WO2022142963A1 - Vector system for screening regulatory sequences and application - Google Patents

Abstract

Provided is a library construction method for highly diverse libraries, which abandons in-vitro homologous recombination technology used in protein reorganization, and by introducing a Y-type adaptor to connect to a random fragment which is smaller than 100 bp after being digested by DNase I, successfully solves the defect in which functional elements having similar characteristics or specific or unknown functions cannot be effectively recombined. A label library, a functional element library and an index label library are constructed, and the diversity of functional elements may be quickly achieved and with high throughput, thus laying a foundation for final screening so as to obtain functional elements having excellent performance.

Description

A vector system and application for screening regulatory sequences

This application claims the priority of the Chinese patent application filed on December 31, 2020 with the application number 202011630533.X and the invention titled "A method for building a library of functional elements and its application", the entire contents of which are approved by Reference is incorporated in this application.

This application claims the priority of the Chinese patent application with the application number 202111247419.3 and the invention titled "A Vector System and Application for Screening Regulatory Sequences", which was filed with the China Patent Office on October 26, 2021, the entire contents of which are incorporated by reference in in this application.

technical field

The invention belongs to the field of bioengineering, and more particularly relates to a vector system and application for screening regulatory sequences.

Background technique

Gene expression is inseparable from the role of regulatory sequences. As one of the regulatory sequences, the promoter or enhancer is a DNA sequence located in the upstream and downstream regions of the 5' of the structural gene, which can accurately interact with specific RNA polymerases and related transcription factors. Binding, thereby initiating the transcription initiation of downstream genes, is the most important cis-acting element for regulating gene expression. Eukaryotic promoters contain three conserved sequences with important biological functions, namely the TATA box (TATA box) located in the -35--25 region, the CAAT box (CAAT box) located in the -80--70 region, and the - GC box in the 110--80 zone. The TATA box is involved in regulating the precise transcription initiation of downstream genes, and the CAAT box and GC box are involved in regulating the frequency of transcription initiation. Although the above three functional regions are important manifestations of the functional activity of promoters, not every promoter contains these three functional regions, and the change of any base or relative position of these three functional regions will often cause promoters Dramatic changes in activity and specificity. The upstream promoter or enhancer activity and the regulatory sequences near the gene, such as 5'UTR and 3'UTR, are the key factors to determine whether the downstream gene can be expressed smoothly and whether the expression level is moderate. Therefore, in order to obtain better expression of the target gene. It is particularly important to transform and screen promoter regulatory sequences using molecular directed evolution technology in vitro.

Natural evolution is a long process of survival of the fittest and the accumulation of favorable mutations. In order to speed up this process, researchers simulate the natural evolutionary mechanisms of mutation, recombination and selection in vitro, so that evolution develops in the expected direction. Early researchers mainly used physical methods, chemical methods, mutagenic strains or error-prone PCR to introduce random mutations into protein-coding genes, and then perform functional screening at the cellular or animal level to obtain new functions that can meet people's needs or Excellent performance protein. Although these methods can improve some properties of proteins to a certain extent, their diversity is far from meeting people's needs. With the continuous development of molecular biology, people have established a new PCR-based in vitro directed molecular evolution technology-DNA shuffling technology, which was first proposed by Stemmer in 1994 and can be used for nucleic acid and protein In vitro directed evolution. DNA shuffling involves dividing multiple related gene families from different sources into random fragments by DNaseI digestion or sonication, and then using the homology between the fragments as templates and primers for each other, these fragments are reassembled by primerless PCR (primerless PCR). To generate full-length genes, the process generates template switching or crossover events that increase the diversity of the mutant library. The protein mutants were then amplified using specific 5' and 3' primers for different protein-coding frames, and cloned into relevant cloning vectors to form mutant libraries. The library diversity (~106 or more) was verified by NGS sequencing. ), and finally perform functional screening at the cellular level or animal level to obtain a protein with improved properties. This method is mainly aimed at the directed evolution of protein molecules. Different genes used as starting templates need to have a certain degree of homology, so as to generate in vitro homologous recombination between small fragments and introduce mutations to form a mutant library for screening.

The main purpose of promoter or enhancer DNA shuffling (promoter or enhancer shuffling) is to enhance the activity of the promoter or specifically change the expression characteristics of the gene. ) are often extremely low in homology, so the above-mentioned DNA shuffling technology for protein molecules obviously cannot be used for the directed evolution of promoter regulatory sequences. At present, promoter shuffling generally adopts the following technical routes: (1) performing two rounds of error-prone PCR on a single promoter to recover PCR products (forming a large number of mutants with homologous sequences); (2) digesting with DNaseI or sonicating into Random fragments and recover; (3) use the recovered product as a template to carry out primer-free PCR; (4) add specific primers containing specific restriction sites to the primer-free PCR system to amplify the full-length promoter, and recover the specific size (5) The cloning vector and the full-length promoter mutant were digested and ligated with the corresponding restriction enzymes; (6) NGS sequencing was used to verify the diversity of the promoter library. This technical route highly repeats the method of protein directed evolution, and can only shuffle the source of a single promoter. Even if the error-prone PCR in the first round improves the diversity of templates, it is still derived from the same promoter in essence. The diversity of the promoter library is still greatly limited, generally only 10 ⁴ to 10 ⁵ under the same system, and it is difficult to screen regulatory sequences with specific functions.

SUMMARY OF THE INVENTION

In view of this, the technical problem to be solved by the present invention is to provide a vector system and application for screening regulatory sequences.

The purpose of the present invention is to overcome the limitations of the promoter shuffling method, solve the problem of insufficient library diversity due to the low homology of promoters from different sources and the inability to carry out efficient in vitro recombination, and provide a method for constructing a functional element library

The technical scheme adopted by the present invention is:

A first aspect of the present invention provides a plasmid vector comprising: an index tag, a reporter gene and a barcode tag;

The barcode label is a random fragment with a length of 5-200 bp;

The number of the index tags is at least 1, and it is independently selected from random fragments with a length of 5-100 bp;

The expression product of the reporter gene is capable of self-emitting light or producing color change by catalyzing the substrate reaction, producing light or producing color change by catalyzing the substrate reaction, or producing emitted light or producing color change by irradiating excitation light, Or resistant to corresponding drug screening.

In some embodiments, the barcode tag is a random fragment with a length of 40bp; the number of the index tags is 2, wherein index1 is a random fragment with a length of 30bp, index2 is a random fragment with a length of 30bp, and the reporter gene At least one selected from the group consisting of fluorescent protein, luciferase, LacZ gene or a resistance gene that can play a screening role, and the resistance gene includes a puromycin resistance gene.

