WO2022145662A1 - Composition and kit, and method using same for diagnosing breast cancer using methylation level of cpg site in ank2 or epas1 genes - Google Patents

Abstract

Provided are a composition and a kit, and a method using same for diagnosing breast cancer using breast cancer-specific ANK2 or EPAS1 methylation biomarkers. When used, breast cancer can be diagnosed by means of a simple method, and breast cancer diagnosis can be highly accurate and sensitive.

Description

Composition, kit, and method for diagnosing breast cancer using methylation level of CPG region in ANK2 or EPAS1 gene, and method using same

This application claims priority to Republic of Korea Patent Application No. 10-2020-0185221 filed on December 28, 2020, and the entire specification is a reference to the present application.

It relates to a composition, a kit, and a diagnostic method using the same for diagnosing breast cancer or mammary gland cancer.

There are many similarities between mammary and breast cancers in dogs and humans. Dogs are chosen as animal models for human diseases such as cancer because they are exposed to human-like environments and exhibit spontaneous disease traits more rapidly than humans. In particular, it is known that environmental stimuli can have a profound effect on the epigenetics of an organism, and it has been reported that epigenetic abnormalities of several genes are associated with the development of human breast cancer. Therefore, investigating the epigenetics of canine mammary gland cancer can be very useful in terms of comparative oncology.

The use of DNA methylation as a biomarker has attracted attention for numerous cancers in the form of tissue and liquid biopsies, but has been very limited in mammary gland cancer in dogs. In the case of cell-free DNA (cfDNA) present in small amounts in the blood, changes in its amount are associated with various disease states, and genetic mutations and epigenetic regulation of specific genes are It has been reported that it can be detected (Uehiro et al., Breast Cancer Research (2016) 18:129). However, the fact that cfDNA is present in a very small amount in the blood and that there is a large variation among people acts as a major limitation in detecting a specific gene mutation in cfDNA and using it as a diagnostic marker.

Therefore, it is necessary to sample breast cancer in an easy way and to select a breast cancer-specific biomarker with excellent diagnostic accuracy.

Provided is a composition for diagnosing breast cancer using a breast cancer-specific methylation biomarker.

Provided is a kit for diagnosing breast cancer using a breast cancer-specific methylation biomarker.

A method for diagnosing breast cancer by detecting a breast cancer-specific methylation biomarker is provided.

Provided is a method for providing information necessary for diagnosing breast cancer by detecting a breast cancer-specific methylation biomarker.

One aspect provides a composition for diagnosing breast cancer, including an agent for measuring the methylation level of a CpG region in a polynucleotide encoding Ankyrin 2 (ANK2) or Endothelial PAS domain-containing protein 1 (EPAS1).

In one embodiment, it was confirmed that the occurrence of human breast cancer can be predicted and diagnosed by changing the methylation level of the CpG region in a polynucleotide encoding a specific protein in a dog having mammary gland cancer. That is, by identifying the methylation biomarkers related to breast cancer in dogs and their guardians who share the same living environment through epigenetics, a diagnostic method commonly applicable to dogs and humans was confirmed. Therefore, the composition for diagnosing breast cancer according to an aspect may be used to predict or diagnose the breast cancer of a guardian from a dog having mammary gland cancer.

The term “breast cancer” refers to cancer of the breast, and may be interchangeably referred to as “mammary cancer”. The breast cancer may include mammary gland breast cancer, lobule breast cancer, or a combination thereof.

The term “diagnosis” refers to determining the disease name, and may include the disease name, disease state, stage, etiology, presence or absence of complications, prognosis, and recurrence of breast cancer.

ANK2 (Ankyrin 2) is a protein that functions in the location and membrane stabilization of ion transporters and ion channels in cardiomyocytes. It is also known as Ankyrin-B, ANK-2, LQT4, Brain ankyrin, Non-erythroid ankyrin, or brank-2. can be called ANK2 is a ubiquitously expressed protein or can be highly expressed in cardiac muscle. ANK2 may include an N-terminal domain comprising multiple ankyrin repeats, a central region comprising a spectrinn binding domain and a death domain, and a C-terminal regulatory domain determining Ankyrin 2 activity. ANK2 is Uniprot Accession No. 1 in humans. a polypeptide consisting of the amino acid sequence of Q01484. ANK2 may comprise a polynucleotide sequence consisting of the nucleotide sequence of CanFam3.1: Chromosome 32: 32,671,281-33,141,036 in dogs. ANK2 is Ensemble Accession No. and a polynucleotide consisting of the nucleotide sequence of ENSG000000145362. A polynucleotide encoding ANK2 may include an intron. The polynucleotide encoding ANK2 may comprise a CpG region of Illumina ID cg25915539, cg17665652, or cg08448479.

