WO2022119348A1 - 유도만능줄기세포 유래 혈관세포 및 sdf1a를 발현하는 중간엽줄기세포를 포함하는 심장 재생용 조성물 - Google Patents
유도만능줄기세포 유래 혈관세포 및 sdf1a를 발현하는 중간엽줄기세포를 포함하는 심장 재생용 조성물 Download PDFInfo
- Publication number
- WO2022119348A1 WO2022119348A1 PCT/KR2021/018112 KR2021018112W WO2022119348A1 WO 2022119348 A1 WO2022119348 A1 WO 2022119348A1 KR 2021018112 W KR2021018112 W KR 2021018112W WO 2022119348 A1 WO2022119348 A1 WO 2022119348A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sdf
- stem cells
- composition
- cells
- hipsc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/48—Reproductive organs
- A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
- A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/44—Vessels; Vascular smooth muscle cells; Endothelial cells; Endothelial progenitor cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/70—Web, sheet or filament bases ; Films; Fibres of the matrix type containing drug
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/70—Web, sheet or filament bases ; Films; Fibres of the matrix type containing drug
- A61K9/7023—Transdermal patches and similar drug-containing composite devices, e.g. cataplasms
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/3604—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix characterised by the human or animal origin of the biological material, e.g. hair, fascia, fish scales, silk, shellac, pericardium, pleura, renal tissue, amniotic membrane, parenchymal tissue, fetal tissue, muscle tissue, fat tissue, enamel
- A61L27/3625—Vascular tissue, e.g. heart valves
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/3604—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix characterised by the human or animal origin of the biological material, e.g. hair, fascia, fish scales, silk, shellac, pericardium, pleura, renal tissue, amniotic membrane, parenchymal tissue, fetal tissue, muscle tissue, fat tissue, enamel
- A61L27/3633—Extracellular matrix [ECM]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
- A61L27/3804—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells characterised by specific cells or progenitors thereof, e.g. fibroblasts, connective tissue cells, kidney cells
- A61L27/3834—Cells able to produce different cell types, e.g. hematopoietic stem cells, mesenchymal stem cells, marrow stromal cells, embryonic stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
- A61L27/507—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials for artificial blood vessels
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2430/00—Materials or treatment for tissue regeneration
- A61L2430/20—Materials or treatment for tissue regeneration for reconstruction of the heart, e.g. heart valves
Definitions
- the present invention relates to a composition for cardiac regeneration comprising simultaneously induced pluripotent stem cells differentiated into vascular cells and mesenchymal stem cells expressing SDF-1 ⁇ .
- IHD Ischemic heart diseases
- MI myocardial infarction
- coronary artery injury is one of the most important pathophysiological causes in myocardial infarction (MI)
- approaches to date have mainly focused on reconstructing functionally perfusable vessels in the ischemic heart through therapeutic angiogenesis.
- therapeutic angiogenesis generally consists of two distinct processes: angiogenesis and vasculogenesis.
- Angiogenesis refers to the growth of existing blood vessels, and angiogenesis is the process of creating new blood vessels from endothelial cells (EC), endothelial progenitor cells (EPC), or other types of stem cells.
- vascular endothelial growth factor VEGF
- FGF fibroblast growth factor
- HGF hepatocyte growth factor
- the modified VEGF RNA indicates that promoting angiogenesis by substantially improving angiogenesis, cardiac function and long-term survival rate is an effective therapeutic strategy for treating a damaged heart.
- angiogenesis is known to occur in both embryonic and adulthood, angiogenesis was considered to occur only during embryonic development.
- angiogenesis is not limited to early embryonic development, but may also have specific physiological roles, contributing to the pathophysiology of postnatal vascular disease.
- This concept is that both EC and EPC in the blood coexist. It is based on the fact that blood vessels can develop in new ways during tumor growth.
- the identification of circulating EPCs in adult vertebrates has suggested a novel functional role for several types of bone marrow-derived cells in postnatal angiogenesis.
- transplantation of EPC, mononuclear cells (MNC) and mesenchymal stem cells (MSC) induces therapeutic angiogenesis in adult ischemic tissues.
- ECs derived from human pluripotent stem cells including human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) have been more It has been found that it has a strong angiogenesis potential, and active research is being conducted on a vascular regeneration approach.
- the present inventors used a composition comprising CD31+ hiPSC-derived endothelial cells (hiPSC-ECs) and genetically engineered mesenchymal stem cells (SDF-eMSCs) derived from human bone marrow that continuously secrete SDF-1 ⁇ .
- hiPSC-ECs hiPSC-derived endothelial cells
- SDF-eMSCs genetically engineered mesenchymal stem cells
- composition for cardiovascular regeneration comprising stem cells capable of differentiating into endothelial cells and mesenchymal stem cells transformed to express SDF-1 ⁇ .
- Another object of the present invention is to provide a method for treating heart disease, comprising administering to an individual a therapeutically effective amount of the composition for cardiovascular regeneration.
- Another object of the present invention is to provide the use of the composition for cardiovascular regeneration in the manufacture of a medicament for the treatment of heart disease.
- the present invention provides a composition for cardiovascular regeneration comprising stem cells capable of differentiating into endothelial cells and mesenchymal stem cells transformed to express SDF-1 ⁇ (stromal cell-derived factor 1 alpha).
- the present invention provides a patch for cardiovascular regeneration comprising the cardiovascular regeneration composition.
- the present invention provides a kit for cardiovascular regeneration comprising a patch for cardiovascular regeneration and endothelial cells (EC).
- EC endothelial cells
- the present invention comprises the steps of (a) preparing a heart-derived decellularized extracellular matrix (ECM); (b) preparing a polymer support; and (c) depositing the composition for cardiovascular regeneration on the polymer support of step (b).
- ECM heart-derived decellularized extracellular matrix
- the present invention provides a pharmaceutical composition for the treatment of heart disease comprising the composition for cardiovascular regeneration.
- the present invention provides a method for treating heart disease, comprising administering to a subject a therapeutically effective amount of the composition for cardiovascular regeneration.
- the present invention also provides the use of the composition for cardiovascular regeneration in the manufacture of a medicament for the treatment of heart disease.
- composition for cardiovascular regeneration of the present invention is administered in combination with endothelial-differentiable stem cells and mesenchymal stem cells transformed to express SDF-1 ⁇ , resulting in the formation of blood vessels by endothelial cells differentiated due to paracrine effect ( Vasculogenesis) and at the same time act on angiogenesis (angiogenesis), it has the effect of efficiently regenerating cardiovascular vessels and treating heart disease.
- hiPSC-ECs CD31 + endothelial cells
- FIG. 3 is an image of capillaries stained perfusion with rhodamine-binding IB4 (red) in the infarct zone (IZ), border zone (BZ) and distant zone 8 weeks after induction of myocardial infarction (MI) and IZ (m), BZ ( n) and the result of quantifying the capillary density per mm 2 of the remote region (o) (Scale Bars: 100 ⁇ m).
- EF left ventricular ejection fraction
- FS left ventricular shortening
- MI myocardial infarction
- MI myocardial infarction
- LIDd left ventricular internal diastolic dimension
- LVISd left ventricular internal systolic dimension
- RWT relative wall thickness
- SWT septal wall thickness
- MI myocardial infarction
- 11 is a result of comparing the secretion amount of SDF-1 ⁇ in SDF-eMSC and bone marrow-derived MSC.
- 15 is a result of confirming the gene expression pattern related to the angiogenic properties by processing a 30% culture medium of SDF-eMSC and BM-MSC in hiPSC-EC, and performing RT-PCR.
- FIG. 16 and 17 show the results of cell migration analysis when hiPSC-EC and HUVEC cells were treated with SDF-eMSC-CM 30% and BM-MSC-CM 30%.
- hiPSC-ECs were placed in transwells (top) and different media (EGM, EBM, BM-MSC-CM and SDF-eMSC-CM) were placed in transwells (bottom) for 7 h.
- 20 is a schematic diagram of a process of making a heart patch using SDF-eMSC and hdECM.
- 21 is a result of measuring SDF1 ⁇ release kinetics from SDF-eMSC-PA.
- FIG. 22 shows the results of left ventricular ejection fraction (EF) and left ventricular shortening rate (FS) after myocardial infarction (MI).
- EF left ventricular ejection fraction
- FS left ventricular shortening rate
- MI myocardial infarction
- EC+PA The results of administration alone or in combination
- the image on the right shows representative images of 4 groups of M-mode at 1 week and 8 weeks after myocardial infarction (MI) induction and without treatment after myocardial infarction (MI).
- LIDd left ventricular internal diastolic dimension
- LVISd left ventricular internal systolic dimension
- RWT relative wall thickness
- SWT septal wall thickness
- MI myocardial infarction
- MI myocardial infarction
- PV 25 shows representative images of hemodynamic pressure and volume (PV) curves for a steady state using a PV loop at 8 weeks after induction of myocardial infarction (MI).
- 26 is a result showing the effect of each experimental group on the stroke volume (SV) during contraction, cardiac output per minute (CO), and the volume of blood discharged from LV (Vmax).
- Figure 27 is after myocardial infarction (MI), the maximum pressure (P max), the maximum pressure change rate (dP / dt max) and the minimum pressure change rate (dP / dt min) measured in the maximum systole measured for each experimental group compared. It is the result.
- FIG. 29 shows the EC distribution of the hiPSC-EC alone group and the EC+PA combination group after myocardial infarction (MI) induction, and it can be seen that the distribution is increased throughout all left ventricular regions when the combination is administered.
- MI myocardial infarction
- IZ infarct region
- BZ border region
- FIG. 30 shows representative images of capillaries stained with rhodamine-binding IB4 (red) in the infarct region (IZ), border region (BZ) and remote region 8 weeks after myocardial infarction (MI).
- Figure 32 shows representative images and quantification of the number of capillaries of 4 groups in which the heart tissue collected 8 weeks after induction of myocardial infarction was stained with Masson's trichrome.
- FIG 33 is a schematic diagram of the hiPSC-EC + SDF-eMSC-PA combined administration method and results showing the effect thereof in the myocardial infarction (MI) induced heart model of the present invention.
- MI myocardial infarction
- the present invention provides a composition for cardiovascular regeneration comprising stem cells capable of differentiating into endothelial cells and mesenchymal stem cells transformed to express SDF-1 ⁇ .
- Cardiovascular regeneration composition of the present invention is angiogenesis (angiogenesis) to grow existing blood vessels; and endothelial cells (EC), endothelial progenitor cells (EPC, endothelial progenitor), or various types of stem cells, which act together in vasculogenesis to generate new blood vessels, especially endothelial cells differentiated from stem cells and , it is characterized in that it also contains mesenchymal stem cells expressing SDF-1 ⁇ , which play a role in promoting the formation of blood vessels therefrom.
- angiogenesis angiogenesis
- EC endothelial cells
- EPC endothelial progenitor cells
- various types of stem cells which act together in vasculogenesis to generate new blood vessels, especially endothelial cells differentiated from stem cells and , it is characterized in that it also contains mesenchymal stem cells expressing SDF-1 ⁇ , which play a role in promoting the formation of blood vessels therefrom.
- endothelial cells refers to epithelial tissue in contact with the lumen of blood vessels, and in particular, may refer to endothelial cells, vascular endothelial cells, or cardiovascular endothelial cells.
- the endothelial cells may be cells differentiated from stem cells, and the types of stem cells are not particularly limited, but human embryonic stem cells (hESC), human induced pluripotent stem cells (hiPSC), pluripotent stem cells (hPSC) and may be selected from the group consisting of mesenchymal stem cells, preferably human induced pluripotent stem cells.
- stem cells are not particularly limited, but human embryonic stem cells (hESC), human induced pluripotent stem cells (hiPSC), pluripotent stem cells (hPSC) and may be selected from the group consisting of mesenchymal stem cells, preferably human induced pluripotent stem cells.
- SDF-1 ⁇ stromal cell-derived factor 1 alpha
- SDF-1 ⁇ stromal cell-derived factor 1 alpha
- MSCs mesenchymal stem cells
- mesenchymal stem cells refers to multipotent stromal cells that can be differentiated into various cells including osteocytes, chondrocytes and adipocytes.
- Mesenchymal stem cells can be differentiated into cells of specific organs, such as bone, cartilage, fat, tendon, nervous tissue, fibroblasts, and muscle cells. These cells can be isolated or purified from adipose tissue, bone marrow, peripheral nerve blood, umbilical cord blood, periosteum, dermis, mesoderm-derived tissue, and the like.
- the mesenchymal stem cells may be immortalized. Specifically, the mesenchymal stem cells may be bone marrow-derived or embryo-derived.
- the mesenchymal stem cells may be immortalized mesenchymal stem cells transduced with hTERT and c-Myc genes.
- the composition may further include a culture medium of mesenchymal stem cells transformed to express SDF-1 ⁇ .
- the composition may further include an extracellular matrix (ECM).
- ECM extracellular matrix
- composition for cardiovascular regeneration of the present invention may be partially prepared in the form of a patch. Accordingly, the present invention provides a patch for cardiovascular regeneration comprising the composition for cardiovascular regeneration.
- the present invention provides a kit for cardiovascular regeneration comprising the patch for cardiovascular regeneration and endothelial cells.
- the endothelial cells may be endothelial cells differentiated from induced pluripotent stem cells.
- the present invention comprises the steps of (a) preparing a heart-derived decellularized extracellular matrix (ECM); (b) preparing a polymer support; and (c) depositing the composition for cardiovascular regeneration according to claim 1 on the polymer support of step (b).
- ECM heart-derived decellularized extracellular matrix
- the patch refers to a patch prepared by mixing SDF-eMSC with cardiac-derived extracellular matrix (hdECM).
- the extracellular matrix may be decellularized and pulverized by a physical method to prepare a particle or matrix state, and may be prepared by a method known in the art.
- the patch may further include vitamin B2.
- the patch was constructed by mixing SDF-eMSC, hdECM and vitamin B2 on a polycaprolactone (PCL) support fabricated through a 3D printer to construct an hdECM patch.
- the SDF-eMSC can construct an hdECM patch by mixing about 1x10 4 to 1x10 6 cell/ml, 1 to 20 mg/ml of hdECM, and 0.0002 to 0.02% (w/v) of vitamin B2, but is limited thereto. not.
- the present invention provides a pharmaceutical composition for the treatment of heart disease, wherein the composition for cardiovascular regeneration is a cell therapeutic agent.
- the heart disease may be selected from the group consisting of ischemic heart disease, myocardial infarction, arteriosclerosis, angina pectoris, and vascular occlusion, but is not limited thereto.
- the pharmaceutical composition may be used in the form of a pharmaceutically acceptable salt.
- the salt is preferably an acid addition salt formed with a pharmaceutically acceptable free acid, and an organic acid and an inorganic acid may be used as the free acid.
- the organic acid is not limited thereto, but citric acid, acetic acid, lactic acid, tartaric acid, maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, metasulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, glutamic acid and aspartic acid.
- the inorganic acid includes, but is not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid and phosphoric acid.
- the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive selected from the group consisting of lubricants, wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents, preservatives, extracellular matrix (ECM), and combinations thereof. have.