Some provided herein include a vector backbone with a first terminator, a recombination site, a reporter gene, a multiple cloning site (MCS), a post-transcriptional regulatory sequence (WPRE), and a second terminator sequentially attached to the vector backbone.

Preferably, according to the vector according to the first aspect of the present invention, the vector further comprises at least one enzyme cleavage site.

Preferably, the expression product of the reporter gene is capable of self-emitting light or producing color change by catalyzing the reaction of the substrate, producing light or producing color change by catalyzing the reaction of the substrate, or by irradiating excitation light to produce emission light or producing Color changes, or resistance to corresponding drug screening.

Specifically, the reporter gene is selected from at least one of fluorescent protein, luciferase, LacZ gene or a resistance gene that can play a screening role, such as a puromycin resistance gene.

In some embodiments of the present invention, TurboGFP is selected as the reporter gene.

Preferably, the first terminator and the second terminator are elements capable of terminating transcription.

Specifically, the terminator SV40 terminator, hGH terminator, BGH terminator or rbGlob terminator.

In some embodiments of the present invention, both the first terminator and the second terminator are selected as BGH terminators, denoted as BGH-pA.

In some embodiments, the plasmid vector sequentially comprises the following elements: pUC ori, 5' ITR, BGH pA, index1, index2, reporter gene, barcode tag, WPRE, BGH pA, 3' ITR, and a resistance selection marker.

In some embodiments, an enzyme cleavage site and a random recombination regulatory sequence are also included between the index1 and index2.

In some specific embodiments, the enzyme cleavage site is AsiSI; the number of the enzyme cleavage site is 2, located at both ends of the random recombination control sequence;

In some embodiments, the random recombination regulatory sequence is a fragmented promoter fragment or a fragmented enhancer fragment.

In some specific embodiments, the random recombination regulatory sequence is an enzymatically digested promoter fragment or an enzymatically digested enhancer fragment.

In the embodiment of the present invention, in the step of preparing the random recombination regulatory sequence, the fragmentation method includes enzymatic digestion, ultrasonication or artificial synthesis. In some embodiments, the enzyme digested by the enzyme is DnaseI.

In the embodiment of the present invention, in the step of preparing the random recombination regulatory sequence, the enzyme digested by the enzyme is DnaseI; the promoter is selected from hRO, hRK, mCAR, ProA1, CMV, EF1A, EFS, CAG, CBh, SFFV, MSCV, SV40, mPGK, hPGK, UBC, Nanog, Nes, Tuba1a, Camk2a, SYN1, Hb9, Th, NSE, GFAP, Iba1, hRHO, hBEST1, Prnp, Cnp, K14, BK5, mTyr, cTnT, αMHC, Myog, ACTA1, MHCK7, SM22a, EnSM22a, Runx2, OC, Col1a1, Col2a1, aP2, Adipoq, Tie1, Cd144, CD68, CD11b, Afp, Alb, TBG, MMTV, Wap, HIP, Pdx1, Ins2, Hcn4, NPHS2, SPB, CD144, TERT, TRE, TRE3G, GAL1, MET17, CUP1, AOX1, sCMV, bactin2, Ubi, cmlc2, zK5, 503unc, HSP70, 5×UAS, CaMV35S, Nos, ZmUbi, TEF1, GPD, ADH1, GAP, actin5C, Polyubiquitin, α1-tubulin, Rh2, Mtn, U6, U3, H1, U6-26, TK, RSV, MC1, GAL1, PH, p5, p10, p40, p41, araBAD, cspA or Hsp68; the enhancer is selected from CMV_en, HBB_en or SV40_en.

In some embodiments, the plasmid vector includes the following elements in sequence: pUC ori, 5'ITR, BGH pA, index1, AsiSI restriction site, index2, Kozak, TurboGFP gene, barcode tag, WPRE, BGH pA, 3'ITR and Amp resistance screening marker; wherein, the barcode label is a random fragment with a length of 40bp, the index1 is a random fragment with a length of 30bp, and the index2 is a random fragment with a length of 30bp;

In other embodiments, the plasmid vector sequentially includes the following elements: pUC ori, 5'ITR, BGH pA, index1, AsiSI restriction site, random recombination control sequence, AsiSI restriction site, index2, Kozak, TurboGFP gene , barcode tags, WPRE, BGH pA, 3'ITR and Amp resistance screening markers; wherein, the length of the random recombination control sequence is 50-2000bp, which is the promoter fragment after DnaseI digestion or the enhancer fragment after enzyme digestion , the barcode label is a random fragment with a length of 40bp, the index1 is a random fragment with a length of 30bp, and the index2 is a random fragment with a length of 30bp.

The second aspect of the present invention provides a method for constructing the plasmid vector, wherein barcode tags, index tags and random recombination control sequences are inserted into a backbone vector containing a reporter gene.

The present invention does not limit the insertion order of barcode tags, index tags or random recombination control sequences, and also does not limit the insertion order thereof. Any method of connecting a vector and a nucleic acid fragment that can be used in the art can be used in the present invention. For the construction of the plasmid vector described above, for example, the insert fragment and the vector are ligated after enzyme digestion, or the fragment and the vector are ligated by Gibson cloning reaction.

In the present invention, the insertion of the barcode tag is as follows: preparing a barcode tag carrying the homology arm of the backbone vector, making it react with the linearized backbone vector through Gibson cloning, and constructing a tag library. In the present invention, the insertion of the index tag and the random recombination regulatory sequence includes:

Prepare a random recombination regulatory sequence, and then add the homology arms and index tags of the backbone vector at both ends to obtain a structure of homology arm 1-index tag 1-restriction site 1-random recombination regulatory sequence-restriction site 2 - index tag 2 - insert of homology arm 2;

The tag library is linearized; the fragments are then ligated to the linearized tag library to obtain a library of regulatory sequences.

In some embodiments, the method for preparing the random recombination regulatory sequence comprises enzymatically digesting the promoter or enhancer. In some specific embodiments, the enzyme is the DnaseI enzyme.

In some embodiments, the preparation of the homology arm 1-index tag 1-enzyme cleavage site 1-random recombination regulatory sequence-enzyme cleavage site 2-index tag 2-homology arm 2 fragment specifically includes:

The primer F and primer R are annealed to form a Y-shaped adapter; the structure of the primer F is homology arm 1-index tag 1-restriction site 1-protection sequence 1; the structure of the primer R is protection sequence 2- Restriction site 2-index tag 2-homology arm 2; the protection sequence 1 and protection sequence 2 are complementary;

Connect the adapter with the blunt-ended random recombination control sequence to obtain a random long fragment of the functional element containing the Y-shaped linker;

A linear fragment is obtained by PCR on the random long fragment of the functional element containing the Y-shaped linker,

The linear fragment is ligated with the linearized tag library to construct a library of regulatory sequences.

