WO2022139886A1 - Circuits enzymatiques crispr pour capteurs électroniques moléculaires - Google Patents

Circuits enzymatiques crispr pour capteurs électroniques moléculaires Download PDF

Info

Publication number
WO2022139886A1
WO2022139886A1 PCT/US2021/046581 US2021046581W WO2022139886A1 WO 2022139886 A1 WO2022139886 A1 WO 2022139886A1 US 2021046581 W US2021046581 W US 2021046581W WO 2022139886 A1 WO2022139886 A1 WO 2022139886A1
Authority
WO
WIPO (PCT)
Prior art keywords
sensor
crrna
molecule
enzyme
electrode
Prior art date
Application number
PCT/US2021/046581
Other languages
English (en)
Inventor
Barry Merriman
Carl Fuller
Paul MOLA
Venkatesh Alagarswamy Govindaraj
Andrew Hodges
Original Assignee
Roswell Biotechnologies, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Roswell Biotechnologies, Inc. filed Critical Roswell Biotechnologies, Inc.
Publication of WO2022139886A1 publication Critical patent/WO2022139886A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6825—Nucleic acid detection involving sensors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
    • G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
    • G01N27/3278—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction involving nanosized elements, e.g. nanogaps or nanoparticles
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/403—Cells and electrode assemblies
    • G01N27/414—Ion-sensitive or chemical field-effect transistors, i.e. ISFETS or CHEMFETS
    • G01N27/4145—Ion-sensitive or chemical field-effect transistors, i.e. ISFETS or CHEMFETS specially adapted for biomolecules, e.g. gate electrode with immobilised receptors

