CN111961686A - System for realizing biallelic precise genome editing by using CRISPR/Cas9 and PiggyBac - Google Patents

Abstract

The invention discloses a system for realizing biallelic precise genome editing by using CRISPR/Cas9 and PiggyBac. The CRISPR/Cas9 expression vector, the PiggyBac system mediated donor vector and the PiggyBac transposase expression vector are constructed, the CRISPR/Cas9 expression vector targets the genome to cause DNA double strand break, the PiggyBac system mediated donor vector is used for HDR repair, and the PiggyBac transposase expression vector is used for deleting the screening marker, so that efficient and accurate biallelic screening marker-free genome editing is realized, and the PiggyBac transposase expression vector can be applied to livestock and poultry transgenic breeding.

Description

System for realizing biallelic precise genome editing by using CRISPR/Cas9 and PiggyBac

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to biallelic accurate and efficient genome editing combining CRISPR/Cas9 and PiggyBac technology.

Background

Based on CRISPR/Cas9 genome editing, using RNA-guided endonucleases (e.g., Cas9), DNA is cleaved at specific genomic sites to create Double Strand Breaks (DSBs), which repair Cas 9-mediated DSBs through non-homologous end joining (NHEJ) pathways or using homologous recombination (HDR) pathways that rely on homologous DNA repair templates. Non-homologous end-joining repair can disrupt target genes by creating insertions and deletions, while homologous recombination repair can integrate genetic changes more precisely into the genome. In recent years, accurate genome editing has been widely applied in the aspects of livestock character improvement, gene function research, establishment of livestock animal models and the like.

The gene editing cell line with the homozygous target site and no screening marker can ensure consistent genetic background and consistent gene copy number of the cell line, and is beneficial to the research of gene functions. HDR-Cre/LoxP and HDR-HDR are the main two-step screening marker-free gene editing technology at present. Among them, the HDR-Cre/LoxP system utilizes the Cre/LoxP technology to realize effective excision of the screening marker, thereby achieving the purpose of genome editing (Xi et al, 2015). However, this technique leaves a foreign LoxP site in the genome and cannot meet the requirements of point editing or point mutation during the gene editing operation. The HDR-HDR strategy (Kuhn and Chu,2015) is to mediate HDR of donor DNA twice through CRISPR/Cas9 system, and when targeting genome, precise editing of genome is achieved through HDR of donor DNA without marker gene (containing point mutation of interest), but the HDR-HDR strategy is still limited by recombination efficiency of genome HDR. For this reason, studies have proposed a Single Strand Annealing (SSA) -mediated precise editing system (2019) for animal genomes, which, while high efficiency of genome biallelic editing can be achieved and deletion of selection markers can be mediated by a Single Strand Annealing (SSA) repair mechanism, when screening expression cassettes relying on the SSA repair pathway knock-out, different genomic loci have large differences in knock-out efficiency.

PiggyBac transposons can insert DNA sequences up to 100kb in length into "TTAA" sequences located in the genome of mammals. Due to high transposition efficiency, PiggyBac is widely applied to stable expression of multi-subunit protein complexes, transgenic mice, induced pluripotent stem cells and large-scale production of recombinants. At present, the application of PiggyBac and CRISPR/Cas9 in combination is reported. For example, Chinese patent CN109652458A proposes a method for constructing a gene knockout cell strain based on the piggyBAC-Cas9 system. However, the PiggyBac transposon can be randomly inserted into other TTAA sites of the genome while being deleted efficiently, the obtained cell still has the possibility of residue of the screening marker, and the efficiency of obtaining the homozygous genome editing cell is low.

Disclosure of Invention

The invention aims to provide a system for realizing biallelic precise genome editing by using CRISPR/Cas9 and PiggyBac, which can delete a screening marker gene by adopting a PiggyBac transposition mode, realize biallelic, residue-free and trace-free precise genome editing and improve editing efficiency.

In order to achieve the purpose, the invention adopts the following technical scheme:

a biallelic genome editing system comprising a first donor vector, a second donor vector, and a CRISPR/Cas9 expression vector for a targeted genome (causing a double strand break in genomic DNA); the first donor vector and the second donor vector comprise sequences homologous to an upstream fragment and a downstream fragment in the genome which are connected by a palindromic sequence, and a transposon sequence which is connected between the homologous sequences of the upstream fragment and the downstream fragment (homologous recombination repair template) and can replace the palindromic sequence by homologous recombination repair (HDR); the transposon sequences of the first donor vector and the second donor vector comprise a screening gene expression cassette for enriching a genome containing a corresponding transposon sequence and Inverted Terminal Repeat Sequences (ITRs) which are positioned at both ends of the corresponding screening gene expression cassette and can be recognized by transposase, and the inverted terminal repeat sequences are directly connected with homologous recombination repair templates at the corresponding ends.

Preferably, the CRISPR/Cas9 expression vector comprises a target gene target site sgRNA sequence expression cassette and a Cas9 nuclease (having cleavage activity to the target gene target site) gene expression cassette.

Preferably, the targeting site of the CRISPR/Cas9 expression vector is located near the palindromic sequence (e.g., PiggyBac transposon-specific insertion site TTAA) (especially when the target site is within 50bp of the TTAA), which can improve biallelic editing efficiency.

Preferably, the selection gene expression cassette comprises a forward drug selection gene sequence (e.g., puromycin resistance gene sequence puro, bleomycin resistance gene sequence zeo); the first donor vector and the second donor vector differ in the forward drug screening gene.

Preferably, the screening gene expression cassette further comprises a fluorescent protein gene sequence (e.g., green fluorescent protein gene sequence eGFP, red fluorescent protein gene sequence mRFP); the fluorescent protein genes of the first donor vector and the second donor vector are different.

Preferably, the screenable gene expression cassette further comprises a negative drug screening gene sequence (e.g., the thymic kinase gene sequence TK).

Preferably, in the screening gene expression cassette, the positive drug screening gene, the fluorescent protein gene and the negative drug screening gene are expressed in series (different genes are connected through T2A and P2A shearing peptide sequences, and the same promoter and termination sequence are adopted).

Preferably, the inverted terminal repeat sequence employs the signature sequences 5'ITR and 3' ITR in the PiggyBac transposon system.

Preferably, the editing system further comprises a transposase expression vector for expressing a transposase (e.g., PiggyBac transposase) gene that is necessary for the transposon sequence to enter and exit the host cell genome.

The preparation method of the biallelic genome editing system comprises the following steps:

1) determining a target site of a target gene, and constructing a CRISPR/Cas9 expression vector for targeting a genome according to the target site of the target gene;

2) constructing corresponding first and second donor vectors according to the target sites of the target genes.

The invention has the beneficial effects that:

according to the invention, through the design of donor DNA, the site-directed editing of the CRISPR/Cas9 targeting gene can be realized by utilizing homologous recombination and repair, and the precisely edited biallelic genome without the screening marker is rapidly enriched by utilizing a transposon sequence consisting of a reverse terminal repeat sequence recognized by transposase and different screening markers, so that an effective way is provided for livestock and poultry gene function research and transgenic breeding.

Furthermore, after the forward drug screening gene is subjected to homologous recombination and repair, the resistance of the cell expression to different drugs (such as puromycin and bleomycin) can be realized, and double drug screening can be performed on the cell co-transfected with the CRISPR/Cas9 expression vector, the first donor vector and the second donor vector, so that the enrichment of the cell subjected to homologous recombination and repair on the genome is accelerated, and the efficiency of double allele genome editing of the cell is improved.

Further, the selected gene expression cassette can be deleted from the integration site by the action of transposase, and the original palindromic sequence (e.g., TTKK) which is repaired by homologous recombination on the genome is formed by the residual fragment of the preserved inverted terminal repeat, thereby realizing the residue-free and trace-free editing of the genome.

Further, cells that do not have the selection gene expression cassette deleted by transposition can also be screened by drugs (e.g., Ganciclovir, GCV) to activate negative drug selection genes (e.g., TK) to induce apoptosis.

Drawings

FIG. 1 is a plasmid map of expression vector pll3.7-U6-CCR5.target-CBh-SpCas9 of CCR5 gene CRISPR/Cas 9.