In some embodiments, the method for constructing the plasmid vector of the present invention further includes removing the random recombination regulatory sequence from the regulatory sequence library by enzyme digestion to obtain an index tag library.

The third aspect of the present invention provides the application of the vector described in the first aspect of the present invention in library construction or functional element screening.

The fourth aspect of the present invention provides a method for library construction, using a Y-shaped linker to integrate randomly interrupted sequences into the vector.

Specifically, the integration site is the recombination site of the vector.

Further, the Y-shaped linker is structurally divided into a complementary region and a non-complementary region.

Further, the non-complementary sequences at the 5' end of the Y-shaped linker respectively comprise the first homology arm, the second homology arm, the first index sequence and the second index sequence from the front and rear ends of the backbone vector cloning site, The complementary sequence at the 3' end contains the restriction enzyme cleavage site.

Specifically, the structure of the Y-shaped linker is a first homology arm, a first index sequence, an enzyme cutting site, a random sequence embedding site, an enzyme cutting site, a second index sequence and a second homology arm.

The homologous sequence facilitates subsequent Gibson cloning reactions with the backbone vector.

The enzyme cleavage site is different from the enzyme cleavage site on the vector described in the first aspect of the present invention, and the enzyme cleavage site can be used for sequencing verification of functional elements after functional screening.

In some embodiments of the present invention, the enzyme cleavage site is selected as an AsiSI enzyme cleavage site.

In some embodiments of the present invention, the Y-shaped linker is prepared by annealing PCR primers.

Further, the downstream primer of the PCR also has an enzyme cleavage site.

More specifically, the Y-shaped linker is prepared by mixing primer A: GGGCTCACCTCAGGCTACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGATCGCTTCATTC (SEQ ID NO.3) and primer B Phos-GAATGAAGCGATCGCNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTGACGTAGGCTGACGGC (SEQ ID NO.4) after mixing.

The method according to the third aspect of the present invention comprises the following steps:

S01. Construct a tag library;

S02. Construct a functional element library;

S03. Build an index tag library.

Further, the label in step S01 is a random sequence with about 40 bases,

Preferably, the random tag sequence is located downstream of the fluorescent tracer screening gene TurboGFP,

More preferably, the random tag sequence is located between the fluorescent tracer screening gene TurboGFP and polyA, and the Barcode sequence can be determined at the mRNA level, thereby indirectly determining its corresponding functional element sequence.

More specifically, the specific operations of step S01 are:

a. Linearize the vector, and recover the linearized vector backbone;

b. Amplify the vector backbone with primers carrying random tag sequences and homology arms to obtain PCR products with random tag sequences;

c. Connect the PCR product to the recovered linearized vector backbone to construct a tag library.

Preferably, the vector is linearized by single enzyme cleavage in step a.

Preferably, the upstream primer of the primer in step b contains the random tag sequence.

Preferably, both the upstream and downstream primers of the primers in step b contain restriction enzyme cleavage sites. The PCR fragment thus amplified can be ligated with the digested vector backbone after digestion.

Preferably, in step c, the ligation product is transformed into E. coli for storage.

In some embodiments of the present invention, XbaI is used to cut the backbone vector, and the primers used are: F-terminal primer: CACCAAGGAAGCCCTCGAGGACGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATCCCGACCTACCGACCCAGCTTTC (SEQ ID NO.1) and R-terminal primer AGGCGAAGACGCGGAAGAGG (SEQ ID NO.2).

After recycling and purifying the PCR product, use Mlu I+Tfi I to carry out digestion and purification to obtain the insert-label Insert-Barcode fragment; use Mlu I+Tfi I to cut the cloned backbone, and reclaim the 4849bp fragment as the vector backbone; then insert the label Insert-Barcode fragment A ligation reaction was performed with the library backbone and transformed into E. coli DH10B to obtain a tagged Barcode library.

In some embodiments of the present invention, the specific technical route of step S01 is as follows: using a specific restriction enzyme to excise the backbone vector MCS and part of the element sequence, recovering the backbone large fragment, using the 5' end to carry the random tag Barcode sequence and The primers of the homology arm PCR amplify the backbone vector to obtain a PCR product with Barcode; the PCR product is subjected to Gibson cloning reaction with the backbone vector recovered by enzyme digestion to construct a tag library, or recorded as a Barcode library.

In addition, the diversity of the tagged Barcode library can also be verified by high-throughput NGS sequencing.

Further, step S02 utilizes the Y-shaped linker to integrate the randomly interrupted sequence of the functional element into the vector.

More specifically, the specific operation of step S02 is:

d. Randomly interrupt the nucleic acid fragments of functional elements to obtain random short fragments of functional elements;

e. Connect the random short fragment of the functional element with the Y-shaped linker to obtain a random long fragment of the functional element containing the Y-shaped linker;

f. Linking the random long fragments of functional elements containing Y-shaped linkers with the tag library constructed in step S01 to construct a functional element library.

Preferably, in step d, the functional element fragments are randomly broken into fragments smaller than 100 bp.

More preferably, the functional element fragments are randomly broken into fragments of about 50 bp in step d.

Preferably, in step d, the nucleic acid fragments are randomly interrupted and then blunted to form blunt-ended short fragments of different sizes.

Preferably, the nucleic acid fragments of the functional elements in step d are nucleic acid fragments of multiple functional elements of a specific function.

Preferably, in step e, the yield of random long fragments of functional elements containing Y-shaped linkers can be increased by PCR, and the random long fragments of functional elements containing Y-shaped linkers can be reconfigured into double-stranded DNA fragments. The PCR product was purified and then ligated with the tagged Barcode library.

The primers used in this step are: F2:CGGTGGGCTCTATGGTGAGACGCCAGCCGTGGGCTCACCTCAGGCTACGG (SEQ ID NO.5);

R2: GTCTAGACCTCGAGGAGAGACGCCACGGCTGCCGTCAGCCTACGTCAGGG (SEQ ID NO. 6).

Further, the Y-shaped adapter in step e is prepared by annealing PCR primers.

Further, the downstream primer of the PCR also has an enzyme cleavage site.

In some embodiments of the present invention, the Y-shaped linker is prepared by mixing primer A: GGGCTCACCTCAGGCTACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGATCGCTTCATTC (SEQ ID NO.3) and primer BPhos-GAATGAAGCGATCGCNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTGACGTAGGCTGACGGC (SEQ ID NO.4) after mixing.

