WO2022119310A1 - Anticorps se liant spécifiquement à aimp2 et/ou à un agrégat d'aimp2 - Google Patents

Anticorps se liant spécifiquement à aimp2 et/ou à un agrégat d'aimp2 Download PDF

Info

Publication number
WO2022119310A1
WO2022119310A1 PCT/KR2021/018007 KR2021018007W WO2022119310A1 WO 2022119310 A1 WO2022119310 A1 WO 2022119310A1 KR 2021018007 W KR2021018007 W KR 2021018007W WO 2022119310 A1 WO2022119310 A1 WO 2022119310A1
Authority
WO
WIPO (PCT)
Prior art keywords
aimp2
antibody
amino acid
seq
acid sequence
Prior art date
Application number
PCT/KR2021/018007
Other languages
English (en)
Korean (ko)
Inventor
이연종
신정용
Original Assignee
성균관대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 성균관대학교산학협력단 filed Critical 성균관대학교산학협력단
Publication of WO2022119310A1 publication Critical patent/WO2022119310A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]

Definitions

  • the present invention was made under the support of the Ministry of Education of the Republic of Korea, project specific number 1345282452, project number NRF-2018R1D1A1B07046762, the research management specialized institution for the above project is the National Research Foundation of Korea, the research project name is “Basic Research”, and the research project name is “Lewis body formation and Research on molecular mechanisms of lesion propagation and development of diagnosis and control strategies”, organized by Sungkyunkwan University, and the research period is March 1, 2020-2021.02.28.
  • the present invention was made by the project specific number 1711067856 and the project number NRF-2017M3C7A1043848 under the support of the Ministry of Science and ICT of the Republic of Korea. ”, the title of the research project is “Development of a new animal model for expression of brain lesions related to basal ganglia disorder”.
  • the present invention relates to antibodies that specifically bind to AIMP2 and/or AIMP2 aggregates.
  • Neurodegenerative brain diseases have characteristic denatured protein aggregates as a major lesion. That is, in the case of Parkinson's disease and Lewy body dementia disease, the Lewy body composed of denatured ⁇ -synuclein is shown as the main lesion, and in the case of Alzheimer's dementia, the neurofibrillar bundle composed of degenerated tau is the main lesion. indicates.
  • Dementia is a representative chronic progressive degenerative brain disease, and is defined as a complex of symptoms that affects both mental, cognitive and social behavioral abilities, leading to disturbances in normal daily life. , is emerging as a serious social and economical health issue for the elderly. Depending on the cause, dementia is classified into Alzheimer's disease, in which cognitive decline progresses without a clear cause, vascular dementia caused by cerebrovascular diseases such as recurrent cerebral infarction, and dementia caused by other diseases. It is known that 50-60% of all dementia patients are caused by Alzheimer's disease (as of 2014).
  • Alzheimer's disease patients show clinically distinct impairments in intellectual ability, emotional and behavioral changes, etc., and then show signs of serious cortical dysfunction such as loss of direction, memory impairment, and aphasia (Kumar V et al., Robbins and Cotran Pathologic Basis of Disease, Elsevier Saunders, 7th, 2004).
  • Alzheimer's disease (Alzheimer's disease) accounts for about 70% of all dementia patients (as of 2007) and occurs in 6% of the population over 65 years of age.
  • the main cause of cerebrovascular dementia is infarction caused by arteriosclerosis, symptoms can be improved by treatment with thrombolytic drugs, etc.
  • Alzheimer's disease rarely shows prognostic signs before the age of 50, but the prevalence usually increases with age. It is a typical degenerative brain disease that worsens as brain cells are gradually destroyed. The final diagnosis of this disease is only possible through pathological examination through post-mortem autopsy. Medical Association, Neuropsychiatry, 2nd, JoongAng Munhwasa, 2007), although many researchers are actively researching it, the cause of the disease has not been fully elucidated so far.
  • Alzheimer's disease is pathologically characterized by brain atrophy in the cerebral cortex or hippocampus and deposition of senile plaques or neurofibrillary tangles in the brain (Selkoe).
  • DJ. Alzheimer's disease: Genes, proteins, and therapy, Physiol. Rev., 81, pp.741-766, 2001) It accumulates inside, and then the tau protein is aggregated in the nerve cells, resulting in synaptic damage, ultimately causing nerve dysfunction and brain cell death.
  • Parkinson's disease is the second most common age-related disease after senile dementia among neurodegenerative diseases.
  • the number of patients is rapidly increasing.
  • the elderly population in Korea is rapidly increasing, and the number of patients with Parkinson's disease is also continuously increasing.