FIG. 2 is a plasmid map of expression vector pX330-U6-ADAM17 Target-CBh-SpCas9 of ADAM17 gene CRISPR/Cas 9.

FIG. 3 is a map of a CCR5 gene, PiggyBac, mediated donor vector for green fluorescent (green fluorescent protein), puromycin (puromycin) resistance and thymokinase expression.

FIG. 4 is a map of a CCR5 gene, PiggyBac, mediated donor vector expressing red fluorescence (red fluorescent protein), bleomycin (zeocin) resistance and thymokinase.

FIG. 5 is a map of ADAM17 gene PiggyBac-mediated donor vectors expressing green fluorescence, puromycin (puromycin) resistance and thymokinase.

FIG. 6 is a map of ADAM17 gene PiggyBac-mediated donor vectors expressing red fluorescence, bleomycin (zeocin) resistance and thymokinase.

FIG. 7 is a working schematic diagram of biallelic precise high-efficiency genome editing performed by CRISPR/Cas9 and PiggyBac combination; wherein: wild-type genome refers to a cell genome without deletion and point Mutation, Mutation site refers to a gene editing target Mutation site, HDrepair refers to homologous recombination repair after shearing a cell genome target site, and modification refers to modification (deletion of a screening gene expression cassette) of the cell genome repaired by homologous recombination by transposase.

FIG. 8 shows cell monoclonals obtained by dual drug screening with puromycin/zeocin.

FIG. 9 shows the PCR range (a) and the amplification result (b) of the monoclonal genome.

Detailed Description

The present invention is further described in detail below with reference to the drawings and examples, which are only used for explaining the present invention and not for limiting the scope of the present invention.

Construction of biallelic efficient precise genome editing System for CCR5 Gene and biallelic efficient precise genome editing System for ADAM17 Gene

CCR5 gene target site selection and construction of CRISPR/Cas9 expression vector

Aiming at CCR5 gene, a CRISPR/Cas9 expression vector pll3.7-U6-CCR5.Target-CBh-SpCas9 (Bai Yi Chun. the application of CRISPR/Cas9 technology in the genome editing research of chicken and pig and the development research of a novel gene seamless editing technology, 2016) is constructed. Referring to the CCR5 gene target site (selected TTAA at 18bp downstream from the target site), the target sequence CCR5.target (5'-CATACAGTCAGTATCAATTC-3') was used as the sgRNA sequence in the CRISPR/Cas9 expression vector (fig. 1).

Construction of CCR5 gene PiggyBac donor vector

2.1 Fragment (408bp) was obtained by PCR amplification using pBluescript II SK (+) vector (Addgene) as template. And then taking the pBluescript II SK (+) vector as a skeleton, and inserting the amplified Fragment into the pBluescript II SK (+) vector to form a modified skeleton vector pBluescript (NheI).

2.1.1 primer design and PCR amplification

Fragment-F(PciI)：

5'-AGCACATGTTCTTTCCTGCGTTATCCCCTG-3'

Fragment-R(NheI-SacI)：

5'-CTGGAGCTCGCTAGCCAGCTTTTGTTCCCTTTAGTGAG-3'

The PCR reaction system and the PCR reaction program are shown in table 1, table 2, and table 3:

TABLE 1 high fidelity PCR reaction system

TABLE 2 general PCR reaction procedure (difference between upstream and downstream primer Tm. ltoreq.5 ℃ C.)

TABLE 3 Touchdown PCR reaction procedure (difference of Tm of upstream and downstream primers >5 ℃)

NheI enzyme cutting site is added in a downstream primer of PCR amplification, so that a new enzyme cutting site is introduced in a pBluescript II SK (+) vector through modification.

2.1.2 backbone and fragment double digestion

See tables 4, 5 for enzyme cleavage systems:

TABLE 4 pBluescript II SK (+) cleavage System

TABLE 5 Fragment cleavage System

Note: the enzyme digestion conditions are 37 ℃ and 1-2 h.

2.1.3 ligation of backbone and fragments: the digested fragments and the backbone were ligated with T4 ligase (Table 6), ligated overnight at 16 ℃, transformed E.coli DH5 α competent cells (Tiangen Biochemical, product number CB101), plated on LB/Amp plates, single clones were picked and cultured in LB/Amp broth for 8h at 37 ℃, plasmids were extracted, and the vector pBluescript (NheI) was obtained by sequencing validation.

TABLE 6 pBluescript (NheI) ligation reaction System

2.2 screening the construction of expression cassette vectors PBluescript-pPGK-Puro-eGFP-TK-SV40pA and PBluescript-pPGK-Zeo-mRFP-TK-SV40 pA;

obtaining a fragment pPGK-Puro-T2A-eGFP-P2A-TK-SV40T polyA (3177bp) from a vector JMB81-pPGK-Puro-T2A-eGFP-P2A-TK-SV40T polyA constructed in the early stage of a laboratory through PCR amplification, taking a pBluescript (NheI) vector in 2.1 as a framework, and inserting the fragment into pBluescript (NheI) to obtain a vector PBluescript-pPGK-Puro-eGFP-TK 40pA capable of expressing green fluorescent protein, puromycin (puromycin) resistance and thymokinase; a fragment pPGK-Zeo-T2A-mRFP-P2A-TK-SV40T polyA (2883bp) is obtained from a vector JMB81-pPGK-Zeo-T2A-mRFP-P2A-TK 40T polyA constructed in the early stage of a laboratory through PCR amplification, a pBluescript (NheI) vector in 2.1 is used as a framework, and the fragment is inserted into pBluescript (NheI) to obtain a vector PBluescript-pPGK-Zeo-mRFP-TK-SV40pA capable of expressing red fluorescent protein, bleomycin (zeocin) resistance and thymokinase.

2.2.1 amplification of the fragments pPGK-Puro-T2A-eGFP-P2A-TK-SV40T polyA and pPGK-Zeo-T2A-mRFP-P2A-TK-SV40T polyA Using the following primers:

pPGK-pA-F(NotI):5'-AATGCGGCCGCCCGGTAGGCGCCAACCGG-3'

pPGK-pA-R(NheI):5'-CTAGCTAGCTAGGGCGAATTGGGTACCGG-3'

2.2.2 backbone and fragment double digestion

See table 7, table 8, table 9 for enzyme cleavage systems:

TABLE 7 pBluescript (NheI) digestion System

Table 8, fragment pPGK-Puro-T2A-eGFP-P2A-TK-SV40T polyA enzyme digestion system

TABLE 9 cleavage system of pPGK-Zeo-T2A-mRFP-P2A-TK-SV40T polyA

2.2.3 ligation of backbone and fragments: the digested fragments and the backbone were ligated with T4 ligase (Table 10, Table 11), overnight at 16 ℃, transformed into E.coli DH5 α competent cells (Tiangen Biochemical, product number CB101), plated on LB/Amp plates, single colonies were picked and cultured in LB/Amp liquid medium at 37 ℃ for 8h, plasmids were extracted, and sequencing was performed.

TABLE 10 connection reaction System of PBluescript-pPGK-Puro-eGFP-TK-SV40pA

TABLE 11 connection reaction System of PBluescript-pPGK-Zeo-mRFP-TK-SV40pA

2.2.4 construction of vector JMB81-pPGK-Puro-T2A-eGFP-P2A-TK-SV40T polyA

(1) The P2A cleavage peptide sequence (76bp) was amplified from the pU6-CBh-Cas9-T2A-mcherry-P2A-Ad4E4orf6 plasmid (Addgene) using the upstream primer P2A-F1 (EcoRI) and the downstream primer P2A-R.

P2A-F1(EcoRⅠ)：5'-CCGGAATTCGCAACAAACTTCTCACTA-3'

P2A-R：5'-ACGAGGCCATAGGCCCGGGATTCTCCTCCA-3'

(2) The forward primer TK-F2 and the reverse primer TK-R2(Xho I) were used to separate the DNA from JMB81-pCAG-TK-SV40T polyA-pPGK-Puro^RT2A-eGFP-BGH polyA backbone vector (doi:10.1111/febs.14626, the superscript R indicates resistance, without restriction to the sequence) amplified the thymus kinase gene sequence TK (1318 bp).