- a pharmaceutically acceptable additive selected from the group consisting of lubricants, wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents, preservatives, extracellular matrix (ECM), and combinations thereof. have.
- the carrier may be included in an amount of about 1% to about 99.99% by weight, preferably about 90% to about 99.99% by weight, based on the total weight of the pharmaceutical composition of the present invention, and the pharmaceutically acceptable additive is about It may be included in an amount of 0.1 wt% to about 20 wt%.
- the pharmaceutical composition may be prepared in a unit dosage form by formulating using a pharmaceutically acceptable carrier and excipient according to a conventional method, or may be prepared by internalizing it in a multi-dose container.
- the formulation may be in the form of a solution, suspension, syrup, or emulsion in oil or an aqueous medium, or may be in the form of an extract, injection, capsule, or patch, and may further include a dispersant or stabilizer, but is not limited thereto.
- the present invention provides a method for regenerating cardiovascular blood vessels, comprising administering the pharmaceutical composition of the present invention to a subject.
- the subject may be a mammal, specifically a human.
- the administration route and dosage of the pharmaceutical composition may be administered to the subject in various methods and amounts depending on the patient's condition and presence or absence of side effects, and the optimal administration method and dosage may be selected within an appropriate range by those skilled in the art.
- the pharmaceutical composition may be administered in combination with other drugs or physiologically active substances with known therapeutic effects on the disease to be treated, or formulated in the form of a combination preparation with other drugs.
- examples thereof include subcutaneous, ocular, intraperitoneal, intramuscular, oral, rectal, orbital, intracerebral, intracranial, intravertebral, intraventricular, intrathecal , intranasal, intravenous, and intracardiac administration.
- the administration may be, for example, simultaneous or sequential administration of induced pluripotent stem cells (hiPSC-EC) expressing endothelial cells (EC) and mesenchymal stem cells (SDF-eMSC) expressing SDF-1 ⁇ .
- hiPSC-EC induced pluripotent stem cells
- EC endothelial cells
- SDF-eMSC mesenchymal stem cells
- the SDF-eMSC may be mixed with the extracellular matrix and manufactured in the form of a patch.
- the present invention provides a method for treating heart disease, comprising administering to a subject a therapeutically effective amount of the composition for cardiovascular regeneration.
- the therapeutically effective amount includes the specific composition including the type and extent of the response to be achieved, whether or not other agents are used if necessary, the subject's age, weight, general health, sex and diet, administration time, administration route, and composition. It is preferable to apply differently depending on various factors including the secretion rate, treatment period, and drugs used or concurrently with a specific composition and similar factors well known in the pharmaceutical field. Therefore, it is preferable to determine the effective amount of the composition suitable for the purpose of the present invention in consideration of the foregoing.
- the subject is applicable to any mammal, and the mammal includes not only humans and primates, but also domestic animals such as cattle, pigs, sheep, horses, dogs and cats.
- the present invention also provides the use of the composition for cardiovascular regeneration in the manufacture of a medicament for the treatment of heart disease.
- hiPSC human induced pluripotent stem cell
- hiPSCs (CMC-hiPS-011) cell line was purchased from KNIH and maintained in Matrigel using StemMACS TM iPSC-BREW (Milltenybiotec) medium. Then, in order to differentiate into endothelial cells, hiPSCs were seeded at 70,000 cells/cm 2 in a Matrigel (Corning)-coated cell culture dish (Eppendorf). After incubation, 5 ⁇ M Y-27632 (Tocris) was added for the first 24 hours. The medium was changed daily, and hiPSCs were cultured in iPSC-BREW for 3 days until the cells were 60% confluent.
- BM-MSC (Catholic MASTER Cells) was obtained from the clergy Cell Therapy Research Institute (CIC, Seoul, Korea).
- To immortalize MSCs replication-deficient lentiviral vectors containing hTERT and c-Myc were prepared and transduced into cells.
- To produce immortalized MSCs expressing SDF-1 ⁇ a replication-incompetent lentiviral vector was prepared with human SDF-1 ⁇ and further transduced into immortalized MSCs. Thereafter, SDF-eMSCs were isolated as a monoclonal cell population by a limiting dilution method. The final monoclonal cells were selected by SDF-1 ⁇ protein secretion, proliferation rate and other MSC phenotypes.
- SDF-eMSC was prepared using DMEM (Dulbecco's modified Eagle's Medium, low glucose, 10% fetal bovine serum (FBS, Gibco), 10 ng/ml basic fibroblast growth factor (bFGF, Peprotech) and 2 ⁇ g/ml doxycycline (Clonetech) added. Gibco) at 37° C. and 5% CO 2 conditions.
- DMEM Dulbecco's modified Eagle's Medium, low glucose, 10% fetal bovine serum (FBS, Gibco), 10 ng/ml basic fibroblast growth factor (bFGF, Peprotech) and 2 ⁇ g/ml doxycycline (Clonetech) added. Gibco) at 37° C. and 5% CO 2 conditions.
- SDF-1 ⁇ release level of SDF-eMSCs was confirmed by enzyme-linked immunosorbent assay (ELISA).
- ELISA enzyme-linked immunosorbent assay
- each cell in Passage 7 was cultured at a density of 1x10 6 cells in a 100 mm dish (Corning) with 10 ml of doxycycline-free complete medium. was busy 5% CO 2 After culturing at 37° C. for 72 hours in an incubator, centrifugation was performed to remove cell debris and the conditioned medium was harvested. SDF-eMSC concentrations were determined using the Human SDF-1 ⁇ ELISA kit (R&D Systems, DY350) according to the manufacturer's instructions. The absorbance of the samples at 450 nm was measured using a SpectraMAX 190 (Molecular Devices) microplate reader.
- the immunophenotype of MSCs was analyzed using flow cytometry.
- Cells were detached from the flask using trypsin, then centrifuged at 1500 rpm for 5 min and resuspended in stain/wash buffer (PBS with 2% FBS).
- stain/wash buffer PBS with 2% FBS.
- BM-MSCs and SDF-eMSCs were washed with stain/wash buffer and incubated for 30 min in the dark at 4°C using the Stemflow WP Human MSC Assay Kit (BD) according to the manufacturer's instructions.
- BD Stemflow WP Human MSC Assay Kit
- MSCs were characterized using the following conjugated monoclonal antibodies: CD90 FITC (clone: 5E10), CD105 PerCP-Cy5.5 (clone: 266), CD73 APC (clone: AD2) and PE negative cocktails (CD34, CD11b). , CD19, CD45, HLA-DR).
- Flow cytometry was performed using an LSR Fortessa TM cell analyzer (BD Biosciences) and analyzed with FlowJo_V10 or BD FACS Diva software.
- Free Reduced Growth Factor Basement Membrane Matrix 500 ⁇ l, Geltrex LDEV, Thermo Fisher was added to a 24-well plate and incubated at 37° C. for 30 minutes to solidify. 1x10 5 cells of hiPSC-ECs and human umbilical vein endothelial cells (HUVECs) were plated in each Geltrex-coated well containing various types of media (EGM, EBM, BM-MSC-CM and SDF-eMSC-CM), and then , and incubated with 5% CO 2 at 37° C. for 9, 24, and 48 hours. After removal of the medium, 4% PFA was added for fixation, the cells were visualized using a light microscope, and the formation of tube structures was calculated using ImageJ software.
- hiPSC-EC and HUVEC cells (3.5 x 10 4 ) were seeded on the upper layer of Transwell inserts (8 ⁇ m pores) with EBM basal medium, followed by media (EGM, EBM, BM-MSC-CM and SDF-eMSC-CM). was dispensed into 24-well plates. Thereafter, the cells were transferred with 5% CO 2 at 37° C. for 7 hours. The migrated cells were fixed in 4% PFA for 10 minutes and stained with 0.1% crystal violet (Sigma) for 10 minutes. After washing the Transwell membrane with distilled water, the top surface of the membrane was gently rubbed with a cotton swab to remove non-migrated cells. Migrated cells were counted using a light microscope and the stained area of the membrane was counted using ImageJ software.
- hiPSC-ECs (1x10 5 ) were aliquoted into 6-well plates containing various types of media (EGM, BM-MSC-CM and SDF-eMSC-CM), and the media was changed daily. After 72 h, total RNA was extracted by adding 0.5 mL of TRIzol reagent (Life Technologies) to the cells in the plate according to the manufacturer's instructions. For 1 ⁇ g of RNA, cDNA was synthesized using SuperScript TM Reverse Transcriptase IV and random primers (Invitrogen). A SYBR® Green PCR Master Mix (Applied Biosystems) was used to detect the accumulation of PCR products during cycling using the ABI Real-time PCR StepOne Plus (Applied Biosystems).
- RT-PCR was performed 3 times, with at least 3 replicates.
- Oligonucleotide primers were designed using real-time RT-PCR system sequence detection software v2.3 (Applied Biosystems), and their sequences (SEQ ID NOs: 1-24 in the SEQ ID NO: 1) are shown in Table 1.
- the fold difference in the expression level of each gene was calculated for each treatment group using CT values normalized to the transcription level of the housekeeping gene 18S rRNA or GAPDH according to the manufacturer's instructions.
- Cardiomyocytes from neonatal rats were isolated from the hearts of 1-day-old Sprague-Dawley rats according to guidelines with the approval of the Animal Care and Use Committee of The Catholic University of Korea.
- Ventricular tissue was incubated with 0.1% trypsin solution (Welgene) in HBSS (Welgene) at 4° C. overnight with gentle agitation. The next day, the digested tissue was transferred to a Petri dish on ice, minced and collected in a conical tube.
- digestion solution [5 ml (1 mg/ml) of Collagenase B in HBSS; Roche] was added to the heart tissue, triturated 15 times using a 5ml pipette, and incubated for 5 minutes in a 37°C water bath with gentle agitation.
- the supernatant containing cardiomyocytes was transferred to a separation medium [DMEM containing 20% FBS (Gibco) with 1X antibiotic-antifungal agent (Gibco)]], and undigested heart tissue was resuspended in 10 ml of digestion solution. Additional digestion steps were performed and the cell containing supernatant was collected. The digestion step was repeated 5 times, followed by centrifugation at 1500 rpm for 10 minutes and washing the cell pellet in the separation medium.
- the cell pellet was then centrifuged at 1500 rpm for 5 min and resuspended in DPBS to use a Percoll (GE Healthcare, 17-5445-02) density gradient. Contaminated fibroblasts and ECs were removed by Percoll density gradient centrifugation at 3000 rcf, 4 °C for 30 min. After the Percoll density-gradient step, the cardiomyocytes were transferred to a new conical tube and resuspended in the separation medium, then centrifuged at 1500 rpm for 10 minutes and the cell pellet washed in the separation medium. Then centrifuged at 1500 rpm for 5 min and resuspended the cell pellet in the separation medium.
- Percoll GE Healthcare, 17-5445-02 density gradient. Contaminated fibroblasts and ECs were removed by Percoll density gradient centrifugation at 3000 rcf, 4 °C for 30 min.
- the cardiomyocytes were transferred to a new conical tube and re
- gelatin 1% gelatin (Welgene) coated culture plate was plated at a density of 1x10 5 cells/cm 2 , and cultured at 37° C. and 5% CO 2 conditions.
- FBS horse serum
- Gibco antibiotic-antifungal agent
- H 2 O 2 (Sigma, 216763) reagents were diluted with different types of culture medium (EBM with 5% FBS or low-glucose DMEM with 5% horse serum, 30% BM-MSC and SDF-eMSC conditioned medium). Total H 2 O 2 concentrations were 500 ⁇ M (NRCM and HUVEC) and 700 ⁇ M (hiPSC-EC). After the H 2 O 2 solution was treated with 5% CO 2 at 37° C.
- the medium was phenol red-free EBM using a mixture of calcein 2M and ethidium homodimer-1 dye 4M for Live/Dead analysis. Or change to DMEM. Incubation was performed for 20 min at room temperature; Cells were imaged with a fluorescence microscope (Nikon). Images were taken with the same settings and processed using ImageJ. Cell viability was assessed using the CCK-8 assay.
- the medium was changed to EBM or DMEM without phenol red.
- CCK-8 reagent was added to containing 10% of the total medium volume with 5% FBS and then incubated with 5% CO 2 at 37° C. for 2 hours. After incubation at 37° C. for 2 hours, absorbance was measured at 450 nm using an Elisa reader (Spectramax Plus384, MSD).
- hdECM was prepared according to a known method.
- Heart tissue from a 6-month-old domestic pig was purchased from a livestock market with supplier approval.
- a small piece of cardiac tissue was immersed in 1% sodium dodecyl sulfate (affimetrix, CA) solution for 48 hours and then treated with 1% triton X-100 solution in PBS (Biosesang, Korea) for 1 hour.
- PBS Biosesang, Korea
- the decellularized heart tissue was then lyophilized, triturated in liquid nitrogen, and supplemented with 33 mg in 10 mL of 0.5 M acetic acid solution (Merck Millipore, Billerica, Mass.) at a final concentration of 3.3 w/v% (330 mg of hdECM powder) supplemented. Pepsin powder was further included and digested.
- the decomposed hdECM solution was filtered through a 40 ⁇ m pore mesh, divided into 1 ml and stored at -20°C for further experiments. Before preparing the heart patch, the hdECM solution was adjusted to a neutral pH of 7.4 by adding 10 N NaOH solution while keeping the conical tube on ice to avoid gelation of the hdECM.
- hdECM patch disc-shaped polycaprolactone (PCL) with a diameter of 8 mm and a height of 0.5 mm was fabricated as a supporting framework using a 3D printer according to the generated code. Then, hdECM patches were constructed by mixing SDF-eMSC (total 1x10 6 /ml), hdECM (20 mg/ml) and 0.02% (w/v) of vitamin B2 in the PCL framework. Then, the hdECM patch was exposed to UVA light for about 60 seconds to start the crosslinking process after vitamin B2 induction (light intensity: 30 mW/cm 2 ) and kept at 37° C. for 24 hours for further thermal crosslinking. After all these procedures, the final thickness and diameter of the hdECM patches averaged 3 mm and 8 mm, respectively.
- the long-term release kinetics of SDF-eMSC-PA was assessed by performing an ELISA on human SDF-1 ⁇ with conditioned media obtained over time. Patches were made of hdECM (100 ⁇ l) with SDF-eMSC (1x10 6 ) and human SDF-1 ⁇ cytokine (50, 100, 300 ng/ml) in disc-shaped PCL. The patches were then incubated in low-glucose-containing DMEM medium (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 5 ng/ml basic fibroblast growth factor (bFGF, Peprotech) at 37°C, 5% CO2. It was cultured under 2 conditions. Media was changed every 2 days and at each time point 0, 7, 14, 21, and 28, patches accumulated for 72 hours yielded conditioned media.
- DMEM medium Gibco
- FBS fetal bovine serum
- bFGF basic fibroblast growth factor
- Fischer 344 rats 160-180 g, male, Koatec, Korea were anesthetized by inhalation of 2% isoflurane and an 18-gauge venous catheter was intubated through the trachea. Rats were mechanically breathed using a rodent ventilator (55-7058, Harvard Apparatus, Canada). Animals were placed on a 37° C. heating pad to prevent body temperature drop during the procedure. After shaving the chest and disinfecting it with 70% alcohol, a thoracotomy was performed.