In some embodiments of the present invention, the specific technical route of step S02 is as follows: PCR amplification and recovery of several functional elements with the same tissue specificity or specific or unknown functions respectively; Random fragments of 100bp and blunt ends are recovered, and the target size band is recovered, such as a small band of about 50bp; the Y-type adaptor that has undergone annealing reaction is added to the random blunt-end short fragment for ligation and PCR reaction, and the obtained structure is the first identical. Source arm-first index sequence-AsiSI restriction site-functional element fragment-AsiSI restriction site-second index sequence-cloned fragment of the second homology arm; the cloned fragment is connected to the pre-digested Barcode library again , to obtain the functional element library. The first index sequence is denoted as index1, and the second index sequence is denoted as index2.

In some embodiments of the present invention, the Barcode library obtained in step S01 was specifically digested with XcmI, and the 4845bp fragment was recovered as the library backbone; the functional element random fragment and the library backbone were ligated and transformed into Escherichia coli DH10B, Obtain the promoter library.

Further, the specific technical route of step S03 is as follows: the functional element library constructed in step S02 is digested with enzymes, the random sequence embedding site is removed, the vector backbone is recovered and self-ligated, and an index tag library is constructed.

Preferably, the fragments obtained by cleaving the functional element library are added to the ligation reaction by means of a small amount of multiple additions, so that the ligation reaction that occurs in the ligation reaction is an intramolecular ligation reaction as much as possible, even if a single linearized fragment is self-circularized Ligation; and transforming the ligation product into E. coli DH10B to obtain an indexed tag library.

In order to determine the one-to-one correspondence between index1, index2 and Barcode, the functional element library was digested with enzymes, random fragments of functional elements were cut out, the backbone was recovered and self-ligated, so that index1 and index2 could be simultaneously analyzed in a high-throughput sequencing reaction. Sequencing with Barcode (the maximum sequencing read length of high-throughput sequencing NGS is 1 kb), an index tag library is constructed, and the inventor named the library as the Marriage library.

Using the plasmid of the Marriage library as a template, the index1, index2 and Barcode sequences in the Marriage library were amplified by PCR for high-throughput sequencing and NGS sequencing. The corresponding relationship between the three can be determined through data analysis.

The fifth aspect of the present invention provides the application of the method described in the third aspect of the present invention in screening functional elements.

The sixth aspect of the present invention provides a method for screening functional elements, comprising the step of building a library, and the method for constructing the library is the method described in the third aspect of the present invention.

The method according to the sixth aspect of the present invention comprises the following steps:

S11. transfect cells or inject experimental animals with the functional element library constructed by the method of the present invention;

S12. Select cells or tissues to extract mRNA according to the expression of the reporter gene, and reverse-transcribe it into cDNA;

S13. Sequence the tag, and obtain functional elements by screening the corresponding relationship between the tag sequence, the first index sequence and the second index sequence.

In some embodiments of the present invention, the promoter library is firstly transfected into specific cells or microinjected into experimental animals. If it is a viral vector, it needs to be packaged into virus particles to infect cells or live animals, and then the fluorescence expression of TurboGFP is observed. , select cells or tissues with suitable fluorescence expression intensity to extract mRNA, reverse transcribed into cDNA and sequence the label Barcode, the corresponding index1 and index2 specific sequences can be obtained through the corresponding relationship between index1, index2 and Barcode in the Marriage library, and finally Using index1 and index2 of known sequences as primers, and using the functional element library as a template, PCR amplifies specific functional elements, and finally selects functional elements with excellent performance (such as small fragments, high specificity, and strong priming ability). sequence.

The beneficial effects of the present invention are:

The existing specific functional element shuffling technology is based on in vitro homologous recombination in protein shuffling, and often only a single functional element can be used as an initial shuffling template, resulting in insufficient library diversity. The invention provides a library construction method with high library diversity, abandons the in vitro homologous recombination technology used in protein shuffling, and successfully solves the problem of similar The defect that functional elements with specific or unknown functions cannot be effectively recombined. This method mainly involves the construction of three libraries, namely, the construction of Barcode library, functional element library and marriage library, which can quickly and high-throughput realize promoter or The construction method of highly diverse enhancers can also be applied to the construction and screening of other functional elements, which lays a solid foundation for the final screening of functional elements with excellent performance.

Description of drawings

Figure 1 is a schematic diagram of the Y-type connector;

Figure 2 Original vector map (example);

Fig. 3 constructs the vector map of label Barcode library;

Fig. 4 constructs the vector map of promoter library;

Fig. 5 constructs the vector map of index tag Marriage library;

Figure 6 The ratio of random segment fragments and adapters; wherein, the ratio of random short fragments added to lane 1 and Y-type adapter is 1:3; the ratio of lane 2 is 1:1;

Figure 7 Fluorescence image of retinal slices after in situ subretinal injection in mice, the brighter red fluorescence in panel A represents the distribution of cone cells, panel B is the distribution and expression of the entire library in the retina, panel C is panel A The co-staining map of Figure B, the yellow-orange fluorescently labeled cells in Figure C can be used for subsequent identification of promoter sequences;

Figure 8 enhancer test expression vector;

Figure 9 Enhancer library.

Detailed ways

The content of the present invention will be described in further detail below with reference to specific embodiments and accompanying drawings. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.

The experimental method of unreceipted specific conditions in the following examples, usually according to conventional conditions, such as Sambrook et al., Molecular Cloning: Conditions described in laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer the proposed conditions. Various common chemical reagents used in the examples are all commercially available products.

In the embodiment, AAV vector is selected as an example, and the plasmid map is shown in FIG. 2 . Those of ordinary skill in the art should understand that the purpose of the present invention can be achieved by adopting the vectors used for conventional library construction. Such as pUC18, pBR322 vectors, etc., different vectors can be selected according to the subsequent screening methods and application scenarios.

Genomic functional elements (functional elements) refer to the elements involved in the regulation of gene expression, mainly including cis-acting elements and trans-acting elements. Common ones include: promoters, enhancers Enhancers, silencers, regulatory regions and sequences, inducible elements, activators and repressors, etc.

Label Barcode, a label for high-throughput sequencing process, to distinguish different samples.

The index is an index for further distinguishing different samples containing the same label Barcode in the high-throughput sequencing process.

Example 1

A method for constructing a functional element library, comprising the construction of three kinds of libraries, respectively constructing a Barcode library, a functional element library and a Marriage library, and specifically comprising the following steps:

S01. Build a label (Barcode) library:

(1) Prepare Insert-Barcode fragment:

Use XbaI to digest the original vector (as shown in Figure 2), and recover the 4528bp fragment as a template for PCR to amplify the partial sequence of the multi-cloning site MCS+ transcriptional regulatory element WPRE element; the primers used are: F1 end primer: CACCAAGGAAGCCCTCGAGG ACGCGT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATCCCGACCTACCGACCCAGCTTTC (SEQ ID NO.1) and R1-terminal primer AGGCGAAGACGCGGAAGAGG (SEQ ID NO.2) for amplification;

The 40 N bases in the F-terminal primer represent random sequencing tag Barcode sequences.