  • Parkinson's disease is not yet known, it is reported that a complex action of genetic factors and environmental factors causes Parkinson's disease.
  • motor function disorders such as hand tremor, rigidity syndrome, slow mobility, and postural instability appear, and emotional disorders such as emotional instability and fear are accompanied.
  • the development of the disease is gradual, and pathologically, severe degeneration (about 70-80%) of dopaminergic neurons in the substantia nigra of the brain is observed.
  • Lewy bodies which are ⁇ -synuclein aggregate lesions
  • Tau aggregate lesions Amyloid plaque lesions
  • Amyloid plaque lesions several subtypes of aggregate lesions (Tau aggregate lesions, Amyloid plaque lesions) appear. It can be divided into subtypes. That is, the development of additional diagnostic markers that can appropriately classify the subtypes of Parkinson's disease in which various complex lesions appear is necessary for precise treatment tailored to the patient.
  • AIMP2 (Aminoacyl-tRNA synthetase complex interacting multifunctional protein-2) is a substrate protein of E3 ligase Parkin, a recessive gene for Parkinson's disease, and has been reported to be present in Lewy body inclusions in the substantia nigra of Parkinson's patients ( Corti O, et al. The p38 subunit of the aminoacyl-tRNA synthetase complex is a Parkin substrate: linking protein biosynthesis and neurodegeneration. Hum Mol Genet. 2003; 12:1427-1437).
  • AIMP2 is a substrate of pathogenic parkin that accumulates in Parkinson's disease, and the level of AIMP2 is increased in the ventral midbrain of Parkin -/- mice, and the level of AIMP2 is increased in the postmortem brain of patients with Parkin mutation or sporadic Parkinson's disease. rises
  • the accumulation and structural denaturation of AIMP2 triggers AIMP2 aggregation, and in the previous study, it was confirmed that AIMP2 was expressed in Lewy bodies containing ⁇ -synuclein as the main component in the brain of an actual Parkinson's patient. It has been reported that Klein promotes aggregation and affects the expression of Lewy bodies in Parkinson's disease.
  • AIMP2 antibodies do not recognize AIMP2 aggregates.
  • the AIMP2 antibody of Proteintech Group which is currently the most used, is a rabbit polyclonal antibody, it is difficult to ensure consistent quality of the product, and antibody recombination technology is not used.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating neurodegenerative diseases.
  • Another object of the present invention is to provide a composition for diagnosing neurodegenerative diseases.
  • Another object of the present invention is to provide a kit for diagnosing neurodegenerative diseases.
  • Another object of the present invention is to provide an information providing method for diagnosing a neurodegenerative disease.
  • Another object of the present invention is to provide a method for screening a substance that inhibits or inhibits the formation of AIMP2 aggregates.
  • the present invention provides an antibody specific for AIMP2 or a fragment having immunological activity thereof.
  • the present invention provides an isolated nucleic acid molecule encoding the antibody or fragment having immunological activity thereof, a vector comprising the same, and a host cell transformed with the vector.
  • the present invention provides a pharmaceutical composition for preventing or treating a neurodegenerative disease comprising an antibody specific to AIMP2 or a fragment having immunological activity thereof.
  • the present invention provides a composition for diagnosing a neurodegenerative disease comprising an antibody specific to AIMP2 or a fragment having immunological activity thereof.
  • the present invention provides a neurodegenerative disease diagnostic kit comprising the composition.
  • the present invention provides an information providing method for diagnosing a neurodegenerative disease.
  • the present invention provides a method for screening a substance that inhibits or inhibits the formation of AIMP2 aggregates.
  • the present invention provides a screening method for a therapeutic agent for a neurodegenerative disease.
  • the antibody or fragment having immunological activity thereof produced from the 5B2 clone and 6C7 clone of the present invention binds specifically to the AIMP2 aggregate, and the antibody produced from the 3C2 clone and the 7H9 clone or its immunological activity
  • the fragment with the normal structure specifically binds to the AIMP2 monomer of the normal structure
  • the antibody or fragment having immunological activity thereof produced in the 13H9 clone specifically binds to both the AIMP2 aggregate and the normal structure of the AIMP2 monomer, so AIMP2 or AIMP2 aggregate It can be usefully used for diagnosis and treatment of related diseases, in particular, neurodegenerative diseases.
  • Figure 1a shows the results of Western blot analysis of the GST-AIMP2 recombinant protein (0) and the GST-AIMP2 aggregate (7) obtained through the aggregation reaction for 7 days.