Endothelial PAS domain-containing protein 1 (EPAS1), also known as hypoxia-inducible factor-2alpha (HIF-2alpha), is a transcription factor involved in the physiological response to oxygen concentration. EPAS1 may also be referred to as ECYT4, HIF2A, HLF, MOP2, PASD2, bHLHe73, or endothelial PAS domain protein 1. EPAS1 is Uniprot Accession No. 1 in humans. a polypeptide consisting of the amino acid sequence of Q99814. EPAS1 may comprise a polynucleotide sequence consisting of the nucleotide sequence of CanFam3.1: Chromosome 10: 48,551,410-48,634,844 in dogs. EPAS1 is Ensembl Accession No. and a polynucleotide consisting of the nucleotide sequence of ENSG00000116016. A polynucleotide encoding EPAS1 may include an intron. The polynucleotide encoding EPAS1 may comprise a CpG region of Illumina ID cg20623601 or cg25124739.

The term "methylation" refers to the attachment of a methyl group to a base constituting DNA. The methylation may be attachment of a methyl group to a cytosine of a CpG nucleotide sequence (CpG site). In the case of methylation, the binding of transcription factors may be disturbed and the expression of specific genes may be suppressed. Conversely, when unmethylation or hypomethylation occurs, the expression of a specific gene may be increased.

The CpG region may be selected from the group consisting of cg25915539, cg17665652, cg08448479, cg20623601, and cg25124739. cg25915539 can also be described as human Chr4: 114214080. cg17665652 can also be described as human Chr4: 114214094. cg08448479 can also be described as human Chr4: 114214186. cg20623601 can also be described as human Chr2: 46526844. cg25124739 can also be described as human Chr2: 46527099. When the sample is genomic DNA, the CpG region may be selected from the group consisting of cg25915539, cg17665652, cg08448479, cg20623601, and cg25124739. When the sample is cfDNA, the CpG region may be selected from the group consisting of cg25915539, cg17665652, and cg08448479. When the sample is a human-derived sample, the CpG region may be cg08448479.

The methylation level of the CpG region may be measured by restriction enzyme digestion followed by polymerase chain reaction (PCR) or methylation-specific PCR. Methylation-specific PCR is, for example, methylation-specific polymerase chain reaction (MSP), real-time methylation-specific polymerase chain reaction (PCR), PCR using a methylated DNA-specific binding protein, or quantitative PCR. The methylation level of the CpG region may be measured by pyrosequencing or bisulfite sequencing.

The agent may include a primer set for CpG site amplification or a CpG site specific probe; methylation sensitive restriction enzymes; and methylation insensitive restriction enzymes.

The primer is an oligonucleotide that provides a polymerization initiation point in a polymerization reaction by a polymerase, and the primer may be one used in a nucleic acid amplification reaction. The primer hybridizes to a region complementary to the target sequence. The term “amplification” refers to increasing the copy number of a target sequence or its complementary sequence. The nucleic acid amplification reaction may be performed by methods known in the art. Amplification of nucleic acids includes methods that require multiple cycles during amplification or methods performed at a single temperature. Examples of cycling techniques include those requiring thermal cycling. Methods requiring thermal cycling include polymerase chain reaction (PCR). PCR is known in the art. Isothermal amplification methods include strand displacement amplification (SDA), helicase dependent amplification (HDA), exonuclease dependent amplification, and recombinase polymerase amplification: RPA), loop mediated amplification (LAMP), nucleic acid based amplification (NASBA and TMA), or a combination thereof. The primers may be included in one or two or more sets depending on the selected amplification method.

The length of the primer is about 5 to about 100 nucleotides (hereinafter referred to as 'nt'), about 10 to about 80 nt, about 10 to about 60 nt, about 10 to about 50 nt, about 10 to about 40 nt, about 10 to about 30 nt, or about 20 to about 30 nt.