- MI Myocardial infarction
- LAD left anterior descending
- 22G polyethylene glycol tube
- Vd [7 / (2.4 + LVIDd)] x LVIDd3
- Vs [7 / (2.4 + LVIDs)] x LVIDs3
- LV pressure-volume (PV) parameters were recorded continuously using a PV conductivity system (MPVS Ultra, emka TECHNOLOGIES, Paris, France) combined with a digital converter (PowerLab 16/35, ADInstruments, Colorado Springs, CO).
- Independent measurements of cardiac functional load including the slope of the end-systolic pressure-volume relationship (ESPVR) and the end-diastolic pressure-volume relationship (EDPVR), use a needle holder to measure the different preloads induced by temporary inferior vena cava (IVC) occlusion using a needle holder. achieved.
- IVC inferior vena cava
- To calculate the parallel conductivity after hemodynamic measurements 50 ⁇ l of hypertensive saline (20% NaCl) was injected into the left jugular vein. Blood was drawn from the left ventricle with a heparinized syringe and placed in a cuvette to convert the conduction signal into volume using a catheter. The absolute volume of rats was defined by correcting for parallel conductance and cuvette conductance.
- Masson's Trichrome (MT) staining was performed to determine the fibrotic area of the myocardial infarction (MI) heart.
- MI myocardial infarction
- Three paraffin slides were incubated in a drying oven at 37° C. prior to deparaffinization and rehydration. Paraffin sections were re-fixed in Bouin solution at 56°C for 1 hour. These sections were stained with Weigert's Iron Hematoxylin Solution at room temperature for 15 minutes, and then stained with Biebrich scarlet-acid fuchsin solution at room temperature for 20 minutes. Finally, sections were counterstained with Aniline Blue for 15 min and then incubated in 1% acetic acid for 1 min at room temperature.
- hiPSC-ECs endothelial cells differentiated from human induced pluripotent stem cells
- a small molecule-based 2D differentiation method (Ref, Grigoriadis et al., Blood, 115 (2010), pp. 2769-2776) (Xiaojun Lian) et al., Stem Cell Reports, (2014) 11;3 (5): 804-16).
- VEGF vascular endothelial growth factor
- hiPSC-CD31 + cells showed a typical endothelial morphology and had significantly higher mRNA levels of EC-specific markers such as PECAM, VE-Cadherin, VEGFR2 and vWF than HUVECs (Fig. 1).
- hiPSC-CD31 + cells expressed PECAM and vWF proteins from the immunofluorescence results ( FIG. 2 ).
- At the functional level it was confirmed that hiPSC-CD31 + cells had the ability to uptake Ac-LDL and form a capillary-like network on Matrigel.
- hiPSC-ECs can form de novo blood vessels through cardiac angiogenic mechanisms in an animal model of induced myocardial infarction (MI)
- MI myocardial infarction
- LAD left anterior descending
- GFP green fluorescence
- MI myocardial infarction
- EF ejection fraction
- FS fractional shortening
- LVIDd left ventricular internal diastolic dimension
- LVISd left ventricular internal systolic dimension
- SWT septal wall thickness
- PWT posterior wall thickness
- LVIDd left ventricular internal diastolic dimension
- the LVID heart was significantly lower than the myocardial infarction (MI) control heart, which shows that revascularization by hiPSC-EC alleviated the pathological remodeling of the heart after ischemia ( FIG. 7 ).
- MI myocardial infarction
- the prepared SDF-eMSC was a homogeneous spindle-shaped cell morphology, a typical morphological characteristic of MSC, and was not morphologically different from normal BM-MSC (FIG. 9). It was confirmed that SDF-eMSC showed a pattern of expressing MSC-specific markers ( FIG. 10 ). In addition, it was confirmed that the cell growth rate (PDL) of SDF-eMSCs was stably maintained during the incubation time, and at the same time, it had the ability to express a high level of SDF-1 protein ( FIGS. 11 and 12 ). SDF-eMSCs stably secreted human SDF-1 ⁇ protein until Passage 16 through ELISA analysis of human SDF-1 ⁇ ( FIG. 13 ). It was confirmed that there is genetic stability (FIG. 14).
- SDF-eMSC can increase angiogenesis of endothelial cells.
- various types of in vitro experiments were performed using SDF-eMSC.
- CM conditioned media
- Tie-2 tyrosine kinase with Ig and epidermal growth factor homology domain 2
- vWF von willebrand factor
- SDF-1 ⁇ SDF-1 ⁇
- CD62 E-selectin
- ICAM-1 intercellular adhesion molecule-1
- a Matrigel tube formation assay was performed to evaluate the cell's angiogenesis ability.
- both hiPSC-ECs and human umbilical cord endothelial cells (HUVECs) treated with 30% CM (conditioned media) obtained from cultured SDF-eMSCs were formed compared to endothelial cells treated with BM-MSC-CM. It was found that the number of branches and the tube length were significantly greater ( FIG. 18 ).
- the treatment of SDF-eMSC-CM not only promoted the tube-forming function of hiPSC-ECs, but also helped the hiPSC-EC-formed blood vessels to be maintained for a long time.
- SDF-eMSC can not only promote the angiogenic properties of hiPSC-EC, but also directly protect endothelial cells and cardiomyocytes through the consistent secretion of cytoprotective SDF cytokines.
- SDF-eMSC-PA SDF-eMSC patch
- PCL polycaprolactone
- the cumulative release curve showed that the initial concentration of SDF-1 ⁇ was higher in SDF-cytokine-PA (300 ng/ml) than in SDF-eMSC-PA at day 0, but SDF-1 ⁇ in SDF-cytokine-PA
- SDF-1 ⁇ released from SDF-eMSC-PA continued to increase until day 21, confirming that SDF-eMSC was continuously releasing SDF-1 ⁇ from within the patch.
- LV hemodynamic measurements were additionally performed through an invasive pressure-volume (PV) catheter capable of measuring LV hemodynamic pressure and volume to more precisely evaluate cardiac function.
- PV invasive pressure-volume
- MI myocardial infarction
- SV stroke volume
- CO cardiac output per minute
- V max maximum volume
- Example 8 Intramyocardial hiPSC-EC engraftment improvement and neovascularization improvement effect by concurrent administration
- the in vivo activity of hiPSC-ECs in myocardium by SDF-eMSC-PA was investigated.
- the activity of hiPSC-ECs in cardiac tissues was confirmed through the expression of GFP.
- the cardiac tissue collected 8 weeks after treatment was observed with a confocal microscope.
- transplantation of SDF-eMSC-PA significantly improved the maintenance and engraftment of GFP-positive hiPSC-ECs injected into myocardium.
- the ratio of GFP-positive hiPSC-ECs in the EC+PA combination administration group was significantly higher than in the endothelial cell (EC) alone group ( FIG. 28 ).
- hiPSC-EC in the hiPSC-EC alone group was limited to the vicinity of the injection site, but hiPSC-EC in the EC+PA group was distributed in all regions of the left ventricle ( FIG. 29 ). Consequently, it was confirmed through histological analysis that SDF-eMSC-PA simultaneously promotes hPSC-ECs-dependent angiogenesis and angiogenesis from host blood vessels.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Cell Biology (AREA)
- General Health & Medical Sciences (AREA)
- Epidemiology (AREA)
- Developmental Biology & Embryology (AREA)
- Zoology (AREA)
- Pharmacology & Pharmacy (AREA)
- Dermatology (AREA)
- Immunology (AREA)
- Oral & Maxillofacial Surgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Transplantation (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Botany (AREA)
- Vascular Medicine (AREA)
- Reproductive Health (AREA)
- Urology & Nephrology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Hematology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Gynecology & Obstetrics (AREA)
- General Chemical & Material Sciences (AREA)
- Biophysics (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
본 발명은 내피세포로 분화되는 줄기세포 및 SDF-1α을 발현하도록 형질전환된 중간엽줄기세포를 포함하는 심장 혈관 재생용 조성물에 관한 것으로서, 상기 조성물은 분화된 내피세포에 의한 혈관 형성(Vasculogenesis)을 촉진함과 동시에, 혈관 신생에 관여하여 심장 혈관의 재생 및 심장 질환 치료에 유용하게 사용될 수 있다.
Description
본 발명은 혈관세포로 분화되는 유도만능 줄기세포 및 SDF-1α를 발현하는 중간엽줄기세포를 동시에 포함하는 심장 재생용 조성물에 관한 것이다.
허혈성 심장 질환(IHD, ischemic heart diseases)은 전 세계적으로 이환율과 사망률의 주요 원인 중 하나이다. 특히, 심장에서 IHD의 대표적인 질환인 심근경색증(MI, myocardial infarction)은 심장 근육과 혈관 모두를 과도하게 손상시킨다. 관상 동맥 손상은 심근경색(MI)에서 가장 중요한 병태 생리학적 원인 중 하나이기 때문에 현재까지의 접근법은 주로 치료적 혈관 신생화를 통해 허혈성 심장에서 기능적으로 관류 가능한 혈관을 재구성하는 데 초점을 두었다. 이전 연구에서는 치료적 혈관 신생이 일반적으로 혈관 신생(angiogenesis) 및 혈관 형성(vasculogenesis)과 같은 두 가지 별개의 과정으로 구성되어 있다고 설명하였다. 혈관 신생은 기존 혈관의 성장을 의미하고, 혈관 형성은 내피세포(EC, endothelial cells), 내피전구세포(EPC, endothelial progenitor) 또는 기타 유형의 줄기세포에서 새롭게 혈관을 생성하는 과정이다.
이전의 여러 연구에서 혈관 신생 유도가 혈관 재생에 효과적이라고 광범위하게 보고된 이후, 심장 질환 치료 전략의 일환으로 심장 혈관 신생을 촉진하는 효율적인 방법을 개발하기 위해 상당한 노력이 투자되었다. 예를 들어, 여러 전임상 설정에서 혈관 내피 성장 인자(VEGF), 섬유아세포 성장 인자(FGF) 및 간세포 성장 인자(HGF)와 같은 혈관 신생 인자를 재조합 단백질, 네이키드 DNA 플라스미드 형태로 투여한다. 또는 변형된 VEGF RNA는 혈관 형성, 심장 기능 및 장기 생존율을 실질적으로 개선하여 혈관 신생을 촉진하는 것이 손상된 심장을 치료하는 효과적인 치료 전략임을 나타낸다. 전임상 연구에서 얻은 고무적인 결과에도 불구하고 후속 임상 시험에서 얻은 결과는 지속적으로 결정적인 결과를 산출하지 못하였다. 전임상 결과와 임상 결과 사이의 이러한 불일치에 대한 한 가지 가능한 설명은 아마도 장기간의 혈관 신생 자극을 위해 특정 기간 동안 표적 영역에서 혈관 신생 인자를 표적화 하는 최적 수준을 유지하지 못했기 때문이고, 이는 기술적으로 어렵고 비용이 많이 소요된다.
혈관 신생은 배아와 성인기 모두에서 발생하는 것으로 알려져 있지만, 혈관 형성은 배아 발달 기간에만 나타나는 것으로 간주되었다. 그러나, 최근의 연구에 따르면, 혈관 형성은 초기 배아 발생에 국한되지 않을 뿐만 아니라, 특정 생리적 역할을 가지고 있어 출생 후 혈관 질환의 병리 생리학에 기여할 수도 있다. 이러한 개념은 혈액 내 EC와 EPC가 모두 공존하고. 혈관이 종양 성장 중에 새로운 방식으로 발전할 수 있다는 사실에 기반한다. 성인 척추 동물에서 순환하는 EPC의 식별은 출생 후 혈관 형성에서 골수에서 파생된 여러 유형의 세포에 대한 기능적 역할을 새롭게 제안하였다. 그 후 여러 연구에서 EPC, 단핵구(MNC, mononuclear cells) 및 중간엽줄기세포(MSC, mesenchymal stem cells)의 이식이 성인 허혈성 조직에서 치료적 혈관 신생을 유도했다고 보고하였다. 그러나, EC로의 분화 및 연속적인 혈관 형성에 대한 잠재력은 그들의 주요 메커니즘이 새로운 혈관 형성이 아닌 파라크린 효과에 의한 것이라는 것이 알려졌다. 최근에는 인간 배아줄기세포 (hESC, human embryonic stem cells)와 인간 유도만능줄기세포(hiPSC, human induced pluripotent stem cells)를 포함한 인간 다능성줄기세포(hPSC, human pluripotent stem cells)에서 파생된 EC가 더 강력한 혈관 형성 잠재력을 보이는 것을 발견하고, 혈관 재생 접근 방식에 대한 적극적인 연구가 진행되고 있는 실정이다.
네이티브 신혈관형성(neovascularization)의 기초는 혈관 신생에 국한되지 않고 출생 후 혈관 형성도 포함하는 것이므로, 치료적 혈관 신생을 위해서는 허혈성 심장에서 혈관 재생을 달성하기 위한 모든 메커니즘을 종합적으로 유도하는 것에 초점을 두는 것이 필요하다.
이에 본 발명자들은 CD31+ hiPSC 유래 내피세포(hiPSC-EC) 및 SDF-1α를 지속적으로 분비하는 인간 골수에서 파생된 유전자 조작된 중간엽줄기세포 (SDF-eMSC)를 포함하는 조성물을 이용하여, 심근경색(MI) 유도된 심장의 혈관 형성 및 혈관 신생을 동시에 촉진하며, 특히 상기 조성물을 포함하는 3 차원(3D) 심장 패치를 이용하여 혈관 형성과 혈관 신생을 동시에 촉진함으로써 혈관을 재생하는 다각적인 접근 방식에 대한 본 발명을 완성하였다.
따라서, 본 발명의 목적은 내피세포로 분화가능한 줄기세포 및 SDF-1α을 발현하도록 형질전환된 중간엽줄기세포를 포함하는 심장 혈관 재생용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 심장 혈관 재생용 조성물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 심장 질환의 치료 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 심장 질환의 치료를 위한 의약의 제조에 있어 상기 심장 혈관 재생용 조성물의 사용을 제공하는 것이다.
상기와 같은 목적을 달성하기 위하여, 본 발명은 내피세포로 분화가능한 줄기세포 및 SDF-1α(stromal cell-derived factor 1 alpha)을 발현하도록 형질전환된 중간엽줄기세포를 포함하는 심장 혈관 재생용 조성물을 제공한다.
또한, 본 발명은 상기 심장 혈관 재생물 조성물을 포함하는 심장 혈관 재생용 패치를 제공한다.
또한, 본 발명은 심장 혈관 재생용 패치 및 내피세포(EC)를 포함하는 심장 혈관 재생용 키트를 제공한다.
또한, 본 발명은 (a) 심장 유래 탈세포화된 세포외 기질(ECM)을 제조하는 단계; (b) 고분자 지지체를 제조하는 단계; 및 (c) 상기 심장 혈관 재생용 조성물을 상기 (b) 단계의 고분자 지지체에 증착하는 단계를 포함하는 심장 혈관 재생용 패치의 제조 방법을 제공한다.