  • Figure 1b shows the results of analyzing the amyloid structure through Thioflavin T fluorescence analysis on the recombinant proteins, GST-AIMP2 (GST-AIMP2 monomer) and GST-AIMP2 aggregate (GST-AIMP2 fibril) of normal structure.
  • FIG. 2a shows the results of analyzing the reactivity of the AIMP2 antibody clone with respect to the normal structure (monomer) and aggregate structure of AIMP2, and shows the results of dot blot analysis of antibodies purified from 8 types of clones.
  • Figure 2b shows the results of analyzing the reactivity of the AIMP2 antibody clone with respect to the normal structure (monomer) and the aggregate structure of AIMP2, and shows the results of Western blot analysis of the antibody purified from 8 types of clones.
  • 3A is an immunofluorescence staining image obtained using an antibody (pS129- ⁇ Syn) that labels ⁇ -synuclein, a Lewy body marker, and 5B2, an AIMP2 target antibody in the form of an aggregate, for autopsy temporal lobe brain tissue of a Parkinson's patient and an age-matched normal control group. is shown.
  • Figure 3b shows the relative quantitative graph of the Parkinson's disease patient group compared to the normal control group of the ⁇ -synuclein-labeling antibody (pS129- ⁇ Syn) immunofluorescence signal for the image group of a.
  • 3c is a graph showing the relative quantification of the 5B2 antibody immunofluorescence signal for the image group of a compared to the normal control group of the Parkinson's disease patient group.
  • FIG. 3D shows confocal immunofluorescence images using pS129- ⁇ -synuclein antibody and 5B2 antibody of autopsied temporal lobe brain tissue of a Parkinson's disease patient.
  • 3E shows the results of immunohistochemistry (DAB staining) and distribution analysis of AIMP2 aggregates in autopsied temporal lobe brain tissues of Parkinson's disease patients and age-matched normal controls.
  • Figure 3f shows the results of dot blot analysis of the amount of AIMP2 aggregates in normal control plasma and Parkinson's disease patient plasma.
  • FIG. 4A shows the results of electrophoretic separation and Coomassie blue staining of AIMP2 aggregate-specific 5B2 antibody (mouse IgG framework) and humanized humanized 5B2 antibody 5B2 purified by cloning into human IgG framework.
  • Figure 4b shows the results of dot blot analysis of the reaction of the 5B2 antibody (mouse IgG skeleton) to the GST-AIMP2 monomer and GST-AIMP2 aggregate.
  • 4C shows the results of dot blot analysis of the reaction of the 5B2 humanized chimeric antibody to the GST-AIMP2 monomer and the GST-AIMP2 aggregate.
  • step for or “step for” does not mean “step for”.
  • the present invention relates to an antibody specific for AIMP2 or a fragment having immunological activity thereof.
  • the antibody specific for AIMP2 may be a monoclonal antibody or a humanized antibody.
  • the antibody or fragment having immunological activity specific for AIMP2 is CDRH (Complementarity determining regions Heavy chain) 1 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 1 to 3, the sequence A VH domain comprising a CDRH2 comprising any one selected from the group consisting of an amino acid sequence of Nos. 4 to 6, and a CDRH3 comprising any one selected from the group consisting of an amino acid sequence of SEQ ID Nos. have.
  • CDRH Complementarity determining regions Heavy chain
  • the AIMP2 specific antibody or fragment having immunological activity thereof is FR1 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 20 to 22, the amino acid sequence of SEQ ID NOs: 23 to 25 VH comprising FR2 comprising any one selected from the group consisting of, FR3 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 26 to 28, and FR4 comprising the amino acid sequence of SEQ ID NOs: 29 or 30 It can contain domains.
  • the AIMP2 specific antibody or fragment having immunological activity thereof is CDRL1 comprising any one selected from the group consisting of amino acid sequences of SEQ ID NOs: 10 to 13, amino acid sequences of SEQ ID NOs: 14 to 16 It may include a VL domain comprising CDRL2 comprising any one selected from the group consisting of, and CDRL3 comprising any one selected from the group consisting of amino acid sequences of SEQ ID NOs: 17 to 19.
  • the AIMP2 specific antibody or fragment having immunological activity thereof is FR1 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 31 to 33, and the amino acid sequence of SEQ ID NOs: 34 to 37 FR2 containing any one selected from the group consisting of, FR3 containing any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 38 to 42, and any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 43 to 45 a VL domain comprising FR4 comprising
  • the AIMP2 specific antibody or fragment having immunological activity thereof is a VH domain comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 46 to 49; And it may include a VL domain comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 50 to 54.