The primer set may include a polynucleotide selected from the group consisting of SEQ ID NOs: 1 to 14.

The probe refers to an oligonucleotide that specifically binds to a target sequence. Probes include polynucleotides comprising specific moieties designed to hybridize in a sequence-specific manner with regions complementary to, for example, a specific nucleic acid sequence, such as a target nucleic acid sequence. The probe may include DNA, RNA, or a combination thereof, and may be labeled with a detectable label.

The primer or probe may be labeled with a fluorescent material, a chemiluminescent material, or a radioactive isotope at the end or inside thereof.

The term "restriction enzyme" refers to an endonuclease that identifies a specific nucleotide sequence of DNA and cuts it. The nucleotide sequence identified by the restriction enzyme is called a recognition sequence.

The term "methylation sensitive restriction enzyme" refers to an enzyme that can or cannot be cleaved depending on the presence of methylation of a CpG site in the recognition sequence of the restriction enzyme. The methylation-sensitive restriction enzyme may be HpaII, BsiSI, or a combination thereof. When the CpG site is methylated in the polynucleotide encoding ANK2 or EPAS1, the target sequence can be amplified by subsequent PCR without cleavage of the nucleic acid sample by HpaII, BsiSI, or a combination thereof. Conversely, if the CpG site in the polynucleotide encoding ANK2 or EPAS1 is not methylated, the nucleic acid sample is cleaved by HpaII, BsiSI, or a combination thereof, and the target sequence may not be amplified by subsequent PCR.

The methylation insensitive restriction enzyme refers to an enzyme capable of cleaving a recognition sequence regardless of methylation of the CpG site among the recognition sequences of the restriction enzyme. The methylation insensitive restriction enzyme may be MspI. Regardless of whether the CpG site in the polynucleotide encoding ANK2 or EPAS1 is methylated, the nucleic acid sample may be cleaved by MspI and the target sequence may not be amplified by subsequent PCR. A nucleic acid sample cleaved by MspI can be used as a negative control. The difference in the amount of amplification of the DNA fragmented with HpaII and MspI may indicate a difference in the level of methylation of the CpG region in the polynucleotide encoding ANK2 or EPAS1.

Another aspect provides a kit for diagnosing breast cancer comprising an agent for measuring the methylation level of a CpG site in a polynucleotide encoding ANK2 or EPAS1 and a reagent for amplifying nucleic acid.

The ANK2, EPAS1, CpG site, methylation level, breast cancer diagnosis, and agent are the same as described above.

The reagent for amplifying the nucleic acid may be a polymerase, dNTP, a buffer, a nucleic acid, a coenzyme, a fluorescent material, or a combination thereof. The polymerase is, for example, Taq polymerase.

Another aspect is to obtain a nucleic acid sample from a biological sample isolated from the subject; And it provides a method for diagnosing breast cancer or providing information for diagnosing breast cancer, comprising measuring the methylation level of a CpG site in a polynucleotide encoding ANK2 or EPAS1 from the obtained nucleic acid sample.

The ANK2, EPAS1, CpG site, methylation level, breast cancer diagnosis, and agent are the same as described above.

The method includes obtaining a nucleic acid sample from a biological sample isolated from a subject.

The subject may be a mammal, including a human, a dog, a mouse, a cow, a pig, a horse, a sheep, or a cat. The subject may be a subject suffering from or suspected of having breast cancer.

The biological sample refers to a sample obtained from the subject. The biological sample may be, for example, tissue, blood, plasma, serum, bone marrow fluid, lymph fluid, saliva, tear fluid, mucosal fluid, amniotic fluid, or a combination thereof.

The nucleic acid sample may be genomic DNA (gDNA), cell free DNA (cfDNA), or a combination thereof. The gDNA may be DNA isolated from a biological sample. The cfDNA does not exist in cells, but refers to cleaved DNA present in the bloodstream. The cfDNA may be DNA isolated from blood, plasma, serum, bone marrow fluid, lymph fluid, saliva, lacrimal fluid, mucosal fluid, amniotic fluid, or a combination thereof.

The method of obtaining a nucleic acid sample from the biological sample may be performed using a method commonly used in the art. The nucleic acid sample may be obtained using, for example, a phenol/chloroform extraction method, an SDS extraction method, a Cetyl Trimethyl Ammonium Bromide (CTAB) separation method, and a commercially available DNA extraction kit.