After the recovery and purification of the PCR product, Mlu I+Tfi I was used for digestion and purification to obtain the Insert-Barcode fragment.

The underline of the F-terminal primer is the restriction site of Mlu I; the restriction site of Tfi I is located on the transcriptional regulatory element WPRE of the vector backbone, and the amplification products of primers F and R contain the restriction site of Tfi I.

(2) Preparation of linearized clone backbone: The clone backbone was digested with Mlu I+Tfi I, and the 4849bp fragment was recovered as the library backbone.

(3) Perform a ligation reaction between the Insert-Barcode fragment and the library backbone (as shown in Figure 3) to obtain a Barcode library, which is transformed into E. coli DH10B for preservation.

(4) Amplify the Barcode sequences in the Barcode tag library for high-throughput NGS sequencing, and confirm that the diversity of the library is as high as 1×10 ⁸ through data analysis.

S02. Construct a regulatory sequence library:

(1) randomly interrupt the nucleic acid fragments of several functional elements of a certain type to obtain random fragments of functional elements;

Use DNase I to digest the nucleic acid fragments of the functional elements (the conditions and times for the digestion of fragments of different lengths are different), so that the promoter fragments are randomly cut into short fragments of different sizes;

1U of DNase I was diluted 25 times, and the fragment was digested according to the following system, so that the promoter fragment was randomly sheared into a short fragment of 50-100 bp, and recovered;

use

End Repair Module (E6050S) blunts the ends of the short fragments to form blunt-ended short fragments of different sizes, which are purified and recovered to obtain random short fragments of functional elements;

Primer F2: GGGCTCACCTCAGGCTACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGATCGCTTCATTC (SEQ ID NO. 3) and primer R2Phos-GAATGAA GCGATCGC NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTGACGTAGGCTGACGGC (SEQ ID NO. 4) were mixed and prepared by annealing. After mixing, a Y-type adapter (containing an AsiSI restriction site) was formed by annealing.

The underline of primer B is the restriction site of AsiSI.

The random short fragments of the functional element and the Y-type adapter are mixed in a certain proportion, and then the ligation reaction is performed to generate a long fragment of the functional element containing the Y-type adapter;

The long fragments of functional elements are screened by agarose gel electrophoresis, gel cutting and recovery, and the long fragments of functional elements within the expected range are recovered and purified;

Using the recovered functional element long fragment as a template, increase the yield of the functional element long fragment within the expected range by PCR amplification, and restructure the functional element long fragment expected to contain Y-type adaptor into double-stranded DNA fragments; recovery and purification PCR products to obtain the final functional element random fragment fragment.

The primer sequence of PCR is: F2: CGGTGGGCTCTATGGTGAGACGCCAGCCGTGGGCTCACCTCAGGCTACGG (SEQ ID NO.5);

R2: GTCTAGACCTCGAGGAGAGACGCCACGGCTGCCGTCAGC CTACGTCAGGG (SEQ ID NO. 6).

(2) prepare the linearized vector backbone: use XcmI to digest the Barcode library obtained in S01, remove the Stuffer sequence, and reclaim the 4845bp fragment as the library backbone;

(3) A ligation reaction is performed between the random fragment of the s functional element and the vector backbone to obtain a promoter library (as shown in Figure 4), which is transformed into Escherichia coli DH10B for preservation.

S03. Build an index tag Marriage library

(1) Linearization: use AsiS I to digest the regulatory sequence library obtained in S02, and recover 4954bp of linearized fragments containing the same sticky ends;

(2) Ligation and transformation: The fragment obtained in the previous step is added to the ligation reaction by adding a small amount of times, so that the ligation reaction that occurs in the ligation reaction is an intramolecular ligation reaction as much as possible, even if a single linearized fragment itself loops ligation; and the ligation product was transformed into E. coli DH10B to obtain an index tag Marriage library (as shown in Figure 5), which was transformed into E. coli DH10B for preservation.

Using the plasmid of the Marriage library as a template, the index1, index2 and Barcode sequences in the index tag Marriage library were amplified by PCR for high-throughput sequencing, and the corresponding relationship between the three was determined by data analysis.

Example 2

In order to obtain a highly specific promoter that targets cone cells and can efficiently express the target gene, the inventors selected four photoreceptor cell-specific promoters hRO, hRK, mCAR and ProA1 as raw materials for DNA shuffling. The difference in seed promoter strength was hRO≈hRK>mCAR>ProA1. Among them, the ProA1 promoter is a promoter that is specifically expressed only in cone cells, but its full length is about 2 kb, which is obviously not suitable for AAV vectors. The full-length hRK promoter is only about 500 bp and can be expressed in both cone and rod cells, but its specificity does not meet the expected requirements. The hRO and mCAR promoters were only expressed in rod cells, again not as expected. Therefore, the inventors used these four promoters to carry out random DNA recombination, selected random recombination fragments with a size of about 500 bp and cloned them into an AAV vector to form a promoter library, and then packaged the obtained highly diverse promoter library into type 8 At the same time, the control virus was used as the reference for the targeting of cone cells, and the subretinal in situ injection was performed at the animal level. By observing the fluorescence expression of TurboGFP (green reporter gene) and Tdtomato (red reporter gene), we screened out those with excellent characteristics. Random recombinant promoter, the specific experimental steps are as follows:

S01. Build the Barcode tag library:

1.1 Prepare Insert-barcode fragment:

1.1.1 Use XbaI to cut the cloned backbone and recover the 4528bp fragment as a template for PCR to amplify the partial sequence of the MCS+WPRE element; use F1 end primers: CACCAAGGAAGCCCTCGAGG ACGCGT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATCCCGACCTACCGACCCAGCTTTC (SEQ ID NO.1) and R1 end primers AGGCGAAGACGCGGAAGAGG (SEQ ID NO. NO.2) Amplify;

1.1.2 use Mlu I+Tfi I to carry out digestion and purification after reclaiming and purifying PCR product, obtain Insert-Barcode fragment;

1.2 Prepare the linearized clone backbone: use Mlu I+Tfi I to cut the clone backbone, and recover the 4849bp fragment as the library backbone;

1.3 Carry out a ligation reaction with the Insert-Barcode fragment and the library backbone, and transform it into Escherichia coli DH10B to obtain the Barcode library;

1.4 Amplify the Barcode sequences in the Barcode tag library for NGS sequencing, and confirm the diversity of the library as high as 1×10 ⁸ through data analysis.