Definitions

  • BACKGROUND [0001] In the field of genetic analysis, it is important to be able to determine if a given sample of biological material contains a DNA or RNA segment of interest. Also important is species identification, where a sequence characteristic of a species is searched for within a sample. These analyses are important for the environmental monitoring of, and diagnosis of, infectious disease. For example, a DNA segment that identifies a pathogen, such as a parasite, bacteria or virus, can be looked for within a sample taken from the environment, or in a bio-sample from an animal or human that may be infected. This is especially important for the environmental surveillance and epidemiology of viral diseases with the potential for large scale, rapidly progressing infection or pandemics, such as COVID-19.
  • pathogen such as a parasite, bacteria or virus
  • genotyping it is important in genetic analysis to look for known genetic variants that may occur relative to a give segment of DNA.
  • This type of measurement is known as genotyping, and in various aspects comprises looking for known variants in humans and animals. In the context of pathogens, this often takes the form of identification of strains, which are defined by DNA or RNA variants relative to a reference genome sequence, or by the sequence differences between two genomes.
  • concentration of a DNA or RNA segment of interest in a sample is important to be able to determine the concentration of a DNA or RNA segment of interest in a sample.
  • gene expression analysis where the activity level or expression level of genes, represented in the form of messenger RNA, can be assessed in a sample.
  • NIPT Non-Invasive Pregnancy Testing
  • Liquid Biopsy for early detection or recurrence monitoring of cancer, which may look to detect of the levels of known mutant sequences in blood samples.
  • CGH Comparative Genomic Hybridization
  • metagenomics Another example arises in the field called metagenomics, where the goal is to characterize complex populations of diverse organisms present in an environmental sample, such as a soil or water sample, by extracting and quantifying the abundance of different forms of genomic DNA present in the organisms in the sample.
  • an environmental sample such as a soil or water sample
  • microbiomes such as gut microbiome, or oral microbiome
  • PCR PCR
  • PCR PCR
  • a molecular electronics sensor comprising a molecular complex further comprising a CRISPR Cas enzyme complexed to a crRNA molecule, electrically coupled to a pair of electrodes to complete a sensor circuit.
  • the molecular electronics sensor is capable of detecting the presence of, and the concentration of, genetic material such as a segment of oligonucleotide from a pathogen genome.
  • FIG.1 illustrates the protein and RNA structure of Cas9 complexed with its target DNA
  • FIG.2 illustrates the protein and RNA structure of Cas9 complexed with its target DNA, with the DNA component not rendered
  • FIG.3 illustrates the structure of Cas12a enzyme complexed with a crRNA from a species of Lachnospiraceae bacterium
  • FIG.9 illustrates the structure of Cas12a enzyme complexed with a crRNA from a species of Lachnospiraceae bacterium
  • FIG. 4 illustrates the structure of Cas12a enzyme complexed with a crRNA for a species of Tularensis bacterium;
  • FIG.5 illustrates the structure of Cas13a complexed with a crRNA;
  • FIG.6 illustrates the concept of a molecular electronics circuit measuring the current through a single molecule bridge;
  • FIG. 7 illustrates the concept of a molecular electronics sensor detecting the interaction of an enzyme with a substrate molecule, in a configuration with the enzyme conjugated to a bridge molecule;
  • FIG. 7 illustrates the concept of a molecular electronics sensor detecting the interaction of an enzyme with a substrate molecule, in a configuration with the enzyme conjugated to a bridge molecule;
  • FIG. 8 illustrates the concept of a molecular electronics sensor detecting the interaction of an enzyme with a substrate molecule, in a configuration with the enzyme wired directly into the current path;
  • FIG.9 illustrates an embodiment of intermediate sensor assembly in which a crRNA is tethered to a molecular bridge, which is pre-assembled to the nanoelectrodes, and the Cas enzyme is engaged from solution;
  • FIG.10 illustrates an embodiment of completed sensor assembly in which a crRNA is tethered to a molecular bridge, which is pre-assembled to the nanoelectrodes, and the Cas enzyme is engaged from solution, to form the completed sensor;
  • FIG.9 illustrates an embodiment of intermediate sensor assembly in which a crRNA is tethered to a molecular bridge, which is pre-assembled to the nanoelectrodes, and the Cas enzyme is engaged from solution, to form the completed sensor;
  • FIG.10 illustrates an embodiment of completed sensor assembly in which a crRNA is tethere
  • FIG. 11 illustrates a sensor embodiment in which the Cas enzyme is engaged to crRNA tethered to a molecular bridge, and is exposed to a pool of candidate target DNA or RNA molecules
  • FIG. 12 illustrates an embodiment of a CRISPR Cas sensor, in which the Cas enzyme is engaged to crRNA tethered to a molecular bridge, with example detection signals produced by the measurement circuitry, when the sensor engages and processes its primary target DNA or RNA molecule;
  • FIG. 12 illustrates an embodiment of a CRISPR Cas sensor, in which the Cas enzyme is engaged to crRNA tethered to a molecular bridge, with example detection signals produced by the measurement circuitry, when the sensor engages and processes its primary target DNA or RNA molecule
  • FIG. 13 illustrates an embodiment of a CRISPR Cas sensor, in which the Cas enzyme is engaged to crRNA tethered to a molecular bridge, with example detection signals produced by the measurement circuitry, after the Cas enzyme has engaged and processed its primary target DNA or RNA molecule, and has become activated as a non-specific nuclease, which then produces signals shown as it cuts nuclease substrates that are provided in abundance in solution; [0019] FIG.
  • FIG. 14 illustrates an embodiment of intermediate sensor assembly in which a crRNA is tethered to a molecular bridge, at a point internal to the crRNA, which is pre-assembled to the nanoelectrodes, and the Cas enzyme is engaged from solution;
  • FIG.15 illustrates an embodiment of completed sensor assembly in which a crRNA is tethered to a molecular bridge, at a point internal to the crRNA , which is pre-assembled to the nanoelectrodes, and the Cas enzyme is engaged from solution, to form the completed sensor;
  • FIG. 16 illustrates an embodiment of intermediate sensor assembly in which a crRNA is tethered to a molecular bridge, with an extended spacer/tether from one end of the crRNA, which is pre- assembled to the nanoelectrodes, and the Cas enzyme is engaged from solution;
  • FIG. 17 illustrates an embodiment of the completed sensor assembly in which a crRNA is tethered to a molecular bridge, with an extended spacer/tether from one end of the crRNA, which is pre- assembled to the nanoelectrodes, and the Cas enzyme is engaged from solution; [0023] FIG.
  • FIG. 18 illustrates an embodiment of intermediate sensor assembly in which a crRNA is tethered to a molecular bridge, with an extended spacer/tether from an internal point of the crRNA, which is pre-assembled to the nanoelectrodes, and the Cas enzyme is engaged from solution;
  • FIG. 19 illustrates an embodiment of the completed sensor assembly in which a crRNA is tethered to a molecular bridge, with an extended spacer/tether from an internal point of the crRNA, which is pre-assembled to the nanoelectrodes, and the Cas enzyme is engaged from solution;
  • FIG.20 illustrates an embodiment of intermediate sensor assembly in which a crRNA spans a gap between bridge molecules anchored to the nanoelectrodes, tethered at/near its termini, and the Cas enzyme is engaged from solution;
  • FIG.20 illustrates an embodiment of intermediate sensor assembly in which a crRNA spans a gap between bridge molecules anchored to the nanoelectrodes, tethered at/near its termini, and the Cas enzyme is engaged from solution;
  • FIG. 20 illustrates an embodiment of intermediate sensor assembly in which a crRNA spans a gap between bridge molecules anchored to the nanoelectrodes, tethered at/near its termini, and the Cas enzyme is engaged
  • FIG. 21 illustrates an embodiment of completed sensor assembly in which a crRNA spans a gap between bridge molecules anchored to the nanoelectrodes, tethered at/near its termini, and the Cas enzyme is engaged from solution;
  • FIG.22 illustrates an embodiment of intermediate sensor assembly in which a crRNA spans a gap between bridge molecules anchored to the nanoelectrodes, tethered at two internal points, and the Cas enzyme is engaged from solution;
  • FIG. 23 illustrates an embodiment of completed sensor assembly in which a crRNA spans a gap between bridge molecules anchored to the nanoelectrodes, tethered at two internal points, and the Cas enzyme is engaged from solution; [0029] FIG.
  • FIG. 24 illustrates an embodiment of intermediate sensor assembly in which a crRNA is tethered at two points to a bridge, and the Cas enzyme is engaged from solution
  • FIG.25 illustrates an embodiment of completed sensor assembly in which a crRNA is tethered at two points to a bridge , and the Cas enzyme is engaged from solution
  • FIG. 26 illustrates an embodiment of intermediate sensor assembly in which the Cas enzyme is conjugated to bridge molecule, and a crRNA is engaged from solution
  • FIG. 27 illustrates an embodiment of completed sensor assembly in which the Cas enzyme is conjugated to bridge molecule, and a crRNA has been engaged from solution
  • FIG. 28 illustrates an embodiment of intermediate sensor assembly in which the Cas enzyme is wired directly into the current path, and a crRNA is engaged from solution
  • FIG. 29 illustrates an embodiment of completed sensor assembly in which the Cas enzyme is wired directly into the current path, and a crRNA has been engaged from solution
  • FIG. 30 illustrates an embodiment of completed sensor assembly in which the Cas enzyme is wired directly into the current path, and a crRNA has been engaged from solution, in which the Cas enzyme is wired such that the connection points to the enzyme are near to the recognition segment of the crRNA;
  • FIG. 31 illustrates an embodiment of intermediate sensor assembly in which a crRNA is tethered to a molecular bridge, and which further comprises an encoding oligo for identifying the crRNA, which is pre-assembled to the nanoelectrodes, and the Cas enzyme is engaged from solution;
  • FIG.32 illustrates an embodiment of completed sensor assembly in which a crRNA is tethered to a molecular bridge, and which further comprises an encoding oligo for identifying the crRNA, which is pre-assembled to the nanoelectrodes, and the Cas enzyme has engaged from solution;
  • FIG.32 illustrates an embodiment of completed sensor assembly in which a crRNA is tethered to a molecular bridge, and which further comprises an encoding oligo for identifying the crRNA, which is pre-assembled to the nanoelectrodes, and the Cas enzyme has engaged from solution;
  • FIG.32 illustrates an embodiment of completed sensor assembly in which a crRNA is tethered to a
  • FIG. 33 illustrates an embodiment of intermediate sensor assembly in which the Cas enzyme is conjugated to bridge molecule, and a crRNA is engaged from solution, and in which the crRNA further comprises an encoding oligo for identifying the crRNA;
  • FIG. 34 illustrates an embodiment of completed sensor assembly in which the Cas enzyme is conjugated to bridge molecule, and a crRNA is engaged from solution, and in which the crRNA further comprises an encoding oligo for identifying the crRNA, and with the encoding oligo available for subsequent decoding;
  • FIG. 34 illustrates an embodiment of completed sensor assembly in which the Cas enzyme is conjugated to bridge molecule, and a crRNA is engaged from solution, and in which the crRNA further comprises an encoding oligo for identifying the crRNA, and with the encoding oligo available for subsequent decoding;
  • FIG. 34 illustrates an embodiment of completed sensor assembly in which the Cas enzyme is conjugated to bridge molecule, and a crRNA is engaged from solution, and in which the crRNA further comprises an encoding
  • FIG. 35 illustrates an embodiment of intermediate sensor assembly in which the Cas enzyme is pre-loaded with a crRNA, and in which the crRNA further comprises an encoding oligo for identifying the crRNA, and in which a bridge with a conjugation site suitable for the Cas enzyme has previously been assembled;
  • FIG. 36 illustrates an embodiment of completed sensor assembly in which the Cas enzyme is pre-loaded with a crRNA, and in which the crRNA further comprises an encoding oligo for identifying the crRNA, and in which a bridge with a conjugation site suitable for the Cas enzyme has previously been assembled, and the Cas enzyme is conjugated to the bridge;
  • FIG. 36 illustrates an embodiment of completed sensor assembly in which the Cas enzyme is pre-loaded with a crRNA, and in which the crRNA further comprises an encoding oligo for identifying the crRNA, and in which a bridge with a conjugation site suitable for the Cas enzyme has previously been assembled, and the Cas enzyme is conjugated to the bridge;
  • FIG. 36 illustrates an embodiment of
  • FIG. 37 illustrates an embodiment of completed sensor assembly in which the Cas enzyme is pre-loaded with a crRNA, and in which the crRNA further comprises an encoding oligo for identifying the crRNA, and is pre-conjugated to the bridge, and the entire complex is assembled into the nanoelectrodes;
  • FIG. 38 illustrates different options for the location of an encoding oligo attached to the crRNA, in an embodiment of completed sensor in which the Cas enzyme is conjugated directly to the bridge;
  • FIG. 38 illustrates different options for the location of an encoding oligo attached to the crRNA, in an embodiment of completed sensor in which the Cas enzyme is conjugated directly to the bridge;
  • FIG. 39 illustrates different options for the location of an encoding oligo attached to the crRNA, in an embodiment of completed sensor in which the crRNA is tethered to the bridge, and is used to engage the Cas enzyme from solution;
  • FIG.40 illustrates an embodiment of intermediate sensor assembly in which a crRNA spans a gap between bridge molecules anchored to the nanoelectrodes, tethered at two internal points, and in which the crRNA further comprises an encoding oligo for identifying the crRNA, and the Cas enzyme is engaged from solution;
  • FIG.40 illustrates an embodiment of intermediate sensor assembly in which a crRNA spans a gap between bridge molecules anchored to the nanoelectrodes, tethered at two internal points, and in which the crRNA further comprises an encoding oligo for identifying the crRNA, and the Cas enzyme is engaged from solution;
  • FIG.40 illustrates an embodiment of intermediate sensor assembly in which a crRNA spans a gap between bridge molecules anchored to the nanoelectrodes
  • FIG. 41 illustrates an embodiment of completed sensor assembly in which a crRNA spans a gap between bridge molecules anchored to the nanoelectrodes, tethered at two internal points, and in which the crRNA further comprises an encoding oligo for identifying the crRNA, and the Cas enzyme has been engaged from solution;
  • FIG.42 illustrates an example sensor embodiment for a Cas9 enzyme, in which the crRNA is tethered to the bridge in the external hairpin segment of the sgRNA;
  • FIG. 43 illustrates an example sensor embodiment for a Cas9 enzyme, in which the crRNA is tethered to the bridge from the terminus of the crRNA;
  • FIG.44 illustrates an example sensor embodiment for a Cas12a enzyme, in which the crRNA is tethered to the bridge in the external hairpin segment of the crRNA;
  • FIG.45 illustrates an example sensor embodiment for a Cas12a enzyme, in which the crRNA is tethered to the bridge near the 3’ end of the crRNA;
  • FIG. 46 illustrates an example sensor embodiment for a Cas13 enzyme, in which the crRNA is tethered to the bridge in the external hairpin segment of the crRNA;
  • FIG. 47 illustrates an example sensor embodiment for a Cas13 enzyme, in which the crRNA is tethered to the bridge near the 3’ end of the crRNA;
  • FIG. 48 illustrates an example sensor embodiment where a Cas enzyme is wired directly into the current path between nanoelectrodes by wiring to ends of an internal alpha-helix of the enzyme;
  • FIG. 49 illustrates an example sensor embodiment where a Cas enzyme is wired directly into the current path between nanoelectrodes by wiring to ends of a series of internal alpha-helices of the enzyme; [0055] FIG.
  • FIG. 50 illustrates an example sensor embodiment where a Cas enzyme is wired directly into the current path between nanoelectrodes by wiring to ends of a beta-sheet internal to the enzyme;
  • FIG. 51 illustrates an example sensor embodiment where a Cas enzyme/crRNA complex is wired directly into the current path between nanoelectrodes by wiring to two points on the crRNA;
  • FIG. 52 illustrates an example sensor embodiment where a Cas enzyme is wired directly into the current path between nanoelectrodes by wiring to the C-terminus and N-terminus of the enzyme protein; [0058] FIG.
  • FIG. 53 illustrates an example sensor embodiment where a Cas enzyme is wired directly into the current path between nanoelectrodes by wiring to points on the enzyme that undergo a change in separation during the conformational changes that the enzyme undergoes during its activity processes;
  • FIG. 54 illustrates an example sensor embodiment where a Cas enzyme is wired directly into the current path between nanoelectrodes with arms that wire to more than two points on the enzyme; [0060] FIG.
  • FIG. 55 illustrates the functional domain structure of a Cas9 enzyme, including the various recognition domains, and nuclease domains;
  • FIG.56 illustrates an example sensor embodiment where a Cas9 enzyme is wired directly into the current path, wiring at points spanning nuclease and recognition domains that undergo large conformational motion;
  • FIG.57 illustrates an example sensor embodiment where a Cas9 enzyme is wired directly into the current path, wiring at points on the HNH nuclease domain;
  • FIG.58 illustrates an example sensor embodiment where a Cas9 enzyme is wired directly into the current path, wiring at points spanning two nuclease domains;
  • FIG.59 illustrates an example sensor embodiment where a Cas9 enzyme is wired directly into the current path, wiring at points spanning two recognition domains;
  • FIG.60 illustrates an example sensor embodiment where a Cas9 enzyme is wired directly into the current path, wiring at points that span a REC domain;
  • FIG.61 illustrates the functional domain structure of a Ca
  • FIG. 62 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring at points that span REC and NUC domains that undergo large relative motion during conformational changes;
  • FIG. 63 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring at points that span nuclease domains;
  • FIG. 64 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring at points that span recognition domains;
  • FIG. 65 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring at points on a single nuclease domain; [0071] FIG.
  • FIG. 66 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring at points that span the wedge and PAM interaction domains;
  • FIG. 67 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring at points of the enzyme near the recognition portion of the crRNA;
  • FIG. 68 illustrates an example sensor embodiment where a Cas12a enzyme/crRNA is wired directly into the current path, wiring directly to points on the crRNA that span the recognition portion of the crRNA, putting this segment of the crRNA directly in the current path;
  • FIG.69 illustrates the detailed functional domain structure of a Cas12a enzyme; [0075] FIG.
  • FIG. 70 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring directly to the C- and N- termini of the protein, and where this is achieved using alpha-helical proteins as wires extending from the termini;
  • FIG. 71 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring to the NUC lobe, using alpha-helical proteins as wires;
  • FIG. 72 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring spanning the NUC and REC lobes, using alpha-helical proteins as wires; [0078] FIG.
  • FIG. 73 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring to the REC lobe, using alpha-helical proteins as wires;
  • FIG. 74 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring spanning NUC and REC domains, using alpha-helical proteins as wires;
  • FIG. 75 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring to the RuvC nuclease domain, using alpha-helical proteins as wires; [0081] FIG.
  • FIG. 76 illustrates an example sensor embodiment where a Cas12a enzyme is conjugated at one point to a molecular bridge, using an alpha-helical protein wire as bridge;
  • FIG.77 illustrates the detailed functional domain structure of a Cas9 enzyme;
  • FIG.78 illustrates an example sensor embodiment where a Cas9 enzyme is wired directly into the current path, wiring directly to the C- and N- termini of the protein, and where this is achieved using alpha-helical proteins as wires extending from the termini;
  • FIG. 79 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring to the NUC lobe, using alpha-helical proteins as wires; [0085] FIG.
  • FIG. 80 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring to the REC lobe, using alpha-helical proteins as wires;
  • FIG. 81 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring spanning the REC and NUC lobes, using alpha-helical proteins as wires;
  • FIG. 82 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring to a single long alpha helix through the REC-NUC lobes, using alpha-helical proteins as wires; [0088] FIG.
  • FIG. 83 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring through RuCV domain, using alpha-helical proteins as wires;
  • FIG. 84 illustrates an example sensor embodiment where a Cas12a enzyme is conjugated at one point to a molecular bridge, using an alpha-helical protein wire as bridge;
  • FIG. 85 illustrates an example sensor embodiment where a Cas12a enzyme/crRNA complex is wired directly into the current path, wiring to points on the crRNA spanning the recognition sequence segment, using alpha-helical proteins as wires; [0091] FIG.
  • FIG. 86 illustrates an example sensor embodiment where a Cas12a enzyme/crRNA complex is wired directly into the current path, wiring to points with one on the enzyme near the end of the crRNA, and the other on the crRNA, spanning the recognition sequence segment, using alpha-helical proteins as wires;
  • FIG. 87 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring to points on the enzyme near the ends of the recognition portion of the crRNA, and using alpha-helical proteins as wires; [0093] FIG.
  • FIG. 88 illustrates an example sensor embodiment where a Cas12a enzyme is wired directly into the current path, wiring to two points on the enzyme, and using double stranded DNA as molecular wires;
  • FIG. 89 illustrates an example sensor embodiment where a Cas12a enzyme/crRNA complex is wired directly into the current path, wiring to points on the crRNA spanning the recognition sequence segment, using double stranded DNA as molecular wires;
  • FIG.90 illustrates an example of a molecular bridge with a DNA oligo attached, and the signals produced when it binds with a complementary DNA;
  • FIG.91 illustrates an example of a molecular bridge with a DNA oligo attached, and the signals produced when it binds with a complementary DNA from a pool that contains diverse DNA;
  • FIG.92 illustrates a CMOS sensor array chip architecture, and measurement pixel architecture, in which a Cas enzyme probe is established at each sensor pixel to deploy a sensor array of Cas sensors;
  • FIG. 96 illustrates signal data from an experimental embodiment of a DNA oligo bridge, deployed on a pixel of a CMOS chip device, as it binds with its complementary DNA target;
  • FIG. 97 illustrates signal data from an experimental embodiment of a DNA oligo bridge, deployed on a pixel of a CMOS chip device, as it binds with its complementary DNA target, showing a long-time trace and a close up of the signals;
  • FIG. 98 illustrates signal data from an experimental embodiment of a DNA oligo bridge, deployed on a pixel of a CMOS chip device, as it binds with its complementary DNA target, showing the signal response as the concentration of target DNA is increased; [00104] FIG.
  • FIG. 99 illustrates signal data from an experimental embodiment of a DNA oligo bridge, deployed on a pixel of a CMOS chip device, as it binds with its complementary DNA target, showing the signal response as the concentration of target DNA is increased, and with the % of time bound and unbound as a measure of binding strength;
  • FIG. 100 illustrates the experimental relationship between DNA target concentration and fraction of time the sensor is bound, for the DNA oligo bridge sensor;
  • FIG. 101 illustrates the experimental impact of mismatched binding on the sensor signal for the DNA oligo bridge sensor, for cases of perfect match, single base mismatch, and 3-base mismatches in the target DNA;
  • FIG. 100 illustrates the experimental relationship between DNA target concentration and fraction of time the sensor is bound, for the DNA oligo bridge sensor
  • FIG. 101 illustrates the experimental impact of mismatched binding on the sensor signal for the DNA oligo bridge sensor, for cases of perfect match, single base mismatch, and 3-base mismatches in the target DNA;
  • FIG. 102 illustrates the major states changes of a DNA polymerase enzyme as it binds to and extends a primer
  • FIG. 103 illustrates the experimental sensor signals acquired as a DNA polymerase enzyme binds to a primed oligo tethered to a bridge, and the relationship between enzyme concentration in solution and resulting binding signal pulse rate. This is a model system for the proposed Cas-crRNA binding signals that would result as the Cas enzymes bind to a crRNA tethered to the sensor bridge;
  • FIG. 104 shows the configuration of a Cas12a enzyme molecular electronics sensor used in experiments; [00110] FIG.
  • FIG. 105 shows an experimental dose-response titration curves for the Cas12a sensor, for interactions with the guide RNA (left) and interactions with the target DNA (right);
  • FIG.106 shows the signal trace from a first exemplar sensor pixel, from a target DNA titration experiment;
  • FIG. 107 shows quantified pixel signal traces and bound fraction for two concentrations phases (0.125 pM, 0.25 pM) from the target DNA titration experiment;
  • FIG. 108 shows quantified pixel signal traces and bound fraction for two concentrations phases (1 pM, 8 pM) from the target DNA titration experiment;
  • FIG. 109 shows quantified pixel signal traces and bound fraction for two concentrations phases (16 pM, 32 pM) from the target DNA titration experiment; [00115]
  • FIG. 110 illustrates a quantified pixel signal trace and bound fraction for one concentrations phase (64 pM) from the target DNA titration experiment;
  • FIG. 111 shows the signal trace from a second exemplar sensor pixel, from a target DNA titration experiment;
  • FIG. 112 shows quantified pixel signal traces and bound fraction for two concentrations phases (0.125 pM, 0.25 pM) from the target DNA titration experiment; [00118] FIG.
  • FIG. 113 illustrates quantified pixel signal traces and bound fraction for two concentrations phases (1 pM, 8 pM) from the target DNA titration experiment; [00119] FIG. 114 illustrates quantified pixel signal traces and bound fraction for two concentrations phases (16 pM, 32 pM) from the target DNA titration experiment; [00120] FIG. 115 illustrates quantified pixel signal traces and bound fraction for two concentrations phases (32 pM, 64 pM) from the target DNA titration experiment; and [00121] FIG.116 shows a quantified pixel signal trace and bound fraction for one concentrations phase (64 pM) from the target DNA titration experiment.
  • CRISPR Enzymes are part of a biological system for acquired immunity present in prokaryotic cells, such as bacteria and archaea.
  • CRISPR is an acronym for “clustered regularly interspaced short palindromic repeats”, which refers to DNA sequence patterns that were discovered in the genomes of bacteria, and which were the first aspect of this acquired immune system to be discovered.
  • Cas enzymes are complexed with various RNA molecules that provide their full activity and specific targeting capability.
  • CRISPR RNA CRISPR RNA
  • tracrRNA trans-activating CRISPR RNA
  • gRNA guide RNA
  • sgRNA single guide RNA
  • a sgRNA refers in particular to RNA for Cas9 or Cas12b in which the guiding crRNA and tracrRNA are present within a single RNA strand, which can be achieved by synthetic creation of such an RNA.
  • Cas12a and Cas13 in nature do not have a separate tracrRNA. Instead, they only have a crRNA that is the gRNA.
  • the literature provides schematics of how the guide RNA associates with various Cas enzymes, and how this complex engages with the target and the cutting activity that results, (see, e.g., J.E.
  • CRISPR Cas enzymes undergo a complex series of conformational changes and other state changes in the course of complexing with their specific target nucleic acid and performing their subsequent cutting activities.
  • H-N-H is a common type of bacterial nuclease, that has conserved locations of histidine (H), asparagine (N) and histidine (H) amino acids in the peptide chain).
  • H histidine
  • N asparagine
  • H histidine
  • H histidine
  • H histidine
  • REC recognition
  • CRISPR-Cas9 Structures and Mechanisms Ann. Rev. Biophysics, 46, 505-529 (2017).
  • various molecular electronics circuits are described that incorporate a CRISPR Cas enzyme. These circuits are configured to act as sensors for a specific target of the CRISPR Cas enzyme.
  • an advantage to incorporating a CRISPR Cas enzyme into a sensor circuit is the direct electronic readout of the CRISPR Cas enzyme detecting its target.
  • a further advantage is the single molecule sensitivity in detection of the target.
  • sensor array chips are disclosed, e.g., CMOS sensor array chips.
  • a chip is used for deployment of multiplex CRISPR enzyme sensors and assays, with the advantages of highly multiplex, low cost and all electronic CRISPR diagnostics.
  • efficient methods of fabricating CRISPR Cas enzyme sensor array chips are disclosed.
  • methods for performing CRISPR diagnostics using CRISPR Cas enzyme molecular electronics sensors are disclosed.
  • methods for performing multiplex CRISPR diagnostics using sensor array chips are disclosed. These diagnostic methods provide rapid, low-cost diagnostics using massively multiplex CRISPR diagnostics.
  • molecular electronics circuits incorporating a CRISPR Cas enzyme are configured for the detection of SARS-CoV-2 virus.
  • CRISPR Cas enzyme sensors in accordance with the present disclosure can be configured for detection of sets of viruses, including detection and discrimination of virus strains.
  • such sensors or sensor array chips are configured for detection of infectious disease pathogens, including viruses, bacteria, fungi and parasites.
  • sensors provide the advantage of CRISPR diagnostics with a high level of multiplexing, all electronic rapid readout on low-cost devices, low cost per test, and single molecule sensitivity.
  • methods of multiplexing up to 10, up to 100, up to 1000, up to 10,000, up to 100,000, or up to 1 million or more CRISPR diagnostics in single assays are disclosed. Multiplexing provides advantages of extremely high throughput screening and extremely low-cost testing.
  • molecular electronics CRISPR enzyme sensors are disclosed that directly provide single molecule detection sensitivity for the enzyme engaging its target. An advantage is that there may be reduced or even no need to pre-amplify an input nucleic acid sample provided to the sensor.
  • CRISPR enzymes incapable of undergoing transformation to a non-specific nuclease such as Cas9
  • this much broader class of enzymes can be used for diagnostic assays having single molecule sensitivity.
  • Cas enzyme refers to any of the enzymes involved in a CRISPR system for any form of bacteria or archaea, which are nucleases capable of cutting a specific nucleic acid target by complexing with a guide RNA (or DNA, if such is ever discovered or engineered).
  • a Cas enzyme refers to any forms of Cas9, Cas12, Cas13 or Cas14 enzymes, or similar such enzymes known or still to be discovered.