The method includes measuring the methylation level of a CpG site in a polynucleotide encoding ANK2 or EPAS1 from the obtained nucleic acid sample.

The step of measuring the methylation level of the CpG region may include cutting the nucleic acid sample by adding a methylation sensitive restriction enzyme, a methylation insensitive restriction enzyme, or a combination thereof to the nucleic acid sample. The nucleic acid sample may be cleaved depending on whether the CpG site is methylated in the polynucleotide encoding ANK2 or EPAS1.

The method may further include amplifying the nucleic acid sample after the step of cleaving the nucleic acid sample. When the nucleic acid sample is not cleaved by a methylation sensitive restriction enzyme or a methylation insensitive restriction enzyme, the target sequence of the nucleic acid sample may be amplified. Conversely, when the nucleic acid sample is cleaved by a methylation sensitive restriction enzyme or a methylation insensitive restriction enzyme, the target sequence of the nucleic acid sample may not be amplified.

The method may further comprise determining that the subject is more likely to have breast cancer or has breast cancer when the methylation level of the CpG region in the polynucleotide encoding ANK2 or EPAS1 is increased compared to the methylation level of a normal control. .

If the methylation level of the CpG site in the polynucleotide encoding ANK2 or EPAS1 is increased compared to the methylation level of the normal control, that is, if hypermethylation of the CpG site is detected in the polynucleotide encoding ANK2 or EPAS1, the subject is diagnosed with breast cancer You may be at high risk of getting it or you may be determined to have breast cancer.

According to the composition, kit, and method for diagnosing breast cancer using a breast cancer-specific methylation biomarker, it is possible to diagnose breast cancer by a simple method using blood, and to diagnose breast cancer with high accuracy and sensitivity.

1A is a schematic diagram of the target selection process using MBD-seq and RNA-seq (the number of genes selected in each step is indicated in parentheses), and FIG. 1B is FPKM (Fragments Per Kilobase) of the top 20 hypermethylated genes. of transcripts per Million mapped reads) for RNA-seq gene expression levels (blue dots: normal, red dots: breast cancer, *: p-value <0.05) and fold change for each target allele (log2 values, gray bar graphs) ) is a graph showing, FIG. 1c is a graph showing IGV (Integrative Genomics Viewer) peak calling of ANK2 and EPAS1 in normal and cancer, and FIG. 1d is 11 pairs of canine mammary cancer tissues and adjacent normal tissues of MBD-seq data. A graph showing the total methylation levels of ANK2 and EPAS1 (**: p-value <0.01, ****: p-value < 0.0001), and FIGS. 1E and 1F are 10 pairs of dogs for ANK2 and EPAS1, respectively Correlation graphs between expression (FPKM) and methylation and matching density graphs for FPKM and methylation in mammary cancer tissue (red) and normal tissue (blue) samples (green: expression, orange: methylation level).

2A and 2B show the results of bisulfite sequencing PCR (BSP) of ANK2 and EPAS1, respectively.

Figure 3a is a schematic diagram showing the positions of the BSP primer set (grey) and the MSP primer set (yellow) on the CpG island of each intron for ANK2 and EPAS1, and Figure 3b is a graph showing the methylation indices of ANK2 and EPAS1 (red: CMT sample, blue: normal sample), Figure 3c is a graph showing the total methylation level (red: CMT sample, blue: paired normal sample, *: p-value <0.05, **: p-value <0.01) , and FIGS. 3D and 3E are ROC (Receiver operating characteristic) curves of methylation levels for ANK2 and EPAS1, respectively.

4A and 4B are graphs showing the results of cfDNA hypermethylation analysis for ANK2 and EPAS1, respectively (red: CMT, blue: paired normal sample, *: p-value <0.05).

Figures 5a and 5b are graphs showing the average methylation level for ANK2 and EPAS1, respectively (blue: normal, red: breast cancer, yellow-green: CpG island in Figure 5b, *: p-value <0.05), Figures 5c and 5d are It is a graph showing the expression levels of target genes for ANK2 and EPAS1, respectively (log2 (corrected with rsem +1), blue: normal, red: breast cancer), and FIGS. 5e and f are gene expression levels for ANK2 and EPAS1, respectively. It is a Kaplan-Meier curve showing relapse-free survival according to

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Identification of methylation levels of differentially methylated genes in biological samples from breast cancer patients

1. Identification of methylation level of differentially methylated genes in canine breast cancer tissue

A gene candidate with a higher methylation level than normal tissue was discovered in the mammary gland cancer tissue of a dog with mammary gland cancer.