  • the AIMP2 specific antibody or fragment having immunological activity thereof includes a heavy chain comprising any one selected from the group consisting of amino acid sequences of SEQ ID NOs: 55 to 58; And it may include a light chain comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 59 to 63.
  • AIMP2 may be an AIMP2 monomer or an AIMP2 aggregate.
  • the antibody or fragment having immunological activity specific for the AIMP2 monomer comprises: a CDRH1 comprising the amino acid sequence of SEQ ID NO: 2, a CDRH2 comprising the amino acid sequence of SEQ ID NO: 5, and an amino acid sequence of SEQ ID NO: 8 a VH domain comprising a CDRH3 comprising; and a V domain comprising a VL domain comprising a CDRL1 comprising the amino acid sequence of SEQ ID NO: 11 or 12, a CDRL2 comprising the amino acid sequence of SEQ ID NO: 15, and a CDRL3 comprising the amino acid sequence of SEQ ID NO: 18 and a VH domain comprising the amino acid sequence of SEQ ID NO: 47 or 48; and a VL domain comprising the amino acid sequence of SEQ ID NO: 52 or 53, and a heavy chain comprising the amino acid sequence of SEQ ID NO: 56 or 57; and a light chain comprising the amino acid sequence of SEQ ID NO: 61 or 62.
  • the antibody or fragment having immunological activity specific for the AIMP2 monomer is an antibody produced from a 3C2 clone comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 56 and a light chain comprising the amino acid sequence of SEQ ID NO: 61 or a fragment having immunological activity thereof; Alternatively, it may be an antibody or fragment having immunological activity thereof produced from the 7H9 clone comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 57 and a light chain comprising the amino acid sequence of SEQ ID NO: 62.
  • the antibody or fragment having immunological activity specific for AIMP2 aggregate is: CDRH1 comprising the amino acid sequence of SEQ ID NO: 1, CDRH2 comprising the amino acid sequence of SEQ ID NO: 4, and the amino acid sequence of SEQ ID NO: 7 a VH domain comprising a CDRH3 comprising; and a V domain comprising a VL domain comprising a CDRL1 comprising the amino acid sequence of SEQ ID NO: 10, a CDRL2 comprising the amino acid sequence of SEQ ID NO: 14, and a CDRL3 comprising the amino acid sequence of SEQ ID NO: 17, a VH domain comprising the amino acid sequence of SEQ ID NO: 46; and a VL domain comprising the amino acid sequence of SEQ ID NO: 50 or 51, and a heavy chain comprising the amino acid sequence of SEQ ID NO: 55; and a light chain comprising the amino acid sequence of SEQ ID NO: 59 or 60.
  • the antibody or fragment having immunological activity specific for the AIMP2 monomer is an antibody produced in clone 5B2 comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 55 and a light chain comprising the amino acid sequence of SEQ ID NO: 59 or a fragment having immunological activity thereof; Alternatively, it may be an antibody or fragment having immunological activity thereof produced from a 6C7 clone comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 55 and a light chain comprising the amino acid sequence of SEQ ID NO: 60.
  • the antibody or fragment having immunological activity specific for AIMP2 monomer and AIMP2 aggregate specific antibody or fragment having immunological activity thereof is: CDRH1 comprising the amino acid sequence of SEQ ID NO:3, SEQ ID NO:6 a VH domain comprising a CDRH2 comprising the amino acid sequence of SEQ ID NO: 9 and a CDRH3 comprising the amino acid sequence of SEQ ID NO: 9; and a V domain comprising a VL domain comprising a CDRL1 comprising the amino acid sequence of SEQ ID NO: 13, a CDRL2 comprising the amino acid sequence of SEQ ID NO: 16, and a CDRL3 comprising the amino acid sequence of SEQ ID NO: 19, a VH domain comprising the amino acid sequence of SEQ ID NO: 49; and a VL domain comprising the amino acid sequence of SEQ ID NO: 54, and a heavy chain comprising the amino acid sequence of SEQ ID NO: 58; And it may be an antibody or a fragment having immunological activity thereof produced in the 13H9
  • the antibody or fragment having immunological activity thereof includes variants thereof, and includes an antibody or fragment thereof having “substantial similarity”.
  • Said "substantial similarity” is at least about 90% sequence identity, more preferably at least about 95%, 98% when the two peptide sequences are optimally aligned, such as by the program GAP or BESTFIT using default gap weights. or share 99% sequence identity.
  • residue positions that are not identical differ by conservative amino acid substitutions.