  • non-specific nuclease activity refers to nuclease activity of a Cas enzyme induced by complexing with the target of its guide RNA. Such activity exists, for example, for Cas 12, Cas 13, and Cas 14 enzymes.
  • guide RNA refers to any RNA or nucleic acid that may be complexed with a Cas enzyme used to define the targeting of a Cas enzyme.
  • crRNA broadly refers to any RNA (or other nucleic acid) that complexes with a Cas enzyme, including a guide RNA.
  • the terms “Cas9,” “Cas12,” “Cas13,” or “Cas14,” refer to any homologous forms of these enzymes that come from any particular bacteria or archaea, or to any of the subtypes of these enzymes, such as Cas12a and Cas13a, whenever it makes sense within the particular context, and unless a more specific reference to such an enzyme is being made.
  • reference to a “complex” or “molecular complex” between a Cas enzyme and a crRNA refers to their specific and proper binding as is present in the targeted form of the Cas enzyme, with its guide RNA or crRNA loaded properly.
  • the “target” or “primary target” or “specific target” of a Cas enzyme refers to the nucleic acid fragment that would specifically bind to the resident guide RNA.
  • the term “tether” or “tethered” refers to any form of chemical conjugation, stable or permanent binding, between one molecule to another molecule.
  • DNA refers generally to not only to the formal meaning of deoxyribonucleic acid, but also, in contexts where it would makes sense, to the well-known nucleic acid analogs of DNA that are used throughout molecular biology and biotechnology, such as RNA, or RNA or DNA comprising modifications such as bases having chemical modifications, such as addition of conjugation groups at the 5’ or 3’ termini or on internal bases, or which includes nucleic acids analogues, such as peptide nucleic acid (PNA) or locked nucleic acid (LNA).
  • PNA peptide nucleic acid
  • LNA locked nucleic acid
  • hybridization or “DNA hybridization” refer to the process by which a single stranded segment of DNA in solution pairs with its reverse complement sequence to form a duplex molecule via Watson-Crick base pairing, forming a double helical segment. It is understood here this includes the cases of DNA-RNA pairs forming, RNA-RNA pairs forming, and that such DNA could also include modified bases or nucleic acid analogs such as PNA or LNA.
  • the terms “complement,” “match,” “exact match,” and “reverse complement,” in relation to a given segment of single stranded DNA or RNA all refer to another single strand of DNA or RNA that will hybridize properly with this strand to form a duplex with Watson-Crick base pairings (and base pairing U-A in the case of RNA-DNA or RNA-RNA pairings, in view that RNA has uracil (U) instead of thymine (T)) for the segment of interest.
  • hybridization probe refers to a specific segment of DNA (or RNA) that is to be used to bind a complementary strand of interest.
  • a strand of interest may exist within a sample or complex pool of known or unknown DNA or RNA fragments, or a diverse set of oligonucleotides presented in a solution environment that allows for the hybridization reaction. This term also may refer to the segment that will be anchored in place for exposure to a test sample solution.
  • the hybridization probe may refer to the single molecule of interest, or to a quantity of such molecules that all have the same sequence or different sequences.
  • a hybridization probe in many instances may be a short segment of DNA, in the range of from about 10 to about 100 bases, but in general can be a DNA strand of any length.
  • the hybridization probe may generally refer to a DNA segment for which only a portion of it is used to hybridize to a target of interest, with other portions of the segment serving different purposes, such as spacers, segments comprising conjugation sites, segments intended to hybridize to other distinct targets, segments intended to bind DNA primers, or sites for binding of decoding probes use to produce location maps for sensor arrays on a chip, including segments that are sites for hybridization to targets that are decoding probes comprising DNA hybridization oligonucleotides, including such oligonucleotides used for combinatorial decoding, wherein oligonucleotides may be labelled or unlabeled with additional signaling groups to aid in decoding of sensor arrays.
  • the primers for extension assays are also a type of hybridization probe, and in contexts where it makes sense, hybridization probe can be taken to include such primers as well.
  • the term “decoding probe” generally refers to any molecule whose binding and subsequent detection is used in a process of constructing a sensor map of where hybridization probes for different targets are located on a sensor pixel array. In this context, it is assumed there are a multiplicity of different types of DNA hybridization probes, having different target DNA as defined by the probe sequences, and that molecules of these types have been randomly assembled into a sensor pixel array, or otherwise placed in such a way that their location in the pixel array is unknown.
  • each hybridization probe is assumed to have physically linked or connected to it, one or more binding sites configured to bind to one or more of the decoding probe molecules.
  • the series of decoded probes are applied to such an array in series or in pooled form, allowed to bind to their specific targets on the hybridization probes, and the bound state is read out using the detectable signal generated by the binding probes.
  • binding probes are single stranded DNA oligonucleotide hybridization probes, with hybridization targets on or linked to the DNA hybridization probes on the array.
  • the detectable signal in decoding is the electrical hybridization signal measurable by the sensor.
  • dye labels on such probes can be read out with an optical microscope imaging system.
  • hybridization target means DNA or RNA molecules which contain an oligonucleotide sequence complementary to a sequence on a DNA hybridization probe.
  • Such a target could be the exact complementary strand to a hybridization probe, but in most cases the target will be a longer oligonucleotide strand that contains only a segment that is exactly complementary to the probe.
  • molecules may match to the probe except at one or more bases.
  • a “perfect match” means a target sequence that correctly hybridizes to the probe sequence with no mis-paired bases, while a “mismatch” refers to a sequence that may bind to the probe sequence, but which has one or more mis-paired bases, i.e., bases not engaged in the standard Watson-Crick pairing found in natural double helix DNA-DNA or double helix DNA-RNA pairings.
  • a hybridization target comprises a segment of the genome from a pathogen, such as a short RNA segment from the SARS-CoV-2 genome, or from an Influenza A or Influenza B strain genome.
  • a sample for testing may be in a solid or liquid physical form, and may also be packaged in some form of container, such as a tube, and/or reside in or on a carrier medium such as a swab or filter paper.
  • a sample may comprise animal or other tissue, cells, bodily fluids, excrement, food products, portions of plants, or any materials collected by a swab, an air filter or a water filter. Such samples may also be stably maintained with some form of preservative or stabilizing agents.
  • sample or bio-sample may refer to a material in its state as initially collected, or materials that have undergone various process steps, such as to extract or amplify DNA or RNA present, prior to being in a form suitable for introduction to a sensor device for analysis.
  • pathogen refers to any disease-causing agent that has a genome, such as parasites, fungi, viruses, or bacteria, or other single or multicellular organisms that cause disease.
  • strain refers to genetic variants within a species, i.e., members of the same species that have genomes that differ in sequence.
  • the term “molecular electronics” refers to electronic devices in which a single molecule or a single molecular complex is integrated as a component in an electronic circuit.
  • the term “molecular electronics sensor” refers to a device that transduces molecular interactions into electronic signals, such as by using a single molecule or molecular complex integrated into an electrical circuit as the primary transduction mechanism and wherein the molecular interactions occur between the single molecule or molecular complex and target molecules provided in solution.
  • the term “molecular complex” refers to an assemblage of a small number of molecules, such as only two, held together by chemical conjugation, bioconjugation, or covalent or non- covalent bonds, such that the assembly retains an assembled configuration or affiliation during a process of incorporating the molecular complex into an electrical circuit to provide a sensor, and during use of the resulting sensor in assays.
  • a small assemblage of molecules may comprise just two molecules, such as a DNA oligonucleotide hybridization probe chemically bound to a bridge molecule.
  • a molecular complex may comprise a crRNA molecule conjugated to a bridge molecule, such as a polypeptide.
  • a molecular complex for use in a molecular electronics sensor may comprise from 2 to 10, from 10 to 100, or from 100 to 1000 molecules in the complex.
  • the term “nanoelectrode” refers to an electrically conducting element having dimensions such as height, width and length of nanometer scale.
  • a length of a nanoelectrode may be substantially greater than both the height and width of the nanoelectrode such that an end portion of each nanoelectrode can be connected into a circuit.
  • nanoelectrodes are disposed in pairs, wherein in each pair of nanoelectrodes a first nanoelectrode and a second nanoelectrode are spaced-apart by a nanoscale gap referred to as a nanogap.
  • a nanoelectrode herein may comprise a metal such as Ag, Al, Au, Cr, Cu, Ni, Ga, Ti, Pt, Pd, Rb, Rh, Ru, or an alloy of these metals.
  • a contact may be disposed on a nanoelectrode, and the contact may be the same material as the nanoelectrode or a different material.
  • nanoelectrodes comprising Pt may each further comprise an Au nanoscale island in the form of nanopillars disposed at an end of the nanoelectrode.
  • bridge or “bridge molecule” refers to a molecular wire or other electrically conducting molecule than may be used to make a conducting connection across a gap between spaced-apart nanoelectrodes in a pair of electrodes.
  • Such molecules that function as bridges include, but are not limited to, double stranded DNA, peptide alpha helices, polypeptides having particular amino acid sequences, graphene nanoribbons, pilin filaments or bacterial nanowires, other multichain proteins or conjugates of multiple single-chain proteins, antibodies, carbon nanotubes e.g., single-walled carbon nanotubes (CNTs, SWCNTs), semiconductor layers such as transition metal dichalcogenides (TMD) or other semiconductor nanoribbons or nanowires, or conducting polymers such as polythiophene, poly(3,4- ethylenedioxythiophene (PEDOT) or other synthetic electrically conducting polymers.
  • CNTs single-walled carbon nanotubes
  • SWCNTs single-walled carbon nanotubes
  • TMD transition metal dichalcogenides
  • conducting polymers such as polythiophene, poly(3,4- ethylenedioxythiophene (PEDOT) or other synthetic electrically conducting polymers.
  • Such molecules may include attachment groups, i.e., functionality that provide for specific attachment to, and/or self- assembly to, nanoelectrodes or contacts such as islands or deposits thereon.
  • polymerase refers broadly to any of the enzymes that can synthesize DNA or RNA segments, of length one or more bases, starting from primed DNA or RNA templates.
  • allele refers to a variant forms of a particular DNA segment that occur within in a species. This is a well-known term from genetics.
  • locus refers to a segment or location in the genome having multiple alleles, i.e., multiple different sequence variants that may be observed within a species.
  • allele specific primer binding refers to the situation where there are a given set of two or more possible alleles at a given locus, and there is a primer that properly binds one of the alleles, and has a mis-match of its 3’ end at the similar sequence sites of all of the other alleles.
  • the allele specific primer may have more mismatches than at its 3’ end, but the 3’ end mismatch is the essential one in this context.
  • allele specific extension refers to the situation where a polymerase extension is performed when priming is done with an allele specific primer, so that extension will only occur on a template that has the allele specifically matching the primer. Allele specific extension in particular refers to processes that rely on the mismatch at the 3’ end of the primer for specificity.
  • chip refers to a semiconductor chip or a CMOS chip.
  • primer sensor or “primer extension sensor” refers to a molecular electronic sensor, with a primer attached to the bridge, suitable for performing primer extension detection.
  • the term “signal group” or “signal enhancing group” refers to a chemical group that could be added to an oligonucleotide, such that the presence of this group complexed into a probe- bridge complex, versus dissociation from this complex, produces a detectable signal. In particular, such a group may be displaced from the critical position by target probe binding, or may be brought into proximity as a label on the target strand.
  • the term “primer probe” refers to a primer that is, or is intended to be, attached to a bridge in a molecular electronics sensor.
  • template refers to a single stranded DNA that is to be used as the substrate for a polymerase extension reaction. It may refer in context to the entire physical strand, or the portion of the strand that directly engages in primer binding and extension.
  • primer binding means the hybridization of a primer to its target site on a template DNA.
  • the term “sensor” refers to a molecular electronics complex comprising a pair of nanoelectrodes, a bridge molecule and a hybridization probe conjugated to the bridge molecule, which is the primary transducer of interactions of the hybridization probes to electrical signals. In contexts where it makes sense, a sensor can also refer to this basic configuration plus the supporting current measurement circuitry, such as including the pixel circuits.
  • “Sensor pixel” refers to the pixel circuitry that provides measurements to a particular sensor.
  • each sensor comprises a first nanoelectrode and a second nanoelectrode spaced-apart from the first nanoelectrode by a nanogap, and wherein a bridge molecule electrically connects the first and second nanoelectrodes together and bridges over the nanogap, and wherein at least one DNA or RNA hybridization probe is conjugated to a specific site along the bridge molecule.
  • the term “pixel” refers to a sensor circuit and/or a measurement circuit that is repeated throughout an array of such identical circuits disposed on a chip.
  • a pixel may in context refer to just a measurement circuit, such as an electrical current meter measuring circuit, or may also include a sensor transducer element or elements affiliated with the circuit, which here are the molecular electronic components, i.e., molecules attached to nanoelectrodes.
  • a pixel may comprise at least one sensor, wherein each sensor comprises first and second nanoelectrodes separated by a nanogap and a bridge molecule bridging the gap and conjugated to at least one hybridization probe.
  • a pixel may comprise only one sensor circuit, i.e., only one pair of electrodes with its associated bridging molecular complex.
  • a pixel may comprise more than one molecular sensor, even a plurality of sensors.
  • the term “measurement pixel” as used herein refers to a measurement circuitry of the pixel
  • the term “sensor pixel” refers to a pixel circuit affiliated with a given sensor element. The origins of this term come from image sensors, where such pixels contain light sensing elements and measurement circuitry for capturing an element of a picture.
  • the term pixel is unrelated to light sensing or imaging, but rather the pixels disclosed herein are configured for sensing chemical interactions rather than light.
  • a plurality of sensors are configured in an array of sensor pixels on a chip, such as a CMOS chip.
  • s single molecule molecular electronic sensor comprises a CRISPR Cas enzyme.
  • the guide RNA or crRNA for the Cas enzyme is tethered into the molecular circuit, and the Cas enzyme itself is then conjugated into the circuit by complexing with the crRNA.
  • the resulting complex, CRISPR Cas enzyme/crRNA (occasionally referred to as the “targeted complex”) is capable of binding a target molecule.
  • the Cas enzyme itself is modified so as to allow it to be directly conjugated into the sensor circuit, and the required guide RNA or crRNA is allowed to complex with the “wired-in” Cas enzyme to form the targeted complex.
  • methods are described for using CRISPR Cas sensor configurations to detect target DNA or RNA molecules, via molecular electronics measurements in the sensor circuit, such as changes in a measured electrical parameter of the sensor circuit.
  • a CMOS sensor array chip is disclosed that comprises an array of CRISPR Cas molecular electronic sensors, providing for a scalable deployment of sensors with suitable control and readout out capabilities.
  • sensor array chips comprise multiplex CRISPR Cas sensors, that target distinct DNA or RNA targets.
  • the present disclosure also describes various methods to map the locations of distinct sensors on a chip array, including methods comprising directed assembly or methods of decoding distinct sensor locations resulting from a more randomized assembly of molecular sensors.
  • a CMOS chip Cas sensor array in accordance with the present disclosure is used to perform multiplex assays for the detection of multiple nucleic acid targets.
  • methods are described for using such assays to detect viral genetic material targets, including the SARS-CoV-2 virus responsible for COVID-19.
  • a CRISPR Cas sensor array specifically detects the tags (directly from their release, or subsequent to an amplification reaction such as isothermal PCR, or other forms of PCR, which amplify the reporter tags for more sensitive detection).
  • a virus as a pathogen of interest such as influenza, flu viruses, cold viruses—including rhinovirus, adenovirus, and human corona virus, HIV, Ebola, SARS, MERS, and COVID-19, and novel viruses of DNA or RNA type related to or unrelated to these.
  • a virus as a pathogen of interest such as influenza, flu viruses, cold viruses—including rhinovirus, adenovirus, and human corona virus, HIV, Ebola, SARS, MERS, and COVID-19
  • novel viruses of DNA or RNA type related to or unrelated to these such as influenza, flu viruses, cold viruses—including rhinovirus, adenovirus, and human corona virus, HIV, Ebola, SARS, MERS, and COVID-19
  • novel viruses of DNA or RNA type related to or unrelated to these such as influenza, flu viruses, cold viruses—including rhinovirus, adenovirus, and human corona virus, HIV, Ebola, SARS, MERS, and COVID-19
  • CRISPR immune response enzymes have been adapted in vitro for use in genome editing and gene therapy and in diagnostics based on detection of specific nucleic acids.
  • the targeted cutting action of Cas9 and Cas12 can be used to target the destruction of unwanted genes, or to excise genes or loci for subsequent replacement through homologous recombination processes.
  • the triggering of generic cutting activity in Cas12, Cas13, or Cas14 after encountering their target can be used to construct a fluorescent reporter system for the primary specific target DNA or RNA detection event.
  • CRISPR diagnostic strategy is known as DETECTR (DNA endonuclease-targeted CRISPR trans reporter).
  • SHERLOCK specific high-sensitivity enzymatic reporter unlocking.
  • these systems can be further extended to detect non-DNA or RNA targets, such as small molecule targets of interest, by having such targets trigger the production or release of a suitable DNA or RNA target detectible by a corresponding targeted Cas enzyme by the above means.
  • a contrivance is made whereby a small molecule target causes an associated bacterial allosteric Transcription Factor (aTF), that is pre-complexed with a synthetic DNA fragment, to release this fragment as the target of a Cas12 enzyme, thereby triggering the previous reporter mechanism.
  • aTF bacterial allosteric Transcription Factor
  • This latter system is known as CaT-SMelor (CRISPR-Cas12a and aTF mediated small molecule detector).
  • a contrivance is made whereby a small molecule target engages with an aTF that is blocking the transcription by an RNA polymerase, causing the aTF to disengage, to trigger transcription of an RNA that is the target of a Cas13 enzyme, and thereby triggering the previous reporter mechanism.
  • SHERLOCK-based profiling of in vitro transcription SPRINT.
  • CRISPR detection can be extended to small molecules, and potentially to other classes of non- DNA/RNA targets suitable for similar contrivances.
  • SPRINT in vitro transcription
  • the technological foundation for the systems, devices and methods herein is molecular electronics. This is a general field of technology in which a single molecule is incorporated as a component within an electrical circuit, where the single molecule performs some useful electrical function such as transducing chemical or molecular events (such as binding/hybridization events) into an electrical signal. Such devices may be particularly powerful as biosensors.
  • molecular electronics sensors are formed by conjugating a molecular bridge between nanoelectrodes, applying a voltage, and measuring the resulting current, with the current vs. time trace then being the primary sensor signal output.
  • the bridge molecule may be, or may comprise, any type of molecular wire.
  • an electrically conductive bridge molecule may comprise a protein alpha helix, a double stranded DNA segment (an oligonucleotide), or a polymer, such as a synthetic graphene nanoribbon.
  • the bridge molecule is configured with suitable conjugation groups that allow it to bind to each of the nanoelectrodes to bridge the nanogap between electrodes.
  • suitable conjugation groups are known for binding molecules to metal electrodes, including use of a metal binding peptide, or a thiol, amine, carbene, or diazonium group.
  • the electrode surface may be functionalized with molecules exposing a conjugation group, and in this case, various conjugation pairs can be used, with one as the head group and the cognate partner configured on the bridge molecule.
  • a CRISPR Cas enzyme may be coupled in a sensor circuit.
  • a CRISPR Cas enzyme may be coupled in a sensor circuit and a crRNA complexed to the CRISPR Cas enzyme.
  • a crRNA molecule may be coupled in a sensor circuit and a CRISPR Cas enzyme complexed to the crRNA.
  • a complex comprising a CRISPR Cas enzyme and crRNA is coupled in a sensor circuit.
  • a first electrode 601 and a second electrode 602 are disposed on a common substrate 604, and are separated by a nanogap having nanoscale dimensions.
  • a single molecule 605 is electrically coupled to the spaced-apart electrodes, such as by bonding one end of the molecule to the first electrode via conjugation 606 and bonding the other end of the molecule to the second electrode 602 via the conjugation 607. In this way, the single molecule forms a bridge spanning over the nanogap.
  • the conjugations 606/607 are described in more detail herein, and may comprise thiol-metal bonding or peptide binding domains having an affinity to a particular metal.
  • the electrode pair 601/602 may comprise positive/negative electrodes, or source/drain electrodes.
  • FIG.6 Further illustrated in FIG.6 are various circuit wiring, where a surrounding circuit 608 is used to apply a voltage V across the electrodes, and a surrounding circuit 609 to measure the current I flowing through the electrodes and the single molecule bridge over time.
  • a surrounding circuit 608 is used to apply a voltage V across the electrodes
  • a surrounding circuit 609 to measure the current I flowing through the electrodes and the single molecule bridge over time.
  • the interactive molecular events may be transduced into signals or detectible signatures 612 seen in the measured current versus time trace 610.
  • the resulting system has the potential to be used as a sensor for a great variety of molecular interaction processes.
  • the scale of the nanogap between electrodes is generally determined and fixed based on the length of the bridge molecule 605 of interest.
  • the bridge molecule 605 is a sterically large enzyme molecule
  • the nanogap may be wide enough to accommodate the enzyme, recognizing that the enzyme may reside above the electrodes.
  • molecular electronic devices readily scale to the smallest possible dimensions for electrical circuits—the scale of molecules.
  • Molecular electronics therefore offers the potential to make semiconductor chip-based, all-electronic sensor devices that are both maximally scalable and maximally sensitive, with single molecule detection capabilities. This is an emerging field of technology, with much promise, but it remains challenging both to devise and to fabricate such systems that actually perform applications of interest.
  • first and second electrodes in an electrode pairs are labeled with numbers ending in “01” and “02,” the underlying substrate on which the electrodes are disposed is labeled with a number ending in “04,” the nanogap spacing between electrodes is labeled with a number ending in “03,” the bridge molecule (or arm molecules) is labeled with a number ending in “05, and an enzyme is labeled with a number ending in “14.”
  • FIGS. 7 and 8 illustrate preferred embodiments of sensors configured with enzymes coupled into sensor circuits with a single bridge molecule or with two arm molecules to couple the enzyme to each of the electrodes.
  • the enzyme 714 is conjugated to the bridge molecule 705 that spans the nanogap 703 between electrodes 701 and 702.
  • a target molecule 720 is shown poised (in solution) to interact with the bound enzyme 714.
  • the conjugation 715 between the bridge molecule 705 and the enzyme 714 may comprise a covalent bond between an atom of the enzyme 714 and an atom of the bridge molecule 705, or there may be any number of intervening atoms, such as comprising a linker, which might be the result of click-chemistry bonding between the two molecules.
  • the sensor detects the interaction of the target molecule 720 with the enzyme 714, with the detection of the interaction comprising the change in current 712 in the current-time trace 710.
  • FIG.8 illustrates another embodiment of a molecular electronics sensor comprising an enzyme molecule 814 coupled into the sensor circuit by two separate arm molecules, a first arm molecule 805a and a second arm molecule 805b.
  • the first arm molecule 805a is bonded to a first distinct site on the enzyme 814 via conjugation 806a
  • the second arm molecule 805b is bonded to a second distinct site of the enzyme 814 via conjugation 807b.
  • the current must flow through a conduction pathway in the enzyme 814 between the two distinct sites.
  • FIGS. 9 and 10 illustrate various embodiments for forming a molecular electronic sensor configured to detect enzymatic activity of a CRISPR Cas enzyme.
  • FIG.9 a crRNA molecule 920 for the Cas enzyme 914 is tethered to the bridge molecule 905 via conjugation 908. Further as illustrated, the bridge molecule 905 is coupled at either end to spaced-apart electrode 901/902 via the bridge molecule-metal conjugations 906a and 906b.
  • FIG.10 illustrates the complete sensor structure, obtained by allowing the Cas enzyme 914 (FIG. 9) to complex with the guide RNA 920 (FIG. 9) to produce the molecular complex comprising Cas enzyme 1014/crRNA 1020 (FIG. 10).
  • coupling between enzyme and RNA may comprise the native complexing for these molecules, or in other embodiments, this CRISPR Cas enzyme/crRNA complex (1014/1020) may be further conjugated in place, such as to make the attachment of the enzyme stronger or even permanent.
  • this conjugation beyond the native coupling may be obtained by making suitable conjugation group modifications to the enzyme and crRNA and then carrying out the corresponding conjugation reaction.
  • a click-chemistry reaction could be provided between sites modified on the crRNA and the enzyme to have click reaction functional groups.
  • a CRISPR Cas sensor such as illustrated in FIG. 10 may then be exposed to a solution containing various nucleic acids, such as shown in FIG.11.
  • the molecular electronics sensor comprises a molecular complex comprising Cas enzyme 1114 and crRNA 1120 coupled together, with the complex secured to the bridge molecule 1105 via the conjugation 1108 between the crRNA 1120 and the bridge molecule 1105.
  • a solution comprising various nucleic acids 1140a, b, c, d, e... and so forth may be provided to the sensor, as illustrated in FIG.11.
  • the molecular electronics sensor configured with a CRISPR Cas enzyme 1214/crRNA 1220 complex, is provided with an applied voltage 1208 and current measurement circuit 1209 to form the active sensor.
  • a measurable electrical parameter is monitored over time, as shown in the current-time trace 1212, wherein a baseline signal 1212a represents no molecular interactions between target 1240 and crRNA 1220.
  • a baseline signal 1212a represents no molecular interactions between target 1240 and crRNA 1220.
  • the current signal trace shows various perturbations or a signature that corresponds to the Cas binding and processing (e.g., cutting) of its target 1240.
  • Such a signal may, in various embodiments, comprise features such as a transient perturbations 1212b, or more of an enduring change 1212c, such as a change in the baseline current level, or in the level of fluctuation.
  • a molecular electronics sensor may be configured with a type of CRISPR Cas enzyme 1314 capable of being activated with a nonspecific nuclease activity (shown by the U-turn block arrow and the nuclease activity acting on target 1380a) as a result of binding its specific target 1345.
  • CRISPR Cas enzyme having this capability include Cas12, Cas13 and Cas14.
  • a sample solution contains a supply of the substrate 1345 required to turn-on this nonspecific activity.
  • the activated Cas enzyme 1314 will subsequently nuclease these substrates 1380a, 1380b, 1380c, etc., and in various embodiments, these events produce current signatures 1312a, 1312b, 1312c, etc., on their own as seen in the current-time trace 1312. In various embodiments, there is ample supply of this substrate 1380a, 1380b, 1380c, etc. in solution, such that multiple such nuclease reactions occur, generating the series of current perturbations 1312a, 1312b, 1312c, etc.
  • the sensor provides for detection of the primary specific target 1345 of the CRISPR Cas enzyme 1314, as defined by the specific recognition sequence of the crRNA 1320. It is an advantage of this embodiment that the series of signal perturbations 1312a, 1312b, 1312c, etc.
  • Suitable substrates for the nuclease activity depicted in FIG.13 exclude Cas 9, which does not have such an activity.
  • the substrates for the non-specific nuclease activity could be single stranded DNA fragments in solution, and in various embodiments, a concentration of just one such type of single-stranded DNA.
  • the substrates for the non-specific activity could be single stranded RNA, and in various embodiments, a concentration of just one such type of single-stranded RNA.
  • molecular electronics sensors configured with CRISPR Cas enzymes feature the crRNA tethered to the bridge molecule at a single site on the crRNA, such as at one end of oligonucleotide sequence.
  • the crRNA molecule could be tethered to the bridge molecule in many differ configurations, some of which may be easier and more reliably constructed, or that provide better performance of the sensor.
  • the crRNA 1420 is tethered to the bridge molecule 1405 from a site internal to the crRNA strand, through conjugation 1408, rather than at its end.
  • the crRNA 1420 may be tethered such that a region of the crRNA 1420, and/or the conjugation 1408, may be left exposed once the CRISPR Cas enzyme 1414 has been complexed to the crRNA 1420.
  • the conjugation 1408 (the “tether point”) left relatively exposed reduces or eliminates steric hindrance that may interfere with complexing with the Cas enzyme, or with the function of the enzyme.
  • the conjugation 1508 could be at a point in the “knot” feature of the complexed crRNA 1420 that is a loop that is relatively exposed and outside of the interior of the Cas enzyme 1514.