TK-F2：5'-TCCCGGGCCTATGGCCTCGTACCCCGGCCA-3'

TK-R2(XhoⅠ)：5'-CCGCTCGAGCAGACATGATAAGATACA-3'

(3) The cleavage peptide sequence of P2A and the thymus kinase gene sequence TK (the molar ratio of the two fragments is 1:1, the total mass is 200ng) are used as templates, and overlap PCR is carried out by using P2A-F1 (EcoRI) and TK-R2(Xho I) to obtain a fragment P2A-TK-SV40T polyA (1374 bp). The fragment is subjected to double enzyme digestion by EcoRI and XhoI and then is connected with JMB81-pPGK-Puro subjected to double enzyme digestion^RT2A-eGFP-BGH polyA vector (from JMB81-pCAG-TK-SV40T polyA-pPGK-Puro^Rthe-T2A-eGFP-BGH polyA vector is obtained by ClaI/BamHI double enzyme digestion, filling in adhesive ends and connecting into a ring), and JMB81-pPGK-Puro-T2A-eGFP-P2A-TK-SV40T polyA vector is obtained, and the vector has a PGK promoter sequence pPGK, a puromycin (puromycin) resistance gene sequence Puro, a T2A shearing peptide sequence, green fluorescenceThe light protein gene sequence eGFP, the P2A cutting peptide sequence, the thymus kinase gene sequence TK and the SV40T polyA termination sequence.

2.2.5 construction of vector JMB81-pPGK-Zeo-T2A-mRFP-P2A-TK-SV40T polyA

(1) The forward primer RFP-F (Nhe I) and the downstream primer RFP-R were used to generate JMB81-pCAG-TK 40T polyA-pPGK-Zeo^RThe red fluorescent protein gene sequence mRFP (694bp) was amplified on the T2A-mRFP-BGH polyA plasmid.

RFP-F(NheⅠ)：5'-CTAGCTAGCATGGCCTCCTCCGAGGAC-3'

RFP-R：5'-AGTTTGTTGCGGTGCCGGTGGAGTGGCGGC-3'

(2) The fragment P2A-TK-SV40TpolyA (1375bp) was amplified from JMB81-pPGK-Puro-T2A-eGFP-P2A-TK-SV40T polyA vector using the upstream primer P2A-F2(RFP) and the downstream primer TK-R2(Xho I).

P2A-F2(RFP)：5'-CACCGGCACCGCAACAAACTTCTCACTACT-3'

TK-R2(XhoⅠ)：5'-CCGCTCGAGCAGACATGATAAGATACA-3'

(3) Takes red fluorescent protein gene sequences mRFP and P2A-TK-SV40TpolyA (molar ratio is 1:1, total mass is 200ng) as templates, RFP-F (Nhe I) and TK-R2(Xho I) are used for performing overlap PCR to obtain mRFP-P2A-TK-SV40T polyA fragments (2094 bp). The fragment is subjected to double enzyme digestion by Nhe I and Xho I and then is connected with JMB81-pPGK-Zeo subjected to double enzyme digestion^RT2A-mRFP-BGH polyA (from JMB81-pCAG-TK-SV40T polyA-pPGK-Zeo^RThe vector is obtained by carrying out double enzyme digestion on a T2A-mRFP-BGH polyA vector by Cla1/BamH1, filling in adhesive ends and connecting into a ring) to obtain a JMB81-pPGK-Zeo-T2A-mRFP-P2A-TK-SV40T polyA vector, wherein the vector is provided with a screening expression cassette ZRT consisting of a PGK promoter sequence pPGK, a bleomycin (zeocin) resistance gene sequence Zeo, a T2A shearing peptide sequence, a red fluorescent protein gene sequence mRFP, a P2A shearing peptide sequence, a thymus kinase gene sequence TK and an SV40T polyA termination sequence.

Wherein, JMB81-pCAG-TK-SV40T polyA-pPGK-Zeo^RThe construction steps of the-T2A-mRFP-BGH polyA vector are as follows:

(1) cloning of a sequence containing mRFP-BGH polyA, see seq.id No.13 for details.

(2) The sequence (SEQ. ID. NO.13) was ligated into NheI/XhoI double digested JMB81-pCAG-TK-SV40T polyA-pPGK-Puro^RT2A-eGFP-BGH polyA skeleton vector (doi:10.1111/febs.14626), thereby replacing eGFP-BGH polyA sequence of the skeleton vector, transforming DH5 alpha escherichia coli competent cells, and obtaining JMB81-TK-SV40T.PA-Puro through ampicillin resistance screening^R-mRFP-BGH polyA。

(3) The forward primer PGK-F and the reverse primer PGK-R were used to prepare a DNA fragment from JMB81-pCAG-TK-SV40T polyA-pPGK-Puro^RThe PGK promoter sequence (424bp) was amplified from the T2A-eGFP-BGH polyA plasmid.

PGK-F：5'-CGCGGATCCCCGGTAGGCGCCAA-3'

PGK-R：5'-TCAACTTGGCCATATTGGCTGCAGGTCGAA-3'

(4) Zeo amplification from pSLIK-Zeo plasmid (Addgene)^R-T2A sequence, the specific steps are as follows: because the T2A sequence is longer, an intermediate fragment (409bp) is obtained by amplification with an upstream primer Zeo-T2A-F and a downstream primer Zeo-T2A-R1, and then the intermediate fragment is used as a template to obtain a complete Zeo by amplification with an upstream primer Zeo-T2A-F and a downstream primer Zeo-T2A-R2^R-T2A fragment (442 bp).

Zeo-T2A-F：5'-AGCCAATATGGCCAAGTTGACCAGTGCCGT-3'

Zeo-T2A-R1：5'-ACCGCATGTTAGCAGACTTCCTCTGCCCTCGTCCTGCTCCTCGGCCACGA-3'

Zeo-T2A-R2：5'-CACGCTAGCTGGGCCAGGATTCTCCTCGACGTCACCGCATGTTAGCAGACTTC-3'

(5) PCR amplified fragments (total mass 200ng) were used as templates, wherein the PGK promoter and Zeo^RThe molar ratio of the-T2A fragment was 1:1, and OVerlap PCR was performed using the primers PGK-F and Zeo-T2A-R2 to obtain a PGK-Zeo-T2A fragment (846 bp).

(6) The double restriction enzyme BamHI/Nhe I is used to cut the PGK-Zeo-T2A fragment into the same double restriction enzyme JMB81-TK-SV40T^RIn the-mRFP-BGH polyA vector, DH5 alpha escherichia coli competent cells are transformed, and the vector JMB81-pCAG-TK-SV40T polyA-pPGK-Zeo is obtained through ampicillin resistance screening^R-T2A-mRFP-BGH polyA。

2.3 construction of PiggyBac-mediated CCR5 Gene Donor vector PBlue-CCR5LA-5'PB ITR-pPGK-Puro-eGFP-TK-SV40pA-3' PB ITR-CCR5RA

2.3.1 construction of vector PBlue-CCR5LA-5' PB ITR-pPGK-Puro-eGFP-TK-SV40pA

Amplifying a 930bp fragment with the sequence of TTAA in the CCR5 gene as a left arm CCR5LA of a homologous arm, and simultaneously amplifying a 5'PB ITR (namely 5' ITR) in a pXL-BACII-attPGAL4LWL (Addgene):

5'-TTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGATTATCTTTTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTTATTTCATGTTCTACTTACGTGATAACTTATTATATATATATTTTCTTGTTATAGATATC-3'

and (3) forming a fragment CCR5LA-5'PB ITR (1263bp) by using overlap PCR (polymerase chain reaction) connection, and enabling the 5' ITR to be seamlessly connected with the left arm sequence of the homologous arm, wherein a NheI enzyme cutting site is introduced into the 5 'end of the fragment, and a NotI enzyme cutting site is introduced into the 3' end of the fragment. The vector PBlueSCrit-pPGK-Puro-eGFP-TK-SV 40pA of the screening expression cassette constructed in 2.2 is taken as a framework, and the same double enzyme digestion is carried out with the fragment CCR5LA-5'PB ITR, so that the vector PBlue-CCR5LA-5' PB ITR-pPGK-Puro-eGFP-TK 40pA is obtained through connection.