  • a “conservative amino acid substitution” is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (eg, charge or hydrophobicity). In general, conservative amino acid substitutions do not substantially change the functionality of the protein. Where two or more amino acid sequences differ from each other by conservative substitutions, the percent or degree of similarity may be up-regulated to correct for the conservative nature of the substitutions.
  • amino acid variations are made based on the relative similarity of amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, size, and the like.
  • amino acid side chain substituents such as hydrophobicity, hydrophilicity, charge, size, and the like.
  • arginine, lysine and histidine are all positively charged residues; alanine, glycine and serine have similar sizes; It can be seen that phenylalanine, tryptophan and tyrosine have similar shapes. Therefore, based on these considerations, arginine, lysine and histidine; alanine, glycine and serine; And phenylalanine, tryptophan and tyrosine can be said to be biologically functional equivalents.
  • the hydropathic idex of amino acids may be considered.
  • Each amino acid is assigned a hydrophobicity index according to its hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
  • the hydrophobic amino acid index is very important in conferring an interactive biological function of a protein. It is a known fact that amino acids having a similar hydrophobicity index must be substituted to retain similar biological activity. When introducing a mutation with reference to the hydrophobicity index, the substitution is made between amino acids that show a difference in the hydrophobicity index, preferably within ⁇ 2, more preferably within ⁇ 1, and even more preferably within ⁇ 0.5.
  • the substitution is made between amino acids exhibiting a difference in the hydrophilicity value within preferably ⁇ 2, more preferably within ⁇ 1, and even more preferably within ⁇ 0.5.
  • Amino acid exchanges in proteins that do not entirely alter the activity of the molecule are known in the art (H. Neurath, R.L. Hill, The Proteins, Academic Press, New York, 1979).
  • the most common exchanges are amino acid residues Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/ It is an exchange between Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly.
  • Antibodies or antigen-binding fragments thereof of the present invention include antibodies or antigen-binding fragments thereof containing small changes to the above-described amino acid sequence, ie, modifications that have little effect on the tertiary structure and function of the antibody. Therefore, in some embodiments, even if it does not match the above-mentioned sequence, it may have at least 100%, 93%, 95%, 96%, 97%, or 98% or more similarity.
  • the fragment having immunological activity of the antibody specific for AIMP2 is Fab, Fd, Fab', dAb, F(ab'), F(ab') 2 , scFv (single chain fragment variable), Fv , single-chain antibodies, Fv dimers, complementarity determining region fragments, humanized antibodies, chimeric antibodies, and diabodies may be any one selected from the group consisting of.
  • the antibody is not only in the form of a whole antibody, but also includes functional fragments of antibody molecules.
  • the whole antibody has a structure having two full-length light chains and two full-length heavy chains, and each light chain is connected to the heavy chain by a disulfide bond.
  • a functional fragment of an antibody molecule refers to a fragment having antigen-binding function
  • antibody fragments include (i) a light chain variable region (VL) and a heavy chain variable region (VH) and a light chain constant region (CL) and a Fab fragment consisting of the first constant region of the heavy chain (CH1); (ii) an Fd fragment consisting of the VH and CH1 domains; (iii) an Fv fragment consisting of the VL and VH domains of a single antibody; (iv) a dAb fragment consisting of a VH domain (Ward ES et al., Nature 341:544-546 (1989)); (v) an isolated CDR region; (vi) a bivalent fragment comprising two linked Fab fragments F(ab')2 fragments: (vii) single chain Fv molecules (scFv) joined by a peptide linker joining the VH and VL domains to form an antigen binding site (viii) bispecific single chain Fv dim
  • the antibody or fragment having immunological activity thereof of the present invention may be selected from the group consisting of an animal-derived antibody, a chimeric antibody, a humanized antibody, a human antibody, and a fragment having immunological activity thereof.
  • the antibody may be recombinantly or synthetically produced.
  • An animal-derived antibody produced by immunizing an animal to be immunized with a desired antigen may cause immune rejection when administered to humans for therapeutic purposes, and a chimeric antibody has been developed to suppress such immune rejection.
  • a chimeric antibody is one obtained by substituting a constant region of an animal-derived antibody that causes an anti-isotype reaction with that of a human antibody using a genetic engineering method. Chimeric antibodies have significantly improved anti-isotype response compared to animal-derived antibodies, but still have animal-derived amino acids in the variable region, potentially resulting in anti-idiotypic side effects. are doing A humanized antibody was developed to improve these side effects. This is produced by grafting complementarity determining regions (CDRs), which play an important role in antigen binding, into a human antibody framework among the variable regions of a chimeric antibody.