S02. Build a promoter library:

2.1 Preparation of random recombinant promoter fragments:

2.1.1 Amplify hRO, hRK, mCAR and ProA1 promoter fragments by PCR respectively;

2.1.2 Use DNase I to digest the promoter fragment and dilute 1U of DNase I by 25 times, digest the fragment according to the following system, so that the promoter fragment is randomly sheared into a short fragment of 50-100bp, and is recovered;

2.1.3 Use

End Repair Module (E6050S) blunts the ends of the above-mentioned fragments to form a blunt-ended short fragment of 50-100 bp, which is purified and recovered to obtain a random short fragment of the promoter;

2.1.4 Mix primer F2: GGGCTCACCTCAGGCTACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGATCGCTTCATTC (SEQ ID NO. 3) and primer R2: Phos-GAATGAA GCGATCGC NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTGACGTAGGCTGACGGC (SEQ ID NO. 4) to form Y-type adaptor (containing AsiSI restriction site) by annealing;

2.1.5 The random short fragment of the promoter and the Y-type adapter were mixed at a ratio of 1:1 and 1:3 respectively, and then the ligation reaction was carried out, and the size of the long fragment of the promoter containing the Y-type adapter was obvious; as shown in Figure 6 With the increase of the amount of adapter added, the length of the obtained fragment is shorter;

2.1.6 The ligation product was subjected to agarose electrophoresis, and the 500bp long promoter fragment was cut into gel for recovery and purification;

2.1.7 The product of the previous step was used as a template, and the yield of the 500bp promoter long fragment was increased by the method of PCR amplification, and the expected Y-type adaptor-containing promoter long fragment was restructured into a double-stranded DNA fragment;

The primer sequence is: F2: CGGTGGGCTCTATGGTGAGACGCCAGCCGTGGGCTCACCTCAG GCTACGG (SEQ ID NO.5);

R2: GTCTAGACCTCGAGGAGAGACGCCACGGCTGCCGTCAGCCTACGTCAGGG (SEQ ID NO. 6).

2.1.8 Recover and purify the PCR product of the previous step to obtain the final shuffling promoter fragment.

2.2 Prepare the linearized clone backbone: use Xcm I to digest the Barcode tag library obtained in the first step, and recover the 4845bp fragment as the library backbone;

2.3 The random recombination promoter fragment and the library backbone are ligated, and transformed into Escherichia coli DH10B to obtain a promoter library;

S03. Build the index tag Marriage library:

3.1 Linearization: Use AsiS I to digest the promoter library obtained in the second step, and recover a 4954bp linearized fragment containing the same sticky end;

3.2 Ligation and transformation: The fragments obtained in the previous step are added to the ligation reaction by adding a small amount of time, so that the ligation reaction that occurs in the ligation reaction is an intramolecular ligation reaction as much as possible, even if a single linearized fragment itself is circularly connected. ; And the ligation product is transformed into Escherichia coli DH10B to obtain the index tag Marriage library;

3.3 Using the plasmid of the Marriage library as a template, PCR amplify the index1, index2 and Barcode sequences in the index tag of the Marriage library for NGS sequencing, and determine the corresponding relationship between the three through data analysis. The diversity of the library was determined to be 8.5×10 ⁶ by sequence analysis.

The present embodiment also provides a method for screening functional elements, comprising the following steps:

S11. Transfect cells or inject experimental animals with the functional element library constructed in step S02;

S12. Select cells or tissues to extract mRNA according to the expression of the reporter gene, and reverse-transcribe it into cDNA;

S13. Sequence the label Barcode, and obtain functional elements by screening the corresponding relationship between the label Barcode sequence, the first index sequence and the second index sequence.

Specifically, take the selection of promoters with excellent properties at the animal level as an example:

4.1 The above-obtained promoter library and the control ProA1-Tdtomato were packaged into type 8 AAV virus;

4.2 In situ injection under the retina of mouse eyeball after mixing the above viruses;

4.3 Two weeks later, the eyeballs were taken out for frozen section and photographed to observe the fluorescence expression;

4.4 Collect photoreceptor cells and perform flow screening to sort out cells with higher fluorescence intensity. The results are shown in Figure 6;

4.5 Extract RNA from the sorted cells with strong fluorescence expression;

4.6 Reverse transcription into cDNA with RNA as a template, PCR amplify the sequence containing Barcode for NGS sequencing, and obtain the specific sequences of index1 and index2 through the data analysis results of the Marriage library;

4.7 Using the obtained index1 and index2 sequences as primers and the promoter library as a template, PCR amplifies the corresponding promoter fragments;

4.8 Obtain the specific sequence of the candidate promoter by Sanger sequencing.

Figure 6 shows the fluorescence images obtained by subretinal orthotopic injection in mice after premixing the library virus with the control ProA1-Tdtomato virus. Since the ProA1 promoter only specifically targets cone cells, the brighter red fluorescence in Figure A represents the distribution of cone cells, Figure B shows the distribution and expression of the entire library in the retina, and Figure C is Figure A The co-staining map of Figure B, the yellow-orange fluorescently labeled cells in Figure C can be used for subsequent identification of promoter sequences.

To sum up, it shows that the library construction method provided by the present invention can achieve the effect of high diversity of the library, successfully solve the defect that functional elements with similar characteristics or specific or unknown functions cannot be effectively recombined, and can quickly and high-throughput. A construction method that realizes high diversity of promoters, enhancers or other functional elements, and can screen out functional element sequences with excellent performance (such as smaller fragments, high specificity, and strong activation ability).

Example 3

Select CMV_en, HBB_en and SV40_en enhancers as raw materials for DNA shuffling, these three enhancers can play a role in gene regulation, the size of the CMV_en enhancer is 300bp, the size of the HBB_ enhancer is 3kb, and the size of the SV40_en enhancer is 237bp. In order to obtain a new, shorter and positively regulated HBB enhancer, we used these three enhancers for random recombination, and selected a random recombination fragment with a size of about 800bp-1k and cloned it into a mammalian enhancer containing the SCP1_mini promoter The enhancer library was formed on the sub-test expression vector (Figure 8), and then the obtained enhancer library was transiently transfected into K562 cells, and cells with different fluorescence intensities were screened by flow sorting, and the random recombination enhancer that met the purpose was further screened. son.