2.3.1.1 primer design and PCR amplification

Homology arm left arm CCR5LA amplification primers:

CCR5-LA-F1(NheI)：5'-CTAGCTAGCCTCCCCATAGCAAGACAAAG-3'

CCR5-LA-R1：5'-GACTATCTTTCTAGGGTTAAAGATAGTCATCTTGGGGCTG-3'

5' PB ITR amplification primer:

CCR5-PB5'ITR-F：5'-CAGCCCCAAGATGACTATCTTTAACCCTAGAAAGATAGTC-3'

PB 5'ITR-R(NotI)：5'-AATGCGGCCGCGATATCTATAACAAGAAAATAT-3'

2.3.1.2 backbone and fragment double enzyme digestion

See tables 12, 13 for enzyme cleavage systems:

TABLE 12 enzyme digestion System of backbone PBluescript-pPGK-Puro-eGFP-TK-SV40pA

TABLE 13 cleavage system for fragment CCR5LA-5' PB ITR

2.3.1.3 ligation of backbones and fragments: the digested fragments and the backbone were ligated with T4 ligase (Table 14), overnight at 16 ℃, transformed into E.coli DH5 α competent cells (Tiangen Biochemical, product number CB101), plated on LB/Amp plates, single clones were picked and cultured in LB/Amp liquid medium at 37 ℃ for 8h, plasmids were extracted, and the vector PBlue-CCR5LA-5' PB ITR-pPGK-Puro-eGFP-TK 40pA was obtained by sequencing validation.

TABLE 14 connection reaction System of PBlue-CCR5LA-5' PB ITR-pPGK-Puro-eGFP-TK-SV40pA

2.3.2 construction of vector PBlue-CCR5LA-5'PB ITR-pGK-Puro-eGFP-TK-SV40pA-3' PB ITR-CCR5RA

Amplifying a 952bp fragment with the sequence of TTAA in 2.3.1 as a right arm CCR5RA of the homologous arm, and simultaneously amplifying a 3'PB ITR (namely 3' ITR) in a pXL-BACII-attPGAL4LWL (Addgene) vector:

5'-TTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGTTTTTTTTTAATAAATAAATAAACATAAATAAATTGTTTGTTGAATTTATTATTAGTATGTAAGTGTAAATATAATAAAACTTAATATCTATTCAAATTAATAAATAAACCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAATATGATTATCTTTCTAGGGTTAA-3'

and (3) performing overlap PCR (polymerase chain reaction) connection to form a fragment 3'PB ITR-CCR5RA (1206bp), seamlessly connecting the 3' ITR with the sequence of the right arm of the homologous arm, introducing a PacI enzyme cutting site at the 5 'end of the fragment, and introducing a BamHI enzyme cutting site at the 3' end of the fragment. The vector PBlue-CCR5LA-5'PB ITR-pPGK-Puro-eGFP-TK 40pA constructed in 2.3.1 is used as a framework, and the same double enzyme digestion is carried out with the fragment 3' PB ITR-CCR5RA, so that the vector PBlue-CCR5LA-5'PB ITR-pPGK-Puro-eGFP-TK 40pA-3' PB ITR-CCR5RA is obtained through connection.

2.3.2.1 primer design and PCR amplification

3' PB ITR amplification primer:

PB 3'ITR-F(PacI)：5'-CCTTAATTAATTTGTTACTTTATAGAAGAAAT-3'

CCR5-PB3'ITR-R：5'-CAGCTCTCATTTTCCATACACCGCGGTTAACCCTAGAAAGATAATC-3'

the right arm of the homologous arm is CCR5RA amplification primer (because the sequence next to TTAA in the right arm is the 32bp deletion sequence 5'-TGTCTGGAAATTCTTCCAGAATTGATACTGAC-3' which needs to be deleted, the forward amplification primer is designed from 33bp behind the TTAA, the 5' end of the primer is introduced with SacII enzyme cutting site, so that the 32bp deletion sequence is replaced by the enzyme cutting site CCGCGG of SacII, and the enzyme cutting site is introduced for detecting whether the mutation is successful or not):

CCR5-RA-F1：5'-GATTATCTTTCTAGGGTTAACCGCGGTGTATGGAAAATGAGAGCTGC-3'

CCR5-RA-R1(BamHI)：5'-CGCGGATCCGGGCGACAGAGTGAGACC-3'

2.3.2.2 backbone and fragment double enzyme digestion

See tables 15, 16 for enzyme cleavage systems:

TABLE 15 digestion system of backbone PBlue-CCR5LA-5' PB ITR-pPGK-Puro-eGFP-TK-SV40pA

TABLE 16 cleavage system for fragment 3' PB ITR-CCR5RA

2.3.2.3 ligation of backbones and fragments: the digested fragments and the backbone were ligated with T4 ligase (Table 17), overnight at 16 ℃, transformed E.coli DH5 α competent cells (Tiangen Biochemical, product number CB101), plated on LB/Amp plates, single clones were picked and cultured in LB/Amp liquid medium at 37 ℃ for 8h, plasmids were extracted, and the vector PBlue-CCR5LA-5'PB ITR-pPGK-Puro-eGFP-TK 40pA-3' PB ITR-CCR5RA (FIG. 3) was obtained by sequence verification.

TABLE 17 connection reaction System of PBlue-CCR5LA-5'PB ITR-pPGK-Puro-eGFP-TK-SV40pA-3' PB ITR-CCR5RA

2.4 construction of PiggyBac-mediated CCR5 Gene Donor vector PBlue-CCR5LA-5'PB ITR-pPGK-Zeo-mRFP-TK-SV40pA-3' PB ITR-CCR5RA

2.4.1 construction of vector PBlue-CCR5LA-5' PB ITR-pPGK-Zeo-mRFP-TK-SV40pA

The fragment CCR5LA-5' PB ITR was obtained identically to 2.3.1.

The screening expression cassette vector PBluescript-pPGK-Zeo-mRFP-TK-SV40pA constructed in 2.2 is used as a framework, and the same double enzyme digestion is carried out with the fragment CCR5LA-5'PB ITR, so that the vector PBlue-CCR5LA-5' PB ITR-pPGK-Zeo-mRFP-TK-SV40pA is obtained through connection.

2.4.1.1 primer design and PCR amplification

The primers were designed as in 2.3.1.1.

2.4.1.2 backbone and fragment double enzyme digestion

See Table 18 for cleavage system, fragment CCR5LA-5' PB ITR cleavage system is the same as 2.3.1.2:

TABLE 18 enzyme digestion System of backbone PBluescript-pPGK-Zeo-mRFP-TK-SV40pA

2.4.1.3 ligation of backbones and fragments: the digested fragments and the backbone were ligated with T4 ligase (Table 19), overnight at 16 ℃, transformed into E.coli DH5 α competent cells (Tiangen Biochemical, product number CB101), plated on LB/Amp plates, single clones were picked and cultured in LB/Amp liquid medium at 37 ℃ for 8h, plasmids were extracted, and the vector PBlue-CCR5LA-5' PB ITR-pPGK-Zeo-mRFP-TK-SV40pA was obtained by sequencing validation.

TABLE 19 PBlue-CCR5LA-5' PB ITR-pPGK-Zeo-mRFP-TK-SV40pA ligation reaction system

2.4.2 construction of vector PBlue-CCR5LA-5'PB ITR-pPGK-Zeo-mRFP-TK-SV40pA-3' PB ITR-CCR5RA

The vector PBlue-CCR5LA-5'PB ITR-pPGK-Zeo-mRFP-TK 40pA constructed in 2.4.1 is used as a framework, and the same double enzyme digestion is carried out with the fragment 3' PB ITR-CCR5RA obtained in 2.3.2, so that the vector PBlue-CCR5LA-5'PB ITR-pPGK-Zeo-mRFP-TK 40pA-3' PB ITR-CCR5RA is obtained through connection.

2.4.2.1 primer design and PCR amplification

The primers were designed as in 2.3.2.1.