  • such loops in the crRNA may already be present naturally as secondary structure, or may be added synthetically as an additional feature of the crRNA (for example, the extended loop of the sgRNA construct commonly used for Cas 9, which was an artificial feature added in the design of the sgRNA).
  • desirable tethering points may be chosen by first examining the crystal structure of the CRISPR Cas enzyme/crRNA complex and selecting points on the crRNA molecule that are accessible for conjugation of the crRNA to a bridge molecule.
  • FIG.15 An example of a complete sensor is illustrated in FIG.15, wherein the crRNA 1520 is conjugated from a knot feature to the bridge molecule 1505 via the conjugation 1508, and wherein the CRISPR Cas enzyme 1514 is complexed to the crRNA 1520 to form the CRISPR Cas enzyme/crRNA molecular complex 1535.
  • a portion of the crRNA 1520 will reside outside of the interior of the Cas enzyme 1514.
  • conjugation between crRNA and a bridge molecule may comprise a single conjugation point of the crRNA to the bridge, by a click chemistry group, an NHS ester conjugation, or other methods where the conjugation partners are synthetically placed in both the crRNA and bridge molecule.
  • the conjugation between crRNA and bridge molecule may comprise a bifunctional linker/spacer that is long enough to further eliminate unwanted steric hinderances, the ends of which attach respectively to the crRNA and bridge molecule.
  • a crRNA molecule 1620 may be conjugated to a single site 1608 on the bridge molecule 1605 via a bifunctional linker 1622 that connects between an end of the crRNA 1620 and the single site 1608 on the bridge 1605.
  • the CRISPR Cas enzyme 1714 is distanced from the bridge molecule 1705 when complexed with the crRNA 1720.
  • linker/spacers are known and widely used in conjugations, and may comprise, for example, a C6, C12 or even longer carbon chain, a PEG chain, such as PEG2 or PEG4 or longer, or a peptide or single-stranded DNA oligonucleotide segment, or many other linker/spacers known in bioconjugation.
  • the bifunctional conjugation groups on the ends of the linker 1722 may comprise click chemistry groups or other reactive functional groups.
  • the crRNA may be tethered at or near one of its termini (i.e., the 5’ or 3’ end), optionally with a bifunctional linker to reduce or eliminate steric hindrance that may interfere with the complexing between tethered crRNA and the Cas enzyme, or with the function of the enzyme.
  • the RNA chain may be extended with additional RNA or DNA bases, such as a poly-U or poly-T linker of any desired length.
  • the crRNA 1820 may be tethered from a site between its 3” and 5” ends to the bridge molecule 1805 through a suitable bifunctional linker 1822.
  • the linker may be conjugated to the bridge molecule 1805 via conjugation 1808.
  • FIG. 19 illustrates the complete sensor wherein the CRISPR Cas enzyme 1914 is complexed to the crRNA 1920 to form the molecular complex 1935 that is spaced from the bridge molecule 1905.
  • FIGS. 20 and 21 illustrate embodiments of molecular electronics sensors in which the crRNA is tethered at or near both of its termini (i.e., both of the 5’ and 3’ ends), optionally with linkers, and optionally with other molecular wires, as shown, so as to form a bridge element that spans the nanoelectrodes. In this way the crRNA strand is included in the primary conductive path between electrodes.
  • a CRISPR Cas enzyme/crRNA complex wired directly into the current path, formation of a duplex between the target nucleic acid and the recognition segment of the crRNA (e.g., DNA duplex, or DNA:RNA duplex) will cause an increase in the conductivity through the molecular complex, as it is known that duplex structures are much more conductive than single stranded RNA. Therefore, upon binding to its target, this duplex formation may cause a lager jump in conductivity, and therefore a larger and more easily detectible current trace signature.
  • a crRNA molecule 2020 is directly wired into the current path of the sensor, bridging the spaced-apart nanoelectrodes 2001 and 2002.
  • the crRNA 2020 may be conjugated to each of the electrodes via arm molecules 2005a/2005b, with or without bifunctional linker molecules 2022a and 2022b.
  • the linkers 2022a and 2022b may comprise base extensions from the crRNA 2020, such as poly-U or poly-T segments.
  • Arm molecules 2005a and 2005b may comprise, for example, peptide molecules (e.g., having at least some alpha-helical content for conductivity), synthetic polymers, single stranded DNA, or double stranded DNA.
  • FIG. 21 illustrates the completed sensor structure wherein the CRISPR Cas enzyme 2114 is complexed to the crRNA 2120 wired into the sensor circuit to produce the CRISPR Cas enzyme/crRNA molecular complex 2135 that is, by virtue of the crRNA wiring, it wired into the sensor circuit.
  • FIGS.22 and 23 illustrate various embodiments of sensor structures in which the crRNA 2220 is tethered at two points internal to the length of the crRNA strand, with optional linkers and molecular wires completing the connections to the nanoelectrodes, and again wiring the segment of the crRNA between the tether points directly into the current path between nanoelectrodes.
  • the internal tether points and linkers may be chosen to reduce steric hinderance that interferes with the complexing of the CRISPR Cas enzyme and the crRNA or with the function of the Cas enzyme.
  • one or both of the tether points may be placed at or near the ends of the recognition segment of the crRNA, so that when this segment forms a duplex with the target, the duplex is a more substantial fraction of the current path between electrodes, and therefore, as this segment is more conductive post-duplex formation, this configuration may result in a larger increase in current for easier detection of the target binding.
  • a complete molecular electronics sensor is illustrated in FIG. 23, wherein the crRNA, wired into the circuit such that the recognition segment provides most of the wired-in portion, is complexed with the CRISPR Cas enzyme 2314 to form the CRISPR Cas enzyme/crRNA molecular complex 2335.
  • FIGS. 24 and 25 illustrate various sensor embodiments in which the crRNA is tethered from two distinct points internal to the length of the crRNA to two distinct points 2408a/2408b on the bridge molecule 2405 spanning the nanogap 2403 between nanoelectrodes 2401/2402.
  • the tethers 2422a/2422b may comprise linkers or spacers to avoid steric hinderances to the assembly of the CRISPR Cas enzyme/crRNA complex or Cas enzyme function.
  • This may have the advantage of reducing the degrees of movement freedom in the final construct, since the CRISPR Cas enzyme/crRNA complex (2535 in FIG. 25) is no longer free to rotate around a single conjugation point.
  • the conformation of the overall structure is more constrained, thus reducing unwanted conformational variation that may result in variations in the sensor signal.
  • this may also have the advantage of creating an effective parallel current path (through linkers 2522a/2522b and the duplex thus formed) relative to the current path through the segment of the bridge molecule 2505 disposed between the tether points 2508a/2508b.
  • molecular electronics sensors comprising a molecular complex further comprising a CRISPR Cas enzyme and crRNA molecule are formed by tethering the Cas enzyme, rather than the crRNA, into the sensor circuit, as discussed below in reference to the following drawing figures.
  • FIGS.26 and 27 illustrate various embodiments of molecular electronics sensors in which the CRISPR Cas enzyme is tethered to the bridge molecule at a single distinct site on the bridge molecule.
  • the Cas enzyme 2614 may be tethered to a specific site on the bridge molecule 2605 using various methods of conjugation 2608, with the conjugation 2608 including, for example, a linker or spacer configured with reactive functionality at either end so as to distance the Cas enzyme 2614 from the bridge molecule 2605.
  • Such methods of conjugation may include, for example, click chemistries, N-hydroxysuccinimide (NHS) ester conjugation, 3-arylpropiolonitrile (APN) cysteine conjugation or maleimide-cysteine conjugation, or Spy-Tag/Spy-Catcher ligation, wherein one of the conjugation partners is provided on the CRISPR Cas enzyme, e.g., through chemical or genetic modification of the amino acid sequence, and the other conjugation partner provided on the bridge molecule, through synthetic chemistry or genetic modification (in the case of a peptide or protein bridge).
  • NHS N-hydroxysuccinimide
  • API 3-arylpropiolonitrile
  • cysteine conjugation or maleimide-cysteine conjugation or maleimide-cysteine conjugation
  • Spy-Tag/Spy-Catcher ligation wherein one of the conjugation partners is provided on the CRISPR Cas enzyme, e.g., through chemical or genetic modification of the amino acid sequence, and the
  • Such bifunctional linkers may include APN-Linker-BCN (bicyclo[6.1.0]nonyne) bifunctional linkers, which can be used to link a thiol group to an azide group, where the thiol and azide being conjugated may reside, respectively, in either the Cas enzyme or bridge molecule.
  • APN-Linker-BCN bicyclo[6.1.0]nonyne
  • the Cas enzyme in order to conjugate the Cas enzyme 2614 to the bridge molecule 2605, may be modified to include a cysteine at a desired conjugation site on the enzyme, and cysteine-APN or cysteine-maleimide conjugation may then be used to attach the Cas enzyme 2614 to the bridge molecule 2605, either directly with the APN or maleimide functionality on the bridge, or with an additional bifunctional linker.
  • a cysteine in the CRISPR Cas enzyme 2614 is functionalized with an APN-BCN, and this in turn is conjugated to an azide group engineered into the bridge molecule 2605.
  • an aldehyde tag peptide motif can be genetically engineered into the Cas enzyme 2614 and used with known aldehyde tag conjugation methods.
  • a nonstandard amino acid (NAA) may be genetically or synthetically engineered into Cas enzyme 2614 at a specific site on the enzyme, providing on it a residue suitable for a conjugation reaction.
  • the tethering site on the Cas enzyme 2614 is selected by consideration of the crystal structure of the CRISPR Cas enzyme/crRNA complex and selecting points that would not create steric hinderance to the formation of the Cas-Bridge conjugation 2608, or of the crRNA complexing in place, or the enzymatic activity of the resulting CRISPR Cas enzyme/crRNA complex.
  • FIG. 27 illustrates a completed sensor obtained by complexing the crRNA (2620 in FIG. 26) to the bound CRISPR Cas enzyme (2614 in FIG. 26) previously conjugated via conjugation 2608 to the bridge molecule 2605. The result as shown in FIG.
  • the CRISPR Cas enzyme 2814 may be coupled to both the first and second electrodes 2801/2802 with intervening arm molecules 2805a/2805b. Each of the arm molecules may comprise a peptide.
  • first electrode 2801 is spaced-apart by nanogap 2803 from second electrode 2802, wherein both first and second electrodes are disposed on the same substrate 2804.
  • a first arm molecule 2805a comprising a first end and a second end is used to couple one distinct site 2807a on the enzyme 2814 to the first electrode 2801.
  • the first arm molecule is coupled to the first electrode 2801 via conjugation 2806a that may comprise, for example, SH-metal bonding or material binding peptide- metal binding.
  • the second arm molecule 2805b has first and second ends, the first end conjugated to a distinct site 2807b on the enzyme 2814 and the second end coupled to the second electrode 2802.
  • the CRISPR Cas enzyme 2814 is directly wired into the conductive pathway, wherein the conductive pathway runs through the first arm molecule 2805a, through a portion of the Cas enzyme between the two distinct sites 2807a/2807b, and through the second arm molecule 2805b.
  • a crRNA molecule 2820 is provided in solution to complex with the bound enzyme. The result is illustrated in FIG. 29.
  • the complete sensor comprises the crRNA 2920 complexed into place in the Cas enzyme 2914 to form a CRISPR Cas enzyme/crRNA complex 2935. This configuration illustrated in FIG.
  • each arm molecule 2905a/2905b to the enzyme 2914 may be by the same general conjugation means as described for the one-point conjugation between the Cas enzyme and bridge molecule (e.g., as illustrated in FIGS.27 and 28).
  • the arm molecules 2905a/2905b may comprise polypeptides in general, or more specifically, alpha-helical proteins that are added via direct genetic engineering to both the N- and C- termini of the Cas protein 2914.
  • a synthetic gene can be made extending the native gene to include additional coding sequences at each end of the gene coding for an alpha helical segment added at the N- and C- terminals of the Cas sequence.
  • each such alpha-helical segments in the arm molecules may comprise repeats of various peptide motifs known to promote stable alpha-helical formation.
  • these additional amino acid sequences emanating from the two distinct sites 2907a/2907b on the Cas enzyme 2914 that make up the arm molecules 2905a/2905b can also include at the distal end of each arm molecule (i.e., the N-terminus of the N-terminus arm, and the C-terminus of the C-terminus arm on the Cas enzyme) a sequence for an amino acid or a peptide that can be used for conjugation of each arm molecule to the metal nanoelectrodes.
  • each arm molecule 2905a/2905b may be conjugated at its end to each of the electrodes 2901/2902 by a thiol-metal bond, dithiol-metal bond, amine-metal bond, carbene-metal bond, or diazonium-metal bond, or other carbon-metal bonds, or the conjugations 2906a/2906b may each comprise a peptide-to-metal binding association.
  • Metal binding peptides may comprise a gold binding peptide (GBP) having the amino acid sequence MHGKTQATSGTIQS (SEQ ID NO: 1).
  • GBP gold binding peptide
  • the metal binding peptide may be repeated in tandem about 2 to about 6 times, separated by short GS rich linkers, so as to ensure a more robust bond between the metal electrode and the peptide arm molecule.
  • a palladium binding peptide may be incorporated at the ends of each arm molecule, having the amino acid sequence QQSWPIS (SEQ ID NO: 2).
  • the conjugations 2906a/2906b between metal electrode and arm molecules may also be achieved by applying a bifunction linker with any of these or other binding groups to attach one end of the arm molecule to the electrode, with a short linker such as a PEG group or other carbon chain about 1 to about 3 nm long, presenting an arbitrary second conjugation group as the head group.
  • a bifunction linker with any of these or other binding groups to attach one end of the arm molecule to the electrode, with a short linker such as a PEG group or other carbon chain about 1 to about 3 nm long, presenting an arbitrary second conjugation group as the head group.
  • the conjugations 2906a/2906b between each arm molecule and each electrode may comprise a click chemistry coupling, such as dibenzocyclooctyne- azide (DBCO-azide) or trans-cyclooctene-azide (TCO-azide), or other non-copper or copper click reactions, an 3-arylpropiolonitrile-thiol (APN-thiol) coupling, an amine-N-hydroxysuccinimide (amine- NHS) ester coupling, a biotin-avidin coupling, a peptide-tag based coupling such as Spy-Tag/Spy-Catcher, or an AviTagTM (GeneCopoeia, Inc.) or an aldehyde tag, with the other cognate partner functionalized onto the electrodes.
  • a click chemistry coupling such as dibenzocyclooctyne- azide (DBCO-azide) or trans-cyclooctene-azide (T
  • a bridge molecule may comprise a peptide, which may further comprise alpha-helical segments, and each end of the bridge molecule may be functionalized as discussed above for arm molecules so that the bridge molecule can be conjugated at a first end to a first electrode and at a second end to a second electrode.
  • the Cas enzyme 3014 is wired directly into the conductive pathway that extends through the arm molecules, wherein the conjugation points 3007a/3007b of each of the arm molecules 3005a/3005b to the two distinct sites on the Cas enzyme are at or near the ends of the recognition segment of the crRNA.
  • this configuration may increase the response of the sensor to the binding of a target to the crRNA recognition segment. The reason is that it is the recognition segment of the crRNA 3020 that forms a duplex with the specific target nucleic acid, and the duplex segment thus formed is a local conductive current path of higher conductivity than any single stranded portion of the crRNA.
  • one of out of multiple possible guide RNA may be the crRNA present in a particular sensor of interest
  • this situation may arise in the case of a devices that contains multiple electrode pairs that have been assembled with sensors, in a fashion that did not otherwise track the identity of the crRNA that was placed with each sensor.
  • a sensor array configured on a chip may comprise a plurality of sensor pixels, and the identity of the particular crRNA molecule in any one pixel may not be certain, depending on how the sensor array was constructed. [00217] As illustrated in FIG.
  • the identity of a crRNA 3120 tethered to a bridge molecule 3105 spanning the nanogap 3103 can be encoded by having an encoding oligomer 3195 (RNA or DNA oligonucleotide) on the end of the primary crRNA 3120 that encodes, via its own unique sequence, the identity of the crRNA 3120 in the particular sensor.
  • this encoding oligonucleotide 3195 may be in the range of about an 8-mer to about a 50-mer, and preferably in the range of about a 10- mer to about a 30-mer.
  • This oligonucleotide segment could include a linker/spacer sequence, such as Poly- U or Poly-T sequence, to space the identity encoding sequence of this oligonucleotide away from the CRISPR Cas enzyme/crRNA complex (3235 in FIG.32) of the finished sensor.
  • linker/spacer sequence such as Poly- U or Poly-T sequence
  • this encoding oligonucleotide 3295 could be read out by exposing the sensor to a solution comprising an oligonucleotide complementary to the encoding oligonucleotide 3295, and using the observed sensor signal (i.e., perturbations in a measurable electrical parameter, such as current) to confirm hybridization between the encoding oligonucleotide 3295 and its complement.
  • this decoding reaction hybridization/signal detection
  • this decoding reaction could be done before complexing the CRISPER Cas enzyme is complexed to the tethered crRNA, as per the transition from FIG.31 to FIG.32.
  • the decoding reaction involving the encoding oligonucleotide can be performed after the CRISPR Cas enzyme/crRNA complex 3435 (FIG.34) is formed.
  • FIG.34 illustrates that the Cas enzyme can be coupled to the bridge molecule first, and then the crRNA molecule bearing the encoding oligonucleotide extension is complexed with the fixed Cas enzyme.
  • the encoding oligonucleotide (3495 in FIG.
  • FIGS.35 and 36 illustrate embodiments wherein the crRNA and the CRISPR Cas enzyme are complexed together prior to assembly to the bridge molecule.
  • FIG. 35 illustrates that the bridge molecule 3505 can be configured with a conjugation site 3508 capable of binding to the CRISPR Cas enzyme/crRNA complex 3535.
  • the CRISPR Cas enzyme/crRNA complex 3535 comprises a crRNA molecule 3520 further comprising an encoding oligonucleotide 3595 as an extension to the crRNA 3520.
  • FIG. 36 illustrates the structure of the completed sensor, wherein the CRISPR Cas enzyme/crRNA complex 3635 is conjugated to the bridge molecule 3605, and wherein the crRNA 3620 comprises an encoding oligonucleotide 3695 for subsequent identity determination via hybridization.
  • the conjugation point 3608 may be on the Cas enzyme or on the crRNA, meaning that either component of the complex 3635 can be bound to the bridge molecule 3605, with the other component complexed to the bound component.
  • FIG. 37 illustrates embodiments of a molecular electronics sensor comprising a CRISPR Cas enzyme/crRNA complex 3735, and the various locations that an encoding oligonucleotide may be attached to the crRNA 3720.
  • the encoding oligonucleotide is attached at the distal end of the crRNA 3720, furthest from the bridge molecule 3705.
  • the encoding oligonucleotide is attached at a location more central along the crRNA 3720 strand.
  • the encoding oligonucleotide is attached at the proximal end of the crRNA 3720, closest to the bridge molecule 3705.
  • the choice of location may be driven by the need to keep the encoding oligonucleotide accessible for hybridization reactions in methods for decoding, and such that the encoding oligonucleotide does not interfere with the complexing of the crRNA to its specific targets or the Cas enzyme function.
  • FIG.38 illustrates additional embodiments showing optional locations of the identity encoding oligonucleotide on the crRNA of the sensor.
  • the encoding oligonucleotide may be attached to either end of the crRNA 3820 (i.e., the 5’ or 3’ end), shown as (C) proximal to the bridge molecule 3805, or distal (A) to the bridge molecule 3805, or conjugated to an internal point (B) on the crRNA molecule 3820, i.e., as a branch.
  • the encoding oligonucleotide may include a linker or spacer to distance the encoding oligonucleotide from the crRNA 3820 and/or the bridge molecule 3805, such as to further avoid steric hindrances.
  • Linkers or spacers may comprise poly-U or poly-T sequences, or any other common linkers/spacers such as a carbon chain or PEG chain.
  • FIGS. 39 and 40 show an embodiment where the crRNA has an identity encoding oligonucleotide attached, and is first wired directly into the current path between the electrodes prior to the complexing of the Cas enzyme to the crRNA (illustrated by the transition from FIG.39 to FIG.40).
  • the crRNA molecule 3920 may be coupled into the sensor circuit by various combinations of arm molecules 3905a/3905b and/or linkers 3922a/3322b.
  • the use of arm molecules and/or linkers distances the crRNA 3920 from the electrodes and leaves access to the encoding oligonucleotide 3995 once the Cas enzyme 3914 (shown in solution) complexes to the crRNA 3920.
  • the encoding oligonucleotide 3995 is located at a site that does not create any steric hinderances with the complexing or enzyme function.
  • the encoding oligonucleotide 3995 can be conjugated within the loop in the “knot” of the crRNA 3920, such that it resides largely outside the CRISPR Cas enzyme/crRNA complex. [00226] FIG.
  • FIGS. 40 illustrates an embodiment of a complete sensor, wherein the CRISPR Cas enzyme 4014 is complexed to the crRNA 4020 to form the CRISPR Cas enzyme/crRNA complex 4035.
  • the encoding oligonucleotide 4095 remains accessible beyond the confines of the CRISPR Cas enzyme/crRNA complex 4035 by virtue of the location on the crRNA 4020 to which the encoding oligonucleotide 4095 is attached.
  • the encoding oligonucleotide 4095 also remains accessible for the various sensor decoding methods by virtue of the spacing provided by the arm molecules 4005a/4005b and/or the linkers 4022a/4022b, as optimized by the lengths of these components. [00227] FIGS.
  • the conjugation used to tether either the Cas enzyme or the crRNA molecule to the bridge molecule of the circuit may vary as desired, and may comprise any of the conjugation options discussed herein.
  • the nature of the bridge molecule is variable in these examples, and may in some examples be illustrated generically as a rod looking structure, or in some examples, more specifically as a helical polypeptide. These examples should not be interpreted as limiting. But rather, these examples are meant to illustrate molecular structural details of various embodiments, and specifically, various details how a Cas enzyme can be oriented relative to the bridge molecule and the pair of nanoelectrodes.
  • FIG. 41 shows an embodiment of a sensor comprising a CRISPR Cas 9 enzyme/crRNA complex 4135 in which the crRNA 4120 is tethered via conjugation 4108 to a bridge molecule 4105 spanning the nanogap 4103 and connecting the pair of nanoelectrodes 4101/4102.
  • the bridge molecule 4105 may comprise an alpha-helical peptide measuring approximately 20 nm in length.
  • the conjugation 4108 is from the bridge molecule 4105 to an internal nucleotide located within the outermost loop portion of the “knot” region of the crRNA 4120. As shown, conjugation to the knot region of the crRNA 4120 reduces steric hinderances since the knot region protrudes from the overall shape of the CRISPR Cas 9 enzyme/crRNA complex 4135.
  • the conjugation 4108 between crRNA 4120 and bridge molecule 4105 may be based on click-chemistry, and may comprise an azide group functionalized into the bridge 4105, and a click-chemistry alkyne group synthesized into the crRNA 4120, which have undergone an alkyne-azide click-chemistry coupling.
  • the electrodes 4101/4102 may comprise a metal, such as gold, palladium, ruthenium, or platinum, and an alpha helical bridge 4105 may include metal binding peptides on each end, or a cysteine containing group, either of which can bind selectively to these metals.
  • FIG. 42 illustrates an embodiment of a sensor comprising a CRISPR Cas 9 enzyme/crRNA complex 4235 in which the crRNA 4220 is tethered by tether 4208 to an alpha-helical peptide bridge 4205, and the tether 4208 is conjugated to the 5’ end of the crRNA 4220.
  • this 5’ tether 4208 includes a short spacer to distance the complex 4235 from the nanoelectrodes 4201/4202 and reduce steric hindrances.
  • the tether 4208 may comprise a poly nucleotide extension of the 5’ end of crRNA 4220, such as a poly-U or a poly-A section of RNA, or a poly-T section of DNA, or any other nucleotide sequence composition of RNA or DNA that provides a linker.
  • the length of the linker 4208 between the bridge molecule 4205 and the 5’ end of the crRNA 4220 is from about 0.5 nm to about 5 nm.
  • FIG.43 illustrates an embodiment of a sensor comprising a CRISPR Cas 12a enzyme/crRNA complex 4335 in which the crRNA 4320 is conjugated via tether 4308 to an alpha-helical peptide bridge molecule 4305, wherein the tether 4308 is conjugated to an internal nucleotide located the outermost loop portion of the “knot” region of the crRNA 4320.
  • the location of the tethering as illustrated reduces steric hinderances.
  • FIG.44 illustrates an embodiment of a sensor comprising a CRISPR Cas 12a enzyme/crRNA complex 4435 in which the crRNA 4420 is conjugated via tether 4408 to an alpha-helical peptide bridge molecule 4405, wherein the tether 4408 is conjugated to the 3’ end of the crRNA 4420.
  • this 3’ tether 4408 includes a linker/spacer of sufficient length to reduce steric hindrances.
  • the length of linker 4408 may be in the range of from about 0.5 nm to about 15 nm.
  • FIG. 45 illustrates an embodiment of a sensor comprising a CRISPR Cas 13 enzyme/crRNA complex 4535 in which the crRNA 4520 is conjugated via tether 4508 to an alpha-helical peptide bridge molecule 4505, wherein the tether 4508 is conjugated to an internal nucleotide located the outermost loop portion of the “knot” region of the crRNA 4520.
  • the location of the tethering provides a sensor configuration wherein steric hinderances are reduced.
  • FIGS. 46 illustrates an embodiment of a sensor comprising a CRISPR Cas 13 enzyme/crRNA complex 4635 in which the crRNA 4620 is conjugated via tether 4608 to an alpha-helical peptide bridge molecule 4605, wherein the tether 4608 is conjugated to the 3’ end of the crRNA 4620.
  • this 3’ tether 4608 includes a linker/spacer of sufficient length to reduce steric hindrances.
  • the length of linker 4408 may be in the range of from about 0.5 nm to about 10 nm.
  • FIG. 47 illustrates an embodiment of a molecular electronics sensor wherein the Cas enzyme 4714 is wired directly into the current path by incorporating two arm molecules 4705a/4705b to couple the Cas enzyme 4714 to each of the two nanoelectrodes 4701/4702.
  • each of the two arm molecules 4705a/4705b are conjugated to each end 4707a/4707b of an alpha-helical segment 4744 internal to the amino acid sequence of the Cas enzyme 4714.
  • the two sites 4707a and 4707b represent two physically distinct sites on the Cas enzyme 4714 such that the portion of the enzyme between the two sites, namely the alpha-helical segment 4744, is forced into being part of the conduction pathway between the electrodes.
  • This configuration with an internal alpha-helix portion being in the electrical conduction pathway, has the advantage of a more conductive connection, allowing for higher currents at a lower applied voltages, which may improve the signal-to-noise ratio of the sensor.
  • alpha-helix- defined conduction pathways internally within enzymes can be used to guide the current carriers close to active sites internal to the enzyme, and thereby increasing the ability for the sensor to acquire more information on the enzymatic activity, and thus improving sensor sensitivity, information content on the signals in the current-time trace representing enzyme function, and/or the signal-to-noise ratio of the sensor.
  • FIG. 48 illustrates an embodiment of a molecular electronics sensor wherein the Cas enzyme 4814 is wired directly into the current pathway by incorporating two arm molecules 4805a/4805b to couple the Cas enzyme 4814 to each of the two nanoelectrodes 4801/4802, wherein each of the two arm molecules 4805a/4805b are conjugated to the ends 4807a/4807b of a linear series of internal alpha-helical segments 4844a/4844b, separated by loops or other short non-helical peptide elements 4844c. Together, the alpha- helical portions 4844a and 4844b, and the interconnecting non-helical portion 4844c, make up a portion of the amino acid sequence of the Cas enzyme 4814.
  • FIG. 49 illustrates an embodiment of a molecular electronics sensor wherein the Cas enzyme 4914 is wired directly into the current path by incorporating two arm molecules 4905a/4905b to couple the Cas enzyme 4914 to each of the two nanoelectrodes 4901/4902.
  • each of the two arm molecules 4905a/4905b are conjugated to each end 4907a/4907b of an internal beta-sheet segment 4944 internal to the amino acid sequence of the Cas enzyme 4914.
  • the two sites 4907a and 4907b represent two physically distinct sites on the Cas enzyme 4914 such that the portion of the enzyme between the two sites, namely the beta-sheet segment 4944, is forced into being part of the conduction pathway between the electrodes.
  • This configuration illustrates how another specific and common protein structural element, in this case, a beta-sheet segment, may improve sensor signals when that internal segment is made an explicit conductive element in the circuit.
  • the Cas enzyme 5014 is effectively wired directly into the current path by virtue of two arm molecules 5005a/5005b conjugated to two distinct sites 5007a/5007b on the crRNA 5020.
  • it is the entire CRISPR Cas enzyme/crRNA complex 5035 that is wired into the sensor circuit, even though the two distinct conjugation sites 5007a/5007b are on the crRNA and the Cas enzyme 5014 is complexed to the wired crRNA 5020.
  • This wiring configuration may be advantageous because the crRNA 5020 will convert from a single- stranded molecule to a more conductive duplex structure when the crRNA hybridizes with its target nucleic acid.
  • FIG. 51 illustrates an embodiment of a molecular electronics sensor wherein the Cas enzyme 5114 is wired directly into the current pathway of the sensor by way of two arm molecules 5105a and 5105b.
  • a first arm molecule 5105a comprises a first end coupled to the first electrode 5101 by conjugation 5106a.
  • the first arm molecule has a second end that is conjugated at or near the N-terminus 5165a of the Cas enzyme amino acid chain.
  • a second arm molecule 5105b comprises a first end coupled to the second electrode 5102 by conjugation 5106b.
  • the second arm molecule has a second end that is conjugated at or near the C-terminus 5165b of the Cas enzyme amino acid chain.
  • Such a wiring configuration forces the current in the sensor circuit through the entire enzyme. This may be advantageous because it encourages current to run throughout the entire enzyme, thereby gathering broad information content about the activity and conformation into the signal.
  • this embodiment is advantageous because, for the case of peptide arm molecules 5105a/5105b, the arms themselves can be genetically engineered into the protein structure, so that a single amino acid chain expressed protein provides the entire construct, i.e., the enzyme and the amino acid sequence extensions off each of the N- and C-termini of the enzyme that comprise the two arm molecules.
  • This provides for extreme simplicity of synthetizing such monomeric or single chain constructs by standard means of genetic engineering and protein expression, as part of the same process used to express the Cas enzyme itself, in contrast to adding arm molecules in additional, complicated, organic chemistry reactions.