1. Build the Barcode label library:

1.1.1 Use ScaI to cut the cloned backbone, and recover the 3974bp fragment as a PCR template to amplify the partial sequence of the MCS+SV40 element; use the F3 end primer (GAAGCCCTCGAGGACGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGGTACCAAAGGATCCCGAC) and the R3 end primer TGGAGCGAACGACCTACACCGA for amplification;

1.1.2 use Mlu I+Drd I to carry out digestion and purification after reclaiming and purifying the PCR product to obtain the Insert-barcode fragment;

1.2 Prepare the linearized clone backbone: Use Mlu I+Drd I to cut the clone backbone, and recover the 3953bp fragment as the library backbone;

1.3 Carry out a ligation reaction with the Insert-barcode fragment and the library backbone, and transform it into Escherichia coli DH10B to obtain the Barcode library;

1.4 Amplify the Barcode sequence in the Barcode tag library for NGS sequencing, and confirm the diversity of the library through data analysis.

2. Build the index tag Marriage library:

2.1 Prepare the linearized clone backbone: Use BsmBI to digest the Barcode tag library obtained in the first step, and recover the 3404bp fragment as the library backbone;

2.2Index1+MCS+Index2片段的制备：将引物F4(TGGGGATGCGGTGGGCTCTATGGNNNNNNNNNNNNNNNNNNNNNNNNNCCCAGACCGACTCGGACCACCCAGCCGTGAACTGGAAAGCTTACCACAAGAGCCG)和引物R4(TTATATAAGTACCCTCGAGGNNNNNNNNNNNNNNNNNNNNNNNNNGGGACAGGCAGTGCCAGGAGCCACGGCTCTTGTGGTAAGCTTTCCAGTTCACGGC)退火延伸形成171bp的双链Index1+MCS+Index2片段；

2.3 Use the Index1+MCS+Index2 fragment to perform Gibon ligation with the library backbone, and transform the ligation product into Escherichia coli DH10B to obtain the Marriage index tag library;

2.4 Using the plasmid of the Marriage index tag library as a template, PCR amplify the Index1, Index2 and Barcode sequences in the index tag Marriage library for NGS sequencing, and determine the corresponding relationship between the three through data analysis.

3. Build the enhancer library:

3.1 Preparation of random recombinant enhancer fragments:

3.2 Amplify CMV_en, HBB_en and SV40_en enhancer fragments by PCR respectively;

3.3 Use Covaris ultrasonic fragmentation to fragment the promoter fragment according to the operating instructions, so that the enhancer fragment is randomly sheared into short fragments of 150bp-550bp, and recovered;

3.4 Use

End Repair Module (E6050S) blunts the ends of the above-mentioned fragments;

3.5将引物F5(gactcggaccacccagccgtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngcgatcgcttcattc)和引物r5(phos-gaatgaagcgatcgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacggctgggtggtccgagtc)混匀后通过退火获得小片段左连接接头；将引物f6(phos-cctaggcgcaccaaggaagccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncctcgagggtacttatataa)和引物r6(ttatataagtaccctcgaggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggcttccttggtgcgcctagg)混匀后通过退火获得小片段右connection connector;

3.6 Mix the random short fragment of the enhancer and the two ligation adapters at a ratio of 1:1 and carry out the ligation reaction to generate the long fragment of the enhancer;

3.7 The ligation product is subjected to agarose electrophoresis, and the recombination fragment of the enhancer with a size of about 800bp-1kb is cut into gel for recovery and purification to obtain the final random recombination enhancer fragment.

3.8 Preparation of linearized clone backbone: Use XcmI enzyme to digest the library index tag library, and recover the 3404bp fragment as the library backbone;

3.9 The random recombination enhancer fragment and the library backbone were subjected to Gibson recombination ligation reaction, and transformed into Escherichia coli DH10B to obtain an enhancer library, as shown in Figure 9;

3.10 Transient the obtained enhancer library into K562 cells, screen out cells with different fluorescence intensities by flow sorting, extract the RNA of the target cells, and use the RNA as a template to reverse transcribe into cDNA, and PCR amplify the sequence containing Barcode Perform NGS sequencing to obtain specific Barcode sequences, and obtain the specific sequences of index1 and index2 through the data analysis results of the Marriage index tag library;

3.11 Using the obtained index1 and index2 sequences as primers and the enhancer library as a template, PCR amplifies the corresponding enhancer fragments;

3.12 The specific sequence of the candidate enhancer can be obtained through the Sanger sequence.

The above-mentioned embodiments only represent several embodiments of the present invention, and the descriptions thereof are specific and detailed, but should not be construed as limiting the scope of the patent of the present invention. It should be pointed out that for those skilled in the art, without departing from the concept of the present invention, several modifications and improvements can be made, which all belong to the protection scope of the present invention.

Claims (23)

1. A vector comprising a vector backbone and a first terminator, a recombination site, a reporter gene, a multiple cloning site, a post-transcriptional regulatory sequence and a second terminator sequentially connected to the vector backbone; The expression product can emit light or produce color change by catalyzing the reaction of the substrate, can cause the substrate to emit light or produce color change by catalyzing the reaction of the substrate, or emit light or produce color change by excitation light irradiation, or can resist the corresponding drug filter.
2. A plasmid vector, which includes: an index tag, a reporter gene, and a barcode tag;

   The barcode label is a random fragment with a length of 5-200 bp;

   The number of the index tags is at least 1, and it is independently selected from random fragments with a length of 5-100 bp;

   The expression product of the reporter gene is capable of catalyzing the substrate reaction to emit light or to produce color change, to catalyze the substrate reaction to cause the substrate to emit light or to produce color change, or to emit light or produce color change through excitation light irradiation, Or resistant to corresponding drug screening.
3. The plasmid vector according to claim 2, wherein the barcode tag is a random fragment with a length of 40bp; the number of the index tags is 2, wherein index1 is a random fragment with a length of 30bp, and index2 is a length of 30bp. The random fragment of , the reporter gene is selected from at least one of fluorescent protein, luciferase, LacZ gene or a resistance gene that can play a screening role, and the resistance gene includes a puromycin resistance gene.
4. The plasmid vector according to claim 3, wherein the following elements are included in sequence: pUC ori, 5'ITR, BGHpA, index1, index2, reporter gene, barcode label, WPRE, BGHpA, 3'ITR and resistance selection marker .
5. The plasmid vector according to claim 4, characterized in that, an enzyme cleavage site and a random recombination control sequence are further included between the index1 and index2.
6. plasmid vector according to claim 5, is characterized in that,

   The enzyme cleavage site is AsiSI;

   The number of the restriction enzyme cleavage sites is 2, which are located at both ends of the random recombination control sequence;