Specifically, canine mammary tumor (CMT) and nearby normal tissues (25 pairs in total) were isolated from a dog with mammary gland cancer (provided by Seoul National University Animal Hospital). Genomic DNA (gDNA) was isolated from mammary gland cancer tissue and nearby normal tissue using the DNEasy Blood & Tissue kit (Qiagen). The isolated gDNA was quantified using a nanodrop spectrophotometer.

As shown in the schematic diagram of FIG. 1A , the hypermethylated differentially methylated region (DMR) was identified using MBD-seq and the corresponding RNA-seq. First, MBD-seq data (Nam, A.-R et al., Clin. Epigenet. 2020, 12, 1-15) obtained from 11 pairs of canine mammary cancer tissues and nearby normal tissues in the NCBI BioProject database (accession number PRJNA601533). was used to identify 16,061 differentially-methylated genes based on the presence of DMR in the gene (p-value <0.01). Among them, 1269 hypermethylated differential-methylated genes were selected based on the fold change (log2 fold change > 1.5).

As shown in FIG. 1B , among the top 20 identified targets with large differences in methylation levels between cancer tissues and normal tissues, EPAS1, ANK2, DST and RUSC2 were RNA-seq data (SRA accession number: SRR8741587-SRR8741602). As confirmed, gene expression was down-regulated in canine mammary carcinoma tissue (CMT). Among them, ANK2 and EPAS1 were at a significant level (*: p-value <0.05). CMT differential-methylation regions were identified in the CpG island of ANK2 intron 21 and EPAS1 intron 1. The increase rate of methylation level in CMT was represented by a linear mixed model (LMM) with thresholds of 10% and 5% ( FIG. 1C ). Total methylation levels detected by MBD-seq for both target regions were significantly hypermethylated in CMT as opposed to normal tissues (Fig. 1d). Of the 11 pairs of canine mammary cancer/normal tissues used for MBD-seq, 10 pairs were also used for RNA-seq analysis.

As shown in Figures 1e and 1f, 10 pairs with data for both MBD-seq and RNA-seq were not all significant, but showed a general inverse correlation trend between expression and metallization for both targets. Therefore, ANK2 and EPAS1 were selected as candidates for differential-methylated CMT biomarkers.

2. Assessment of Differential Methylation Regions in Canine Mammary Cancer and Nearby Normal Tissues

Differential methylation was evaluated by further analyzing the target intron regions of ANK2 and EPAS1 identified through MBD-seq. Quantitative methylation specific PCR (qMSP) was performed as a methylation analysis method.

Bisulfite sequencing PCR (BSP) was performed on three randomly selected pairs of CMT and normal gDNA for each target to establish representative methylation patterns for each target. Specifically, the gDNA sample was treated with bisulfite using the EZ DNA Methylation-Lightning kit (Zymo Research), and the bisulfite-treated gDNA was quantified with Qubit ssDNA Assay on the Qubit 3.0 Fluorometer (Invitrogen). Each sample was prepared at the same concentration by diluting with water before performing qMSP. Bisulfite-treated gDNA was subjected to bisulfite sequencing PCR (BSP) using the BSP primer set.

2A and 2B show the results of bisulfite sequencing PCR (BSP) of ANK2 and EPAS1, respectively. For ANK2 and EPAS1, 9 and 10 colonies sequenced for each 3 pairs of normal and CMT samples (delimited by gray dashed lines) are indicated, methylation of CpG is indicated by black circles, unmethylation by white circles, The forward and reverse MSP primer regions for each target are indicated by black squares. As shown in FIGS. 2A and 2B , both the ANK2 and EPAS1 target regions were more methylated in CMT compared to paired normal samples, but the amount of differential methylation varied according to the pair of samples.