2.4.2.2 backbone and fragment double digestion

See Table 20, the cleavage system for fragment 3' PB ITR-CCR5RA is the same as 2.3.2.2:

TABLE 20 cleavage system of backbone PBlue-CCR5LA-5' PB ITR-pPGK-Zeo-mRFP-TK-SV40pA

2.4.2.3 ligation of backbones and fragments: the digested fragments and the backbone were ligated with T4 ligase (Table 21), overnight at 16 ℃, transformed E.coli DH5 α competent cells (Tiangen Biochemical, product number CB101), plated on LB/Amp plates, single clones were picked and cultured in LB/Amp liquid medium at 37 ℃ for 8h, plasmids were extracted, and the vector PBlue-CCR5LA-5'PB ITR-pPGK-Zeo-mRFP-TK 40pA-3' PB ITR-CCR5RA (FIG. 4) was obtained by sequence verification.

TABLE 21 PBlue-CCR5LA-5'PB ITR-pPGK-Zeo-mRFP-TK-SV40pA-3' PB ITR-CCR5RA ligation reaction System

ADAM17 gene target site selection and construction of CRISPR/Cas9 expression vector

3.1 target site selection

Based on the characteristics of the target site targeted by the CRISPR/Cas9 system, a target site containing a PAM sequence (NGG/NGGNG) needs to be searched in a genome (the selected TTAA is 1bp away from the target site at the upstream of the target site). Through screening of a benchmark website (http:// benchmark. com /), a sequence ADAM17.target is selected as a target sequence of an ADAM17 gene target site, and the sequence ADAM17.target is specifically shown as follows:

5'-AATCAAAATTCACCAAAACA-3'

the PAM sequence of the ADAM17 gene target site is AGG.

3.2 construction of CRISPR/Cas9 expression vector pX330-U6-ADAM17 Target-CBh-hSpCas9

The CRISPR/Cas9 expression vector is constructed by inserting a 20bp target sequence ADAM17.target of ADAM17 gene between a U6 promoter and a gRNA by using a vector pX330-U6-Chimeric _ BB-CBh-hSpCas9 (Addgene). Referring to fig. 2, the constructed CRISPR/Cas9 expression vector pX330-U6-ADAM17 Target-CBh-hSpCas9 comprises elements of an AmpR promoter, an Ampicillin resistance gene sequence, a U6 promoter, an ADAM17 gene Target sequence ADAM17.Target, a gRNA sequence, a CBh promoter, hSpCas9 and a BGH polyA in sequence, and the specific construction method is as follows.

3.2.1 design of primers required to fit ADAM17 Gene Target sequences based on the determined ADAM17 Gene Target sites (Table 22), named ADAM17 Target-F and ADAM17 Target-R, respectively.

TABLE 22 primer design Table for ADAM17 Gene target sequences

3.2.2 PCR amplification of the desired ADAM17 Gene target sequence

The reaction conditions for the analing reaction system (table 23) were: and (3) cooling to room temperature after 5min at 95 ℃, and obtaining an ADAM17 gene target sequence with BsaI cantilevers at two ends for later use.

TABLE 23 ADAM17 Gene target sequence Annealing System (Beijing Quanjin Biotechnology, cat # AP111)

3.2.3 ligation of backbone and fragments: digesting the vector pX330-U6-Chimeric _ dBsai-CBh-hSpCas9 (Table 24) by BsaI, using ADAM17 gene Target sequence primer anealing as a fragment, connecting the fragment and the digested skeleton by T4 ligase (Table 25), connecting overnight at 16 ℃, then transforming Escherichia coli DH5 alpha competent cells (Tiangen biochemistry, product number CB101), coating LB/Amp plates, picking up single clones, culturing for 8h at 37 ℃ in LB/Amp liquid culture medium, extracting plasmids, and verifying by sequencing to obtain the vector pX330-U6-ADAM17 Target-CBh-hSpCas 9.

TABLE 24 enzyme cleavage system of pX330-U6-Chimeric _ dBsai-CBh-hSpCas9

TABLE 25 pX330-U6-ADAM17 Target-CBh-hSpCas9 ligation system

Construction of ADAM17 gene PiggyBac donor vector

4.1 construction of PiggyBac-mediated ADAM17 Gene Donor vector PBlue-ADAM17LA-5'PB ITR-pPGK-Puro-eGFP-TK 40pA-3' PB ITR-ADAM17RA

4.1.1 construction of the vector PBlue-ADAM17LA-5' PB ITR-pPGK-Puro-eGFP-TK-SV40pA

A935 bp fragment upstream of a site with a sequence of TTAA in ADAM17 gene is amplified to be used as a homologous arm left arm ADAM17LA, and because the left arm is provided with a mutation site (determined according to SNP site rs142946965 on ADAM17 gene, namely, cell genome is changed into homozygous mutant through gene editing), the homologous arm left arm ADAM17LA is amplified by adopting Overlap PCR. The method comprises the steps of firstly connecting a sequence from a site with a sequence TTAA to a mutation site with 5' PB ITR in an existing vector pXL-BACII-attPGAL4LWL (Addgene) in a laboratory to obtain a fragment I (386bp), then amplifying the rest part (a fragment II, namely a part positioned at the upstream of the mutation site, 902bp) of the left arm of the homologous arm, continuously connecting the fragment II with the fragment I by using Overlap PCR to obtain a fragment ADAM17LA-5' PB ITR (1268bp), enabling the 5' ITR to be connected with the left arm sequence of the homologous arm in a seamless mode, introducing an NheI enzyme cutting site at the 5' end of the fragment, and introducing an NotI enzyme cutting site at the 3' end of the fragment. The vector PBluescript-pPGK-Puro-eGFP-TK 40pA of the screening expression cassette constructed in 2.2 is used as a framework, and the same double enzyme digestion is carried out with the fragment ADAM17LA-5'PB ITR, so that the vector PBlue-ADAM17LA-5' PB ITR-pPGK-Puro-eGFP-TK 40pA is obtained through connection.

4.1.1.1 primer design and PCR amplification

Left arm ADAM17LA amplification primer of homology arm (TTAA to mutation site, mutation site is shown in italics, and base substitution is performed at underlined position near the mutation site, so that the site forms ClaI cleavage site ATCGAT)

ADAM17-LA-F2：5'-GATCTGGGTCATCGATTCTT-3'

ADAM17-LA-R2：5'-GACTATCTTTCTAGGGTTAATAGTGCATACAAATTCATATTAGAG-3'

5' PB ITR amplification primer

ADAM17-PB 5'ITR-F：5'-ATATGAATTTGTATGCACTATTAACCCTAGAAAGATAGTC-3'

PB 5'ITR-R(NotI)：5'-AATGCGGCCGCGATATCTATAACAAGAAAATAT-3'

Homologous arm left arm ADAM17LA amplification primer (mutation site upstream)

ADAM17-LA-F1(NheI)：5'-CTAGCTAGCGGGAAGGGAAAGAAGTTG-3'

ADAM17-LA-R1：5'-AAGAATCGATGACCCAGATC-3'

4.1.1.2 backbone and fragment double enzyme digestion

See Table 26, the backbone PBluescript-pPGK-Puro-eGFP-TK-SV40pA enzyme digestion system is the same as 2.3.1.2

TABLE 26 cleavage system for fragment ADAM17LA-5' PB ITR

4.1.1.3 ligation of backbones and fragments: the digested fragments and the backbone were ligated with T4 ligase (Table 27), overnight at 16 ℃, transformed into E.coli DH5 α competent cells (Tiangen Biochemical, product number CB101), plated on LB/Amp plates, single clones were picked and cultured in LB/Amp liquid medium at 37 ℃ for 8h, plasmids were extracted, and the vector PBlue-ADAM17LA-5' PB ITR-pPGK-Puro-eGFP-TK 40pA was obtained by sequencing validation.

