includes any one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460;

   Preferably, the quenching group includes any one of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.
9. A nucleic acid amplification method, comprising:

   (1) The target molecule whose 5'-end sequence is determined is brought into contact with the capture oligonucleotide according to any one of claims 1 to 4, whereby the capture sequence of the capture oligonucleotide binds to the target molecular binding;

   (2) The capture oligonucleotide is subjected to an extension reaction using the target molecule as a template, whereby a nucleotide complementary to the target molecule is added to the 3' end of the capture oligonucleotide to form an extended capture oligonucleotide ;

   (3) Incubating the extended capture oligonucleotide under conditions that allow intramolecular self-folding, whereby the extended capture oligonucleotide undergoes complementary base pairing with the folded sequence through the extension sequence to form a half-hairpin structure product ;and

   (4) The half-hairpin structure product is further subjected to an extension reaction, whereby a nucleotide complementary to the first universal sequence is added to the 3' end to form a complete hairpin structure product.
10. The method according to claim 9, wherein the method further comprises: using the complete hairpin structure product as a template, using universal primers and/or specific primers to perform exponential amplification to obtain amplification products;

    Preferably, the nucleic acid sequence of the universal primer is identical or partially identical to the first universal sequence or the second universal sequence of the capture oligonucleotide;

    Preferably, the exponential amplification comprises polymerase chain reaction;

    Preferably, the method further includes the step of combining the amplification product with the detection probe for detection.

Images