   The random recombination control sequences are fragmented promoter fragments or fragmented enhancer fragments.
7. The plasmid vector according to claim 6, wherein the fragmentation mode comprises enzymatic digestion, ultrasonication or artificial synthesis; the promoter is selected from hRO, hRK, mCAR, ProA1, CMV, EF1A, EFS, CAG, CBh, SFFV, MSCV, SV40, mPGK, hPGK, UBC, Nanog, Nes, Tuba1a, Camk2a, SYN1, Hb9, Th, NSE, GFAP, Iba1, hRHO, hBEST1, Prnp, Cnp, K14, BK5, mTyr, cTnT, αMHC, Myog, ACTA1, MHCK7, SM22a, EnSM22a, Runx2, OC, Col1a1, Col2a1, aP2, Adipoq, Tie1, Cd144, CD68, CD11b, Afp, Alb, TBG, MMTV, Wap, HIP, Pdx1, Ins2, Hcn4, NPHS2, SPB, CD144, TERT, TRE, TRE3G, GAL1, MET17, CUP1, AOX1, sCMV, bactin2, Ubi, cmlc2, zK5, 503unc, HSP70, 5×UAS, CaMV35S, Nos, ZmUbi, TEF1, GPD, ADH1, GAP, actin5C, Polyubiquitin, α1-tubulin, Rh2, Mtn, U6, U3, H1, U6-26, TK, RSV, MC1, GAL1, PH, p5, p10, p40, p41, araBAD, cspA or Hsp68; the enhancer is selected from CMV_en, HBB_en or SV40_en.
8. The plasmid vector according to any one of claims 1 to 7, characterized in that:

   The following elements are included in sequence: pUC ori, 5'ITR, BGHpA, index1, AsiSI restriction site, index2, Kozak, TurboGFP gene, barcode tag, WPRE, BGHpA, 3'ITR and Amp resistance selection marker; wherein, barcode tag is a random fragment with a length of 40bp, the index1 is a random fragment with a length of 30bp, and the index2 is a random fragment with a length of 30bp;

   Or include the following elements in sequence: pUC ori, 5'ITR, BGHpA, index1, AsiSI restriction site, random recombination regulatory sequence, AsiSI restriction site, index2, Kozak, TurboGFP gene, barcode tag, WPRE, BGH pA, 3 'ITR and Amp resistance screening markers; wherein, the length of the random recombination control sequence is 50-2000, which is the promoter fragment after digestion with DnaseI enzyme or the enhancer fragment after enzyme digestion, and the barcode tag is a random fragment with a length of 40bp , the index1 is a random fragment with a length of 30bp, and the index2 is a random fragment with a length of 30bp.
9. The method for constructing a plasmid vector according to any one of claims 5 to 8, characterized in that a barcode tag, an index tag and a random recombination control sequence are inserted into a backbone vector containing a reporter gene.
10. construction method according to claim 9, is characterized in that, the insertion of described barcode label is:

    The barcode tag carrying the homology arm of the backbone vector is prepared, and it reacts with the linearized backbone vector through Gibson cloning to construct a tag library.
11. construction method according to claim 9, is characterized in that, the insertion of described index label and random recombination control sequence comprises:

    Prepare a random recombination regulatory sequence, and then add the homology arms and index tags of the backbone vector at both ends to obtain an insert;

    Linearizing the tag library prepared by the construction method of claim 10;

    The inserts are ligated with the linearized tag library to obtain a library of regulatory sequences.
12. The construction method according to claim 11, wherein the preparation method of the random recombination regulatory sequence comprises: digesting a promoter or an enhancer with an enzyme.
13. construction method according to claim 11 or 12, is characterized in that, the preparation of described insert fragment specifically comprises:

    The primer F and primer R are annealed to form a Y-shaped adapter; the structure of the primer F is homology arm 1-index tag 1-restriction site 1-protection sequence 1; the structure of the primer R is protection sequence 2- Restriction site 2-index tag 2-homology arm 2; the protection sequence 1 and protection sequence 2 are complementary;

    Connect the adapter with the blunt-ended random recombination control sequence to obtain a random long fragment of the functional element containing the Y-shaped linker;

    A linear fragment was obtained by PCR on the random long fragment of the functional element containing the Y-shaped linker,

    The linear fragment is ligated with the linearized tag library to construct a library of regulatory sequences.
14. The method for constructing a plasmid vector according to any one of claims 2 to 4, characterized in that the random recombination regulatory sequence is removed by enzyme digestion from the regulatory sequence library constructed by the construction method described in claims 11 to 13 to obtain an index tag library.
15. Application of the vector according to any one of claims 1 to 8 in library construction or functional element screening.
16. A method for library construction, characterized in that, utilizing a Y-type linker to integrate the randomly interrupted sequence into the carrier of claim 1; the sequence integration site is preferably the recombination site of the carrier;

    Further, the structure of the Y-shaped linker sequentially includes a first homology arm, a first index sequence, an enzyme cleavage site, a random sequence insertion site, an enzyme cleavage site, a second index sequence and a second homology arm.
17. The method of claim 16, wherein the method comprises the steps of:

    S01. Construct a tag library;

    S02. Construct a functional element library;

    S03. Build an index tag library;

    Wherein, in step S02, the sequence of the randomly interrupted functional element is preferably integrated into the vector of claim 1 through the Y-shaped linker.
18. The method according to claim 17, wherein the specific operation of step S01 is:

    Linearizing the vector of claim 1, recovering the linearized vector backbone;

    Amplify the vector backbone with primers carrying random tag sequences and homology arms to obtain PCR products with random tag sequences;

    The PCR product was ligated with the recovered linearized vector backbone to construct a tag library.
19. The method according to claim 17; it is characterized in that, the specific operation of step S02 is:

    Randomly interrupt the nucleic acid fragments of functional elements to obtain random short fragments of functional elements;

    Connecting the random short fragments of the functional element with the Y-shaped linker to obtain a random long fragment of the functional element containing the Y-shaped linker;

    A functional element library is constructed by ligating the functional element random long fragment containing the Y-shaped linker with the tag library constructed in step S01.
20. The method according to claim 17, wherein the specific operation of step S03 is: enzyme digestion of the functional element library constructed in step S02, removal of random sequence embedding sites, recovery of the vector backbone and self-ligation to construct an index tag library .
21. Application of the method of any one of claims 8 to 19 in screening functional elements.
22. A method for screening functional elements, comprising the step of building a library, wherein the method for building a library is the method for constructing a plasmid vector according to any one of claims 9 to 14, or any one of claims 15 to 20. the method described.
23. The method of claim 22, wherein the method comprises the steps of:

    S11. Transfect cells or inject the functional element library constructed by the method according to any one of claims 9 to 20 into an experimental animal;

    S12. Select cells or tissues to extract mRNA according to the expression of the reporter gene, and reverse-transcribe it into cDNA;

    S13. Sequence the tag, and obtain functional elements by screening the corresponding relationship between the tag sequence, the first index sequence and the second index sequence.

Images