또한, 본 발명은 상기 심장 혈관 재생용 조성물을 포함하는 심장 질환 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 심장 혈관 재생용 조성물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 심장 질환의 치료 방법을 제공한다.
또한, 본 발명은 심장 질환의 치료를 위한 의약의 제조에 있어 상기 심장 혈관 재생용 조성물의 사용을 제공한다.
본 발명의 심장 혈관 재생용 조성물은, 내피세포로 분화가능한 줄기세포 및 SDF-1α을 발현하도록 형질전환된 중간엽줄기세포가 병용 투여되어, 파라크린 효과로 인하여 분화된 내피세포에 의한 혈관 형성(Vasculogenesis)를 촉진함과 동시에, 혈관 신생(angiogenesis)에도 작용하여, 심장 혈관을 효율적으로 재생하고, 심장 질환을 치료하는 효과를 가진다.
도 1은 hiPSC로부터 CD31+ 내피세포(hiPSC-EC)로의 분화를 유도하고, in vitro에서 hiPSC-EC를 HUVEC 세포와 비교하여 EC 특이적 마커의 mRNA 발현 수준을 확인한 결과이다.
도 2는 hiPSC-EC에서 EC 특이적 단백질의 발현을 면역 형광 이미지를 확인한 결과이다.
도 3은 심근경색(MI) 유발 8주 후에 경색 영역 (IZ), 경계 영역 (BZ) 및 원격 영역에서 로다민 결합 IB4(빨간색)로 관류 염색된 모세 혈관의 이미지 및 IZ (m), BZ (n) 및 원격 영역 (o)의 mm2 당 모세관 밀도를 정량화한 결과이다 (Scale Bars: 100 μm). 데이터는 평균 ± SD.; 대조군 n = 5; hiPSC-EC-IN 그룹 n = 5. * p<0.05; 통계 분석은 양측 t- 검정을 사용하여 수행됨.
도 4는 hiPSC-EC-GFP (녹색), 로다민 결합 IB4 (빨간색) 및 EC 그룹의 DAPI (파란색)를 사용한 대표적인 면역 염색 결과이다.
도 5는 심근경색(MI) 유발 후 좌심실 박출율 (EF) 및 좌심실 단축율 (FS)을 나타낸 결과이며, hiPSC-EC 처리군과 대조군의 2, 4, 8주차 결과를 측정한 결과이다. 데이터는 평균 ± SD; 대조군 n=5; EC 그룹 n=6. * 대조군과 비교하여 p<0.05; 양방향 ANOVA를 사용하여 통계 분석을 수행한 다음 Tukey 방법과의 다중 비교를 수행함.
도 6은 심근경색(MI)를 유발한 후, 치료를 시행하지 않은 Pre 및 8 주 시점에서, hiPSC-EC 처리군과 대조군의 M-모드 대표 이미지를 나타낸 결과이다.
도 7은 심근경색(MI) 유발 후 1주, 2, 4, 8주마다 좌심실 내부 확장기 치수 (LVIDd), 좌심실 내부 수축기 치수 (LVISd), 상대 벽 두께 (RWT), 중격 벽 두께 (SWT), 후방 벽 두께 (PWT)를 측정하여 hiPSC-EC 투여군과 비교한 결과이다. 데이터는 평균 ± SD; 대조군 n=5; EC 그룹 n=6. * 대조군과 비교하여 p<0.05; 양방향 ANOVA를 사용하여 통계 분석을 수행한 다음 Tukey 방법과의 다중 비교를 수행함.
도 8은 심근경색 8 주 후 수집된 심장에 Masson's trichrome으로 염색된 대조군 및 hiPSC-EC 처리군의 대표 이미지와, 섬유증 발생 비율 및 생존성 심근의 정량 결과를 나타낸 것이다 (Scale Bars: 2000 μm). 데이터는 평균 ± SD; 대조군 n=5; hiPSC-EC-IN에서 n=5. * p<0.05; 통계 분석은 양측 t-검정을 수행함.
도 9는 제작된 SDF-eMSC의 형태적 특성을 관찰한 결과이다.
도 10은 제작된 SDF-eMSC 및 골수 유래 MSC의 MSC 특이적 마커의 발현을 비교한 결과이다.
도 11은 SDF-eMSC와 골수 유래 MSC에서 SDF-1α의 분비량을 비교한 결과이다.
도 12는 SDF-eMSC의 PDL 증가량을 확인한 결과이다.
도 13은 SDF-eMSC 계대 배양 시, 이로부터 분비되는 계대별 SDF-1α의 분비량을 측정한 결과이다.
도 14는 SDF-eMSC의 핵형 분석 결과를 나타낸 것이다.
도 15는 SDF-eMSC 및 BM-MSC를 배양한 30% 배양액을 hiPSC-EC에 처리하고, RT- PCR을 수행하여 혈관 신생 특성과 관련한 유전자 발현 양상을 확인한 결과이다.
도 16 및 도 17은 hiPSC-EC와 HUVEC 세포에 SDF-eMSC-CM 30%를 처리한 경우와, BM-MSC-CM 30%를 처리한 경우 각각의 세포 이동 분석 결과를 나타낸 것이다. hiPSC-EC를 트랜스 웰 (위)에 배치하고 다른 배지 (EGM, EBM, BM-MSC-CM 및 SDF-eMSC-CM)를 트랜스 웰 (아래)에 7 시간 동안 배치하였다. 튜브 형성의 대표 이미지 및 이동 영역 백분율의 정량화 결과이다. 데이터는 평균 ± SD; EGM n = 3; EBM n = 3; BM-MSC-CM n = 3; SDF-eMSC-CM n = 3이다. * p <0.05; 통계 분석은 일원 분산 분석을 사용하고 Tukey 방법과의 다중 비교를 사용하여 수행되었다.
도 18은 SDF-eMSC의 혈관 신생(angiogenesis)을 촉진여부를 확인하기 위해 Matrigel tube 형성 분석을 통해 세포의 혈관 형성 능력을 평가한 결과이다.
도 19는 SDF-eMSC가 EC 또는 심근세포에 대한 직접적인 세포 보호 여부를 확인하기 위하여, 산화적 스트레스 조건하에, SDF-eMSC를 처리한 후 이의 효과를 확인한 결과이다.
도 20은 SDF-eMSC와 hdECM을 이용하여 심장 패치를 만드는 과정을 도식화한 것이다.
도 21은 SDF-eMSC-PA로부터 SDF1α 방출 동역학을 측정한 결과이다.
도 22는 심근경색(MI) 후 좌심실 박출율 (EF) 및 좌심실 단축율 (FS)에 대한 결과로서, 심근경색(MI) 유발 후 2, 4, 8주에 대조군, 패치(PA) 단독, EC 단독, 병용(EC+PA) 투여 결과를 나타낸 것이다. 우측 이미지는 심근경색(MI) 유도 후, 치료없이 심근경색(MI) 후 1주 및 8주 시점에서 4개 그룹의 M 모드의 대표 이미지를 나타낸 것이다. 데이터는 평균 ± SD; 대조군에서 n = 7; PA 전용 그룹에서 n = 10; EC 전용 그룹에서 n = 8; EC + PA 그룹에서 n = 11. * p <0.05; 양방향 ANOVA를 사용하여 통계 분석을 수행한 다음 Tukey 방법과의 다중 비교를 수행함.
도 23은 심근경색(MI) 유발 후 1주, 2, 4, 8주마다 좌심실 내부 확장기 치수 (LVIDd), 좌심실 내부 수축기 치수 (LVISd), 상대 벽 두께 (RWT), 중격 벽 두께 (SWT), 후방 벽 두께 (PWT)를 측정하여 각 실험군 별로 비교한 결과이다. 데이터는 평균 ± SD; 대조군에서 n = 7; PA 전용 그룹에서 n = 10; EC 전용 그룹에서 n = 8; EC + PA 그룹에서 n = 11. * p <0.05; 양방향 ANOVA를 사용하여 통계 분석을 수행한 다음 Tukey 방법과의 다중 비교를 수행함.
도 24는 심근경색(MI) 유발 후, 각 처리군에 따른 섬유증 발생 비율 및 생존성 심근을 정량화한 결과이다 (Scale Bars: 2000 μm). 데이터는 평균 ± SD; 대조군 n = 5; PA 단일군 n = 5; EC 단일군 n = 5; EC + PA 병용투여군 n = 5. * p <0.05; 통계 분석은 일원 분산 분석을 사용하고 Tukey 방법과의 다중 비교를 수행함.
도 25는 심근경색(MI) 유발 후 8주차에 PV 루프를 이용한 정상 상태에 대한 혈역학 적 압력 및 부피 (PV) 곡선의 대표적인 이미지를 나타낸 것이다.
도 26은 수축 시 일회 박출량(SV), 분당 심 박출량(CO) LV에서 배출된 혈액량(Vmax)에 대한 각 실험군의 영향을 나타낸 결과이다. 데이터는 평균 ± SD; 대조군에서 n = 4; PA 단독군에서 n = 4; EC 단독군에서 n = 4; EC + PA 병용 투여군에서 n = 4. * p <0.05; 통계 분석은 일원 분산 분석을 사용하고 Tukey 방법과의 다중 비교를 수행함.
도 27은 심근경색(MI) 유발 후, 최대 수축기에서 측정된 최대 압력(P max), 최대 압력 변화율(dP/dt max) 및 최소 압력 변화율 (dP/dt min)을 각 실험군 별로 측정하여 비교한 결과이다.
도 28은 SDF-eMSC-PA에 의한 심근 내 hiPSC-EC의 in vivo 활성을 확인하기 위한 GFP 발현 양상을 확인한 결과이다.
도 29는 심근경색(MI) 유발 후 hiPSC-EC 단독 투여군과 EC+PA 병용 투여군의 EC 분포를 확인한 것이며, 병용 투여 시, 모든 좌심실 영역내 전체로 분포가 늘어난 것을 알 수 있다. 경색 영역 (IZ) 및 경계 영역 (BZ)에서 GFP 양성 혈관 직경을 정량화한 결과이다 (Scale Bars: 20 μm). 데이터는 평균 ± SD; EC 단독 n = 4; EC + PA 병용 n = 4. * p <0.05; 통계 분석은 일원 분산 분석을 사용하고 Tukey 방법과의 다중 비교를 수행함.
도 30은 심근경색(MI) 후 8주에 경색 영역 (IZ), 경계 영역 (BZ) 및 원격 영역에 로다민 결합 IB4 (빨간색)로 염색된 모세 혈관의 대표적인 이미지를 나타낸 것이다.
도 31은 IZ, BZ 및 RTZ 영역의 mm2 당 모세관 밀도를 정량화한 결과이다. 스케일 바 : 100 μm. 데이터는 평균 ± SD; 대조군 n = 5; PA 단독 n = 5; EC 단독 n = 5; EC + PA 병용 투여 시 n = 7. * p <0.05; 통계 분석은 일원 분산 분석을 사용하고 Tukey 방법과의 다중 비교를 수행함. N.S. 유의한 차이 없음.
도 32는 심근경색 유발한 뒤 8주 후 수집 한 심장 조직을 Masson's trichrome으로 염색 한 4개 그룹의 대표 이미지 및 모세혈관의 수를 정량화하여 나타낸 것이다.
도 33은 본 발명의 심근경색(MI) 유발 심장 모델에 대하여, 수행된 hiPSC-EC + SDF-eMSC-PA 병용 투여 방법의 모식도 및 그 효과를 나타낸 결과이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 내피세포로 분화가능한 줄기세포 및 SDF-1α을 발현하도록 형질전환된 중간엽줄기세포를 포함하는 심장 혈관 재생용 조성물을 제공한다.
본 발명의 심장 혈관 재생용 조성물은 기존 혈관을 성장시키는 혈관 신생(angiogenesis); 및 내피세포(EC, endothelial cells), 내피전구세포(EPC, endothelial progenitor) 또는 다양한 유형의 줄기세포로부터 새로운 혈관을 생성하는 혈관 형성(vasculogenesis)에 함께 작용하며, 특히 줄기세포로부터 분화된 내피세포와, 이로부터의 혈관 형성을 촉진하는 역할을 하는, SDF-1α을 발현하는 중간엽줄기세포를 함께 포함하고 있는 것에 특징을 가진다.
본 발명의 용어, "내피세포(EC, endothelial cells)"는 혈관의 내강과 맞닿은 상피 조직을 의미하며, 특히, 심장내막세포, 혈관 내피세포 또는 심장혈관 내피세포를 의미하는 것일 수 있다.
본 발명의 일 실시예에 있어서, 상기 내피세포는 줄기세포로부터 분화된 세포인 것일 수 있으며, 상기 줄기세포는 그 종류에 특별히 제한되는 것은 아니나, 인간 배아줄기세포(hESC), 인간 유도만능줄기세포(hiPSC), 다능성줄기세포(hPSC) 및 중간엽줄기세포로 이루어진 군에서 선택되는 것일 수 있으며, 바람직하게는 인간 유도만능줄기세포인 것일 수 있다.
본 발명의 용어, "SDF-1α(stromal cell-derived factor 1 alpha)"는 93개의 아미노산을 포함하고 10.7 kDa의 분자량을 갖는 비당화 단백질로서, 다양한 면역 세포를 염증성 활막으로 이동시키는 역할을 하는 케모카인이며, 혈관 내피세포에서 생성되어, 혈관 전구세포를 불러들이는 역할을 수행하는 물질이다. 즉, 혈관 신생에 관여하는 것으로 알려져 있다. 본 발명의 SDF-1α는 인간으로부터 유래된 것일 수 있으며, 본 발명에서는 중간엽줄기세포(MSC)를 형질 전환하여, SDF-1α을 계속적으로 발현할 수 있도록 제작하였다.
상기 용어, "중간엽줄기세포"는 골세포, 연골세포 및 지방세포를 포함하는 다양한 세포로 분화될 수 있는 다분화능 기질세포를 말한다. 중간엽줄기세포는 뼈, 연골, 지방, 힘줄, 신경조직, 섬유아세포 및 근육세포 등 구체적인 장기의 세포로 분화될 수 있다. 이들 세포는 지방조직, 골수, 말초신경 혈액, 제대혈, 골막, 진피, 중배엽-유래 조직 등으로부터 분리 또는 정제될 수 있다. 또한, 상기 중간엽줄기세포는 불사화된 것일 수 있다. 구체적으로, 상기 중간엽줄기세포는 골수 유래 혹은 배아 유래인 것일 수 있다.
본 발명의 일 실시예에 있어서, 상기 중간엽줄기세포는 hTERT 및 c-Myc 유전자가 형질도입된 불사화된 중간엽줄기세포인 것일 수 있다.
본 발명의 일 실시예에 있어서, 상기 조성물은 SDF-1α를 발현하도록 형질전환된 중간엽줄기세포의 배양액을 추가로 포함하는 것일 수 있다.
본 발명의 일 실시예에 있어서, 상기 조성물은 세포외 기질(ECM)을 추가로 더 포함하는 것일 수 있다.