TABLE 27 PBlue-ADAM17LA-5' PB ITR-pPGK-Puro-eGFP-TK-SV40pA ligation reaction System

4.1.2 construction of the vector PBlue-ADAM17LA-5'PB ITR-pPGK-Puro-eGFP-TK-SV40pA-3' PB ITR-AD AM17RA

Amplifying a 986bp fragment at the downstream of a site with a sequence of TTAA in 4.1.1 to be used as a homologous arm right arm ADAM17RA, simultaneously amplifying a 3'PB ITR in an existing vector pXL-BACII-attPGAL4LWL (Addge) in a laboratory, connecting the 3' PB ITR with the homologous arm right arm sequence by using overlap PCR (polymerase chain reaction) to form a fragment 3'PB ITR-ADAM17RA (1240bp), enabling the 3' ITR to be seamlessly connected with the homologous arm right arm sequence, introducing a PacI enzyme cutting site at the 5 'end of the fragment, and introducing a BamHI enzyme cutting site at the 3' end. The vector PBlue-ADAM17LA-5'PB ITR-pPGK-Puro-eGFP-TK 40pA constructed in 4.1.1 is used as a framework, and the same double enzyme digestion is carried out with the fragment 3' PB ITR-ADAM17RA, so that the vector PBlue-ADAM17LA-5'PB ITR-pPGK-Puro-eGFP-TK 40pA-3' PB ITR-ADAM17RA is obtained through connection.

4.1.2.1 primer design and PCR amplification

3' PB ITR amplification primer

PB 3'ITR-F(PacI)：5'-CCTTAATTAATTTGTTACTTTATAGAAGAAAT-3'

ADAM17-PB3'ITR-R：5'-TTGTTTTGGTGAATTTTGATTTAACCCTAGAAAGATAATC-3'

Homologous arm right arm ADAM17RA amplification primer

ADAM17-RA-F1：5'-GATTATCTTTCTAGGGTTAAATCAAAATTCACCAAAACAAGAAG-3'

ADAM17-RA-R1(BamHI)：5'-CGCGGATCCCTTTGACTTCCAGGTTCAGG-3'

4.1.2.2 backbone and fragment double digestion

See tables 28, 29 for enzyme cleavage systems:

TABLE 28 enzymatic cleavage system of backbone PBlue-ADAM17LA-5' PB ITR-pPGK-Puro-eGFP-TK-SV40pA

TABLE 29 cleavage System of fragment 3' PB ITR-ADAM17RA

4.1.2.3 ligation of backbones and fragments: the digested fragments and the backbone were ligated with T4 ligase (Table 30), ligated overnight at 16 ℃, transformed E.coli DH5 α competent cells (Tiangen Biochemical, product number CB101), plated on LB/Amp plates, single clones were picked and cultured in LB/Amp liquid medium at 37 ℃ for 8h, plasmids were extracted, and sequence verified to give the vector PBlue-ADAM17LA-5'PB ITR-pPGK-Puro-eGFP-TK 40pA-3' PB ITR-ADAM17RA (FIG. 5).

TABLE 30 PBlue-ADAM17LA-5'PB ITR-pPGK-Puro-eGFP-TK-SV40pA-3' PB ITR-ADAM17RA ligation reaction System

4.2 construction of PiggyBac-mediated ADAM17 Gene Donor vector PBlue-ADAM17LA-5'PB ITR-pPGK-Zeo-mRFP-TK-SV40pA-3' PB ITR-ADAM17RA

4.2.1 construction of vector PBlue-ADAM17LA-5' PB ITR-pPGK-Zeo-mRFP-TK-SV40pA

The screening expression cassette vector PBluescript-pPGK-Zeo-mRFP-TK-SV40pA constructed in 2.2 is used as a framework, the same double enzyme digestion is carried out on the fragment ADAM17LA-5'PB ITR obtained in 4.1.1, and finally the vector PBlue-ADAM17LA-5' PB ITR-pGK-Zeo-RFP-TK 40pA is obtained through connection.

4.2.1.1 primer design and PCR amplification

The designed primer is the same as 4.1.1.1.

4.2.1.2 backbone and fragment double digestion

The enzyme cutting system of the framework PBluescript-pPGK-Zeo-mRFP-TK-SV40pA is the same as 2.4.1.2; the cleavage system of the fragment ADAM17LA-5' PB ITR was identical to 4.1.1.2.

4.2.1.3 ligation of backbones and fragments: the digested fragments and the backbone were ligated with T4 ligase (Table 31), overnight at 16 ℃, transformed into E.coli DH5 α competent cells (Tiangen Biochemical, product number CB101), plated on LB/Amp plates, single clones were picked and cultured in LB/Amp liquid medium at 37 ℃ for 8h, plasmids were extracted, and the vector PBlue-ADAM17LA-5' PB ITR-pPGK-Zeo-mRFP-TK-SV40pA was obtained by sequencing validation.

TABLE 31 PBlue-ADAM17LA-5' PB ITR-pPGK-Zeo-mRFP-TK-SV40pA ligation reaction System

4.2.2 construction of vector PBlue-ADAM17LA-5'PB ITR-pPGK-Zeo-mRFP-TK-SV40pA-3' PB ITR-AD AM17RA

The vector PBlue-ADAM17LA-5'PB ITR-pPGK-Zeo-mRFP-TK 40pA constructed in 4.2.1 is used as a framework, and the same double enzyme digestion is carried out with the 3' PB ITR-ADAM17RA obtained in 4.1.2, so that the vector PBlue-ADAM17LA-5'PB ITR-pPGK-Zeo-mRFP-TK 40pA-3' PB ITR-ADAM17RA is obtained through connection.

4.2.2.1 primer design and PCR amplification

The primers were designed as in 4.1.2.1.

4.2.2.2 backbone and fragment double digestion

See Table 32 for cleavage system the cleavage system for fragment 3' PB ITR-ADAM17RA is identical to 4.1.2.2:

TABLE 32 enzymatic cleavage system of backbone PBlue-ADAM17LA-5' PB ITR-pPGK-Zeo-mRFP-TK-SV40pA

4.2.2.3 ligation of backbones and fragments: the digested fragments and the backbone were ligated with T4 ligase (Table 33), ligated overnight at 16 ℃, transformed E.coli DH5 α competent cells (Tiangen Biochemical, product number CB101), plated on LB/Amp plates, single clones were picked and cultured in LB/Amp liquid medium at 37 ℃ for 8h, plasmids were extracted, and the vector PBlue-ADAM17LA-5'PB ITR-pPGK-Zeo-mRFP-TK 40pA-3' PB ITR-ADAM17RA (FIG. 6) was obtained by sequencing validation.

TABLE 33 PBlue-ADAM17LA-5'PB ITR-pPGK-Zeo-mRFP-TK-SV40pA-3' PB ITR-ADAM17RA ligation reaction System

(II) screening and enriching biallelic genome precise editing cells

Referring to fig. 7, taking the constructed double-allele efficient precise genome editing system of CCR5 gene as an example, the specific process is as follows:

1) the PiggyBac mediated CCR5 gene donor vector PBlue-CCR5LA-5'PB ITR-pPGK-Puro-eGFP-TK-SV40pA-3' PB ITR-CCR5RA, PBlue-CCR5LA-5'PB ITR-pPGK-Zeo-mRFP-TK-SV40pA-3' PB ITR-CCR5RA and CRISPR/Cas9 expression vector pll3.7-U6-CCR5.target-CBh-SpCas9 (sgRNA-Cas 9 for short) are co-transfected into 293T cell line in a molar ratio of 1:1:1.2, the genome is targeted by CRISPR/Cas9 expression vector to cause genome DNA double strand break, homologous repair (HDR) is carried out by CCR PiggyBac mediated 5 gene donor vector, and the homologous repair (HDR) is constructed (the PGIkyBac mediated CCR expression cassette is inserted into PGLU-SV 40-3 gene donor vector and the pGlu-SV 40-mRFP-TK-3 gene-RT-84 and the pGlu-5-rT-TK-SV 40 and the cDNA-SV 84 gene is inserted into the homologous recombination (sRNA-Cas Panel and replacing TTAA sequences of the genome). The transfection system was described with reference to the Hieff TransTM Liposome nucleic acid transfection reagent 24-well plate, and the cell transfection density was 90%.