  • CDRs complementarity determining regions
  • the most important thing in the CDR grafting technology for producing a humanized antibody is to select an optimized human antibody that can best accept the CDR region of an animal-derived antibody. structure analysis, molecular modeling technology, etc. are used. However, even when the CDR regions of an animal-derived antibody are transplanted into the optimized human antibody framework, there are cases in which amino acids that affect antigen binding are present while being located in the framework of the animal-derived antibody, so that antigen-binding ability is not preserved in many cases. Therefore, it can be said that the application of additional antibody engineering technology to restore antigen binding force is essential.
  • the antibody or fragment having immunological activity thereof may be isolated from a living body (not present in the living body) or non-naturally occurring, for example, synthetically or recombinantly produced.
  • the term "antibody” refers to a substance produced by stimulation of an antigen in the immune system, the type is not particularly limited, and can be obtained naturally or non-naturally (eg, synthetically or recombinantly).
  • Antibodies are advantageous for mass expression and production because they are very stable and have a long half-life not only in vitro but also in vivo.
  • the adhesion is very high.
  • a complete antibody has a structure having two full-length light chains and two full-length heavy chains, and each light chain is linked to a heavy chain by a disulfide bond.
  • the constant region of an antibody is divided into a heavy chain constant region and a light chain constant region, and the heavy chain constant region has gamma ( ⁇ ), mu ( ⁇ ), alpha ( ⁇ ), delta ( ⁇ ) and epsilon ( ⁇ ) types, subclasses gamma 1 ( ⁇ 1), gamma 2 ( ⁇ 2), gamma 3 ( ⁇ 3), gamma 4 ( ⁇ 4), alpha 1 ( ⁇ 1) and alpha 2 ( ⁇ 2).
  • the constant region of the light chain has kappa ( ⁇ ) and lambda ( ⁇ ) types.
  • the term “heavy chain” refers to a variable region domain V H and three constant region domains C H1 , C H2 and C H3 comprising an amino acid sequence having a variable region sequence sufficient to confer specificity to an antigen. and a full-length heavy chain including a hinge and a fragment thereof.
  • the term “light chain” refers to both full-length light chains and fragments thereof comprising a variable region domain VL and a constant region domain CL comprising an amino acid sequence having sufficient variable region sequence to confer specificity to an antigen. interpreted as including
  • variable region or variable domain refers to a portion of an antibody molecule that exhibits many variations in sequence while performing a function of specifically binding to an antigen, and complementarity in the variable region There are determining regions CDR1, CDR2 and CDR3. Between the CDRs, a framework region (FR) portion exists to support the CDR ring.
  • FR framework region
  • the "complementarity determining region” is a ring-shaped region involved in antigen recognition, and the specificity of the antibody for the antigen is determined as the sequence of this region changes.
  • FR refers to variable domain residues other than hypervariable region (HVR) residues.
  • the FRs of a variable domain generally consist of the four FR domains FR1, FR2, FR3 and FR4.
  • HVR and FR sequences generally appear in the following order in VH and VL/Vk:
  • FRL1 Framework region 1 of Light chain
  • CDRL1 complementarity determining region 1 of Light chain
  • the antibody or antigen-binding fragment may be presented in the following order:
  • scFv single chain fragment variable
  • scFv single chain fragment variable
  • CDR complementarity determining region
  • the terms “specifically binding” or “specifically recognized” have the same meaning as commonly known to those skilled in the art, and mean that an antigen and an antibody specifically interact to conduct an immunological reaction. .
  • Specific binding is at least about 1 x 10 -6 M or less (eg, 9 x 10 -7 M, 8 x 10 -7 M, 7 x 10 -7 M, 6 x 10 -7 M, 5 x 10 -7 M , 4 x 10 -7 M, 3 x 10 -7 M, 2 x 10 -7 M, or 1 x 10 -7 M), preferably 1 x 10 -7 M or less (eg, 9 x 10 -8 M , 8 x 10 -8 M, 7 x 10 -8 M, 6 x 10 -8 M, 5 x 10 -8 M, 4 x 10 -8 M, 3 x 10 -8 M, 2 x 10 -8 M, or 1 x 10 -8 M), more preferably 1 x 10 -8 M or less (eg, 9 x 10 -9 M, 8 x 10 -9 M, 7 x 10 -9 M, 6 x 10 -9 M , 5 x 10 -9 M, 4 x 10 -9 M, 3 x 10 -9 M
  • affinity refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (eg, an antibody) and its binding partner (eg, an antigen).
  • binding affinity refers to an intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (eg, antibody and antigen).