본 발명의 심장 혈관 재생용 조성물은 일부가 패치 형태로 제조된 것일 수 있다. 따라서, 본 발명은 상기 심장 혈관 재생용 조성물을 포함하는 심장 혈관 재생용 패치를 제공한다.
또한, 본 발명은 상기 심장 혈관 재생용 패치 및 내피세포를 포함하는 심장 혈관 재생용 키트를 제공한다.
본 발명의 일 실시예에 있어서, 상기 내피세포는 유도만능줄기세포로부터 분화된 내피세포인 것일 수 있다.
또한, 본 발명은 (a) 심장 유래 탈세포화된 세포외 기질(ECM)을 제조하는 단계; (b) 고분자 지지체를 제조하는 단계; 및 (c) 제1항에 따른 심장 혈관 재생용 조성물을 상기 (b) 단계의 고분자 지지체에 증착하는 단계를 포함하는 심장 혈관 재생용 패치의 제조 방법을 제공한다.
상기 패치는 심장 유래 세포외 기질(hdECM)에 SDF-eMSC를 혼합하여 제조된 패치를 의미한다. 패치 형태로 제조될 경우, 상기 세포외 기질은 물리적 방법으로 탈세포화 및 분쇄되어 입자상이나 매트릭스 상태로 준비될 수 있으며, 본 발명이 속하는 기술 분야에서 공지된 방법으로 제작될 수 있다. 상기 패치에는 비타민 B2를 추가로 포함한 것일 수 있다.
본 발명의 일 실시예에 있어서, 상기 패치는 3D 프린터를 통해 제작된 폴리카프로락톤(PCL) 지지체에, SDF-eMSC, hdECM 및 비타민 B2를 혼합하여 hdECM 패치를 구축하였다. 상기 SDF-eMSC는 약 1x104~1x106 cell/ml, hdECM 1~20 mg/ml 및 0.0002~0.02% (w/v)의 비타민 B2를 혼합하여 hdECM 패치를 구축할 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 상기 심장 혈관 재생용 조성물은 세포 치료제로서, 심장 질환의 치료용 약학적 조성물을 제공한다.
본 발명의 일 실시예에 있어서, 상기 심장 질환은 허혈성 심장질환, 심근경색, 동맥경화증, 협심증 및 혈관 폐색으로 이루어진 군에서 선택되는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 약학적 조성물은 약학적으로 허용 가능한 염의 형태로 사용될 수 있다. 상기 염으로는 약학적으로 허용 가능한 유리산(free acid)에 의하여 형성된 산 부가염이 바람직하며, 상기 유리산으로는 유기산과 무기산을 사용할 수 있다. 상기 유기산은 이에 제한되는 것은 아니나, 구연산, 초산, 젖산, 주석산, 말레인산, 푸마르산, 포름산, 프로피온산, 옥살산, 트리플로오로아세트산, 벤조산, 글루콘산, 메타술폰산, 글리콜산, 숙신산, 4-톨루엔술폰산, 글루탐산 및 아스파르트산을 포함한다. 또한 상기 무기산은 이에 제한되는 것은 아니나, 염산, 브롬산, 황산 및 인산을 포함한다.
본 발명의 약학적 조성물은 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제, 세포외기질(ECM)및 이의 조합으로 이루어진 군에서 선택되는 약학적으로 허용가능한 첨가제를 추가로 포함할 수 있다.
상기 담체는 본 발명의 약학적 조성물 총 중량을 기준으로 약 1 중량% 내지약 99.99 중량%, 바람직하게는 약 90 중량% 내지 약 99.99 중량%로 포함될 수 있으며, 상기 약학적으로 허용 가능한 첨가제는 약 0.1 중량% 내지 약 20 중량%로 포함될 수 있다.
상기 약학적 조성물은 통상의 방법에 따라, 약학적으로 허용되는 담체 및 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나, 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질 중의 용액, 현탁액, 시럽제 또는 유화액 형태이거나 엑스제, 주사제, 캅셀제 또는 패치제 형태일 수도 있고, 분산제 또는 안정화제를 추가로 포함할 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 본 발명의 약학적 조성물을 개체에 투여하는 단계를 포함하는, 심장 혈관의 재생 방법을 제공한다.
상기 개체는 포유동물, 구체적으로 인간일 수 있다. 상기 약학적 조성물의 투여 경로 및 투여량은 환자의 상태 및 부작용의 유무에 따라 다양한 방법 및 양으로 대상에게 투여될 수 있고, 최적의 투여 방법 및 투여량은 통상의 기술자가 적절한 범위로 선택할 수 있다. 또한, 상기 약학적 조성물은 치료하고자 하는 질환에 대하여 치료 효과가 공지된 다른 약물 또는 생리학적 활성물질과 병용하여 투여되거나, 다른 약물과의 조합 제제 형태로 제형화될 수 있다.
상기 약학적 조성물을 비경구적으로 투여하는 경우, 그 예로는 피하, 눈, 복강 내, 근육 내, 구강, 직장, 안와 내, 뇌 내, 두개 내(intracranial), 척추 내, 뇌실 내, 수강막 내, 비 내, 정맥 내, 심장 내 투여가 있다.
상기 투여는, 예를 들어, 내피세포(EC)를 발현하는 유도만능 줄기세포(hiPSC-EC) 및 SDF-1α를 발현하는 중간엽줄기세포(SDF-eMSC)를 동시에 또는 순차적으로 투여하는 것일 수 있으며, 상기 SDF-eMSC는 세포외 기질과 혼합되어, 패치 형태로 제작된 것일 수 있다.
또한, 본 발명은 상기 심장 혈관 재생용 조성물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 심장 질환의 치료 방법을 제공한다.
상기 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 개체의 연령, 체중, 일반건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다. 따라서 본 발명의 목적에 적합한 조성물의 유효량은 전술한 사항을 고려하여 결정하는 것이 바람직하다.
상기 개체는 임의의 포유동물에 적용가능하며, 상기 포유동물은 인간 및 영장류뿐만 아니라, 소, 돼지, 양, 말, 개 및 고양이 등의 가축을 포함한다.
또한, 본 발명은 심장 질환의 치료를 위한 의약의 제조에 있어 상기 심장 혈관 재생용 조성물의 사용을 제공한다.
이하, 본 발명을 실시예를 통하여 더욱 상세히 설명하기로 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 실험 방법
1.1. 인간 유도만능줄기세포(hiPSC) 유래 내피세포로의 분화
hiPSCs(CMC-hiPS-011)세포주는 KNIH에서 구입하였고, StemMACSTM iPSC-BREW (Milltenybiotec) 배지를 사용하여 Matrigel에서 유지하였다. 그 후, 내피세포로 분화시키기 위해 hiPSC를 Matrigel(Corning)이 코팅된 세포 배양 접시(Eppendorf)에 70,000 cell/cm2 로 분주하였다. 배양 후 5 μM Y-27632(Tocris)를 처음 24 시간 동안 첨가하였다. 배지는 매일 교체하고, hiPSC는 세포가 60% confluent될 때까지 3일 동안 iPSC-BREW에서 배양하였다. 0일에 세포를 접종하고 CHIR99021 (Tocris) 6μM/ml로 처리, 1 일 후에 배양 배지를 교체하고 CHIR99021 2 μM/ml를 RPMI1640 + B27(-, 인슐린)에서 다시 처리하였다. 2~5 째일 3일 동안에는 20ng/ml bFGF (RnD system), 10ng/ml EGF(RnD system), 10μg/ml 인간 혈장 피브로넥틴 (Thermofisher) 및 50ng/ml VGFG (RnD system)의 사이토카인이 첨가된 인간-내피-무혈청-배지(Human-Endothelial-Serum-Free-Medium, Thermofiser)를 매일 교환하였다. 5일 후 HESFM 배양액의 VEGF 농도를 30ng/ml로 낮추고, 2일에 1회씩 7 일째에 선별을 수행하였다.
1.2. SDF-1α 발현 MSC의 합성
BM-MSC (Catholic MASTER Cells)는 가톨릭 세포 치료 연구소 (CIC, Seoul, Korea)로부터 입수하였다. MSC를 불사화하기 위해, hTERT 및 c-Myc를 포함하는 복제 불능 렌티 바이러스 벡터를 준비하였고, 세포로 형질도입하였다. SDF-1α를 발현하는 불사화된 MSC를 생산하기 위해, 인간 SDF-1α와 함께 복제 불가능한 렌티 바이러스 벡터를 준비하고 추가로 불사화된 MSC로 형질 도입시켰다. 이후, SDF-eMSC는 제한 희석 방법(limiting dilution method)에 의해 단클론 세포군(monoclonal cell population)으로서 분리하였다. 최종 단일 클론 세포는 SDF-1α 단백질 분비, 증식 속도 및 기타 MSC 표현형에 의해 선택되었다. SDF-eMSC는 10% 우태아 혈청(FBS, Gibco), 10 ng/ml 염기성 섬유아세포 성장 인자(bFGF, Peprotech) 및 2μg/ml 독시사이클린 (Clonetech)이 첨가된 DMEM(Dulbecco's modified Eagle's Medium, low glucose, Gibco)에서 37℃, 5% CO2 조건으로 배양되었다.
1.3. ELISA 분석법
SDF-eMSC 및 SDF-eMSC 패치에서 SDF-1α의 방출 수준은 ELISA(Enzyme-linked immunosorbent assay)를 통해 확인하였다. 첫 번째로 계대에 따른 SDF-eMSC의 SDF-1α 방출 수준을 확인하기 위해, SDF-eMSC는 독시사이클린이 없는 10ml 완전 배지가 있는 100mm 접시 (코닝)에 5x105 세포의 밀도로 분주되었다. 5% CO2 인큐베이터에서 37℃에서 48시간 후 세포를 탈착시켜 회수한 후, 다시 독시사이클린이 없는 1ml 완전 배지에 접종하였다. 48시간 후에 원심 분리하여 세포 파편을 제거하고 조절된 배지를 수확하였다.
두 번째로 BM-MSC와 SDF-eMSC의 SDF-1α의 방출수준을 비교하기 위해, Passage 7의 각각의 세포는 10ml의 독시사이클린이 없는 완전 배지가 있는 100mm 접시 (코닝)에 1x106 세포의 밀도로 분주되었다. 5% CO2 인큐베이터에서 37℃에서 72시간 동안 배양 후, 원심 분리하여 세포 파편을 제거하고 조절된 배지를 수확하였다. SDF-eMSC 농도는 제조업체의 지침에 따라 Human SDF-1α ELISA 키트 (R&D Systems, DY350)를 사용하여 결정되었다. 450nm에서 샘플의 흡광도는 SpectraMAX 190 (Molecular Devices) 마이크로 플레이트 판독기를 사용하여 측정되었다.
1.4. 세포 증식 분석
SDF-eMSC의 증식 속도를 결정하기 위해 4x105 개의 세포를 T75 플라스크에 분주하였다. 3~4 일 후 세포를 채취하고 일회용 혈구계(INCYTO)를 사용하여 트리판블루(Gibco) 배제법을 통해 증식률을 측정하였다. SDF-eMSC의 누적 세포 성장률 (population doubling level, PDL)은 세포 성장(PD)의 합에 의해 결정되었다. PDL은(logN-logN0)/log2를 사용하여 계산되었으며, 여기서 N은 수확된 세포의 수이고 N0은 분주된 세포의 수이다.
1.5. MSC 마커 분석
MSC의 면역 표현형은 유세포 분석을 사용하여 분석되었다. 트립신을 사용하여 세포를 플라스크에서 분리한 다음 1500rpm에서 5 분 동안 원심 분리하고 염색/세척 완충액 (2% FBS가 있는 PBS)에 재 현탁 시켰다. 염색을 위해 BM-MSC 및 SDF-eMSC를 염색/세척 완충액으로 세척하고 제조업체의 지침에 따라 Stemflow WP Human MSC 분석 키트 (BD)를 사용하여 4℃의 어두운 곳에서 30 분 동안 배양했다. MSC는 다음의 접합된 단일 클론 항체들을 이용하여 특성화되었다: CD90 FITC (클론: 5E10), CD105 PerCP-Cy5.5 (클론: 266), CD73 APC (클론: AD2) 및 PE 음성 칵테일(CD34, CD11b, CD19, CD45, HLA-DR). LSR FortessaTM 세포 분석기 (BD Biosciences)를 사용하여 유세포 분석을 수행하고 FlowJo_V10 또는 BD FACS Diva 소프트웨어로 분석하였다.
1.6. 튜브 형성 분석
Free Reduced Growth Factor Basement Membrane Matrix (500μl, Geltrex쪠 LDEV, Thermo Fisher)를 24 웰 플레이트에 첨가하고 30 분 동안 37℃에서 배양하여 고형화하였다. 1x105 cells의 hiPSC-EC 및 인간 제대 정맥 내피세포(HUVEC)를 다양한 유형의 배지 (EGM, EBM, BM-MSC-CM 및 SDF-eMSC-CM)를 포함하는 각 Geltrex 코팅웰에 플레이팅한 다음, 37℃에서 5% CO2와 함께 9, 24, 48 시간 동안 배양하였다. 배지를 제거한 후 고정을 위해 4% PFA를 첨가하고 세포를 광학 현미경을 사용하여 시각화하고 튜브 구조의 형성을 ImageJ 소프트웨어를 사용하여 계산하였다.
1.7. 내피세포 이동 분석
hiPSC-EC 및 HUVEC 세포 (3.5 x 104)를 EBM 기저 배지로 Transwell 삽입물 (8μm 기공)의 상부 층에 분주한 다음 배지 (EGM, EBM, BM-MSC- CM 및 SDF-eMSC-CM)를 포함하는 24-웰 플레이트에 분주하였다. 그 후 세포를 5 % CO2로 37℃에서 7 시간 동안 이동시켰다. 이동된 세포를 4 % PFA에 10 분간 고정하고 0.1 % 크리스탈 바이올렛 (Sigma)을 사용하여 10 분간 염색하였다. Transwell 멤브레인을 증류수로 세척한 후 멤브레인의 윗면을 면봉으로 부드럽게 문질러 이동하지 않은 세포를 제거했다. 이동된 세포를 광학 현미경을 사용하여 계수하고 막의 염색된 영역을 ImageJ 소프트웨어를 사용하여 계산하였다.