2) Cells are digested 48 hours after transfection, the cells are transferred into a 100mm culture dish, puromycin (puromycin) and bleomycin (zeocin) double screening is carried out after 6 days of transfection, puromycin drug concentration is 2 mug/mL, zeocin drug concentration is 600 mug/mL, puromycin drug concentration is reduced to 1 mug/mL after 4 days, zeocin drug concentration is unchanged, dosing is stopped on the 10 th day, and a normal culture medium is changed to wait for growth of a single clone. Cells that fluoresced both green and red were monoclonal after double drug screening were selected with the aid of a fluorescent inverted microscope (fig. 8).

When two antibiotics, bleomycin (zeocin) and puromycin (puromycin), were added to the cells for selection, only zeocin resistance and no puromycin resistance were observed for cells that showed only red fluorescence after single or biallelic editing. Similarly, cells that fluoresce only green are puromycin resistant and zeocin resistant. These cells are killed by the corresponding other antibiotic in the culture system. The final screen therefore yielded cells that fluoresced both red and green (both puromycin and zeocin resistance expressed). And once the cells showed both green and red fluorescence, indicating that they were cells that completed biallelic editing, sequencing validation was performed.

(III) selectable marker-free Diallelic Gene editing cells

Referring to fig. 7, cells that fluoresce both green and red are transfected with the PiggyBac transposase expression vector and the selection markers (fluorescent protein genes eGFP and mRFP, positive selection genes puro, zeo, and negative selection gene TK) inserted into the genome are repaired by homologous recombination are deleted to give cells with biallelic editing without selection markers. If the selection marker is still present in the cell genome after transfection, the TK gene already expressed in the cell is phosphorylated to GCV triphosphate derivatives by drug selection with Ganciclovir (GCV), which can be inserted into the replicating DNA strand to inhibit DNA synthesis, block the cell cycle, induce apoptosis.

The PiggyBac Transposase expression vector transfected into cells expresses Transposase (Transposase), and the characteristic sequences 5'PB ITR and 3' PB ITR which are inserted into the genome of the cells through homologous recombination are identified and transposed, so that the fragment 5'PB ITR-pPGK-Puro-eGFP-TK-SV40pA-3' PB ITR and the fragment 5'PB ITR-pGK-Zeo-RFP-TK 40pA-3' PB ITR of the inserted genome are deleted, and the original TTAA sequence of the genome replaced by the inserted fragment is restored after transposition by using the 5'PB ITR and the 3' PB ITR (namely, the TTAA is connected with the genome sequences corresponding to the left arm and the right arm of the homologous arm).

The specific steps for preparing positive cell clones without screening markers and residues are as follows:

transfecting a transposase expression vector psfTn5 (purchased from Addgene) into a monoclonal cell which is selected in the early stage and emits green fluorescence and red fluorescence, wherein the transfection system is described by referring to a Hieff TransTM liposome nucleic acid transfection reagent 24-well plate, the cell transfection density is 90%, digesting the cell 48h after transfection, transferring the cell into a 100mm culture dish, carrying out GCV screening 6 days after transfection, the drug concentration is 40 mu g/mL, stopping adding the drug 10 days, and replacing a normal culture medium to wait for the growth of the monoclonal. Under the assistance of a fluorescence inverted microscope, selecting monoclonals which do not emit green fluorescence or red fluorescence after GCV screening, marking the monoclonals at the bottom of a dish by using a marker pen, selecting the monoclonals to a 24-hole plate for amplification culture, reserving 1/5 cells for continuous culture in the original hole after the cells grow full, and collecting 4/5 cells for extracting a genome from a Tiangen cell genome cassette.

(IV) double-allelic efficient accurate genome editing system transfection result and identification

Referring to fig. 9, a single clone was selected for expanded culture, the Tiangen cell genome cassette was used to extract the cell genome, and genome primers were designed outside the homology arms and inside the screening expression cassette, respectively, for identification, for testing the integrity of the left and right homology arms after HDR. There are three types of HDR-mediated integration of cellular genomes: the amplification results of the biallelic knock-in cells are positive except that P5 is negative; the amplification results of the single allele knock-in cells are positive; wild-type cells screened for random integration of the expression cassette were negative except for P5. Only if the amplification results of the left and right homology arms P1, P2 and P3 are positive at the same time, the complete knock-in of the screening expression cassette can be proved, and the positive monoclonal can be recorded. And (3) carrying out enzyme digestion detection on the PCR gel recovery products of P2 and P3 through the introduced enzyme digestion site SacII, wherein if two bands are generated by enzyme digestion, the mutation is successful, and finally, carrying out sequencing detection. 43 single clones were finally picked from the CCR5 locus, and the PCR detection of these 43 single clones resulted in a double knock-in efficiency of 60.47% (26/43). Although the 5'ITR and 3' ITR sequences at the two ends of the screening expression cassette actually increase the length of the screening expression cassette, the biallelic gene editing efficiency is not affected, and the biallelic gene editing efficiency of the existing screening expression cassette of the same type is improved under the condition that the sequence length (the part between the homologous arms) of the expression cassette is equivalent or even longer. The introduction of 5'ITR and 3' ITR sequences also ensures the stable efficiency of knocking out the screening expression cassettes from the cell genome.

<110> northwest agriculture and forestry science and technology university

<120> System for Diallelic exact genome editing Using CRISPR/Cas9 and PiggyBac

<160> 42

<210>1

<211>30

<212>DNA

<213> Fragment-F(PciI)

<400>1

agcacatgtt ctttcctgcg ttatcccctg 30

<210>2

<211>38

<212>DNA

<213> Fragment-R(NheI-SacI)

<400>2

ctggagctcg ctagccagct tttgttccct ttagtgag 38

<210>3

<211>29

<212>DNA

<213> pPGK-pA-F(NotI)

<400>3

aatgcggccg cccggtaggc gccaaccgg 29

<210>4

<211>29

<212>DNA

<213> pPGK-pA-R(NheI)

<400>4

ctagctagct agggcgaatt gggtaccgg 29

<210>5

<211>27

<212>DNA

<213> P2A-F1(EcoRⅠ)

<400>5

ccggaattcg caacaaactt ctcacta 27

<210>6

<211>30

<212>DNA

<213> P2A-R

<400>6

acgaggccat aggcccggga ttctcctcca 30

<210>7

<211>30

<212>DNA

<213> TK-F2

<400>7

tcccgggcct atggcctcgt accccggcca 30

<210>8

<211>27

<212>DNA

<213> TK-R2(XhoⅠ)

<400>8

ccgctcgagc agacatgata agataca 27

<210>9

<211>27

<212>DNA

<213> RFP-F(NheⅠ)

<400>9

ctagctagca tggcctcctc cgaggac 27

<210>10

<211>30

<212>DNA

<213> RFP-R

<400>10

agtttgttgc ggtgccggtg gagtggcggc 30

<210>11

<211>30

<212>DNA

<213> P2A-F2(RFP)

<400>11

caccggcacc gcaacaaact tctcactact 30

<210>12

<211>27

<212>DNA

<213> TK-R2(XhoⅠ)

<400>12

ccgctcgagc agacatgata agataca 27

<210>13

<211>27

<212>DNA

<213> mRFP-BGH polyA

<400>13

ctagcgctac cggtgccacc atggcctcct ccgaggacgt catcaaggag ttcatgcgct 60

tcaaggtgcg catggagggc tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg 120

agggccgccc ctacgagggc acccagaccg ccaagctgaa ggtgaccaag ggcggccccc 180

tgcccttcgc ctgggacatc ctgtcccctc agttccagta cggctccaag gcctacgtga 240

agcaccccgc cgacatcccc gactacttga agctgtcctt ccccgagggc ttcaagtggg 300

agcgcgtgat gaacttcgag gacggcggcg tggtgaccgt gacccaggac tcctccctgc 360

aggacggcga gttcatctac aaggtgaagc tgcgcggcac caacttcccc tccgacggcc 420

ccgtaatgca gaagaagacc atgggctggg aggcctccac cgagcggatg taccccgagg 480

acggcgccct gaagggcgag atcaagatga ggctgaagct gaaggacggc ggccactacg 540

acgccgaggt caagaccacc tacatggcca agaagcccgt gcagctgccc ggcgcctaca 600

agaccgacat caagctggac atcacctccc acaacgagga ctacaccatc gtggaacagt 660

acgagcgcgc cgagggccgc cactccaccg gcacctaagg ccggccaggc gcgccgtcta 720

gagggcccgt ttaaacccgc tgatcagcct cgactgtgcc ttctagttgc cagccatctg 780

ttgtttgccc ctcccccgtg ccttccttga ccctggaagg tgccactccc actgtccttt 840

cctaataaaa tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct attctggggg 900