After that, more samples were investigated by performing qMSP. qMSP was performed using the CFX96 Real-time PCR Detection System (Bio-Rad Laboratories) and the MSP primer set. Quantitative PCR using the BSP primer set was performed on the same sample to correct the MSP results. One MSP primer set was designed to contain at least 6 CpGs, and at least one CpG was located in the last 3 bases of the 3' end of the primer. The BSP primers were designed to include at least 4 C, not CpG, in each primer set. Each sample was run in triplicate using both MSP and BSP primer sets, and PCR conditions were 15 min at 95 °C, 30 sec at 95 °C, 30 sec at each annealing temperature shown in Table 1, and 30 sec extension at 72 °C. After 45 cycles of 1 cycle, the final extension was performed at 72° C. for 5 minutes. The primer sets used are shown in Table 1 below.

		forward primer (5'->3')	reverse primer (5'->3')	Product size (bp)	Annealing temperature (℃)
dog	ANK2 BSP	TGAGTTTTTGTATAGTTGTAGTTAAAT (SEQ ID NO: 1)	CTACTCTTCTAATAAAAAACACTTAAC (SEQ ID NO: 2)	235	60
	ANK2 MSP	AATTTGTTATCGAGTTTTTCGCGG (SEQ ID NO: 3)	CGCTTTAACCCTAAAATAATCGAACG (SEQ ID NO: 4)	185	66
	EPAS1 BSP	AGAAAATAAAATTATAGTTAGTTTTTTTGA (SEQ ID NO: 5)	AAACTTTTCCCTATTCCCAAAT (SEQ ID NO: 6)	240	60.5
	EPAS1 MSP	AGTTAGTTTTTTTGAGCGCGTTGCGG (SEQ ID NO: 7)	AACCCGACGCAAAACCGCGA (SEQ ID NO: 8)	172	70
human	ANK2 BSP	GAGTATAGTAAGGGAGTTGTTAGT (SEQ ID NO: 9)	CCATCTACTACAAATAAAATATTACCAT (SEQ ID NO: 10)	198	61
	ANK2 MSP	CGGTGTAATTAAACGAATTGGGATTTC (SEQ ID NO: 11)	CTACAAATAAAATATTACCATCGAAAACACG (SEQ ID NO: 12)	149	68
	EPAS1 BSP	GGGAGGGAATTTGTGTATTTTAT (SEQ ID NO: 13)	ATTTTTCCCCTACTCCCAAA (SEQ ID NO: 14)	182	60.5

The methylation index was based on the demethylation index (Akirav et al., Proc. Natl. Acad. Sci. USA, 2011, 108, 19018-19023) and was corrected by measuring the amount of methylated DNA to unmethylated DNA. To normalize the MSP reads, a bisulfite sequencing PCR (BSP) primer set adjacent to the MSP region of interest and Taq DNA polymerase (Bioneer) were used, and the BSP primer set at the CpG island of each intron in Figure 3a ( The positions of the gray) and MSP primer sets (yellow) are indicated. PCR amplicons were purified using MEGAquick-spin Plus Total Fragment DNA Purification kit (Intron Biotechnology), and the purified amplicons were ligated to pGEM T-Easy vector (Promega) and cloned in E. coli. Selected colonies were ordered by Macrogen and sequenced.

The methylation indices of ANK2 and EPAS1 are shown in FIG. 3b (red: CMT sample, blue: paired normal sample). As shown in Figure 3b, 12 out of 15 paired samples analyzed for ANK2 targets were more methylated in CMT compared to normal based on methylation index, whereas 9 out of 15 EPAS1 target samples were paired normal. was more methylated in CMT compared to

Based on the paired t-test, the total methylation level is shown in Fig. 3c (red: CMT sample, blue: paired normal sample, *: p-value <0.05, **: p-value <0.01). As shown in Figure 3c, it was shown to be significantly more methylated in CMT for both ANK2 and EPAS1 targets.

To confirm the sensitivity and specificity of using CMT and methylation as biomarkers, ROC (Receiver operating characteristic) curves were created for both targets, and are shown in FIGS. 3D and 3E for ANK2 and EPAS1, respectively. As shown in FIG. 3D , ANK2 had an area under the curve (AUC) of 0.764. As shown in Figure 3e, EPAS1 had an AUC of 0.733.

Therefore, it was confirmed that the ANK2 intron 21 and EPAS1 intron 1 regions were hypermethylated in CMT compared to normal tissues, and it was confirmed that they were tissue biomarkers for breast cancer.