  • the arms may be alpha helices, such as a EAAAR (SEQ ID NO: 3) repeat alpha helix or an EEEERRRR (SEQ ID NO: 4) repeat alpha helix, and there may be a short peptide linker at either end, such as the well-known and widely used class of “GS linkers”, such as GSG or GSGSG (SEQ ID NO: 5), and there may be a peptide conjugation group at the N- and C- terminals of these arms, such as a material binding peptide, or a cysteine, or multiple cysteines, or other peptide motifs or proteins that can be used for conjugation, such as Spy-Tag/Spy-Catcher, or an AviTagTM (GeneCopoeia, Inc.) or an aldehyde tag, or amino acids that have click-like conjugation chemistries, such as arginine, histidine, tryptophan, and tyrosine, or peptide or amino acids which
  • FIG. 52 illustrates an embodiment of a molecular electronics sensor wherein the Cas enzyme 5214 is wired directly into the current path by arm molecules 5205a/5205b conjugated to points 5207a/5207b on the enzyme that undergo large relative motions or separation changes (indicated by “(C)”) as part of the conformational changes occurring during enzyme activity.
  • the inset in FIG. 52 illustrates enzyme conformational changes between conformation (A) and conformation (B).
  • Such motions (C) may cause large changes in conductivity through each of the arm molecules as the result of tension and/or twisting (D)/(E) in the arm molecules 5205a/5205b.
  • the change in arm molecule conductivity as a result of tension/twist of the arm molecules can generally result in large changes in the sensor signal current that directly represents these conformation changes, and therefore provide detailed information on the enzyme activity and the state of the enzyme.
  • the ideal conjugation points on an enzyme to take advantage of these conformations changes differ on the different Cas enzymes, depending on their detailed mechanisms, and the desirable conjugation sites on any enzyme can be deduced from the protein structure and knowledge of the structural changes that occur in the enzyme during enzymatic activity.
  • the chosen sites on the enzyme for conjugation undergo large changes in the three-dimensional straight-line distance between the points (Euclidean distance), due to the conformational changes of the enzyme. [00242] FIG.
  • FIG. 53 illustrates an embodiment of a molecular electronics sensor wherein the Cas enzyme 5314 is wired directly into the current pathway of the sensor circuit by more than two arm molecules.
  • the Cas enzyme 5314 is held in place and wired into the sensor circuit by three arm molecules, labeled 5305a, 5305b and 5305c.
  • the additional arm molecule in excess of two may assist in stabilizing, positioning or orienting the enzyme, such as in a particular rotational orientation, thereby reducing the number of possible conformations of the sensor construct, and thereby reducing variability that shows up as unwanted variation, noise, or artifacts in the signal.
  • additional anchoring arms in excess of two may improve overall signal-to-noise ratio for the sensor.
  • the structure-oriented wiring schemes outlined herein can be combined with these domain wiring schemes, such as, for example, wiring to alpha-helical portions or a series of alpha-helical portions in the protein structure when wiring to the enzyme domains shown for a specific enzyme.
  • the distinct sites on the enzyme for wiring to arm molecules are preferably accessible sites on the outside (solvent accessible) of the enzyme, i.e., to amino acid residues that are accessible, so as to avoid steric hindrance of the arm molecule-enzyme conjugation and/or steric hinderance of the enzyme functions.
  • FIG. 54 illustrates the general functional domain structure of the CRISPR Cas 9 enzyme.
  • the protein has two major lobes, the recognition lobe and the nuclease lobe.
  • the functional domains in these lobes are depicted and labeled with the known acronyms.
  • Protein domains REC1, REC2 and REC3 are involved in the recognition of the target nucleic acid
  • domain RuvC and HNH are nuclease domains involved in cutting of the bound target nucleic acid.
  • CTD an acronym for C-terminal domain
  • the Cas 9 enzyme may be bound into a sensor circuit in various rotational orientations, and electrically wired into the circuit at distinct points on the enzyme.
  • a CRISPR Cas 9 enzyme may be wired into a sensor circuit via two arm molecules 5505a and 5505b and thus held in a particular rotational orientation relative to the two electrodes 5501/5502 and the underlying substrate 5504.
  • the arm molecules are coupled to the CTD and REC1 domains of the Cas 9 enzyme, as these points undergo large conformational changes relative to each other during the enzymatic action of the enzyme, and also define a long current path throughout the length of the enzyme that may gather activity information from across the enzyme.
  • a first arm molecule 5505a comprises a first end conjugated to first electrode 5501 through conjugation 5506a, and a second end that is conjugated to the CTD domain of the enzyme via conjugation 5507a.
  • a second arm molecule 5505b comprises a first end conjugated to the second electrode 5502 via conjugation 5506b and a second end conjugated to the REC1 domain of the enzyme via conjugation 5507b.
  • FIG.56 illustrates an embodiment of a molecular electronics sensor in which the Cas 9 enzyme is wired similarly as in the sensor of FIG. 55, i.e., with two arm molecules, but to other sites on the Cas 9 enzyme.
  • both of the arm molecules 5605a/5605b are conjugated to the HNH domain of Cas 9 enzyme, as this nuclease domain undergoes substantial changes during the processing of the bound target molecule, and therefore directly wiring to it may better leverage this target cutting activity to translate it into a signal.
  • a first arm molecule 5605a comprises a first end conjugated to first electrode 5601 through conjugation 5606a, and a second end that is conjugated to the HNH domain of the enzyme via conjugation 5607a.
  • a second arm molecule 5605b comprises a first end conjugated to the second electrode 5602 via conjugation 5606b and a second end conjugated to the HNH domain of the enzyme via conjugation 5607b.
  • FIG.57 illustrates an embodiment of a molecular electronics sensor in which the Cas 9 enzyme is wired similarly as in the sensor of FIGS. 55 and 56, i.e., with two arm molecules, but to two different sites on the Cas 9 enzyme than the previous examples.
  • the arm molecules are conjugated to the HNH and CTD domains of Cas 9 enzyme.
  • a first arm molecule 5705a comprises a first end conjugated to first electrode 5701 through conjugation 5706a, and a second end that is conjugated to the HNH domain of the enzyme via conjugation 5707a.
  • a second arm molecule 5705b comprises a first end conjugated to the second electrode 5702 via conjugation 5706b and a second end conjugated to the CTD domain of the enzyme via conjugation 5707b.
  • the HNH and CTD domains of Cas 9 undergoe substantial changes during the processing of the target, and therefore directly wiring to these two domains may better translate this key target cutting activity to a measurable signal.
  • FIG.58 illustrates wiring of two arm molecules to the REC1 and REC2 domains of the Cas 9 enzyme, as these recognition domains undergoes substantial changes during the binding to the target nucleic acid, and therefore directly wiring to them may better represent this key target recognition activity in the signal.
  • a first arm molecule 5805a comprises a first end conjugated to first electrode 5801 through conjugation 5806a, and a second end that is conjugated to the REC1 domain of the enzyme via conjugation 5807a.
  • a second arm molecule 5805b comprises a first end conjugated to the second electrode 5802 via conjugation 5806b and a second end conjugated to the REC2 domain of the enzyme via conjugation 5807b.
  • FIG.59 illustrates wiring with two arm molecules to the REC1 domain of Cas 9.
  • both of the arm molecules 5905a/5905b are conjugated to the REC1 domain of Cas 9 enzyme, as this recognition domain has the most direct role in binding to the target nucleic acid, and therefore directly wiring to it may better represent this key target recognition activity in the signal.
  • a first arm molecule 5905a comprises a first end conjugated to first electrode 5901 through conjugation 5906a, and a second end that is conjugated to the REC1 domain of the enzyme via conjugation 5907a.
  • a second arm molecule 5905b comprises a first end conjugated to the second electrode 5902 via conjugation 5906b and a second end conjugated to the REC1 domain of the enzyme via conjugation 5907b.
  • FIG. 60 illustrates the general functional domain structure of the CRISPR Cas 12a enzyme. Briefly, the protein has two major lobes, the recognition lobe and the nuclease lobe. The key functional domains in these lobes are depicted and labeled accordingly.
  • the REC lobe and 3’ portion of the crRNA are involved in the recognition of the target nucleic acid, and domain RuvC and Nuc are nuclease domains involved in cutting.
  • PI an acronym for PAM-Interaction
  • WED wedge domain
  • the Cas 12a enzyme may be bound into a sensor circuit in various rotational orientations, and electrically wired into the circuit at distinct points on the enzyme.
  • FIG.61 illustrates wiring to the Nuc and REC lobe domains of Cas 12a, as these points undergo large conformational changes relative to each other, during the action of the enzyme, and also define a long current path throughout the length of the enzyme that may gather activity information from across the enzyme.
  • a first arm molecule 6105a comprises a first end conjugated to first electrode 6101 through conjugation 6106a, and a second end that is conjugated to the Nuc domain of the enzyme via conjugation 6107a.
  • a second arm molecule 6105b comprises a first end conjugated to the second electrode 6102 via conjugation 6106b and a second end conjugated to the REC lobe of the Cas 12a enzyme via conjugation 6107b.
  • FIG. 62 illustrates wiring to the PI and Nuc domains of Cas 12a enzyme, as these domains undergoes substantial changes during the processing of the target, and therefore directly wiring to it may better represent this key target cutting activity in the signal.
  • a first arm molecule 6205a comprises a first end conjugated to first electrode 6201 through conjugation 6206a, and a second end that is conjugated to the PI domain of the enzyme via conjugation 6207a.
  • a second arm molecule 6205b comprises a first end conjugated to the second electrode 6202 via conjugation 6206b and a second end conjugated to the Nuc domain of the Cas 12a enzyme via conjugation 6207b.
  • FIG. 63 illustrates an embodiment of a molecular electronics sensor wherein the wiring is to two distinct sites on the REC lobe domain of Cas 12a enzyme, as the recognition domains undergoes substantial changes during the binding to the target nucleic acid, and therefore directly wiring to them may better represent this key target recognition activity in the signal.
  • a first arm molecule 6305a comprises a first end conjugated to first electrode 6301 through conjugation 6306a, and a second end that is conjugated to a first distinct site on the REC lobe of the enzyme via conjugation 6307a.
  • a second arm molecule 6305b comprises a first end conjugated to the second electrode 6302 via conjugation 6306b and a second end conjugated to a second distinct site on the REC lobe of the Cas 12a enzyme via conjugation 6207b.
  • a first arm molecule 6405a comprises a first end conjugated to first electrode 6401 through conjugation 6406a, and a second end that is conjugated to the RuvC domain of the enzyme via conjugation 6407a.
  • a second arm molecule 6405b comprises a first end conjugated to the second electrode 6402 via conjugation 6406b and a second end conjugated to the Nuc domain of the Cas 12a enzyme via conjugation 6407b.
  • a first arm molecule 6505a comprises a first end conjugated to first electrode 6501 through conjugation 6506a, and a second end that is conjugated to the WED domain of the enzyme via conjugation 6507a.
  • FIG. 66 illustrates an embodiment of a molecular electronics sensor wherein the wiring is to the recognition segment of the crRNA complexed within the Cas 12a enzyme, as this segment of crRNA goes from a lower electrically conducting single stranded form to a higher electrically conducting duplex form during target binding and hybridization, and therefore direct wiring to this segment of crRNA may increase the magnitude of the signal in the current-time trace upon target-related duplex formation, and a more reliable indication of this hybridization.
  • a first arm molecule 6605a comprises a first end conjugated to first electrode 6601 through conjugation 6606a, and a second end that is conjugated to a first distinct site on the crRNA molecule, such as the 3’ end of the crRNA, via conjugation 6607a.
  • a second arm molecule 6605b comprises a first end conjugated to the second electrode 6602 via conjugation 6606b and a second end conjugated to a second distinct site on the crRNA strand, via conjugation 6607b, such that the segment of crRNA that participates in target hybridization and duplex formation is mostly or entirely between the first and second distinct sites on the crRNA molecule.
  • FIG.67 illustrates an embodiment of a molecular electronics sensor with wiring to the crRNA as complexed to the Cas 12a enzyme similar to the embodiment of FIG. 66, but with linkers or spacers used to reduce steric hinderances from the arm molecules, which could otherwise impair the assembly or enzyme function.
  • a first spacer molecule 6707a is used to distance the conjugation between the second end of the first arm molecule 6705a and the first distinct site on the crRNA molecule, such as the 3’end.
  • a second spacer molecule 6707b is used to distance the conjugation between the second end of the second arm molecule 6705b and the second distinct site on the crRNA molecule.
  • FIGS.68 through 88 illustrate various embodiments of molecular electronics sensors, wherein the CRISPR Cas enzyme is wired into the sensor circuit in various orientations, such as rotational orientations, and with various wiring strategies that take advantage of conformational changes and/or proximity to the cutting activity of the enzyme.
  • These exemplary structures are illustrated without explicit indication of the nature of the chemical conjugations that might be used to tether the Cas enzyme to a bridge molecule or to arm molecules, or the specific chemistry that might be used to conjugate the enzyme, bridge or arm molecules to the pair of nanoelectrodes.
  • These embodiments are meant to illustrate structural details as to how the CRISPR enzyme and associated crRNA might be oriented relative to the bridge molecule or the arm molecules attached to the electrodes.
  • FIG. 68 is a ribbon structure showing the detailed protein structure underlying the functional domain structure of the CRISPR Cas12a enzyme.
  • this structure represents the Cas 12a from Francisella tularensis, subspecies novicida (strain U112), indicated as structure ID PDB 5MGA (RCSB Protein Data Bank).
  • the ribbon structure in FIG. 68 is a structure for the Cas 12a enzyme when it is complexed with a crRNA molecule, but in order to better shown the protein structure, the crRNA is not shown in this rendering.
  • the N- and C- termini of the protein are labeled in this structure.
  • molecular electronics sensors can incorporate the Cas 12a enzyme, directly wired into the sensor circuit, in various rotational orientations, and by using arm molecules that may, in some embodiments, comprise short peptide extensions of the amino acid sequence of the enzyme, one from each of the N- and C-termini of the enzyme, as described below.
  • FIG. 69 illustrates an embodiment of a molecular electronics sensor comprising alpha-helical peptide arm molecules 6905/6905b genetically engineered as extensions from each of the N- and C-termini of the Cas12a enzyme. In various embodiments of manufacturing methods, this construct would be expressed as a single amino acid protein chain, and thus no additional conjugation mechanism would be required to attach the arm molecules to the enzyme.
  • a first arm molecule 6905a comprises a peptide having an alpha-helical structure, a first end conjugated to the first electrode 6901 via conjugation 6906a, which may comprise a short peptide material binding domain at the first end of the peptide arm molecule.
  • the first arm molecule 6905a further comprises a second end that merges into either the C- or N-terminus of the enzyme 6914 at bond 6907a.
  • this bond 6907a may comprise an amide in that the arm molecule 6905a is merely a short peptide contiguous with the amino acid chain of the enzyme 6914.
  • a second peptide arm molecule 6905b comprises a first end conjugated to the second electrode 6902 via a material binding domain-metal conjugation 6906b.
  • the second arm molecule 6905b also merges into either other end of the amino acid chain of the enzyme 6914, at amide linkage 6907b, wherein the arm molecule 6905b is merely a short peptide extension from the main amino acid chain of the enzyme 6914.
  • FIG.70 illustrates an embodiment of a molecular electronics sensor comprising a CRISPR Cas 12a enzyme, wherein two alpha-helical peptide arm molecule wire the enzyme at its NUC lobe to the spaced-apart nanoelectrodes.
  • the alpha-helical arm molecules 7005a/7005b connect directly to alpha-helical amino acid segments (at 7007a/7007b) present in the NUC lobe of the Cas 12a enzyme 7014.
  • a first arm molecule 7005a comprises a first end conjugated to first electrode 7001 through conjugation 7006a, and a second end that is conjugated to an alpha-helical amino acid segment present in the NUC lobe of the enzyme via conjugation 7007a.
  • a second arm molecule 7005b comprises a first end conjugated to the second electrode 7002 via conjugation 7006b and a second end conjugated to an alpha-helical amino acid segment present in the NUC lobe of the enzyme via conjugation 7007b.
  • a first arm molecule 7105a comprises a first end conjugated to first electrode 7101 through conjugation 7106a, and a second end that is conjugated to an alpha-helical amino acid segment present in the NUC lobe of the enzyme via conjugation 7107a.
  • a second arm molecule 7105b comprises a first end conjugated to the second electrode 7102 via conjugation 7106b and a second end conjugated to an alpha-helical amino acid segment present in the REC lobe of the enzyme via conjugation 7107b.
  • FIG. 72 illustrates an embodiment of a molecular electronics sensor wherein alpha-helical peptide arm molecules are both wired to the REC lobe of the Cas12a enzyme, and in particular to alpha- helical segments present in this domain.
  • a first arm molecule 7205a comprises a first end conjugated to first electrode 7201 through conjugation 7206a, and a second end that is conjugated to an alpha-helical amino acid segment present in the REC lobe of the enzyme 7214 via conjugation 7207a.
  • a second arm molecule 7205b comprises a first end conjugated to the second electrode 7202 via conjugation 7206b and a second end conjugated to an alpha-helical amino acid segment present in the REC lobe of the enzyme 7214 via conjugation 7207b.
  • each arm molecule 7205a/7205b connect to two distinct sites on the same alpha-helical segment present within the REC lobe of the Cas 12a enzyme 7214.
  • a first arm molecule 7305a comprises a first end conjugated to first electrode 7301 through conjugation 7306a, and a second end that is conjugated to an alpha-helical amino acid segment present in the RuvC domain of the NUC lobe of the enzyme 7314 via conjugation 7307a.
  • a second arm molecule 7305b comprises a first end conjugated to the second electrode 7302 via conjugation 7306b and a second end conjugated to an alpha-helical amino acid segment present in the REC2 domain of the REC lobe of the Cas12a enzyme 7314 via conjugation 7307b.
  • FIG. 74 illustrates an embodiment of a molecular electronics sensor wherein alpha-helical peptide arm molecules 7405a/7405b are both wired to the RuvC nuclease domain of the Cas12a enzyme, and in particular to alpha-helical segments present in this domain.
  • a first arm molecule 7405a comprises a first end conjugated to first electrode 7401 through conjugation 7406a, and a second end that is conjugated to an alpha-helical amino acid segment present in the RuvC nuclease domain of the enzyme 7414 via conjugation 7407a.
  • a second arm molecule 7405b comprises a first end conjugated to the second electrode 7402 via conjugation 7406b and a second end conjugated to an alpha-helical amino acid segment present in the RuvC nuclease domain of the enzyme 7414 via conjugation 7407b.
  • each arm molecule 7405a/7405b connect to two distinct sites on the same alpha-helical segment present within the RuvC nuclease domain of the Cas 12a enzyme 7414.
  • FIG. 75 illustrates an embodiment of a molecular electronics sensor wherein the Cas12a enzyme 7514 is conjugated to an alpha helical bridge molecule 7505 at one conjugation site 7508 within the RuvC nuclease domain of the Cas 12a enzyme 7514.
  • conjugation is formed between the bridge molecule 7505 and a single site on the amino acid chain of the Cas 12a enzyme 7514 present within the RuvC nuclease domain.
  • the bonding between bridge molecule 7505 and enzyme 7514 may comprise a covalent bond between amino acid residues or a click-chemistry coupling, or other type of chemical conjugation usable to couple an amino acid chain of an enzyme to a peptide molecule.
  • FIG. 76 shows the detailed protein structure underlying the functional domain structure of CRISPR Cas9 enzyme.
  • the ribbon structure illustrated is the structure of Cas9 from Staphylococcus aureus, shown in the conformation the enzyme would be when complexed with sgRNA and a target DNA, and is the structure referenced as ID PDB 5CZZ (Protein Data Bank).
  • ID PDB 5CZZ Protein Data Bank
  • the crRNA and target DNA are not shown in this rendering of the ribbon structure of Cas9.
  • a Cas9 enzyme is wired into a sensor circuit of a molecular electronics sensor, either directly between electrodes, directly to a bridge molecule, or by the aid of two or more arm molecules.
  • the Cas9 enzyme may be held in a desired rotational orientation, and may be held in by arm molecules bonded to strategic sites that allow maximum leverage of conformation changes in the enzyme.
  • FIG. 77 illustrates an embodiment of a molecular electronics sensor wherein alpha-helical peptide arm molecules 7705a/7705b are genetically engineered at the N- and C-termini (7707a/7707b) of the Cas9 protein 7714. In this way, this construct would be expressed as a single chain protein, without any additional conjugation mechanism required to attach the arm molecules to the enzyme.
  • a first arm molecule 7705a comprises a first end conjugated to first electrode 7701 through conjugation 7706a, (e.g., material binding domain-metal association) and a second end that is contiguous with an end 7707a of the amino acid chain of the enzyme 7714 (contiguous with the N- or C-terminus).
  • a second arm molecule 7705b comprises a first end conjugated to the second electrode 7702 via conjugation 7706b (e.g., a material binding domain-metal association) and a second end that is contiguous with the other end 7707b of the amino acid chain of the enzyme 7714 (contiguous with the N- or C-terminus).
  • FIG. 78 illustrates an embodiment of a molecular electronics sensor wherein alpha-helical peptide arm molecules 7805a/7805b are both wired to the NUC lobe of the Cas9 enzyme 7814, and in particular to alpha-helical segments present in this domain.
  • a first arm molecule 7805a comprises a first end conjugated to first electrode 7801 through conjugation 7806a, and a second end that is conjugated to an alpha-helical amino acid segment present in the NUC lobe of Cas9 enzyme 7814 via conjugation 7807a.
  • a second arm molecule 7805b comprises a first end conjugated to the second electrode 7802 via conjugation 7806b and a second end conjugated to an alpha-helical amino acid segment present in the NUC lobe of Cas9 enzyme 7814 via conjugation 7807b.
  • each arm molecule 7805a/7805b connect to two distinct sites on the same alpha-helical segment present within the NUC lobe of the Cas9 enzyme 7814.
  • FIG. 79 illustrates an embodiment of a molecular electronics sensor wherein alpha-helical peptide arm molecules 7905a/7905b are both wired to the REC lobe of the Cas9 enzyme 7914, and in particular to alpha-helical segments present in this domain.
  • a first arm molecule 7905a comprises a first end conjugated to first electrode 7901 through conjugation 7906a, and a second end that is conjugated to an alpha-helical amino acid segment present in the REC lobe of Cas9 enzyme 7914 via conjugation 7907a.
  • a second arm molecule 7905b comprises a first end conjugated to the second electrode 7902 via conjugation 7906b and a second end conjugated to an alpha-helical amino acid segment present in the REC lobe of Cas9 enzyme 7914 via conjugation 7907b.
  • each arm molecule 7905a/7905b connect to two distinct sites on the same alpha-helical segment present within the REC lobe of the Cas9 enzyme 7914.
  • FIG. 80 illustrates an embodiment of a molecular electronics sensor wherein alpha-helical peptide arm molecules 8005a/8005b are wired to the WED domain of the NUC lobe and to the REC lobe of Cas9 enzyme 8014, and in particular to alpha-helical segments present in each of these domains.
  • a first arm molecule 8005a comprises a first end conjugated to first electrode 8001 through conjugation 8006a, and a second end that is conjugated to an alpha-helical amino acid segment present in the WED domain of the NUC lobe of Cas9 enzyme 8014 via conjugation 8007a.
  • a second arm molecule 8005b comprises a first end conjugated to the second electrode 8002 via conjugation 8006b and a second end conjugated to an alpha-helical amino acid segment present in the REC lobe of Cas9 enzyme 8014 via conjugation 8007b.
  • a first arm molecule 8105a comprises a first end conjugated to first electrode 8101 through conjugation 8106a, and a second end that is conjugated to the alpha-helical amino acid segment 8137 present in the REC lobe of Cas9 enzyme 8114 via conjugation 8107a.
  • a second arm molecule 8105b comprises a first end conjugated to the second electrode 8102 via conjugation 8106b and a second end conjugated to another site along the alpha- helical amino acid segment 8137 present in the REC lobe of Cas9 enzyme 8114 via conjugation 8107b.
  • FIG. 82 illustrates an embodiment of a molecular electronics sensor wherein alpha-helical peptide arm molecules 8205a/8205b are used to wire the Cas9 enzyme 8214 into the sensor circuit through an alpha helix segment present in the RuvC nuclease domain of Cas9 enzyme 8214.
  • a first arm molecule 8205a comprises a first end conjugated to first electrode 8201 through conjugation 8206a, and a second end that is conjugated to an alpha helix segment present in the RuvC nuclease domain of the Cas9 enzyme 8214 via conjugation 8207a.
  • a second arm molecule 8205b comprises a first end conjugated to the second electrode 8202 via conjugation 8206b and a second end conjugated to another site along the alpha-helical amino acid segment present in the RuvC nuclease domain of the Cas9 enzyme 8214 via conjugation 8207b.
  • FIG.83 illustrates an embodiment of a molecular electronics sensor wherein the Cas9 enzyme 8314 is conjugated to an alpha helical bridge molecule 8305 at one site in the RuvC nuclease domain of the Cas9 enzyme 8314.
  • the Cas9 enzyme 8314 is conjugated to an alpha helical bridge molecule 8305 at one site in the RuvC nuclease domain of the Cas9 enzyme 8314.
  • there are no arm molecules connecting to the spaced-apart electrodes but rather a single bridge molecule 8305 connecting the electrodes 8301/8302 and spanning over the nanogap 8303.
  • conjugation is formed between the bridge molecule 8305 and a single site present on the amino acid chain in the RuvC nuclease domain of the Cas9 enzyme 8314.
  • FIGS.84 through 86 illustrate various embodiments of molecular electronics sensors wherein the two arm molecules provide wiring from the spaced-apart electrodes to two distinct sites on or near the crRNA of Cas9.
  • the crRNA which is part of the structures shown, is made visible in order to highlight the role of the crRNA in the wiring of the enzyme/crRNA complex into the sensor circuit.
  • FIG.84 illustrates an embodiment of a molecular electronics sensor wherein the arm molecules 8405a/8405b wire directly to the crRNA, at points at the 5’ end of the crRNA strand and at an internal site on the crRNA in the most exposed portion of the loop in the knot region. Wiring the crRNA into the sensor circuit in this way has the benefit that upon target binding, much of this portion of crRNA between the conjugation sites will comprise a duplex structure, creating a substantial increase in electrical conduction, and thus a clear jump or perturbation of the measured conduction current signal.
  • a first arm molecule 8405a comprises a first end conjugated to first electrode 8401 through conjugation 8406a, and a second end that is conjugated to the 5’ end of the crRNA 8420 (complexed in the Cas9 enzyme 8414) via conjugation 8407a.
  • a second arm molecule 8405b comprises a first end conjugated to the second electrode 8402 via conjugation 8406b and a second end conjugated to an internal site on the crRNA 8420 in the most exposed portion of the loop in the knot region via conjugation 8407b.
  • a molecular electronics sensor wherein a first arm molecule is conjugated to the Cas9 enzyme and a second arm molecule is conjugated to the crRNA that is complexed to the Cas9 enzyme.
  • the arms wire directly to the crRNA at an internal nucleotide in the most exposed portion of the loop in the knot region, and to an alpha-helix in the protein near the end of the recognition segment of the crRNA. Wiring both crRNA and Cas9 enzyme to the circuit in this way has the benefit that upon target binding, much of the crRNA will be present as a duplex structure, creating a substantial increase in conduction in this accessible channel and thus a clear jump or perturbation of the measured conduction current signal.
  • a first arm molecule 8505a comprises a first end conjugated to first electrode 8501 through conjugation 8506a, and a second end that is conjugated to an alpha-helical segment of the Cas9 enzyme 8514 near the end of the recognition segment of the crRNA via conjugation 8507a.
  • a second arm molecule 8505b comprises a first end conjugated to the second electrode 8502 via conjugation 8506b and a second end conjugated to an internal site on the crRNA 8520 in the most exposed portion of the loop in the knot region via conjugation 8507b.
  • FIG.86 illustrates an embodiment of a molecular electronics sensor wherein the arm molecules wire directly to alpha helical portions in the Cas9 enzyme 8614 that are near the ends of the recognition segment of the complexed crRNA 8620.
  • a first arm molecule 8605a comprises a first end conjugated to first electrode 8601 through conjugation 8606a, and a second end that is conjugated to an alpha-helical segment of the Cas9 enzyme 8614 near one end of the recognition segment of the crRNA 8620 via conjugation 8607a.
  • a second arm molecule 8605b comprises a first end conjugated to the second electrode 8602 via conjugation 8606b and a second end conjugated to an alpha-helical segment of the Cas9 enzyme 8614 near the opposite end of the recognition segment of the crRNA 8620 via conjugation 8607b.
  • FIGS.87 and 88 illustrate embodiments of molecular electronics sensors wherein the first and second arm molecules comprise segments of double stranded DNA (dsDNA) instead of alpha-helical peptide molecules or double stranded RNA molecules. Double stranded DNA is in general a useful option for a bridge molecule or the two arm molecules absent a bridge molecule.
  • dsDNA double stranded DNA
  • the conjugation of the DNA molecules to each of the nanoelectrodes may be via thiol-metal bonding, such as by utilizing thiol groups present at or near the ends of the DNA strands, or by other conjugation groups that may be engineered on the ends of the DNA molecules.
  • Conjugation of the DNA to the CRISPR enzyme can be via any of the conjugation methods described herein.
  • the dsDNA arm molecules 8705a/8705b wire directly to amino acid residues present in the NUC lobe of the Cas9 enzyme 8714, and particularly in the RuvC and WED domains of the NUC lobe.
  • the dsDNA arm molecules 8805a/8805b wire directly to the crRNA 8820, the first arm molecule 8805a conjugated to the 5’ end of the crRNA 8820 via conjugation 8807a and the second arm molecule 8805b conjugated to a site on the crRNA 8820 internal to the outermost loop region of the knot via conjugation 8807b.