gtggggtggg gcaggacagc aagggggagg attgggaaga caatagcagg catgctgggg 960

atgcggtggg ctctatggcc 980

<210>14

<211>23

<212>DNA

<213> PGK-F

<400>14

cgcggatccc cggtaggcgc caa 23

<210>15

<211>30

<212>DNA

<213> PGK-R

<400>15

tcaacttggc catattggct gcaggtcgaa 30

<210>16

<211>30

<212>DNA

<213> Zeo-T2A-F

<400>16

agccaatatg gccaagttga ccagtgccgt 30

<210>17

<211>50

<212>DNA

<213> Zeo-T2A-R1

<400>17

accgcatgtt agcagacttc ctctgccctc gtcctgctcc tcggccacga 50

<210>18

<211>53

<212>DNA

<213> Zeo-T2A-R2

<400>18

cacgctagct gggccaggat tctcctcgac gtcaccgcat gttagcagac ttc 53

<210>19

<211>29

<212>DNA

<213> CCR5-LA-F1(NheI)

<400>19

ctagctagcc tccccatagc aagacaaag 29

<210>20

<211>40

<212>DNA

<213> CCR5-LA-R1

<400>20

gactatcttt ctagggttaa agatagtcat cttggggctg 40

<210>21

<211>40

<212>DNA

<213> CCR5-PB5'ITR-F

<400>21

cagccccaag atgactatct ttaaccctag aaagatagtc 40

<210>22

<211>33

<212>DNA

<213> PB 5'ITR-R(NotI)

<400>22

aatgcggccg cgatatctat aacaagaaaa tat 33

<210>23

<211>32

<212>DNA

<213> PB 3'ITR-F(PacI)

<400>23

ccttaattaa tttgttactt tatagaagaa at 32

<210>24

<211>46

<212>DNA

<213> CCR5-PB3'ITR-R

<400>24

cagctctcat tttccataca ccgcggttaa ccctagaaag ataatc 46

<210>25

<211>47

<212>DNA

<213> CCR5-RA-F1

<400>25

gattatcttt ctagggttaa ccgcggtgta tggaaaatga gagctgc 47

<210>26

<211>27

<212>DNA

<213> CCR5-RA-R1(BamHI)

<400>26

cgcggatccg ggcgacagag tgagacc 27

<210>27

<211>20

<212>DNA

<213> ADAM17.target

<400>27

aatcaaaatt caccaaaaca 20

<210>28

<211>24

<212>DNA

<213> ADAM17 Target -F

<400>28

caccaatcaa aattcaccaa aaca 24

<210>29

<211>24

<212>DNA

<213> ADAM17 Target -R

<400>29

aaactgtttt ggtgaatttt gatt 24

<210>30

<211>20

<212>DNA

<213> ADAM17-LA-F2

<400>30

gatctgggtc atcgattctt 20

<210>31

<211>45

<212>DNA

<213> ADAM17-LA-R2

<400>31

gactatcttt ctagggttaa tagtgcatac aaattcatat tagag 45

<210>32

<211>40

<212>DNA

<213> ADAM17-PB 5'ITR-F

<400>32

atatgaattt gtatgcacta ttaaccctag aaagatagtc 40

<210>33

<211>33

<212>DNA

<213> PB 5'ITR-R(NotI)

<400>33

aatgcggccg cgatatctat aacaagaaaa tat 33

<210>34

<211>27

<212>DNA

<213> ADAM17-LA-F1(NheI)

<400>34

ctagctagcg ggaagggaaa gaagttg 27

<210>35

<211>20

<212>DNA

<213> ADAM17-LA-R1

<400>35

aagaatcgat gacccagatc 20

<210>36

<211>40

<212>DNA

<213> ADAM17-PB3' ITR-R

<400>36

ttgttttggt gaattttgat ttaaccctag aaagataatc 40

<210>37

<211>44

<212>DNA

<213> ADAM17-RA-F1

<400>37

gattatcttt ctagggttaa atcaaaattc accaaaacaa gaag 44

<210>38

<211>29

<212>DNA

<213> ADAM17-RA-R1(BamHI)

<400>38

cgcggatccc tttgacttcc aggttcagg 29

<210>39

<211>20

<212>DNA

<213> CCR5.Target

<400>39

catacagtca gtatcaattc 20

<210>40

<211>32

<212>DNA

<213> CCR5 deleted sequence

<400>40

tgtctggaaa ttcttccaga attgatactg ac 32

<210>41

<211>313

<212>DNA

<213> 5' ITR

<400>41

ttaaccctag aaagatagtc tgcgtaaaat tgacgcatgc attcttgaaa tattgctctc 60

tctttctaaa tagcgcgaat ccgtcgctgt gcatttagga catctcagtc gccgcttgga 120

gctcccgtga ggcgtgcttg tcaatgcggt aagtgtcact gattttgaac tataacgacc 180

gcgtgagtca aaatgacgca tgattatctt ttacgtgact tttaagattt aactcatacg 240

ataattatat tgttatttca tgttctactt acgtgataac ttattatata tatattttct 300

tgttatagat atc 313

<210>42

<211>235

<212>DNA

<213> 3' ITR

<400>42

tttgttactt tatagaagaa attttgagtt tttgtttttt tttaataaat aaataaacat 60

aaataaattg tttgttgaat ttattattag tatgtaagtg taaatataat aaaacttaat 120

atctattcaa attaataaat aaacctcgat atacagaccg ataaaacaca tgcgtcaatt 180

ttacgcatga ttatctttaa cgtacgtcac aatatgatta tctttctagg gttaa 235

Claims (9)

1. A biallelic genome editing system, comprising: the editing system comprises a first donor vector, a second donor vector and a CRISPR/Cas9 expression vector for targeting a genome; the first donor vector and the second donor vector comprise sequences homologous to an upstream fragment and a downstream fragment of the genome joined by a palindromic sequence, and a transposon sequence capable of replacing the palindromic sequence by homologous recombination repair, joined between the homologous sequences of the upstream and downstream fragments; the transposon sequences of the first donor vector and the second donor vector comprise a selection gene expression cassette for enriching a genome containing a corresponding transposon sequence and inverted terminal repeat sequences recognized by transposase at both ends of the corresponding selection gene expression cassette, the inverted terminal repeat sequences being linked to the homologous sequences of the upstream fragment or the downstream fragment at the corresponding ends.

2. The biallelic genome editing system of claim 1, wherein: the CRISPR/Cas9 expression vector comprises a target gene target site sgRNA sequence expression cassette and a Cas9 nuclease gene expression cassette.

3. The biallelic genome editing system of claim 1, wherein: the target-hitting site of the CRISPR/Cas9 expression vector is located near the palindromic sequence TTAA, and the distance between the target-hitting site and the palindromic sequence TTAA is less than or equal to 50 bp.

4. The biallelic genome editing system of claim 1, wherein: the screening gene expression cassette comprises a forward drug screening gene sequence; the first donor vector and the second donor vector differ in the forward drug screening gene.

5. The biallelic genome editing system of claim 4, wherein: the screening gene expression cassette also comprises a fluorescent protein gene sequence; the fluorescent protein genes of the first donor vector and the second donor vector are different.

6. The biallelic genome editing system of claim 4or 5, wherein: the screening gene expression cassette also includes a negative drug screening gene sequence.

7. The biallelic genome editing system of claim 6, wherein: in the screening gene expression box, a positive drug screening gene, a fluorescent protein gene and a negative drug screening gene are expressed in series.

8. The biallelic genome editing system of claim 1, wherein: the inverted terminal repeat sequence adopts characteristic sequences 5'ITR and 3' ITR in a PiggyBac transposon system.

9. The biallelic genome editing system of claim 1, wherein: the editing system further comprises a transposase expression vector.

Images