1.8. hiPSC-EC의 자극 및 RT-PCR
hiPSC-EC (1x105)를 다양한 유형의 배지 (EGM, BM-MSC-CM 및 SDF-eMSC-CM)를 포함하는 6 웰 플레이트에 분주하고 배지를 매일 교체했다. 72 시간 후, 제조업체의 지침에 따라 플레이트의 세포에 0.5mL의 TRIzol 시약 (Life Technologies)을 첨가하여 총 RNA를 추출하였다. 1μg의 RNA에 대해, SuperScriptTM Reverse Transcriptase IV 및 랜덤 프라이머 (Invitrogen)를 이용하여 cDNA를 합성했다. SYBR® Green PCR Master Mix (Applied Biosystems)는 ABI Real-time PCR StepOne Plus (Applied Biosystems)를 사용하여 사이클링하는 동안 PCR 산물의 축적을 감지하는 데 사용되었다. RT-PCR은 3 회 이상의 반복 실험으로, 3회 수행되었다. 올리고 뉴클레오타이드 프라이머는 실시간 RT-PCR 시스템 서열 검출 소프트웨어 v2.3 (Applied Biosystems)을 사용하여 설계되었으며, 그 서열(서열목록의 서열번호 1 내지 24)은 표 1에 제시되어 있다. 제조업체의 지침에 따라 하우스 키핑 유전자인 18S rRNA 또는 GAPDH의 전사 수준으로 정규화된 CT 값을 사용하여 각 처리 그룹에 대해 각 유전자의 발현 수준의 배 차이를 계산하였다.
| Gene | Primer | |
| Forward (5'=>3') | Reverse (5'=>3') | |
| GAPDH | AGTGCCAGCCTCGTCTCATA | GTAACCAGGCGTCCGATACG |
| SDF-1α | AAGTGTGCATTGACCCGAAG | GTTTCAGAGCTGGGCTCCTAC |
| VEGF | ACGAAAGCGCAAGAAATCCC | CTCCAGGGCATTAGACAGCA |
| HGF | CGACAGTGTTTCCCTTCTCG | ATTGAGAACCTGTTTGCGTTTCT |
| TIE2 | CCAGGATGGCAGGGGCTCCA | GGTAGCGGCCAGCCAGAAGC |
| vWF | CCTTGGTCACATCTTCACATTCAC | TCATTGGCTCCGTTCTCATCAC |
| eNOS | AGATGGTCAACTATTTCCTGTC | GCCACTTCTTTAAAGGTCTTC |
| KDR | GTTCTTCTGGCTACTTCTTGTCATC | GCATCATAAGGCAGTCGTTCAC |
| CD31 | GCAGTGGTTATCATCGGAGTG | CGTTGTTGGAGTTCAGAAGTGG |
| VE-Cad | TGGTGCCTATCTGCCTGGAG | CTTGGAGTGGAGTATGGAGTTGG |
| E-SELE | CGAAGGGTTTGGTGAGGTGT | AGCTGAAGGCACAAGAGGAC |
| ICAM-1 | CAGCTTCTCCTGCTCTGCAA | CAATCCCTCTCGTCCAGTCG |
1.9. 신생아 랫트의 심근세포 분리
신생아 랫트의 심근세포는 가톨릭대학교 동물 관리 및 사용위원회의 승인을 받아 지침에 따라 1 일령 Sprague-Dawley 랫트의 심장에서 분리되었다. 심실 조직을 HBSS(Welgene)에서 0.1% 트립신 용액 (Welgene)과 함께 4℃에서 밤새 부드럽게 교반하면서 배양하였다. 다음날, 소화된 조직을 얼음 위의 페트리 접시로 옮기고 다진 다음 원뿔형 튜브에 수집했다. 소화 용액 [HBSS 중 콜라게나제 B 5ml (1mg/ml); Roche]를 심장 조직에 첨가하고 5ml 피펫을 사용하여 15 회 분쇄하고 부드럽게 교반하면서 37℃ 수조에서 5 분 동안 배양했다. 심근세포를 포함하는 상청액을 분리 배지 [1X 항생제-항진균제 (Gibco)와 함께 20 % FBS (Gibco) 함유 DMEM]]로 옮기고, 소화되지 않은 심장 조직을 10ml의 소화 용액에 재현탁 시켰다. 추가 분해 단계를 수행하고 세포 함유 상청액을 수집하였다. 분해 단계를 5 회 반복한 후 1500rpm에서 10 분 동안 원심 분리하고 분리 배지에서 세포 펠렛을 세척했다. 그런 다음 1500rpm에서 5 분간 원심 분리하고 Percoll (GE Healthcare, 17-5445-02) 밀도 그라데이션을 사용하기 위해 DPBS에서 세포 펠릿을 재현탁하였다. 오염된 섬유아세포 및 EC는 3000rcf, 4℃에서 30 분 동안 Percoll 밀도 그라데이션 원심 분리에 의해 제거되었다. Percoll 밀도-구배 단계 후, 심근세포를 새로운 원뿔형 튜브로 옮기고 분리 배지에 재현탁한 다음 1500rpm에서 10 분 동안 원심 분리하고 분리 배지에서 세포 펠릿을 세척했다. 그런 다음 1500rpm에서 5 분 동안 원심 분리하고 분리 매체에서 세포 펠릿을 재현탁하였다. 이후, 0.1% 젤라틴(Welgene) 코팅된 배양 플레이트에 1x105 cells/cm2의 밀도로 도금하고 37℃ 및 5% CO2 조건에서 배양하였다. 배양 배지로는 비심근 세포의 성장을 억제하기 위해 FBS를 배제하였으며, 배지에는 말 혈청 (Sigma, H1138) 5 %와 항생제-항진균제(Gibco) 1X가 포함되어 있었다. 배지는 격일로 교체되었다.
1.10. ROS 보호 분석
hiPSC-EC, HUVEC 및 NRCM의 ROS 보호 분석은 Live/Dead Viability 키트 (Invitrogen, L3224) 및 CCK-8 시약 (Dojindo Laboratories)으로 평가되었다. H2O2(Sigma, 216763) 시약은 서로 다른 유형의 배양 배지 (5 % FBS 포함 EBM 또는 5% 말혈청 포함 저 포도당 DMEM, 30 %의 BM-MSC 및 SDF-eMSC 조정 배지)로 희석되었다. 총 H2O2 농도는 500 μM (NRCM 및 HUVEC) 및 700 μM (hiPSC-EC)이었다. H2O2 용액을 37℃에서 5% CO2로 2 시간 동안 처리한 후, 배지를 Live/Dead 분석을 위해 칼세인 2M 및 에티듐 호모다이머-1 염료 4M 혼합물을 사용하여 페놀레드가 없는 EBM 또는 DMEM으로 변경했다. 배양은 실온에서 20 분 동안 수행되었다; 세포는 형광 현미경 (Nikon)으로 이미지화 되었다. 이미지는 동일한 설정으로 촬영되었으며 ImageJ를 사용하여 처리되었다. 세포의 생존력은 CCK-8 분석을 사용하여 평가되었다. 배지는 페놀 레드가 없는 EBM 또는 DMEM으로 변경되었다. CCK-8 시약을 5% FBS와 함께 총 배지 부피의 10%를 포함하는 것에 첨가한 다음 37℃에서 5 % CO2와 함께 2 시간 동안 배양했다. 37℃에서 2 시간 동안 배양한 후, Elisa 리더 (Spectramax Plus384, MSD)를 사용하여 450nm에서 흡광도를 측정하였다.
1.11. 탈세포화된 심장 유래 세포외 기질을 이용한 심장 패치 제조
hdECM은 공지된 방법에 따라 준비되었다. 6 개월 된 국내 돼지의 심장 조직을 공급 업체의 승인을 받아 축산물 시장에서 구매했다. 우리는 완전한 돼지 심장에서 좌심실을 해부하고 작은 조각으로 잘랐다. 그런 다음 작은 조각의 심장 조직을 1 % sodium dodecyl sulfate (affimetrix, CA) 용액에 48 시간 동안 담근 후 PBS (Biosesang, Korea)에서 1% triton X-100 용액으로 1 시간 동안 처리했다. 다음으로 탈세포화된 조직을 PBS에 3 일 동안 담가 잔류 계면활성제를 제거하였다. 이어서, 탈세포화된 심장 조직을 동결 건조하고, 액체 질소에서 분쇄하고, 보충된 최종 농도 3.3w/v% (330mg의 hdECM 분말)에서 0.5M 아세트산 용액 (Merck Millipore, Billerica, MA) 10mL에 33mg의 펩신 분말을 추가로 포함하여 분해하였다. 분해된 hdECM 용액을 40 μm pore mesh를 통해 여과하고, 1 ml로 나누어서 추가 실험을 위해 -20℃에 보관했다. 심장 패치를 제조하기 전에, hdECM의 겔화를 피하기 위해 얼음에 원뿔형 튜브를 유지하면서 10 N NaOH 용액을 추가하여 hdECM 용액을 pH 7.4의 중성으로 조정했다.
hdECM 패치를 생성하기 위해 먼저 생성된 코드에 따라 3D 프린터를 사용하여 지원 프레임 워크로 직경 8mm, 높이 0.5mm의 디스크형 폴리카프로락톤 (PCL)을 제작하였다. 그런 다음 PCL 프레임 워크에서 SDF-eMSC (총 1x106/ml), hdECM (20 mg/ml) 및 0.02% (w/v)의 비타민 B2를 혼합하여 hdECM 패치를 구축하였다. 그 후, hdECM 패치를 UVA 광에 약 60 초 동안 노출시켜 비타민 B2 유도 후 가교 과정 (광 강도: 30 mW/cm2)을 시작하고 추가 열 가교를 위해 24 시간 동안 37℃에서 유지하였다. 이러한 모든 절차 후, hdECM 패치의 최종 두께와 직경은 각각 평균 3mm와 8mm였다.
1.12. SDF-eMSC-PA의 방출 역학
SDF-eMSC-PA의 장기 방출 역학은 시간이 지남에 따라 얻은 조건화된 배지로 인간 SDF-1α에 대한 ELISA를 수행하여 평가되었다. 패치는 디스크 모양의 PCL에서 SDF-eMSC(1x106) 및 인간 SDF-1α 사이토카인(50, 100, 300 ng/ml)이 있는 hdECM(100 μl)으로 만들어졌다. 그 후, 패치를 10% 우태아혈청 (FBS, Gibco) 및 5 ng/ml 염기성 섬유아세포 성장 인자 (bFGF, Peprotech)가 보충된 저-포도당 함유 DMEM 배지(Gibco)에서, 37℃, 5% CO2 조건으로 배양하였다. 매 2 일마다 배지를 교체하고 각 0, 7, 14, 21 및 28일 시점에, 72 시간 동안 축적한 패치가 조건화된 배지를 얻었다.
1.13. 심근경색 모델 및 패치의 전달
모든 연구는 가톨릭 대학교 동물 관리 및 사용위원회의 승인하에 수행되었다. Fischer 344 랫트(160-180g, 수컷, Koatec, 한국)를 2 % 이소플루란을 흡입하여 마취하고 18 게이지 정맥 카테터를 기관을 통해 삽관하였다. 랫트는 설치류 인공 호흡기 (55-7058, Harvard Apparatus, Canada)를 이용하여 기계적으로 호흡시켰다. 시술 중 체온 저하를 방지하기 위해 동물을 37℃ 온열 패드에 위치하였다. 흉부를 면도하고 70% 알코올로 소독한 후 개흉술을 시행했다. 심근경색(MI)는 좌전 하행 (LAD) 동맥에 폴리에틸렌글리콜 튜브(22G)를 사이에 두고 봉합사를 묶어 1분간 MI를 유도하고 1분간 재관류 후에, 7-0 prolene 봉합사를 사용하여 매듭을 영구적으로 결찰했다. 기준 좌심실 기능(POD)을 확립하기 위해, 박출률(EF)을 수술 7일 후 조사하였다 (포함 기준: 심 초음파 평가, EF<45%). 다음날, 랫트를 이소플루란을 흡입시켜 다시 마취시키고, 삽관 하여 기계 호흡시켰다. 우리는 하기와 같이 3 개의 치료 플랫폼을 생성하였다.
1) 심근 내 이식에 의한 hiPSC-EC (EC, 1 x 106)
2) 심장 외막 이식에 의한 SDF-eMSC-PA (PA, 1 x 106)
3) hiPSC-EC와 SDF-eMSC-PA의 결합 플랫폼 (EC + PA, 각 1 x 106)
동물의 가슴을 다시 열고, hiPSC-EC를 심장의 경색 경계 영역에 있는 두 개의 다른 부위에 주입한 다음 3 개의 봉합사를 사용하여 심 외막에 직접 3D 심장 패치를 이식했다. 갈비뼈와 근육, 피부를 무균처리된 봉합사로 봉합하고 항생제와 0.9 % 생리 식염수를 투여하였다. 모든 동물은 공지된 바와 같이 면역 억제제 (azathioprine, 2mg/kg; cyclosporine A, 5mg/kg; methylprednisolone, 5mg/kg)를 매일 투여 받았다.
1.14. 심장 초음파
동물을 이소플루란으로 마취시키고 온열 패드를 사용하여 37℃에서 유지 하였다. 15MHz L15-7io 선형 변환기(Affniti 50G, Philips)가 장착된 경흉부 심 초음파 시스템을 사용하여 치료 후 1, 2, 4 및 8 주에 연속 심장 초음파 검사를 수행하여 분출률 (EF), 분획 단축(FS), 좌심실 이완 기말 직경(LVIDd), 좌심실 수축 기말 직경 (LVID), 관련 벽 두께 (RWT), 중격벽 두께(SWT) 및 후벽 두께(PWT)을 측정하였다. 모든 매개 변수는 중간-유두근 레벨에 도달한 M 모드에서 측정되었다. 심 초음파 검사 시, 그룹 분류는 블라인드로 진행하였다.
동물을 이소플루란으로 마취시키고 온열 패드를 사용하여 37℃에서 유지 하였다. 손상된 심장 조직의 기능적 개선 평가는 심 초음파 검사로 수행되었다. 랫트를 이소플루란을 흡입하여 가볍게 마취하고 15MHz L15-7io 선형 변환기 (Affniti 50G, Philips)가 장착된 경흉부 심 초음파 시스템을 사용하여 생리학적 데이터를 기록했다. 연속심 초음파 검사는 치료 전, 2, 4, 8 주에 수행되었다. 심 초음파 검사 시, 그룹 분류는 블라인드로 진행하였다. 좌심실 수축기 기능의 지표인 박출률(EF)과 단편적 단축(FS)은 각각 다음 방정식으로 계산되었다.
Vd = [7 / (2.4 + LVIDd)] x LVIDd3
Vs = [7 / (2.4 + LVIDs)] x LVIDs3
EF(%) = (Vd - Vs) / Vd
1.15. 혈역학적 측정
동물 모델의 안락사 전 8주 말에 혈역학적 측정을 수행하였다. 출혈 없는 개흉술 후, 심장의 LV 정점을 26 게이지 바늘로 뚫고 2F 전도도 카테터(SPR-838, Millar)를 LV에 삽입하였다. LV 압력-체적(PV) 파라미터는 디지털 컨버터 (PowerLab 16/35, ADInstruments, Colorado Springs, CO)와 결합된 PV 전도도 시스템 (MPVS Ultra, emka TECHNOLOGIES, Paris, France)을 사용하여 지속적으로 기록되었다. 수축기 말 압력 체적 관계 (ESPVR) 및 이완기 말 압력 체적 관계 (EDPVR)의 기울기를 포함하는 심장 기능 부하의 독립적 측정은 바늘 홀더를 사용하여 일시적으로 하대정맥(IVC) 폐색에 의해 유도된 다른 전부하들을 달성하였다. 혈역학적 측정 후 평행 전도도를 계산하기 위해 50μl의 고혈압 식염수 (20% NaCl)를 왼쪽 경정맥에 주입했다. 혈액을 좌심실에서 헤파린 처리된 주사기로 채취하고 큐벳에 배치하여 카테터를 사용하여 전도 신호를 부피로 변환했다. 래트의 절대 부피는 병렬 전도도와 큐벳 전도도를 보정하여 정의되었다.