  • a dsDNA arm molecule such as first arm molecule 8805a or second arm molecule 8805b, may be conjugated from each strand to the crRNA molecule as indicated by the two sites of conjugation, 8807a/8827a and 8807b/8827b, respectively.
  • this DNA-RNA (or all-RNA) construct could be formed from one long single strand oligonucleotide that has hairpin duplexes on each end, which has the advantage of convenient synthesis in a single nucleic acid synthesis process usable to make one single strand.
  • Sensor Assembly Methods [00284] In general, in all the molecular constructs discussed herein for use in a sensor circuit, the molecular element that bridges the nanoelectrodes may be assembled in place through assembly procedures that provide the molecule to the vicinity of the electrode tips, such that the binding groups on the ends of the bridging component may bind to each of the electrodes and span the nanogap.
  • This assembly process may rely on passive diffusion of the bridging molecule to present the bridge for binding to the electrode pair, or on electrophoresis or dielectrophoresis driven by voltages applied to the nanoelectrodes (or voltages applied to auxiliary assembly electrodes present in the vicinity of the nanoelectrode pair to be bridged).
  • electrophoresis or dielectrophoresis driven by voltages applied to the nanoelectrodes or voltages applied to auxiliary assembly electrodes present in the vicinity of the nanoelectrode pair to be bridged.
  • the multiplex detection capability of a collection of molecular electronics sensors each comprising a CRISPR Cas enzyme/crRNA complex depends on different targeting crRNAs (i.e., crRNA molecules having different oligonucleotide sequences) having been placed on different sensors (referred to herein as “assembly”), and knowing which individual sensor contains which crRNA targeting sequence (referred to herein as “mapping”).
  • a collection of individual sensors also referred to as a “plurality of sensors” is arranged in a two-dimensional spatial array on a surface, such as on an integrated circuit chip surface (CMOS chip), as further discussed herein.
  • CMOS chip integrated circuit chip surface
  • the crRNA molecules may already be attached to the bridge molecule prior to deposition of a molecular construct between spaced-apart electrodes, or the crRNA molecule may be conjugated to an existing bridge molecule or a Cas enzyme already wired between electrodes in the sensor. Therefore, for simplicity, methods for depositing and mapping crRNA are disclosed, without explicit mention of the bridge molecule or the Cas enzyme, presuming the various possibilities for the relation of the crRNA to these are clear from each context discussed below.
  • the methods below may reference the use of the sensor as a hybridization sensor for purposes of assembly and mapping.
  • a bound crRNA molecule within a sensor circuit may be treated for discussion purposes as an oligonucleotide hybridization probe in the sensor circuit.
  • FIG. 89 the general operation of molecular electronic sensors detecting hybridization is illustrated, for example, in FIG. 89, wherein an oligonucleotide 8912 attached to a bridge molecule 8905 generates a detection signal 8911 in the sensor current-time trace 8910 upon sequence- specific exact match binding to its complement oligonucleotide 8914, such as from a pool of potential hybridization targets provided in solution to the sensor.
  • a tethered crRNA could play the role of a hybridization sensor, with a crRNA molecule in place of the hybridization probe 8912, either using the recognition sequence of the crRNA as the hybridization probe 8912, or using an encoding oligonucleotide affiliated with the crRNA, as indicated, for example, in FIGS.31 through 40.
  • Various methods for assembling and mapping the crRNA are outline below, any of the sensor embodiments disclosed (crRNA tethered to bridge, or enzyme tethered) may be in effect, and the method described can be interpreted in the context of these specific embodiments.
  • Microfluid directed assembly In various embodiments of microfluid directed assembly, different portions of a sensor array are selectively provided with different solutions under microfluidic control. A different crRNA is provided to each independent volume of solution, allowing the crRNA provided in that volume to assembly in the portion of the array exposed to the volume. The assembly map is therefore known from knowing which sensors in the array were exposed to which solutions.
  • a gasket is used to cover an area, and optionally divide an area of the microfluidic chamber into independent volumes, and each volume can have separate liquid lines flowing in and out of it.
  • electrowetting methods can be used to direct liquid volumes containing a crRNA to a region of the array.
  • the crRNA to be assembled into individual sensor circuits are supplied serially to the reaction volume, one crRNA type at a time, and with a given crRNA resident in solution, a voltage is applied to a sensor electrode or a polarity applied to a pair of electrodes to drive electrophoretic or dielectrophoretic attraction of the particular crRNA to the individual sensor (or attract a preassembled crRNA-bridge molecular complex, or crRNA with associated arm molecules).
  • the crRNA is concentrated at, and reacts to, the sensor’s electrodes selected by the electrical addressing.
  • application of an appropriate voltage and/or polarity to electrodes electrically configures the electrodes to either attract or repel the crRNA, crRNA-bridge molecular complexes, or crRNA complete with arm molecules, in the local environment.
  • a positive voltage may be used to attract negative charges on crRNA (or DNA bridge or arm molecules attached to the crRNA) in solution, or a negative voltage may be used to repel such negatively charged crRNA or DNA. This phenomena relies on the process of electrophoresis.
  • an AC voltage may be used to selectively attract or repel the various crRNA, crRNA-bridge molecular complexes, or crRNA complete with arm molecules, using the process of dielectrophoretic forcing.
  • the solution containing a particular type of crRNA, crRNA- bridge molecular complex, or crRNA with engineered arm molecules destined for a particular plurality of individual sensors is applied to the solution for a short period of time and in a low concentration, such that diffusive transport is unlikely to deliver these molecules to bind to nanoelectrodes on the chip array.
  • an AC voltage of proper frequency and amplitude creates a dielectrophoretic force that will drive these molecules to concentrate near the electrode gaps of the intended sites in the form of localized concentrations, and allowing the electrodes to selectively bind the intended crRNA or crRNA complexes or constructs.
  • the solution is then flushed away, and the next crRNA or crRNA complexes or constructs introduced in the presence of other dielectrophoretic forces at other electrodes.
  • This procedure may be done for individual types of crRNA, or pools of distinct crRNA types, in which case their locations are restricted to a much smaller set of possible sites, yet crRNA type from the pool is still randomly distributed across electrodes within those site sets, and further location information would be required to complete the map to the individual sensor level.
  • the low concentrations of the crRNA used may be in the range of about 1pM (pico-Molar) to about 100nM (nano-molar)
  • the exposure time used may be in the range of about 0.1 sec to about 100 sec
  • the amplitude of applied voltage used to locally concentrate crRNA or crRNA complexes or constructs may be in the range of from about 0.1 V to about 10 V
  • the frequency of AC modulation used may be in the range of from about 1 KHZ to about 100 MHZ.
  • Pooled assembly and decoding [00297] In various embodiments, different targeting crRNAs are mixed in a pool and exposed to an array of sensor devices and allowed to assembly randomly.
  • decoding binding events comprise hybridization reactions, either between the crRNA target segment and its complementary oligonucleotide, or between an encoding oligonucleotide attached to the crRNA (such as, for example, in variations of FIGS. 31 through 40), and its complementary oligonucleotide.
  • the decoding reaction may comprise the reaction between an assembled CRISPR Cas enzyme/crRNA complex detecting its specific target oligonucleotide, assuming this detection can be suitably reversed so that the sensor is then free to engage in additional detection reactions, either in the decoding process, or in subsequent applications of the decoded multiplex sensor.
  • target hybridization oligonucleotides complementary to the encoding oligonucleotide probes are applied individual and serially, and the responses therefrom indicate the location of the corresponding crRNA. This requires N such reactions to decode and map N different targeting crRNA.
  • the target hybridization oligonucleotides are applied in pools, and each sensor on the array of sensors registers a detection (“1”) or non-detection (“0”) event.
  • the series of such pooled assays provides a binary series for each sensor, indicated within which of the pools its target hybridization oligonucleotide was presented.
  • the “0” and “1” outcome series of a given sensor, exposed to Pool 1, Pool 2, ..., Pool j,...,Pool B in series is exactly the encoding binary string that identifies the crRNA, and this provides the unique decoding and mapping of the crRNA present at the sensor.
  • error correcting codes for this decoding method, such that an error in measurement for a sensor exposed to a pool during this decoding process can be detected or corrected for the sensor.
  • One such method would be the use of a hamming code, where the encoding binary string identifiers for the crRNA are the hamming code words.
  • the resulting 0/1 outcome string for a sensor is not one of the allowed binary codes, it can be corrected to the correct code, up to some number of errors in results of the pooled reaction detections for the sensor, using the hamming distance to select the closest valid code word.
  • error correction methods for correction errors in the transmission of binary strings of fixed length, are known to those skilled in coding theory, and could be applied to this encoding and decoding problem to correct errors in the detection assay. These correction methods include, for example, Hamming codes, Golay codes, and others known in coding theory.
  • an array of hybridization sensors is first established, where the oligonucleotide probes (e.g., as indicated, for example, as 8912 in FIG.89 and 9012 in FIG.90), comprise unique sequence addresses, preferable in the range of 8 to 40 nucleotide bases in length.
  • This array may itself be produced by the above methods, or by other means.
  • the complementary address oligonucleotides are added to the crRNA, such as by extending the existing sequence by synthesis to include these address sequences, or otherwise tethering them to the crRNA.
  • the crRNA tether onto the sensors at known locations as per the map for the address oligonucleotides.
  • the hybridization may be augmented for stability by an additional reaction, such as a click chemistry reaction, to irreversibly tether the crRNA to the address oligonucleotide- bridge molecule complex, with the required cognate reaction groups synthesized into the address oligonucleotides and the crRNA-address oligonucleotide constructs.
  • the address oligonucleotides may also include nucleic acid analogues that enhance the binding of shorter oligonucleotides, such as PNA or LNA oligonucleotides, which may enable the use of hybridization probes in the range of 6 to about 12 bases that provide both unique addressability and strong binding.
  • the assembly and mapping methods disclosed herein can be used in any combination.
  • the microfluidic addressing could comprise the depositing of a crRNA pool onto a subset of sensors in the plurality of sensors, and the final decoding and mapping could be done by using the pooled decoding methods.
  • microfluidics could be used to serially apply the different targeting crRNA.
  • the voltage directed assembly could be applied to pools and with sets of electrodes selected, to deposit known pools at known electrode pair sites, with the final level of mapping resolving down to individual sensor locations of the crRNA performed with the pooled decoding techniques.
  • the voltage direction could be applied to the entire array with a pool just to get the advantage of the rapid assembly, under voltage control, of the pool onto the full sensor array.
  • a programmable address array may be used within each microfluidic volume, or used with voltage directed assembly for acceleration. From this disclosure, many such variations in combinations of these methods are anticipated, and all such combinations of the above methods are meant to be encompassed by this disclosure.
  • CRISPR Cas enzyme sensors are deployed on semiconductor integrated circuit chips, e.g., Complementary Metal Oxide Semiconductor (or CMOS) chips. Deployment on a chip provides an advantage that large arrays of such sensors can be deployed in a highly compact, scalable, and mass-manufacturable form that leverages the manufacturing capabilities of the semiconductor chip industry.
  • CMOS Complementary Metal Oxide Semiconductor
  • a sensor array in accordance with the present disclosure is organized as a standard array similar to architectures used in CMOS digital imaging chips, and RAM memory arrays, as shown, for example, in FIG. 91 (at left).
  • sensor pixels are organized into a rectangular array, and standard circuit blocks are shown in schematic form.
  • This arrangement of circuit blocks provides the bias currents and voltages, a row address decoder that selects the row to be output, along with a bank of column Analog to Digital Converters (ADCs) that digitize the analog output of the selected row on the array and transfer it to a memory buffer for serialization and transfer off chip.
  • ADCs Analog to Digital Converters
  • These processes are performed under the control of clocks and phase-locked loop control circuitry, within a Timing and Control block.
  • the array is of a scalable number of pixels.
  • a chip array may comprise up to 100 sensor pixels, up to 1000 sensor pixels, up to 10,000 sensor pixels, up to 100,000 sensor pixels, or up to 1,000,000 sensor pixels, or up to 10,000,000 sensor pixels, or up to 100,000,000 sensor pixels, or more.
  • Data frames are transferred off the sensor array at a particular fame rate that is preferably at least 100 frames per second, or at least 1000 frames per second, or at least 10,000 frames per second, or up to 100,000 frames per second.
  • each sensor pixel (9001a, 9001b, 9001c, etc.) in the chip array 9100 comprises an identical circuit (e.g., 9001a) that performs the required sensor current measurements.
  • Each sensor pixel 9001a comprises a molecular electronics sensor 9002a comprising a CRISPER Cas enzyme/crRNA complex as indicated, along with the per-pixel measurement circuitry shown.
  • the current meter circuit (e.g., indicated in FIGS. 6-8 and FIGS. 12 and 13) is embodied in the pixel as a transimpedance amplifier circuit, as shown, comprising a transimpedance amplifier 9006.
  • the circuit shown provides source (V s ) voltage 9003 and drain (V d ) voltage 9005, and an optional gate (V g ) voltage 9004 applied to a buried gate capacitively coupled to the pair of nanoelectrodes below the nanogap of the sensor.
  • the pairs of nanoelectrodes in each sensor pixel of an array of pixels on a chip are fabricated by photolithographic pattering, and/or other standard methods of deposition and etching compatible with CMOS foundry processes.
  • nanoelectrode fabrication is done by establishing planarized vias at an upper CMOS layer, such as via layer 6 in a 180 nm CMOS node, where such vias pass down to the transistor layer as the input lines to the amplifier shown in the circuit schematic of FIG. 91.
  • high resolution photolithography methods such as multiple patterning, 193 nm wavelength immersion lithography, or EUV or DUV patterning, are used to pattern nanoelectrodes with a nanogap dimension from about 8 nm to about 50 nm in width, and preferably from about 10 nm to about 25 nm in width between electrodes.
  • CMOS compatible metal nanoelectrodes which may comprise, for example, Ru, Pd, or Pt, with a suitable adhesion layer such as a several nm thick layer of Ti or Cr.
  • a suitable adhesion layer such as a several nm thick layer of Ti or Cr.
  • passivation such as SiN or SiO 2 , leaving a window exposed around the nanoelectrodes to provide fluidic access to the nanoelectrodes on the sensor array chip.
  • the CMOS node used is 180 nm or finer, preferably 65 nm or finer, and more preferably 28 nm or 20nm or finer, for use of planar transistor CMOS technology.
  • FinFET transistors or other transistor geometries in finer nodes such as 14 nm, 10 nm, 7 nm, 5 nm or 3 nm or 2 nm CMOS may be used. Finer CMOS nodes allow high pixel densities as well as lower power and lower overall cost of deployment of more sensors in an array.
  • the resulting pixel pitch may be 80 microns or less, 20 microns or less, 15 microns or less, 10 microns or less, 5 microns or less, under 3 microns, or 1 micron or less, or as low as 0.1 microns.
  • a sensor array chip 9200 may comprise individual sensor pixels 9201a, 9201b, 9201c, and so forth, wherein each sensor pixel comprises multiple molecular electronics sensors 9202a, 9202b, 9202c, and so forth.
  • multiple molecular electronics sensors 9202a, 9202b, 9202c, and so forth share the same pixel amplifier circuit, and each individual molecular electronics sensor in the pixel can be interrogated by closing the corresponding selection switch 9207a, 9207b, 9207c, etc.
  • This configuration illustrated has the allows for a higher total number of sensors with little or no increase in chip area requirement or power usage. Such sensors may be read serially in time, with the limitation that they can no longer integrate continuously.
  • each of N such sensors are therefore only monitored for the fraction 1/N of the overall frame rate.
  • this form is used with Cas sensors in which the current signature is of an extended duration, such as for changes in current level due to the primary Cas enzyme target interaction during detection of the non-specific activated phase of Cas12, Cas13, and Cas14 enzymes, as the enzyme processes many substrates.
  • Assay Applications for CRISPR Cas Sensor Array Chips [00312] In various embodiments, a variety of assays can be performed with a properly designed CRISPR Cas sensor array chip comprising a plurality of Cas enzyme sensor pixels.
  • a sensor array may be configured to produce a physical pool of DNA tags, which are sequences from a known and limited master set of possible sequences, and it is required to detect the presence or absence of each possible tag, and in some cases, to also obtain a measure of the concentration or abundance of each tag.
  • DNA tags which are sequences from a known and limited master set of possible sequences, and it is required to detect the presence or absence of each possible tag, and in some cases, to also obtain a measure of the concentration or abundance of each tag.
  • Common and well-known examples of such assays are those normally carried out using DNA hybridization microarrays for readout, such as SNP genotyping, gene expression, sequencing by hybridization, or universal DNA tag array or DNA barcode array assays.
  • CRISPR Cas sensor array chips disclosed herein can be used for the readout of any such DNA tag reporter assay.
  • the assay process and Cas enzyme type are selected such that the assay produces nucleic acid tags that can be the target of a targeted Cas enzyme.
  • the tags should be in a dsDNA form
  • tags should be in a ssDNA form
  • the tags should be in a ssRNA form.
  • the Cas sensor array chip is then assembled, such as by the methods disclosed above, to produce sensors capable of targeting the complete master set of such tags.
  • this is a multiplex sensor chip, with CRISPR Cas enzyme/crRNA molecular electronic sensors targeting a multitude of different tags, and with each target also represented by a multitude of replicate sensors having the same targeting construct.
  • the number of distinct tag targets multiplexed on such an array may be up to 10, up to 100, up to 1000, up to 10,000, up to 100,000, up to 1 million, or up to 10 million, or more.
  • the number of replicate pixels for each PR Cas enzyme/crRNA molecular electronic sensor is at least 10, at least 100, or at least 1,000, or at least 10,000.
  • SNP genotyping refers to a method of assessing which genetic variants are present in a sample of genetic material, where such variants are “Single Nucleotide Polymorphisms,” i.e., single base substitutions, or insertions or deletions involving one, or a few, bases.
  • genomic DNA from a given species is captured from a bio-sample, such as blood, saliva, or any other cellular material, and reduced to a pool of oligonucleotide fragments by known methods.
  • a bio-sample such as blood, saliva, or any other cellular material
  • the result is a pool of short fragments, each from about 30 to about 300 bases that include genomic sites of interest that are known to have single base substitutions, or small insertions or deletions of one or a few bases, relative to the reference sequence available.
  • the totality of such variants under consideration form the candidate SNP genotypes.
  • the Cas enzyme in use will have a length to its targeting or guide segment of the crRNA, denoted L, of approximately 18 to 40 bases (e.g., 18 to 24 bases for Cas9, 18 to 25 bases for Cas12, 22 to 30 bases for Cas13, and 20 to 40 bases for Cas14).
  • L a sequence segment (from the variant version of the reference genome) of length L including the variant of interest is provided.
  • the site of the variant within this length L will be at the corresponding location in the guide RNA for which the Cas enzyme to be used is most sensitive to variations in the guide RNA sequence segment, which can be determined empirically for the Cas enzyme in use.
  • the result in totality will be a set of length L sequences represented all the variants under consideration (which in preferred embodiments may be less than the totality of known or possible variants).
  • the corresponding crRNA with these sequences as guide segments are produced, and used to populate the sensors on a CRISPR Cas enzyme assay.
  • the genomic DNA will be converted in the assay to ssRNA, such as by known methods using T7 amplification (based on the T7 DNA-dependent RNA polymerase) in the sample preparation to produce ssRNA copies from the primary genomic DNA.
  • the Cas13 enzyme, or other enzyme having ssRNA targets is used for the plurality of molecular electronics sensors in the sensor array.
  • the target DNA in the pool will be dsDNA, and the Cas9 or Cas12 enzyme, or other enzyme having dsDNA targets, is used for the plurality of molecular electronics sensors in the sensor array.
  • the target DNA in the pool will be in the form of ssDNA, and the Cas14 enzyme, or other enzyme having ssDNA targets, is used for the plurality of molecular electronics sensors in the sensor array. It is advantageous for CRISPR Cas sensor chip SNP genotyping assays to directly detect ssRNA, as assays in which the sample is converted to ssRNA during T7 amplification can deal with smaller amounts of sample material. [00317] In various embodiments of a sensor array readout method, the sample-derived target pool is exposed in solution to the array chip sensor area, and the signals generated from the primary interaction of the CRISPR Cas enzyme/crRNA complex with their targets are used to detect the targets or assess target concentration.
  • any of Cas9, Cas12, Cas13, or Cas14 enzymes may be used in these various embodiments.
  • the Cas enzyme used is a type of Cas enzyme that becomes activated as a non-specific nuclease upon engaging its specific target, and in this case, also provided in solution will be a concentration of a suitable substrate for this non-specific activity (e.g., ssDNA fragments for Cas12 and Cas14, or ssRNA fragments for Cas13), and the signal response from this non-specific nuclease activity will be used to register detection of the primary target.
  • a suitable substrate for this non-specific activity e.g., ssDNA fragments for Cas12 and Cas14, or ssRNA fragments for Cas13
  • both of the above signal detection events will be used to provide a more accurate overall detection signature for the sensor, i.e., a signature that includes both such features. This provides for a reduction in false-positive detections of the targets of interest.
  • the number of sensors registering a target as a fraction of the total number of viable sensors with that target, provides a measure of concentration of the target in the provided sample solution.
  • the time interval length to detection from the time of providing the sample, provides a measure of target concentration.
  • turn-over times from the CRISPR Cas enzyme/crRNA complexes releasing their acquired targets to the time of acquiring new targets, can be used as a measure of concentration.
  • the sample provided to the sensor array chip for detection may have undergone various steps to purify it for the targets of interest, such as providing highly purified dsDNA in a specific reaction buffer.
  • the sample provided to the sensor may be in a crude lysate, or other forms, with little or no purification.
  • An advantage of molecular electronics sensors comprising a CRISPR Cas enzyme is that the sensors can perform their specific detection activity under biological in vivo conditions, and therefore provide for the potential to have limited, little, or no sample prep (such as extraction, purification and buffer exchange processes) for the primary bio-samples.
  • electrophoretic or dielectrophoretic methods for concentrating the provided sample pool of nucleic acids near the sensors may be used, to reduce the time required for detection, or increase the sensitivity of detection.
  • CRISPR Cas sensor chip SNP genotyping assays herein have significant advantages over common SNP genotyping assays, such as those performed with DNA microarrays, including the following: [00322] Label Free. It is an advantage for CRISPR Cas sensor chip SNP genotyping assays that no labeling process is required to add labels to the sample nucleic acids, unlike standard microarray methods that add fluorescent or other labels to the sample material for detection. The embodiments described require no such labeling due to the direct electrical detection, on chip, of the sensor activity; [00323] Enhanced Specificity of Match Detection.
  • the single molecule sensitivity of a Cas enzyme-based sensor and the potential to apply electronic target concentration, provide for a novel level of sensitivity, which provides the advantage that the assay can have a larger dynamic range for detection, and can accept lower amounts of input sample material.
  • standard microarray methods often rely on amplification of input nucleic acid material, such as by PCR methods, which adds costs and complexity, or multi-hour long hybridization reactions, which greatly extends the assay time, to attain and improve sensitivity; and [00325] Double Stranded DNA Sample Input Format.
  • CRISPR Cas sensor chip SNP genotyping assays that some embodiments target dsDNA, as this is often a more convenient or natural form of nucleic acid to generate, including the option of using primary genomic DNA as a sample, with no or minimal processing (such as fragmentation). This is in contrast to standard microarray methods that all require the target nucleic acid to be in single stranded form in order to hybridize to the array probe oligonucleotide.
  • Species Detection [00327] This problem shares many similarities to SNP genotyping in that the targets are genome sequences from one or multiple species, and considerations above that would apply here are meant to be included without further repetition.
  • genomic DNA (or RNA in the case of some viruses) is extracted, possibly amplified and or converted, resulting in a nucleic acid of the type targeted by the Cas enzyme.
  • This sample is exposed to the array, and the detection readouts determine whether the species of interest has been detected, and corresponding concentration measurements may provide an estimate of the abundance of the target species in the sample.
  • the species may be a virus, or a collection of viruses, and the recognition targets are short segments of these viral genomes that distinguish it from the host and from other viruses of concern.
  • this may include targets from the SARS-CoV-2 viral genome, or sequence variants from known strains of the virus.
  • targets in the viral genomic RNA are detected directly with no PCR amplification or conversion to DNA necessary.
  • this is combined with electronic target concentration to achieve extreme sensitivity without the need for PCR amplification, so that low quantities of virus, approaching single viral particles in a sample, can be detected.
  • gene expression analysis comprises readout of a set of target nucleic acid tags.
  • a goal is to assess a sample of cellular material for which genes are undergoing expression, and possibly to also measure the level of expression.
  • the cellular material may be from an organ of a human, animal, or plant species, or from single celled organisms such as bacteria or yeast. It is assumed there is knowledge of a master set of genes to be considered, and that the sequence of the genes or corresponding expressed messenger RNA is known.
  • guide RNA sequences are selected that target sequence segments of the genes or transcripts of interest.
  • recognition sequences are chosen that would detect and distinguish all the transcripts of interest.
  • RNA multiplex CRISPR Cas sensor array chip
  • Cas enzyme suited to the form of nucleic acids to be detected, which will depend on the sample preparation method.
  • mRNA messenger RNA
  • This material may undergo amplification, and possible also conversion to single stranded complementary DNA (cDNA) or double stranded cDNA.
  • cDNA single stranded complementary DNA
  • the sensors are to be based on Cas13.
  • the resulting material is single stranded cDNA
  • the sensor can be based on Cas14.
  • the senor may be based on Cas9 or Cas12.
  • the sample-derived target pool is exposed in solution to the array chip sensor area, and the signals generated from the primary interaction of the CRISPR Cas enzyme/crRNA complexes with their targets are used to detect the targets or assess target concentration.
  • any of Cas9, Cas12, Cas13, or Cas14 may be used in these embodiments.
  • the Cas enzyme used is a type that becomes activated as a non-specific nuclease upon engaging its specific target, and for this embodiment, also provided in solution will be a concentration of a suitable substrate for the non-specific activity (e.g., ssDNA fragments for Cas12 or Cas14, or ssRNA fragments for Cas13), and the signal response from this non-specific activity will be used to register detection of the primary target.
  • a suitable substrate for the non-specific activity e.g., ssDNA fragments for Cas12 or Cas14, or ssRNA fragments for Cas13
  • each target on the sensor array will be represented by replicate CRISPR Cas enzyme/crRNA-based sensors on the array, preferably at least 10, or at least 100, or at least 1000, or more individual molecular electronics sensors, each comprising a CRISPR Cas enzyme/crRNA complex.
  • CRISPR Cas sensor chip gene expression assays have significant advantages over common gene expression assays, such as those performed with DNA microarrays, including the following: [00334] Label Free. It is an advantage for CRISPR Cas sensor chip gene expression assays that no labeling process is required to add labels to the sample nucleic acids, unlike standard microarray methods that add fluorescent or other labels to the sample material for detection; [00335] Enhanced Specificity of Match Detection.
  • the single molecule sensitivity of Cas sensor and the potential to apply electronic target concentration, provide for a novel level of sensitivity, which provides the advantage that the assay can have a larger dynamic range for detection, and can accept lower amounts of input sample material; and [00337] Direct detection of RNA.
  • the primary material for gene expression is always single stranded RNA. Because the Cas13 enzyme can target this directly, Cas13 sensors could be used with minimal or no sample preparation. Combined with the enhanced sensitivity, this may allow analysis of the primary RNA or mRNA materials extracted from the samples, with no conversion or amplification as is commonly done for DNA microarray gene expression. This has the further advantage of not distorting the relative abundance of the transcripts through such manipulations, so that analysis of expression levels can be more accurate.