  • Kd dissociation constant
  • the term “antigen-binding fragment” refers to a fragment of the entire immunoglobulin structure, and refers to a portion of a polypeptide including an antigen-binding portion. For example, it may be scFv, (scFv) 2, scFv-Fc, Fab, Fab' or F(ab')2, but is not limited thereto.
  • Fab has a structure having a light chain and heavy chain variable regions, a light chain constant region and a heavy chain first constant region (C H1 ), and has one antigen-binding site.
  • Fab' differs from Fab in that it has a hinge region comprising one or more cysteine residues at the C-terminus of the heavy chain C H1 domain.
  • the F(ab')2 antibody is produced by forming a disulfide bond with a cysteine residue in the hinge region of Fab'.
  • Fv is a minimal antibody fragment having only a heavy chain variable region and a light chain variable region, and a recombinant technique for generating an Fv fragment is well known in the art.
  • the heavy chain variable region and the light chain variable region are linked by a non-covalent bond
  • single-chain Fv single-chain Fv
  • the linker may be a peptide linker consisting of any amino acids from 1 to 100 or 2 to 50 amino acids, and an appropriate sequence is known in the art.
  • the antigen-binding fragment can be obtained using a proteolytic enzyme (for example, Fab can be obtained by restriction digestion of the entire antibody with papain, and F(ab') 2 fragment can be obtained by digestion with pepsin), It can be produced through genetic recombination technology.
  • a proteolytic enzyme for example, Fab can be obtained by restriction digestion of the entire antibody with papain, and F(ab') 2 fragment can be obtained by digestion with pepsin
  • the term "hinge region” is a region included in the heavy chain of an antibody, which exists between the C H1 and C H2 regions, and functions to provide flexibility of the antigen-binding site in the antibody. means area.
  • the hinge may be derived from a human antibody, and specifically, may be derived from IgA, IgE, or IgG, such as IgG1, IgG2, IgG3 or IgG4.
  • the present invention relates to an isolated nucleic acid molecule encoding an antibody or immunologically active fragment thereof of the present invention, a vector comprising the same, and a host cell transformed therewith.
  • nucleic acid molecule has a meaning comprehensively including DNA (gDNA and cDNA) and RNA molecules. Also included are site-modified analogues (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90:543-584 (1990)).
  • the nucleic acid molecules of the present invention may be isolated or recombinant, and include single-stranded and double-stranded forms of DNA and RNA as well as corresponding complementary sequences.
  • An isolated nucleic acid is a nucleic acid that has been separated from surrounding genetic sequences present in the genome of the individual from which the nucleic acid was isolated, in the case of a nucleic acid isolated from a naturally occurring source.
  • a nucleic acid synthesized enzymatically or chemically from a template such as a PCR product, a cDNA molecule, or an oligonucleotide
  • a nucleic acid resulting from such a procedure can be understood as an isolated nucleic acid molecule.
  • nucleic acid molecule refers to a nucleic acid molecule in the form of separate fragments or as a component of a larger nucleic acid construct.
  • Nucleic acids are operably linked when placed into a functional relationship with another nucleic acid sequence.
  • the DNA of the presequence or secretion leader is operably linked to the DNA of the polypeptide when expressed as a preprotein in the form before the polypeptide is secreted
  • the promoter or enhancer is the polypeptide sequence is operably linked to a coding sequence when it affects the transcription of, or a ribosome binding site is operably linked to a coding sequence when positioned to facilitate translation.
  • operably linked means that the DNA sequences to be linked are located contiguously, and in the case of a secretory leader, they are contiguous and in the same reading frame. However, enhancers need not be located adjacent to each other. Linkage is achieved by ligation at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers are used according to conventional methods.
  • An isolated nucleic acid molecule encoding an antibody or immunologically active fragment of the present invention is expressed from a coding region due to codon degeneracy or in consideration of codons preferred in the organism in which the antibody is to be expressed.
  • Various modifications can be made to the coding region within the range that does not change the amino acid sequence of the antibody, and various modifications or modifications can be made within the range that does not affect the expression of the gene in parts other than the coding region. It will be well understood by those skilled in the art that genes are also included within the scope of the present invention.
  • nucleic acid molecule of the present invention encodes a protein having an equivalent activity
  • one or more nucleic acid bases may be mutated by substitution, deletion, insertion, or a combination thereof, and these are also included in the scope of the present invention.
  • the sequence of such a nucleic acid molecule may be single-stranded or double-stranded, and may be a DNA molecule or an RNA (mRNA) molecule.