1.16. 면역조직화학
동물 모델의 희생 시, 심장은 실온에서 15 분 동안 그리포니아 심플리시폴리아(Griffonia simplicifolia)에 포함된 로다민-접합 이소렉틴 B4로 관류되었다. 그런 다음 심장을 4 % 파라포름알데히드에 밤새 고정한 다음 블록을 만들었다. 심장은 마이크로톰(Leica, RM2255, Germany)을 사용하여 정점 상단에서 시작하여 5μm 섹션으로 단면화되었다. 섹션은 사용하기 전에 -20℃에 보관되었다. 탈 파라핀화 및 재수화 후, 습윤 챔버에서 표적 회수 용액(DAKO)으로 항원 회수를 수행하였다. PBS로 3 회 세척한 후 핵 염색을 위해 DAPI 용액(VectaShield)으로 섹션을 염색한 다음 슬라이드에 장착했다. 형광 현미경 (Nikon)을 사용하여 5 개의 무작위 현미경 필드에서 모세 혈관의 수를 계수하고 조직 면적 평방 밀리미터 당 모세 혈관의 수로 표시하였다.
1.17. 섬유증 측정
심근경색(MI) 심장의 섬유증 영역을 결정하기 위해 Masson's Trichrome (MT) 염색 (Sigma, St. Louis, MO, USA)을 수행하였다. 파라핀 슬라이드 3 개를 탈파라핀화 및 재수화 하기 전에 37℃ 건조 오븐에서 인큐베이션하였다. 파라핀 절편은 56℃ Bouin 용액에서 1 시간 동안 다시 고정하였다. 이들 절편은 Weigert의 Iron Hematoxylin Solution을 사용하여 실온에서 15 분 동안 염색한 후, Biebrich scarlet-acid fuchsin 용액을 사용하여 실온에서 20 분 동안 염색하였다. 마지막으로, 섹션을 Aniline Blue로 15 분 동안 카운터 염색한 다음 1% 아세트산에서 1 분 동안 실온에서 인큐베이션하였다. 각 단계 사이에 광범위한 세척이 수행되었다. 콜라겐 섬유는 파란색으로, 생존 가능한 심근은 빨간색으로 관찰되었으며, 심장 섹션의 이미징은 슬라이드 스캐너(Pannoramic MIDI)로 수행되었다. 섬유증 영역을 포함한 다른 모든 항목은 ImageJ 소프트웨어를 사용하여 정량화되었다.
1.18. 데이터 분석
모든 정량 데이터는 달리 표시되지 않는 한 평균±S.E로 표시된다. 두 그룹 간의 통계적 차이는 양측 스튜던트 t-검정으로 분석되었다. 4 개의 그룹 간 통계적 차이도 Bonferroni의 사후 분석과 함께 ANOVA로 분석되었다. 결과는 p- 값이 0.05 미만일 때 통계적으로 유의한 것으로 간주되었다.
실시예 2. hiPSC로부터 CD31+ 내피세포(EC) 생성 및
in vitro
분석.
hiPSC-EC(인간 유도만능줄기세포로부터 분화된 내피세포)는 소분자 기반 2D 분화 방법 (Ref, Grigoriadis et al., Blood, 115 (2010), pp. 2769-2776)을 사용하여 생성되었다 (Xiaojun Lian et al., Stem Cell Reports, (2014) 11; 3 (5): 804-16). hiPSC에서 분화된 내피 계통 세포를 풍부하게 하기 위해 CD31 항체를 사용하여 FACS로 CD31+ 세포를 분류하고 혈관 내피 성장 인자(VEGF, vascular endothelial growth factor)를 포함한 혈관성 유형의 사이토카인을 포함하는 배양 배지에서 배양하였다. hiPSC-CD31+ 세포는 전형적인 내피세포의 형태를 보였으며, HUVEC보다 PECAM, VE-Cadherin, VEGFR2 및 vWF와 같은 EC 특정 마커의 mRNA 수준이 훨씬 더 높았다 (도 1). 또한, 면역 형광 결과에서 hiPSC-CD31+ 세포가 PECAM 및 vWF 단백질을 발현하는 것을 추가로 확인하였다 (도 2). 기능 수준에서 hiPSC-CD31+ 세포는 Ac-LDL을 흡수하고, Matrigel 위에 모세관 유사 네트워크를 형성할 수 있는 능력을 가졌음을 확인하였다.
실시예 3. 심근 내 주입된 hiPSC-EC의 혈관 신생(vasculogenesis) 효과
심근경색(MI)을 유발한 동물 모델에서 hiPSC-EC가 심장의 혈관 형성 메커니즘을 통해 de novo 혈관을 형성할 수 있는지 확인하기 위해, 심근경색(MI) 유도 랫트 심장의 경계 영역에 있는 두 개의 서로 다른 부위에 CD31+ hiPSC-EC를 심근 내 주입하였다. 심근경색(MI)는 심장의 좌전하행 (LAD) 동맥의 결찰에 의해 생성되었다. 추적 목적으로 녹색 형광(GFP) 신호를 지속적으로 발현하는 hiPSC-EC가 사용되었다. 심근경색(MI) 심장의 기능 혈관을 시각화하기 위해, hiPSC-EC 주입 후 8 주 후 조직 수확 전에 심장에 적색 형광 염료와 결합된 isolection-B4(IB4)로 관류 염색을 수행하였다. 형광 이미지 분석은 hiPSC-EC에 주입된 심장의 모세 혈관 수가 심근경색(MI) 대조군보다 유의하게 높음을 보여주었다 (도 3). 다음으로, 심근경색(MI) 심장의 혈관 형성에 대한 hiPSC-EC의 영향을 평가하기 위해 심장 조직 내 hiPSC-EC의 GFP 신호를 추적하였다. 공초점 현미경 이미지는 hiPSC-EC의 IB4 및 GFP 신호 모두에 대해 상당한 수의 혈관이 주입 후 8주 후에, 심장 조직에 주입된 hiPSC-EC의 경색 영역에서 검출되었음을 보여주었다. 또한, 상당한 수의 hiPSC-EC가 숙주 모세관 네트워크와 통합되었고 이들 중 다수가 혈관 주위 영역에 위치한 것을 확인하였다 (도 4). 이러한 결과는 CD31+ hiPSC-EC가 허혈성 심장에서 de-novo 혈관을 재구성할 수 있음을 의미한다.
혈관 형성을 통한 혈관 재생으로 인하여 심근경색(MI)이 회복될 수 있으므로, hiPSC-EC를 심근경색(MI) 심장에 심근 내 주입할 경우, 심장 기능을 촉진할 수 있음을 실험을 통해 확인하였다. 심근경색(MI) 유도 후 심근 내 주사 또는 패치 이식을 하기 전, 주사 또는 패치 이식 후 2, 4 및 8 주에 각각 좌심실 (LV) 기능 및 심장 리모델링을 평가하기 위한 직렬 심장 초음파 검사를 수행하였다. 분출률(EF) 및 분획 단축 (FS)에 의해 결정된 심장 초음파 검사 결과, hiPSC-EC를 주입한 심장(EC)이 8 주까지 심근경색(MI) 대조군에 비해 훨씬 더 높은 EF, FS를 나타냄을 확인하였다(도 5). 좌심실 내부 이완기 치수(LVIDd), 좌심실 내부 수축기 치수(LVISd), 중격 벽 두께(SWT) 및 후벽 두께(PWT)와 같은 심장 리모델링을 위한 여러 매개 변수에 대하여, hiPSC-EC가 주입된 모델에서 LVIDd 및 LVID 심장은 심근경색(MI) 대조군 심장보다 현저히 낮았는데, 이는 hiPSC-EC에 의한 혈관재생이 허혈 후에 심장의 병리학적 리모델링을 완화시켰음을 보여주는 결과이다(도 7). 이와 유사하게, 심근경색(MI) 후 8 주에 채취한 심장 조직을 사용하여 얻은 Masson's trichrome 염색 결과는 hiPSC-EC 주입 그룹의 섬유증 면적(%)이 심근경색(MI) 대조군에 비해 상당히 작고 생존성 심근(%)이 더 컸음을 보여주었다 (도 8). 상기 결과로부터, hiPSC-EC는 심근경색(MI) 심장에서 생체 내 de-novo 혈관을 생성하고 심장 기능을 향상시키는 데 직접 기여할 수 있음을 확인하였다.
실시예 4. SDF-eMSC의 세포적 특성
제조된 SDF-eMSC는 MSC의 대표적인 형태학적 특성인 균질한 방추형 세포 형태로서, 정상의 BM-MSC와 형태적으로 다르지 않았다 (도 9). SDF-eMSC는 MSC 특이적 마커를 발현하는 양상을 보임을 확인하였다 (도 10). 또한, SDF-eMSC는 세포 성장률(PDL)이 배양 시간동안 안정적으로 유지되었으며, 동시에 높은 수준의 SDF-1 단백질의 발현 능력을 가지고 있음을 확인하였다 (도 11 및 12). SDF-eMSC는 인간 SDF-1α의 ELISA 분석을 통해, Passage 16까지 인간 SDF-1α 단백질을 안정적으로 분비하였으며 (도 13), 핵형 분석을 통해 염색체 이상이 없는 정상 핵형을 가짐으로써, 유전적 안정성(genetic stability)이 있음을 확인하였다(도 14).
실시예 5.
In vitro
에서 SDF-eMSC의 내피세포의 혈관 신생 향상 효과
SDF-eMSC가 내피세포의 혈관 신생을 증가시킬 수 있는지 여부를 조사하기 위해 SDF-eMSC를 사용하여 다양한 유형의 in vitro 실험을 수행하였다.
먼저, SDF-eMSC가 내피세포 및 혈관 신생 특성과 관련된 유전자 발현에 영향을 미치는지 여부를 조사하기 위해, 배양된 SDF-eMSC 또는 BM-MSC로부터 얻은 30% 컨디션드 배지(CM, conditioned media)에서 배양된 hiPSC-EC에 3 일 동안 처리하고 qRT-PCR 분석을 수행하였다. 그 결과, Tie-2 (tyrosine kinase with Ig and epidermal growth factor homology domain 2), vWF (von willebrand factor), SDF-1α, CD62 (E-selectin) 및 ICAM-1 (intercellular adhesion molecule-1)의 발현 수준은 BM-MSC-CM으로 처리된 hiPSC-EC에 비해 SDF-eMSC-CM으로 처리된 hiPSC-EC에서 훨씬 더 높았다(도 15). 특히, 활성화된 ECs로서 혈관 신생에 관여하는 것으로 알려진 E-selectin 및 ICAM-1의 발현 증가가 관찰되었다.
다음으로, 내피세포 이동 분석에서, 30%의 SDF-eMSC-CM으로 추가 처리된 경우에는 BM-MSC-CM이 처리된 경우에 비하여 hiPSC-EC (도 16) 또는 HUVEC (도 17)의 이동을 크게 향상시켰음을 확인하였다. 이로써, SDF-eMSC에서 방출된 사이토카인이 내피세포의 이동성을 강화한다는 것을 확인하였다.
또한, SDF-eMSC가 직접 혈관 신생(angiogenesis)을 촉진하는지 여부를 확인하기 위해, Matrigel tube 형성 분석을 수행하여 세포의 혈관 형성 능력을 평가하였다. Matrigel tube 형성 분석의 결과, 배양된 SDF-eMSC로부터 얻은 30% CM(conditioned media)으로 처리한 hiPSC-EC 및 인간 제대 내피세포(HUVEC) 모두에서는 BM-MSC-CM으로 처리된 내피세포에 비해 형성된 가지(branches)의 수 및 튜브 길이가 현저히 큰 것으로 나타났다 (도 18). 또한, SDF-eMSC-CM의 처리는 hiPSC-EC의 튜브 형성 기능을 촉진했을 뿐만 아니라, hiPSC-EC가 형성된 혈관이 오래 유지되도록 도와주었다. BM-MSC-CM이 처리된 hiPSC-ECs는 혈관 형성 후 24 시간 이내에 혈관 구조가 파괴되기 시작한 반면, SDF-eMSC-CM을 처리된 경우에는 최대 48 시간까지 형성된 혈관이 유지되었다.
마지막으로, SDF-eMSC가 내피세포 또는 심근세포에 직접적인 세포 보호 효과를 부여할 수 있는지 여부를 확인하기 위하여, 세포에 H2O2(500 μM)를 처리하여, 산화적 스트레스를 유발한 뒤, 이의 효과를 확인하였다. 그 결과, SDF-eMSC-CM가 투여된 경우에는 대조군에 비해 허혈성 손상에 대한 내피세포 및 심근세포의 세포 생존력을 유의하게 개선하였다 (도 19). 즉, SDF-eMSC-CM은 허혈성 손상에 대한 세포 보호 효과를 가지고 있음을 확인하였다.
상기 결과로부터, SDF-eMSC는 hiPSC-EC의 혈관 신생 특성을 촉진할 수 있을 뿐만 아니라 세포 보호 SDF 사이토카인의 일관된 분비를 통해 내피세포 및 심근세포를 직접적으로 보호할 수 있음을 확인하였다.
실시예 6. SDF-eMSC-PA의 SDF-1α 지속적 방출 효과
SDF-eMSC 패치(SDF-eMSC-PA)가 SDF-1α를 효율적으로 방출할 수 있는지 확인하기 위하여 실험을 진행하였다. 먼저 SDF-eMSC-PA의 생산을 위해 SDF-eMSC를 2% 심장 유래 탈세포화 세포외 매트릭스 (hdECM) 기반 바이오 잉크와 혼합하고 폴리카프로락톤(PCL) 메쉬에 로딩하였다 (도 20). 후, SDF-eMSC-PA를 시험관 내 조건에서 28 일 동안 배양하고 다양한 시점에서 상층 액을 수집하여 SDF-1α ELISA 분석 키트를 통해 SDF-eMSC-PA의 방출 동역학을 분석하였다. 도 21에서 나타낸 바와 같이, 누적 방출 곡선은 SDF-1α의 초기 농도가 0 일에 SDF-eMSC-PA보다 SDF-cytokine-PA(300ng/ml)에서 더 높았지만 SDF-1α는 SDF-cytokine-PA에서는 검출되지 않았으며, 반면, SDF-eMSC-PA에서 방출된 SDF-1α는 21 일 까지 지속적으로 증가하여 SDF-eMSC가 패치 내에서 SDF-1α를 지속적으로 방출하고 있다는 것을 확인하였다.