  • Micro RNA analysis shares many similarities to gene expression assays in that the targets are expressed RNA molecules, and considerations above that would apply in this context are meant to be included without further repetition.
  • Micro RNA are non-coding RNA that play regulatory and signaling roles in humans, as well as in animals, plants and some viruses. In particular, free (extra-cellular) miRNA circulate in human blood and the abundance patterns can indicate different disease conditions. It is desirable to be able to detect and quantify the levels of a set of miRNAs is various bio-samples. These miRNAs are single stranded RNA, typically 22 bases long.
  • a set of miRNA sequence targets of interest are targeted using corresponding Cas13 guide RNAs with 22 base recognition sequences.
  • These Cas13:crRNA are assembled onto a sensor array chip.
  • a suitable preparation which may be the crude materials, such as blood, or may be the product of a miRNA extraction, is applied to the array, and the Cas13 sensors are used to directly detect the miRNA. This has the advantage of providing a direct assay on the miRNA without amplification or conversion of these to other forms. This may have the advantage of allowing rapid tests for miRNA in blood, directly from the blood sample with little or no processing.
  • Aptamer Switch Detection Assays are single stranded DNA or RNA oligonucleotides that have been selected to have a sequence that specifically binds a target, which may be a protein, a small molecule, or more complex targets such as a cell wall or viral capsule. Aptamers are typically in the range of 30 to 80 bases long. For many such aptamers, it is possible to make a complementary oligonucleotide that matches (exactly, or with mismatches) against a portion of the aptamer, and which is displaced when the aptamer binds to its target.
  • This displaced oligonucleotide may then dissociate from the aptamer, or in other embodiments it may be attached to the aptamer (such as an extension on the 3’ or 5’ end, or by a tether to the aptamer) and remain attached after it has been displaced by the target ligand of the aptamer.
  • This displaceable oligonucleotide may be referred to as a “switch” oligonucleotide (in analogy with a riboswitch, which has similar functionality in biological systems).
  • a CRISPR Cas enzyme sensor array can be used for the multiplex readout of these aptamers engaging their targets, and thus these aptamers and the corresponding Cas sensor array chip provide a method for multiplex detection of the targets.
  • guide RNAs are constructed that target the switch oligonucleotides, and these are assembled into a CRISPR Cas enzyme/crRNA sensor array chip.
  • the target of such oligonucleotides may in preferred embodiments be a detection sequence segment of the oligonucleotide that is present in addition to the portion that was hybridized to the aptamer. For a sample to be tested, it is mixed with the switch aptamer solution and applied to the sensor chip for readout.
  • the CRISPR Cas enzyme/crRNA-based sensors provide for the detection of the switch oligonucleotides.
  • the switch oligonucleotides are detected directly.
  • the switch oligonucleotides undergo an amplification process, such as an isothermal amplification, to increase the sensitivity and reduce the time to detection.
  • the switch oligonucleotides may be concentrated near the sensors using electronic concentration methods, to increase sensitivity and reduce the time to detection.
  • the Cas enzyme used is Cas14, or any Cas enzyme that targets ssDNA, and the switch oligonucleotide is a single stranded DNA, or the enzyme is Cas 13, or any Cas enzyme that targets ssRNA and the switch oligonucleotide is single stranded RNA. It is an advantage of the method using aptamers and switches that the Cas sensor array chip thus configured can detect a great diversity of molecular targets, in multiplex, including proteins, small molecules, entire cells or portions of cells, or viral capsids.
  • DNA Tag Reporter Assays There are many assays in which the internal reporter of detection is initially the generation of a DNA oligonucleotide tag that is subsequently read out. Such assays have been constructed for multiplex detection of targets, in conjunction with DNA microarrays for readout.
  • the detection targets of such assays can be of many types, such as nucleic acids, proteins, small molecules, protein-protein interactions, receptor-ligand interactions, or cells.
  • the DNA reporter tag is an oligomer, often 18 to 40 bases long, the sequence of which uniquely encodes the detection event.
  • the encoding portion may be part of a larger “carrier” DNA oligomer.
  • the reporter tag may be released from a previously inaccessible state as part of the detection event, or may be constructed by processes of cleavage, ligation, or polymerase extension, from parts that are brought together during the detection event, and/or may undergo isothermal or other amplification as part of the detection event.
  • DNA reporter tags is Molecular Inversion Probes, which are linear ssDNA that are ligated into circles by interaction with their target, and then undergo Rolling Circle Amplification.
  • a CRISPR Cas enzyme sensor array chip can provide the multiplex readout, with the details, variations and benefits of the same outlined above.
  • the assay is constructed so that the DNA reporter encoding segment can be the target of a Cas enzyme.
  • Corresponding crRNA for the tag reporter sequences are produced, and assembled into a sensor array chip comprising CRISPR Cas enzyme/crRNA sensors, providing multiplex and redundant detection of the reporter tags.
  • the tag reporter assay is applied to a sample and the sample applied to the sensor array chip, either in sequential steps or in a single reaction volume, whereby the sensors sense the presence in the sample, either through the primary engagement with their respective targeted Cas enzymes, or through the secondary activation of such enzymes to a nonspecific nuclease state, provided with substrate, or through the combination of both such sensor signatures.
  • DNA Microarray Assays [00346] From the embodiments disclosed above, many variations are contemplated including variations that allow the disclosed CRISPR Cas enzyme/crRNA sensor array chips and methods to be modified to perform comparable assays as developed for DNA microarrays. The assays disclosed herein are not meant to be limiting, and all such variations and modifications of the assays disclosed are meant to be included in the scope of this disclosure.
  • CRISPR Cas enzyme/crRNA sensor array chips and methods disclosed provide many benefits relative to DNA microarray assays, as noted above, including label-free detection, rapid detection, Cas enzyme-enhanced specificity of target binding, single-molecule sensitivity, electronic target amplification, direct detection of desired targets, less sample preparation, and the ability to be deployed on a CMOS chip device and to be configured as an all-electronic (and non- optical) platform.
  • detection assay methods disclosed for CRISPR Cas enzyme/crRNA sensor array chips can also be used for various other applications. For example, these sensor devices can be used for pathogen detection, such as for viruses, bacteria, fungi, or parasites.
  • the sensor array is targeted at sequence identifiers for the target pathogens of interest, using sequence targets about 18 to 40 bases in length from the pathogen genomes, and then, in use, a bio-sample is acquired, genomic DNA material is extracted from it, prepared and provided to the sensor chip, whose detection report out is then converted to a report as to where target genomes were detected along with a measure of the abundance of each genome in the sample.
  • FIG. 93 illustrates various embodiments of pathogen detection, in which pathogens in the environment 9301 are collected in a sample 9302a/9302b, which undergoes sample preparation 9303 to suitably extract and possibly purify and possibly amplify the genomic material (DNA, or RNA for some viruses).
  • this preparation is done on a sample preparation instrument or module, prior to putting the sample on the sensor chip 9305 present in a suitable instrument 9304 that operates the chip 9305 and manages the data transfer and processing, and provides a local report 9306 on the results of the pathogen detection.
  • the resulting data is also sent 9307 to a central or cloud- based database 9308, where it can be aggregated and analyzed 9309 for surveillance and rapid response applications 9310.
  • pathogens for detection by the sensor arrays of the present disclosure comprise infectious disease pathogens. In various embodiments, these are viral infection disease pathogens.
  • methods herein include testing for SARS-CoV-2, possibly in multiplex with other relevant respiratory viruses, such as influenza A, B, RSV and cold viruses, or other coronaviruses, and also including multiple genetic variants or strains of these viruses.
  • the sample may be diagnostic samples taken from an individual via saliva or nasal swabs, or the sample may comprise environmental samples captured from air, wastewater, or from surfaces.
  • pathogens for detection comprise infectious disease pathogens for sexually transmitted diseases (STD), such as Herpes, HPV or HIV viruses, and the application is testing for infection status.
  • pathogens for detection comprise bacterial pathogens responsible for food-borne illness, such as E.
  • the polymerase complexing onto a primer-oligonucleotide template bound on a bridge molecule is comparable to a Cas enzyme complexing to a crRNA tethered to the bridge molecule.
  • Sensor signal traces that result from the sensing of hybridization probe binding are similar to sensor signal traces that may result from the CRISPR Cas enzyme/crRNA complex binding a target DNA.
  • the perturbations in the current-time traces resulting from polymerase activity are representative of those perturbations that may result from the non-specific exonuclease activity of the activated Cas enzymes wired into molecular electronics sensor circuits.
  • these sensors consist of a DNA oligonucleotide probe 9412 conjugated via conjugation 9413 to an alpha-helical peptide bridge molecule 9405 bound to and connecting a pair of ruthenium (Ru) nanoelectrodes 9401/9402, thus bridging the two across the nanogap 9403.
  • ruthenium (Ru) nanoelectrodes 9401/9402 a pair of ruthenium (Ru) nanoelectrodes 9401/9402, thus bridging the two across the nanogap 9403.
  • a plurality of these devices were deployed on a 16k pixel array CMOS chip device, with a 20 micron pixel pitch, fabricated in a 180 nm CMOS node. This configuration is represented generally by the chip and pixel architecture shown in FIG.91. [00356] FIG.
  • the nanoelectrode geometry comprises a nanogap between the two electrodes of about 15 nm to about 20 nm (labeled on the SEM as “Gap”), an electrode height of about 20 nm, and an electrode width (looking down onto the electrodes from above) of about 50 nm.
  • the nanoelectrodes connect to exposed vias (800 nm) on the chip surface that in turn connect the sensor into the pixel amplifier circuit as in the schematic of FIG.
  • each molecular electronics sensor present in each sensor pixel comprises a source electrode 9401, a drain electrode 9402 spaced-apart from the source electrode 9401 by the nanogap 9403, and a bridge molecule 9405 conjugated to both the source and drain electrodes.
  • the hybridization probe 9412 is conjugated to the bridge molecule 9405 by linker 9413.
  • the bridge molecule 9405 comprises metal binding peptide portions 9406 at each end for conjugation to the metal electrodes.
  • a crRNA molecule would be similarly conjugated to the bridge molecule 9405 in making molecular electronic sensors comprising a CRISPR Cas enzyme/crRNA complex.
  • the bridge molecule 9405 used in the plurality of sensors in this experimental sensor array chip is a 227 amino acid sequence polypeptide capable of forming an alpha-helical protein structure: [00359] QQSWPISGSGQQSWPISGSGQQSWPISGSGAEAAAREAAAREAAAREAAAREAAAR EAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREACARE AAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREAAAREA AAREAAAREAAAREAAARAGSGQQSWPISGSGQQSWPIS (SEQ ID NO: 6) [00360] In various embodiments, a polypeptide having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity to SEQ ID NO: 6 may be used as a bridge molecule herein.
  • the structure of this peptide comprises a repeat of the helix-promoting motif EAAAR (SEQ ID NO: 4), wherein a centrally located amino acid is replaced by a C to allow for cysteine-mediated conjugation between the polypeptide 9405 and the hybridization probe molecule 9412 as indicated in FIG. 94B.
  • the two termini 9406 of this peptide 9405 consist of the repeats QQSWPISGSGQQSWPISGSGQQSWPISGSG (SEQ ID NO: 7), which comprise three repetitions of the metal binding peptide QQSWPIS (SEQ ID NO: 2), separated by short GSG spacers, which provides for binding of the peptide bridge molecule 9405 to the metal electrodes 9401/9402.
  • the length of this 227 amino acid peptide bridge molecule is approximately 25 nm. It can be used to bridge nanoelectrode gaps in the range of from about 15 to about 20 nm.
  • This peptide was produced by bacterial protein expression of a synthetic gene encoding the peptide.
  • the conjugation 9413 of the hybridization probe 9412 to the bridge 9405 was achieved using a bifunctional cross-linker usable for thiol-to-azide linking, abbreviated APN-BCN, which is bicyclo[6.1.0]non-4-yn-9-ylmethyl (4-(cyanoethynyl)phenyl)carbamate.
  • the conjugation product between APN-BCN and the peptide is purified using a desalting spin-column, and the product peptide reacted with a variety of hybridization probe oligonucleotides having an azide at the 5’ end, such that the 5’ end is conjugated proximal to the bridge through the APN-BCN linker.
  • the various peptide/DNA complexes thus resulting are purified by size-exclusion chromatography with structures verified by SDS Gel electrophoresis.
  • the relative quantities of fluorescein (for the labeled hybridization probe), DNA and tryptophan were checked by UV-vis spectroscopy.
  • the hybridization probe 9412 conjugated to the peptide bridge molecule 9405 has the 19-mer oligonucleotide sequence: [00364] 5’-ACGTAGCAGGTGACAGGTT-3’ (SEQ ID NO: 8).
  • the experimental target primer used for testing this particular hybridization probe was a 14- mer oligonucleotide having the sequence: [00366] 5’-AACCTGTCACCTGC-3’ (SEQ ID NO: 9).
  • FIG.95 when the probe 9520 and the primer 9521 are hybridized to form a DNA duplex 9522, a sequence of five (5) bases on the bridge end of the hybridization probe are left unpaired to the primer.
  • a fluorescein dye can be attached to a free hydroxyl group at the 3’ end of any of the hybridization probes in any of the sensor structures herein.
  • the relative quantities of fluorescein for labeled sequences can be checked by UV-vis spectroscopy, for example.
  • FIG. 96 shows a signal pixel trace obtained from the 19-mer hybridization probe sensor deployed on the 16k pixel chip (FIG. 94A/B). In the region of the trace 9630 marked “Buffer Only,” the 14-mer hybridization target SEQ ID NO: 9 has not yet been introduced to the sensor.
  • the target 14-mer SEQ ID NO: 9 is then added into the solution provided to the sensor, typically at a 1 ⁇ M concentration, giving rise to the signal trace portion 9640 marked “+ Add Primer.”
  • the signal trace reproduced in FIG. 96 covers approximately 1200 seconds of signal monitoring. Viewed at this high level, it is clear that more frequent and greater amplitude signal spikes occur once the primer is added to the sensor, as a result of primer hybridization events. The current levels and fluctuations observed are on the scale of about 20 to about 30 pA.
  • FIG. 97A reviews the general sensor structure used in the experiments and primer binding in use.
  • the molecular electronics sensor comprises a source electrode 9701 and a drain electrode 9702 spaced-apart from the source electrode 9701 by a nanogap.
  • the two electrodes in the pair are disposed on a common substrate 9704.
  • the electrodes are electrically connected by bridge molecule 9705 spanning the nanogap and bridging over the substrate 9704.
  • the hybridization probe 9720 is attached to the bridge molecule 9705 by conjugation 9713, such as a linker, as described above.
  • the “off” state of the sensor is shown at left in FIG. 97A.
  • the hybridization probe 9720 binds its target primer oligonucleotide 9721 (“primer binding”) to form the duplex 9722, which is denoted as the “on” state of the sensor shown in the structure at right in FIG.97A.
  • FIGS. 97B and 97C show progressively expanded portions of the signal trace from the “+ Add Primer” region of the trace in FIG. 96, with FIG. 97B showing the portion of the trace from about 1140 seconds to about 1220 seconds, and with FIG. 97C showing only an 8 second interval from about 1189 seconds to about 1197 seconds.
  • FIG. 98 shows a high level signal trace (current response) of the sensor on the chip when the concentration of target is raised from 10 nM to 100 nM and to 1000 nM (1 ⁇ M) over the course of about 1500 seconds. It is clear from examining the three portions of this signal trace in FIG.98 that the nature of the signals, e.g., frequency of “on” state,” changes as the concentration of the target primer increases.
  • FIGS.99A, 99B and 99C show signal traces and corresponding expanded regions of the signal traces obtained for the three concentrations of 14-mer primer, as well as histograms showing the relative times the primer/probe spent in the “on” (primer hybridized) and “off” states (primer and probe as separate strands). From the expanded signal traces, it is clear that the rate of signal spiking increases in frequency as the concentration of the primer target increases from 10 nM to 100 nM and to 1000 nM, and also that the relative proportion time the sensor is in the “on” state increases, while the amplitude of the current remains nearly constant.
  • FIG. 100 illustrates a plot of “Fraction of Time Bound” versus Primer Concentration (nM), with a curve fit to the data points (shown as “X’s,” at 10 nM, 100 nM, and 1000 nM). The data are fit to a standard exponential decay curve. The curve thus provides a calibration curve usable to obtain the concentration for a primary measurement such as “on” fraction.
  • FIG.101 shows the results from an experimental hybridization sensor configured with a longer oligonucleotide hybridization probe.
  • the longer probe is a 45-mer having the following sequence: [00377] 5’-CGATCAGGCCTTCACAGAGGAAGTATCCTGTCGTTTAGCATACCC-3’ (SEQ ID NO: 10).
  • FIG. 101 shows signaling results obtained using the sensor configured with the 45-mer hybridization probe for 1-base (SingB15) and 3-base (3TRIP) mismatched target sequences, relative to the signaling observed for the perfect match (Match20) target sequence.
  • the primer targets are Match20, having the oligonucleotide sequence 3’-CCTCTGTGAAGGCCTGATCG-5’ (SEQ ID NO: 21); SingB15, having the oligonucleotide sequence 3’-CCTCTCTGAAGGCCTGATCG-5’ (SEQ ID NO: 44); and 3TRIP, having the oligonucleotide sequence CCAGAGTGAAGGCCTGATCG (SEQ ID NO: 31).
  • the signal trace obtained for the single base mismatch (SingB15) target is clearly changed in appearance from the signal trace obtained for the perfect match target (Match20), with lower “on” time as expected as well as reduced current signal amplitude.
  • the triple mismatch target (3-base mismatch scenario, using 3TRIP as the target) produced a signal trace even further reduced in both “on” time and signal amplitude.
  • the polymerase binds to a primer site, with a free 3’ end and template strand, and supplied with proper dNTPs (deoxynucleotide triphosphates), extends the primer by a base, and repeats until the end of the template is reached, or when the polymerase dissociates from the primer, or when the dNTP supply is exhausted.
  • the primer concentration is 100 nM (nano-Molar) for the priming of the targets on the sensors.
  • the polymerase used is Klenow, used at 50 nano-Molar concentration, unless otherwise indicated.
  • Two different buffer compositions are used, one with Mg 2+ and Mn 2+ as the divalent metal cation co-factors for the enzyme, in which the enzyme is catalytic, and can extend, and a version where these are instead replaced by strontium, at the same concentration, producing Sr 2+ as the divalent metal cation co-factor for the enzyme, in which case the enzyme is not catalytic, and therefore will preferentially engage the dNTPs but cannot incorporate and extend the primer. Instead, it stays in a dNTP sampling mode, with these transitioning in and out of the enzyme binding pocket. dNTPs are added at a typical concentration of 20 ⁇ M (micro-Molar) concentration.
  • the Sr version of the buffer features the Mg replaced by Sr, and this form of the buffer is non-catalytic to prevent dNTP incorporation by the enzyme.
  • FIG. 103A illustrates a molecular electronics sensor comprising a primer/template duplex structure binding a polymerase enzyme. This type of sensor was used to produce the data shown in FIGS. 103B and 103C. [00383] FIG.
  • FIG.103B shows the signal pulses produced by docking of the polymerase to the primer/template duplex tethered to the bridge.
  • FIG.103C presents a graph of the docking pulse rate titrated against polymerase concentration. The graph of FIG. 103C shows that the rate of pulses increases approximately linearly with polymerase concentration.
  • This experimentally observed polymerase-primer docking process is comparable to the manner in which a Cas enzyme will complex with its tethered crRNA, and therefore illustrates the reduction to practice of the general oligonucleotide tethering and enzyme recruitment process.
  • FIG. 105 Shown in Figure 105 are summary results from binding experiments using Cas12a enzyme, programmed by a guide RNA designed to detect a 20 base DNA sequence from the S gene of the SARS- CoV-2 virus with a nucleic acid sequence TAATTTCTACTCTTGTAGAT GAGTC CAACC AACAG AATCT having SEQ ID NO:45 (target sequence shown in Figure 105, left).
  • the guide RNA (underlined sequence) was conjugated to the peptide bridge in two different embodiments, wherein two different specific sites in the RNA were conjugated to the bridge.
  • the resulting guide RNA bridge was assembled onto a sensor array CMOS chip, which was then first used to observe dose-response titrations.
  • the first such titration was of the Cas12a enzyme binding to the guide RNA on the bridge, over a Cas12a protein concentration range of 0-1 ⁇ M.
  • Figure 106 shows a current-vs.-time signal trace from one exemplar pixel from the 16k sensor CMOS chip, from the experiment looking at titrating the concentration of the target dsDNA. As annotated on the trace shown, there is a baseline phase (labeled BS), where the bridge with guide RNA tether is present, to establish baseline noise levels.
  • BS baseline phase
  • the next phase is the period of Cas12a enzyme binding to guide RNAs.
  • the subsequent phases are different concentrations of target dsDNA present to the sensor, from 0.125 pico-Molar to 64 pico-Molar (labeled as such).
  • Magnesium is added (labeled Mg ++ ) so that the nuclease activity of Cas12a is fully activated.
  • a single stranded DNA oligomer is added (20-mer ssDNA), as a substrate to observe the non-specific nuclease activity of Cas12a that has already engaged and cut the specific programmed dsDNA target.
  • Figures 107 through 110 show representative time segments of the signal traces from the different dsDNA target concentration phases, overlaid with the Hidden Markov Method (HMM) state classification (black dashed lines) that identifies the bound and un-bound states.
  • HMM Hidden Markov Method
  • the histograms at right are distributions of the observed current measurements in the traces shown, with identification of the “bound fraction”, i.e. the fraction of time spent in the bound state. As expected, this fraction bound generally increases with dsDNA concentration, resulting in the measures summarized in Figure 105
  • Figure 111 and Figures 112 through 116 respectively, show the same data for another exemplar pixel from the same 16k CMOS chip and experiment.
  • Figure 111 shows the entire pixel signal trace
  • Figures 112 through 116 show time segments from the different phases, and the corresponding quantification of the traces to measure the bound fractions.
  • the guide RNA used was RNA SEQ1: (rUrArArUrUrUrCrUrArCrUrC/iAzideN/rUrGrUrA rGrArUrGrArGrUrCrCrArArCrArArGrArArUrCrU) (SEQ ID NO:46, obtained as a synthetic RNA oligomer from Integrated DNA Technologies).
  • the double-stranded target DNA was DNASEQ1: [00392] 5'-AACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATATCCTA-3’ SEQ ID NO:47 (obtained as a synthetic DNA oligomer from Integrated DNA Technologies). These experiments were performed in a buffer consisting of 20 mM Tris ⁇ HCl pH 8.0, 20 mM KCl, 10 mM SrCl2, 4 mM DTT.
  • CMOS Sensor Chips [0039395] The proprietary CMOS sensor array chips used in this study were designed at Roswell Biotechnologies Inc. and fabricated at TSMC in Taiwan, using a 180nm CMOS node. These chips present a 16k (16,384) sensor pixel array. Pixels are post-processed to have Ruthenium nano-electrodes exposed on the solution-facing surface of the chip, with such electrodes fabricated using e-beam lithography, and sputtering deposition and lift-off techniques.
  • the 16k electrodes were fabricated to have various nano-gap sizes in different ranges: 10-12 nm, 14-16 nm, 17-20nm and 20-30 nm. Gaps of 14-20 nm proved best for the present experiments, and other sizes were not analyzed for present experiments.
  • the chips were mounted in custom-built instruments to supply support to chip operations and sensor pixel data collection. The data is collected from the 16k sensor array at a frame rate of 1000Hz, and current measurements have 10 bits of resolution. The resulting current-vs. time traces are analyzed using a Hidden Markov Method (HMM) to segment the traces into bound and un-bound states.
  • HMM Hidden Markov Method
  • Alpha-helical Peptide bridge preparation The peptide has an alpha-helix conformation ( ⁇ 25 nm long) formed by repeats of the EAAAR amino-acid motif, with an N-terminal FLAG sequence and three repeats of a metal-binding peptide motif at each terminus, and GSG spacer-linkers separating elements. A single cysteine is located in the middle of the peptide as functionalization site for attachment of probes using alkyne/azide click chemistry.
  • BRIDGE SEQ1 (molecular weight: 24,371 Daltons) [00397] BRIDGE SEQ1: [00398] MDYKDDDDKGSGSGS(QQSWPISGSG) 3 A(EAAAR) 16 EACAR(EAAAR) 16 A(GSGQQSW PIS) 2 GSGQQSWPIS (SEQ ID NO: 48) [00399] (FLAG tag, central C, and metal-binding 7-mer peptide QQSWPIS are underlined for clarity) [00400] The peptide was prepared by standard means of protein expression in bacteria.
  • cysteine was first modified using a thiol-reactive (45) 3- arylpropiolonitrile (APN)-PEG4- bicyclo [6.1.0] nonyne (BCN) (Conju-Probe, San Diego, CA) yielding a reactive bicyclo nonyne alkyne on the peptide.
  • APN thiol-reactive 3- arylpropiolonitrile
  • BCN nonyne
  • 100 ⁇ L of peptide solution (3 to 4 mg/mL in PBS) was first mixed with freshly prepared DTT or TCEP (2 mM final) and left at room temperature for an hour.
  • APN-BCN reagent dissolved in DMSO (1 M stock), is added to a final concentration of 0.01 M and mixed thoroughly by pipetting. The reaction is left at 4°C for a minimum of 48 hours. The excess APN-BCN is removed by size-exclusion chromatography. The purified peptide-BCN is stored at - 20°C until needed. to do further click with oligos designed with an azide to obtain the bridges used in this study. The reaction of BCN-azide was performed in PBS at molar excess of the oligo-azide to purified peptide-BCN prep. The final reaction was further chromatographically purified to more than 95%.
  • oligos were blocked at the free 3’ end with a fluorescent dye (FAM or Cy3 to help detection of peptide on SDS-PAGE).
  • FAM fluorescent dye
  • Cy3 Cy3 to help detection of peptide on SDS-PAGE.
  • a gel shift on SDS-PAGE confirmed the bridge conjugation to oligos.
  • the chosen sequence (rUrA rArUrU rUrCrU rArCrU rC/iAzideN/rU rGrUrA rGrArU rGrArG rUrCrC rArArC rCrArArG rArArU rCrU , SEQ ID NO:46) was synthesized and attached to the sensor bridge peptide using click chemistry as described.
  • the Cas12a enzyme was purchased from Integrated DNA Technologies and used as obtained (Cas12a [Cpf1] V3, #1081068).
  • the target DNA strands were a 50-mer having the sequence 5'- AACTTCTAACTTT AGAGTCCAACCAACAGAATCTATTGTTAGATATCCTA (SEQ ID NO:49) were mixed at equimolar concentrations, heated to 95oC and slowly cooled to 4oC. [00403] In other embodiments, a portion of the nucleic acid sequence of gene S from COVID-19 is used to make particular gRNA’s.
  • a nucleic acid probe may for example comprise a nucleic acid sequence of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45 or 50 contiguous nucleotides of a pathogen of interest described herein.
  • a nucleic acid probe may comprise a nucleic acid sequence of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 to 35, 35 to 40, 40 to 45, or 45 to 50 contiguous nucleotides of a pathogen of interest described herein.
  • a nucleic acid probe may comprise any range of consecutive nucleic acid sequence numbering between 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25, such as a range between 5 and about 20 contiguous nucleotides of a pathogen, between 4 and about 18 contiguous nucleotides of a pathogen, between 5 and about 15 contiguous nucleotides of a pathogen, between 6 and 12 contiguous nucleotides of a pathogen, etc.
  • references to “various embodiments”, “one embodiment”, “an embodiment”, “an example embodiment”, etc. indicate that the embodiment described may include a particular feature, structure, or characteristic, but every embodiment may not necessarily include the particular feature, structure, or characteristic. Moreover, such phrases are not necessarily referring to the same embodiment. Further, when a particular feature, structure, or characteristic is described in connection with an embodiment, it is submitted that it is within the knowledge of one skilled in the art to affect such feature, structure, or characteristic in connection with other embodiments whether or not explicitly described. After reading the description, it will be apparent to one skilled in the relevant art(s) how to implement the disclosure in alternative embodiments.
  • Steps recited in any of the method or process descriptions may be executed in any order and are not necessarily limited to the order presented.
  • any reference to singular includes plural embodiments, and any reference to more than one component or step may include a singular embodiment or step.
  • any reference to attached, fixed, connected, coupled or the like may include permanent (e.g., integral), removable, temporary, partial, full, and/or any other possible attachment option. Any of the components may be coupled to each other via friction, snap, sleeves, brackets, clips or other means now known in the art or hereinafter developed. Additionally, any reference to without contact (or similar phrases) may also include reduced contact or minimal contact. [00408] Benefits, other advantages, and solutions to problems have been described herein with regard to specific embodiments.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Nanotechnology (AREA)
  • Biophysics (AREA)
  • Electrochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Selon divers modes de réalisation de la présente divulgation, un capteur électronique moléculaire comprenant un complexe enzyme CRISPR Cas/ARNr est décrit. Le capteur électronique moléculaire CRISPR Cas enzyme/ARNcr peut être l'un d'une pluralité de tels capteurs disposés dans un réseau de capteurs sur une puce CMOS. La puce du réseau de capteurs est capable de détecter des cibles d'acide nucléique s'hybridant avec l'ARNcr et/ou se complexant avec l'enzyme Cas de CRISPR dans les pixels individuels des capteurs, où les interactions moléculaires et/ou l'activité de l'enzyme Cas sont perçues comme des perturbations dans un paramètre électrique mesuré des circuits de capteurs, comme des signaux ou une signature de signaux dans une trace de courant en fonction du temps.
PCT/US2021/046581 2020-12-21 2021-08-18 Circuits enzymatiques crispr pour capteurs électroniques moléculaires WO2022139886A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063128409P 2020-12-21 2020-12-21
US63/128,409 2020-12-21