3. Detection of Differential Methylation in Dog Plasma cfDNA

To evaluate whether a tendency for hypermethylation in CMT tissues was also detected in cfDNA, which could be a potential liquid biopsy biomarker for CMT, the same qMSP method was performed on cfDNA isolated from plasma samples of CMT and normal female dogs. .

For the ANK2 target, blood samples were collected from 19 CMT dogs and 10 cancer-free normal dogs and analyzed with pooled cfDNA samples from the blood. cfDNA was isolated from blood samples using the QIAamp Circulating Nucleic Acid Kit (Qiagen), and quantified with a Qubit 3.0 Fluorometer using the Qubit HS dsDNA Assay (Invitrogen).

EPAS1 targets were analyzed with cfDNA samples from 10 CMTs and 10 normal dogs. The results of cfDNA hypermethylation analysis for ANK2 and EPAS1 are shown in FIGS. 4A and 4B, respectively (red: CMT, blue: paired normal sample, *: p-value <0.05). As shown in FIG. 4a , in the case of ANK2, there was a significant tendency to hypermethylation in CMT compared to normal. However, as shown in FIG. 4b , in the case of EPAS1, it did not show an increase in the methylation level for CMT, as shown in tissue samples, and, in contrast, CMT cfDNA showed low-methylation in CMT compared to normal plasma for EPAS1. .

Therefore, in canine cfDNA, ANK2 showed significant hypermethylation in CMT samples, confirming that ANK2 is a liquid biopsy biomarker for breast cancer.

4. Ortholog Human Regions Analyzed from TCGA Data

To determine whether the hypermethylation tendency seen in canine mammary cancer also appears in human breast cancer, the target region of the canine genome (CanFam3.1) was used using liftOver (Kent W.J. et al., Genome Res. 2002;12:996-1006). was mapped to the human genome (HG19). The sequence identity between the canine ANK2 and canine EPAS1 genes and the human ANK2 and human EPAS1 genes was analyzed by BLAST, and the results are shown in Table 2 below.

As shown in Table 2, about 79% sequence identity to the human 405 bp region and about 76% to the 221 bp region, where the 500 bp region identified in canine MBD-seq for ANK2 and EPAS1 targets is an ortholog. It was confirmed that they have sequence identity.

The human EPAS1 target, like in dogs, had an orthologous region located on the CpG island at the 30th end of the first intron. The target located in the 21st intron of the canine ANK2 gene had an orthologous region in the 21st intron of human ANK2, but human ANK2 did not contain a CpG island.

Not the qMSP method, as human ANK2 orthologs do not contain CpG islands, but Diez-Villanueva et al., . Epigenet. Data from The Cancer Genome Atlas (TCGA) for target regions were investigated as described in Chromatin 2015, 8, 1-8.

TCGA data for ANK2 and EPAS1 were analyzed to determine the mean methylation level ( FIGS. 5A and 5B ), the expression level of the target gene ( FIGS. 5C and 5D ), and relapse-free survival according to the gene expression level. The Kaplan-Meier curve shown (FIGS. 5e and f) was confirmed.

Human breast cancer data were obtained using TCGA's 450k Infinium Chip methylation arrays and Illumina HISeq RNA-seq data. The survival rate was analyzed using ANK2 and EPAS1 expression data and the recurrence-free survival rate of 3951 patients obtained from the GEO database, and using a Kaplan-Meier Plotter.

As shown in Fig. 5a, human ANK2 orthologs confirmed that ANK2 was significantly hypermethylated in 3 of the 4 CpG probes (cg25915539, cg17665652 and cg08448479) (indicated by light blue highlight in Fig. 5a). These regions corresponded to the hypermethylation regions observed in the dog ortholog region. Furthermore, although the amount of CpG in this region is much lower in humans compared to dogs, these three hypermethylated human CpGs are conserved in both species and have been shown to be hypermethylated in canine mammary cancer samples (Fig. 2a). Also, as shown in FIG. 5B , the hypermethylated canine EPAS1 region and the ortholog human EPAS1 region contained two hypermethylated CpG probes.

5c and 5d , the expression of ANK2 and EPAS1 in human breast cancer was down-regulated, which was consistent with the canine data. In addition, as shown in FIGS. 5E and 5F , the survival rate of the individual was decreased according to the down-regulation of ANK2 and EPAS1.