실시예 7. hiPSC-EC 및 SDF-eMSC-PA 병용 시, 심장 기능 개선 및 혈관 재생 효과
hiPSC-EC 및 SDF-eMSC-PA를 함께 사용하여 혈관 형성 및 혈관 신생을 동시에 유도할 경우, 심근경색(MI) 유도 심장에서 포괄적인 혈관 재생 및 심장 기능 개선을 이끌 수 있는지 여부를 확인하기 위한 실험을 진행하였다. 랫트의 심장의 LAD 결찰에 의한 심근경색(MI)를 유도하고, 1) Sham control, 2) MI control, 3) SDF-eMSC-PA 이식 MI 심장 심외막 (PA, 1x106), 4) hiPSC-EC 심근내 주사 (EC, 1x106) 및 5) hiPSC-EC 및 SDF-eMSC-PA (EC+PA, 각각 1x106)의 병용 투여의 5가지 방법으로 실험을 수행하였다.
PRE (MI 후 1 주 및 처리 전), 처리 후 2, 4 및 8 주에 모든 실험 그룹에 대해 연속 심장 초음파 검사를 수행하였다. 그 결과, 심 초음파 검사에서 병용 치료군의 심장 기능이 8 주까지 단독 처리군에 비해 유의하고 지속적으로 높음을 확인할 수 있었다 (도 22). 또한, LVIDd, LVID, RWT 및 SWT를 측정한 결과, 심장 리모델링은 다른 실험 그룹에 비해 EC+PA 그룹에서 현저하게 감소하였다 (도 23). 또 다른 결과는, 병용 투여군이 심장 섬유증을 현저하게 감소시켰다는 것이다. 투여 후 8 주에 채취한 심장 조직을 Masson's trichrome 염색으로 확인한 결과, 다른 실험군에 비해 병용 치료군에서 섬유증 면적(%)이 현저히 낮았음을 확인하였다 (도 24).
또한, 심장 기능을 더욱 정밀하게 평가하기 위해 LV 혈역학적 압력과 부피를 측정할 수 있는 침습적 압력-볼륨(PV) 카테터를 통해 LV 혈역학적 측정을 추가로 수행하였다. 심근경색(MI) 후 8 주차에 PV 루프의 측정 결과, EC+PA 그룹에서 다른 그룹에 비해 심장 기능을 크게 개선하고 심장 리모델링을 보호하는 것으로 나타났다 (도 25). 또한, EC+PA 그룹에서 1회 박출량 (SV) 및 분당 심박출량(CO)과 같은 일반적인 심장 기능의 두 가지 파라미터가 상당히 높았으며, 최대 확장기에서 측정된 심장 리모델링 지수인 최대 용적(V max)의 경우, EC+PA 투여군은 다른 그룹에 비해 유의하게 낮았다 (도 26). 최대 수축기에서 측정된 최대 압력(P max)은 그룹 간에 큰 차이가 없었지만, 최대 압력 변화율(dP/dt max)과 LV의 압력 변화를 나타내는 최소 압력 변화율 (dP/dt min)은 EC+PA 투여군에서 증가하였다 (도 27). 종합적으로, LV 혈역학 측정 결과는 hiPSC-EC 및 SDF-eMSC-PA를 병용 투여할 경우, 심근경색(MI) 심장 회복을 개선할 수 있음을 확인하였다.
실시예 8. 병용 투여에 의한 심근 내 hiPSC-EC 생착 향상 및 신생 혈관 개선 효과
SDF-eMSC-PA에 의한 심근 내 hiPSC-EC의 in vivo 활성을 조사하였다. hiPSC-EC의 심장 조직 내 활성은 GFP의 발현을 통해 확인하였다. 처리 후 8 주 경과시 채취된 심장 조직을 공초점 현미경으로 관찰하였다. 그 결과, SDF-eMSC-PA의 이식이 심근 내 주사 된 GFP 양성 hiPSC-EC의 유지 및 생착을 상당히 개선하였음을 확인할 수 있었다. 양적으로, EC+PA 병용 투여군에서 GFP 양성 hiPSC-EC의 비율은 내피세포(EC) 단독 그룹보다 상당히 높았다 (도 28). 또한, hiPSC-EC 단독 투여군의 hiPSC-EC는 주사 부위 근처에만 국한되었지만 EC+PA 그룹의 hiPSC-EC는 좌심실의 모든 영역에 분포되어 있었다(도 29). 결과적으로, SDF-eMSC-PA가 조직학적 분석을 통해 숙주 혈관으로부터 hPSC-ECs 의존성 혈관 형성 및 혈관 신생을 동시에 촉진한다는 것을 확인하였다.
또한, 내피세포의 기능을 확인하기 위해 동물 모델의 희생 전에 RFP 염료가 결합된 ILB4가 전신 주입되었다. IB4 관류 염색 이미지는 EC+PA 그룹에서 심장의 경계 영역(border zone)과 경색 영역(infarct zone) 모두에 있는 모세 혈관 수가 EC 단독 투여군을 포함한 다른 실험 그룹보다 상당히 높았음을 보여주었으며, 이는 혈관 신생이 병용 투여에 의해 향상되었음을 명확히 증명하는 것이다(도 30 및 도 31).
또한, hiPSC-EC-GFP+에 의해 형성된 de-novo 혈관의 수가 EC 단독 투여 그룹 보다 EC+PA 그룹에서 상당히 높았으며 이는 SDF-eMSC-PA가 hiPSC-EC에 종속된 혈관 형성에 영향을 주는 것을 의미한다(도 32). 특히, 병용 투여 그룹에서 더 큰 직경 (직경 범위 : 5-10μm)을 가진 모세 혈관의 수는 다른 실험군보다 많았으며, 이는 SDF-eMSC-PA가 혈관 성장에 효과가 있다는 것을 의미한다. 상기 결과로부터, hiPSC-EC 및 SDF-eMSC-PA의 병용 투여는 혈관 재생을 강화하고, 이를 통해 통합적인 심장 기능 회복으로 이어질 수 있어, 허혈성 심장질환, 심근경색, 동맥경화증, 협심증 또는 혈관 폐색과 같은 심장 질환의 치료에 유용하게 사용할 수 있음을 확인하였다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
Claims (12)
- 내피세포(endothelial cell)로 분화가능한 줄기세포; 및SDF-1α을 발현하도록 형질전환된 중간엽줄기세포를 포함하는 심장 혈관 재생용 조성물.
- 제1항에 있어서,상기 내피세포로 분화가능한 줄기세포는 배아줄기세포, 유도만능줄기세포, 중간엽줄기세포 및 다능성 줄기세포로 이루어진 군에서 선택되는 것인, 심장 혈관 재생용 조성물.
- 제1항에 있어서,상기 SDF-1α을 발현하도록 형질전환된 중간엽줄기세포는 불사화된 중간엽줄기세포인 것인, 심장 혈관 재생용 조성물.
- 제1항에 있어서,상기 조성물은 상기 SDF-1α을 발현하도록 형질전환된 중간엽줄기세포의 배양액을 추가로 포함하는 것인, 심장 혈관 재생용 조성물.
- 제1항에 있어서,상기 조성물은 세포외 기질(ECM)을 추가로 더 포함하는 것인, 심장 혈관 재생용 조성물.
- 제1항 내지 제5항 중 어느 한 항에 따른 조성물을 포함하는 심장 혈관 재생용 패치.
- 제6항에 있어서,상기 패치는 SDF-1α를 발현하도록 형질전환된 중간엽줄기세포를 포함하는 것인, 심장 혈관 재생용 패치
- 제6항에 따른 심장 혈관 재생용 패치 및 내피세포(EC)를 포함하는 심장 혈관 재생용 키트.
- 제8항에 있어서,상기 내피세포는 유도만능줄기세포로부터 분화된 내피세포인 것인, 심장 혈관 재생용 키트.
- (a) 심장 유래 탈세포화된 세포외 기질(ECM)을 제조하는 단계;(b) 고분자 지지체를 제조하는 단계; 및(c) 제1항에 따른 심장 혈관 재생용 조성물을 상기 (b) 단계의 고분자 지지체에 증착하는 단계를 포함하는 심장 혈관 재생용 패치의 제조 방법.
- 제1항 내지 제5항 중 어느 한 항에 따른 조성물을 포함하는 심장 질환 치료용 약학적 조성물.
- 제11항에 있어서,상기 심장 질환은 허혈성 심장질환, 심근경색, 동맥경화증, 협심증 및 혈관 폐색으로 이루어진 군에서 선택되는 것인, 약학적 조성물.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020200167578A KR102545746B1 (ko) | 2020-12-03 | 2020-12-03 | 유도만능줄기세포 유래 혈관세포 및 SDF1a를 발현하는 중간엽 줄기세포를 포함하는 심장 재생용 조성물 |
| KR10-2020-0167578 | 2020-12-03 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022119348A1 true WO2022119348A1 (ko) | 2022-06-09 |
Family
ID=81853257
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2021/018112 Ceased WO2022119348A1 (ko) | 2020-12-03 | 2021-12-02 | 유도만능줄기세포 유래 혈관세포 및 sdf1a를 발현하는 중간엽줄기세포를 포함하는 심장 재생용 조성물 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR102545746B1 (ko) |
| WO (1) | WO2022119348A1 (ko) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150139967A1 (en) * | 2002-08-22 | 2015-05-21 | Marc S. Penn | Method of treating ischemic disorders |
| WO2017123623A1 (en) * | 2016-01-11 | 2017-07-20 | University Of Louisville Research Foundation, Inc. | Engineered cardiac tissue and related methods |
| US20180127713A1 (en) * | 2016-11-07 | 2018-05-10 | Emory University | Method of Producing Stem Cell-Derived Endothelial Cells and Uses Thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MXPA05011896A (es) * | 2003-05-05 | 2006-05-25 | Univ Ben Gurion | Preparaciones polimericas reticuladas inyectables y sus usos. |
| BR112015020469A2 (pt) * | 2013-03-15 | 2020-01-28 | Ampio Pharmaceuticals Inc | Usos de da-dkp, composição e método para fornecimento de células-tronco a umindivíduo |
| KR102306236B1 (ko) * | 2019-03-15 | 2021-09-29 | 가톨릭대학교 산학협력단 | 유도만능줄기세포 유래 세포치료제의 치료 효율 및 성능 향상을 위한 중간엽 줄기세포 기반 패치 적용 기술 |
-
2020
- 2020-12-03 KR KR1020200167578A patent/KR102545746B1/ko active Active
-
2021
- 2021-12-02 WO PCT/KR2021/018112 patent/WO2022119348A1/ko not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150139967A1 (en) * | 2002-08-22 | 2015-05-21 | Marc S. Penn | Method of treating ischemic disorders |
| WO2017123623A1 (en) * | 2016-01-11 | 2017-07-20 | University Of Louisville Research Foundation, Inc. | Engineered cardiac tissue and related methods |
| US20180127713A1 (en) * | 2016-11-07 | 2018-05-10 | Emory University | Method of Producing Stem Cell-Derived Endothelial Cells and Uses Thereof |
Non-Patent Citations (2)
| Title |
|---|
| LEE, MIN YEONG: "Development of integrative application technique of human pluripotent stem cell-derived cardiomyocytes(hPSC-CMs)/mesenchymal stem cells(MSCs) for ischemic heart disease", FINAL (RESULT) REPORT OF SCIENCE AND ENGINEERING PERSONAL BASIC RESEARCH SUPPORT PROJECT, 1 January 2017 (2017-01-01), pages 1 - 10, XP055936039, DOI: 10.23000/TRKO201800003085 * |
| PARK SOON-JUNG, KIM RI YOUN, PARK BONG-WOO, LEE SUNGHUN, CHOI SEONG WOO, PARK JAE-HYUN, CHOI JONG JIN, KIM SEOK-WON, JANG JINAH, C: "Dual stem cell therapy synergistically improves cardiac function and vascular regeneration following myocardial infarction", NATURE COMMUNICATIONS, vol. 10, no. 1, 1 December 2019 (2019-12-01), pages 1 - 12, XP055817786, DOI: 10.1038/s41467-019-11091-2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20220078246A (ko) | 2022-06-10 |
| KR102545746B1 (ko) | 2023-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7535070B2 (ja) | 虚血性疾患または虚血性損傷を処置するための心臓線維芽細胞由来細胞外マトリックスおよびその注射可能製剤 | |
| Mills et al. | Stem cell therapy enhances electrical viability in myocardial infarction | |
| Lokmic et al. | Engineering the microcirculation | |
| Wang et al. | Injectable biodegradable hydrogels for embryonic stem cell transplantation: improved cardiac remodelling and function of myocardial infarction | |
| CN101820890A (zh) | 心脏脂肪组织来源的成体干细胞群及其在心脏再生中的用途 | |
| US9913864B2 (en) | Compositions and methods for cardiac tissue repair | |
| KR101702629B1 (ko) | 체세포로부터 혈관 전구 세포로의 직접교차분화 유도용 조성물 및 이의 용도 | |
| US20200016210A1 (en) | Methods of Reducing Teratoma Formation During Allogeneic Stem Cell Therapy | |
| ES2378165T3 (es) | Utilización de células procedentes del tejido adiposo para inducir a la formación de una red vascular funcional | |
| Shi et al. | Adipose tissue-derived stem cells embedded with eNOS restore cardiac function in acute myocardial infarction model | |
| Atoui et al. | Marrow stromal cells as universal donor cells for myocardial regenerative therapy: their unique immune tolerance | |
| Lee et al. | Vascularization and restoration of heart function in rat myocardial infarction using transplantation of human cbMSC/HUVEC core-shell bodies | |
| WO2018117569A1 (ko) | 심장줄기세포의 다층세포시트 및 이의 제조방법 | |
| WO2021006670A1 (ko) | 혼합물 4f를 이용한 줄기세포 생물학적 활성 증가용 조성물 | |
| US20120020925A1 (en) | Therapeutic Use of Specialized Endothelial Progenitor Cells | |
| AU2018257071A1 (en) | Peptide for inducing regeneration of tissue, and use thereof | |
| WO2019004792A2 (ko) | 인간 유래 심장 줄기세포 미세구의 제조 방법 및 용도 | |
| WO2019027299A2 (ko) | 간세포성장인자를 발현하는 중간엽줄기세포를 유효성분으로 포함하는 혈관계 질환 예방 또는 치료용 약학 조성물 | |
| KR102545746B1 (ko) | 유도만능줄기세포 유래 혈관세포 및 SDF1a를 발현하는 중간엽 줄기세포를 포함하는 심장 재생용 조성물 | |
| KR102513507B1 (ko) | 장기 섬유증의 예방 또는 치료제 | |
| WO2015199416A1 (ko) | 피부 또는 혈관 조직 손상 치료용 약학 조성물 및 이의 이용 | |
| WO2001063281A1 (en) | Methods of screening for compounds that modulate blood vessel formation | |
| WO2026024042A1 (ko) | 하지 허혈 치료 효과를 보유한 스페로이드 및 이의 제조방법 | |
| Zhou et al. | A novel experimental study on establish a myoblasts differentiated cell sheet using induced adipose-derived stem cell technology | |
| Xie et al. | Cardiac Derived CD51-Positive Mesenchymal Stem Cells Enhance the Repair of Infarcted Heart in Mice Through SCF-Mediated Angiogenesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21901036 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 21901036 Country of ref document: EP Kind code of ref document: A1 |