Publications (1)

Publication Number Publication Date
WO2022139886A1 true WO2022139886A1 (fr) 2022-06-30

Family

ID=82158320

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/046581 WO2022139886A1 (fr) 2020-12-21 2021-08-18 Circuits enzymatiques crispr pour capteurs électroniques moléculaires

Country Status (1)

Country Link
WO (1) WO2022139886A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190112643A1 (en) * 2017-08-04 2019-04-18 Keck Graduate Institute Immobilized RNPs for sequence-specific nucleic acid capture and digital detection
WO2019222527A1 (fr) * 2018-05-17 2019-11-21 Stuart Lindsay Dispositif, système et procédé de mesure électrique directe d'activité enzymatique

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190112643A1 (en) * 2017-08-04 2019-04-18 Keck Graduate Institute Immobilized RNPs for sequence-specific nucleic acid capture and digital detection
WO2019222527A1 (fr) * 2018-05-17 2019-11-21 Stuart Lindsay Dispositif, système et procédé de mesure électrique directe d'activité enzymatique

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BRUCH RICHARD; URBAN GERALD A.; DINCER CAN: "Unamplified gene sensing via Cas9 on graphene", NATURE BIOMEDICAL ENGINEERING, NATURE PUBLISHING GROUP UK, LONDON, vol. 3, no. 6, 7 June 2019 (2019-06-07), London , pages 419 - 420, XP036799470, DOI: 10.1038/s41551-019-0413-4 *
FOROUHI SAGHI, GHAFAR-ZADEH EBRAHIM: "Applications of CMOS Devices for the Diagnosis and Control of Infectious Diseases", MICROMACHINES, vol. 11, no. 11, pages 1003, XP055945331, DOI: 10.3390/mi11111003 *
HAJIAN REZA; BALDERSTON SARAH; TRAN THANHTRA; DEBOER TARA; ETIENNE JESSY; SANDHU MANDEEP; WAUFORD NOREEN A.; CHUNG JING-YI; NOKES : "Detection of unamplified target genes via CRISPR–Cas9 immobilized on a graphene field-effect transistor", NATURE BIOMEDICAL ENGINEERING, NATURE PUBLISHING GROUP UK, LONDON, vol. 3, no. 6, 25 March 2019 (2019-03-25), London , pages 427 - 437, XP036799471, DOI: 10.1038/s41551-019-0371-x *

Similar Documents

Publication Publication Date Title
US20240003892A1 (en) Heterogeneous single cell profiling using molecular barcoding
US20230204538A1 (en) Methods and apparatus for measuring analytes using large scale molecular electronics sensor arrays
US10036064B2 (en) Biomolecular sensors and methods
Zhang et al. Programming nanopore ion flow for encoded multiplex microRNA detection
Paniel et al. Aptasensor and genosensor methods for detection of microbes in real world samples
Sassolas et al. DNA biosensors and microarrays
US20190094175A1 (en) Molecular sensors and related methods
JP4759707B2 (ja) ナノスケール電子式検出システムおよびその製造方法
US20220213531A1 (en) Molecular electronic sensors for genetic analysis by hybridization
US20070259359A1 (en) Nanoelectronic Detection of Biomolecules Employing Analyte Amplification and Reporters
AU2006335690A1 (en) Biosensor cell and biosensor array
WO2005075638A1 (fr) Dispositif à effet de champ pour détecter les gènes et procédé d’analyse du polymorphisme des gènes avec ce dispositif
JP2010532485A (ja) ナノｆｅｔを含む電子検出のためのシステムおよび方法
Gabig-Ciminska Developing nucleic acid-based electrical detection systems
Zhang et al. Gene detection: an essential process to precision medicine
WO2020023946A1 (fr) Dispositif à nanopores et procédés de détection de particules chargées utilisant ce dernier
US20240026471A1 (en) Molecular electronic sensors for multiplex genetic analysis using dna reporter tags
EP2007379A2 (fr) Detection nanoelectronique de biomolecules en employant l'amplification des analytes et des rapporteurs
Mittal et al. Amplifying Quantum Tunneling Current Sensitivity through Labeling Nucleotides Using Graphene Nanogap Electrodes
US20220282311A1 (en) Molecular electronic sensors for detecting sars-cov-2 virus
Cao et al. Nucleic acid amplification-free detection of DNA and RNA at ultralow concentration
WO2022139886A1 (fr) Circuits enzymatiques crispr pour capteurs électroniques moléculaires
JP2010524459A (ja) 未知の生体分子と一本鎖核酸の結合プロファイルを生成するための核酸チップ、核酸チップの製造方法、及び核酸チップを利用した未知の生体分子分析方法
WO2001025481A1 (fr) Procede de detection d'acide nucleique
WO2022266398A1 (fr) Procédé, système et appareil destiné à des mesures de molécule unique de cinétique de liaison et d'activités enzymatiques à l'aide de capteurs électroniques moléculaires

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21911775

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21911775

Country of ref document: EP

Kind code of ref document: A1