To determine the level of methylation of human plasma cfDNA, human blood samples were provided from Samsung Medical Center. Blood was collected from patients who underwent breast cancer surgery and from healthy individuals with no evidence of breast cancer. The same volume of Ficoll-Paque PLUS (GE Healthcare) was added to whole blood and centrifuged at 18°C at 500xg for 30 minutes to obtain plasma, and the plasma was stored at -80°C until use.

For ANK2, colonies were sequenced from 4 individual samples of human breast cancer cfDNA and 5 pooled normal cfDNA samples. The methylation levels (%) of hypermethylated CpG islands in human breast cancer (HBC) cfDNA, human normal (HN) cfDNA, canine normal (CN) tissue, and canine mammary cancer (CMT) tissue are shown in Table 3 below (CpG2: cg25915539, CpG3: cg17665652, CpG5: cg08448479).

As shown in Table 3, of the three CpGs identified as hypermethylated in the TCGA data, only CpG5 (cg08448479) was more methylated in human breast cancer (HBC) cfDNA compared to human normal (HN). CpG5 showed an increase in methylation from 71.88% of human normal (HN) to 85.48% of human breast cancer (HBC), which was seen for ortholog canine CpG from 31.03% of canine normal (CN) tissues to 62.07% of canine mammary cancer (CMT) tissues. Consistent with a maximal increase in methylation.

Therefore, it was confirmed that the hypermethylation biomarker of ANK2 can be used as a tissue and blood biomarker in both humans and dogs.

The description of the present invention described above is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

Claims (15)

1. A composition for diagnosing breast cancer, comprising an agent for measuring the methylation level of a CpG region in a polynucleotide encoding Ankyrin 2 (ANK2) or Endothelial PAS domain-containing protein 1 (EPAS1).
2. The composition of claim 1 , wherein the CpG region is selected from the group consisting of cg25915539, cg17665652, cg08448479, cg20623601, and cg25124739.
3. The method according to claim 1, wherein the agent is

   a primer set or CpG site-specific probe for CpG site amplification;

   methylation sensitive restriction enzymes; and

   A composition selected from the group consisting of methylation insensitive restriction enzymes.
4. The composition of claim 3, wherein the primer set comprises a polynucleotide selected from the group consisting of SEQ ID NOs: 1 to 14.
5. The composition of claim 3, wherein the methylation sensitive restriction enzyme is HpaII, BsiSI, or a combination thereof.
6. The composition of claim 3, wherein the methylation insensitive restriction enzyme is MspI.
7. A kit for diagnosing breast cancer, comprising an agent for measuring the level of CpG methylation in a polynucleotide encoding Ankyrin 2 (ANK2) or Endothelial PAS domain-containing protein 1 (EPAS1), and a reagent for nucleic acid amplification.
8. obtaining a nucleic acid sample from a biological sample isolated from a subject; and

   A method of providing information for diagnosing breast cancer, comprising measuring a methylation level of a CpG region in a polynucleotide encoding an endothelial PAS domain-containing protein 1 (EPAS1) or Ankyrin 2 (ANK2) from an obtained nucleic acid sample.
9. The method of claim 8 , wherein the subject is a human, dog, mouse, cow, pig, horse, sheep, or cat.
10. The method of claim 8, wherein the biological sample is tissue, blood, plasma, serum, bone marrow fluid, lymph fluid, saliva, tear fluid, mucosal fluid, amniotic fluid, or a combination thereof.
11. The method of claim 8, wherein the nucleic acid sample is genomic DNA (gDNA), cell free DNA (cfDNA), or a combination thereof.
12. The method of claim 8, wherein measuring the methylation level of the CpG site comprises cutting the nucleic acid sample by adding a methylation-sensitive restriction enzyme, a methylation insensitive restriction enzyme, or a combination thereof to the nucleic acid sample.
13. The method of claim 12 , wherein the method further comprises amplifying the nucleic acid sample after the step of cleaving the nucleic acid sample.
14. The method of claim 8 , wherein the CpG region is selected from the group consisting of cg25915539, cg17665652, cg08448479, cg20623601, and cg25124739.
15. The method of claim 8 , wherein the method further comprises determining that the subject is more likely to have breast cancer or has breast cancer when the methylation level of the CpG region is increased compared to the methylation level of a normal control group.

Images