  • the isolated nucleic acid molecule encoding the antibody or immunologically active fragment thereof of the present invention comprises the nucleotide sequence of SEQ ID NO: 64 encoding CDRH1, the nucleotide sequence of SEQ ID NO: 65 encoding CDRH2 and the nucleotide sequence of SEQ ID NO: 66 encoding CDRH3.
  • the isolated nucleic acid molecule encoding the antibody or immunologically active fragment thereof of the present invention is the nucleotide sequence of SEQ ID NO: 70 encoding FR1, the nucleotide sequence of SEQ ID NO: 71 encoding FR2 sequence, the nucleotide sequence of SEQ ID NO: 72 encoding FR3 and the nucleotide sequence of SEQ ID NO: 73 encoding FR4.
  • the isolated nucleic acid molecule encoding the antibody of the present invention or an immunologically active fragment thereof is a nucleotide sequence of SEQ ID NO: 67 encoding CDRL1, a nucleotide sequence of SEQ ID NO: 68 encoding CDRL2 and the nucleotide sequence of SEQ ID NO: 69 encoding CDRL3.
  • the isolated nucleic acid molecule encoding the antibody or immunologically active fragment thereof of the present invention is the nucleotide sequence of SEQ ID NO: 74 encoding FR1, the nucleotide sequence of SEQ ID NO: 75 encoding FR2 sequence, the nucleotide sequence of SEQ ID NO: 76 encoding FR3 and the nucleotide sequence of SEQ ID NO: 77 encoding FR4.
  • the isolated nucleic acid molecule encoding the antibody or immunologically active fragment thereof of the present invention comprises the nucleotide sequence of SEQ ID NO: 78 encoding VH and the nucleotide sequence of SEQ ID NO: 79 encoding VL sequence may be included.
  • the isolated nucleic acid molecule encoding the antibody or immunologically active fragment thereof of the present invention comprises a nucleotide sequence of SEQ ID NO: 80 encoding a heavy chain and a nucleotide sequence of SEQ ID NO: 81 encoding a light chain sequence may be included.
  • the nucleic acid molecule of the present invention encoding the antibody or fragment having immunological activity thereof also includes a sequence exhibiting substantial identity. The substantial identity is at least when the sequence of the present invention and any other sequences are aligned to correspond to the maximum, and the aligned sequence is analyzed using an algorithm commonly used in the art.
  • At least 60% homology such as 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, or 69%), more specifically at least 70% homology (such as 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%), even more specifically at least 80% homology (such as 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%), even more specifically at least 90% homology (such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%), most specifically 95% or greater homology (eg, 95%, 96%, 97%, 98%, or 99%). All integers greater than or equal to 60% and less than or equal to 100% and prime numbers therebetween are included within the scope of the present invention with respect to % homology.
  • NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10(1990)) is accessible from the National Center for Biological Information (NBCI), etc. It can be used in conjunction with sequencing programs such as blastx, tblastn and tblastx. BLAST can be accessed through the BLAST page of the ncbi website. A method for comparing sequence homology using this program can be found on the BLAST help page of the ncbi website.
  • BLAST Basic Local Alignment Search Tool
  • An isolated nucleic acid molecule encoding an antibody of the present invention or an immunologically active fragment thereof according to the present invention can be inserted into an expression vector for protein expression.
  • Expression vectors usually contain a protein that is operatively linked, ie, placed in a functional relationship, with regulatory or regulatory sequences, selectable markers, optional fusion partners, and/or additional elements.
  • operably linked refers to a functional linkage between a nucleic acid expression control sequence (eg, a promoter, signal sequence, or array of transcriptional regulator binding sites) and another nucleic acid sequence, whereby the control sequence to regulate the transcription and/or translation of said other nucleic acid sequences.
  • the present invention by a method for inducing protein expression by culturing a host cell transformed with a nucleic acid, preferably an expression vector containing an isolated nucleic acid molecule encoding an antibody of the present invention or an immunologically active fragment thereof Antibodies of the invention or fragments having immunological activity thereof can be produced.
  • a nucleic acid preferably an expression vector containing an isolated nucleic acid molecule encoding an antibody of the present invention or an immunologically active fragment thereof
  • Antibodies of the invention or fragments having immunological activity thereof can be produced.
  • a variety of suitable host cells can be used, including, but not limited to, mammalian cells, bacteria, insect cells, and yeast. Methods for introducing an exogenous nucleic acid into a host cell are known in the art and will vary depending on the host cell used.
  • E. coli which has a high industrial use value due to low production cost, can be produced as a host cell.
  • the vector of the present invention includes, but is not limited to, a plasmid vector, a cosmid vector, a bacteriophage vector, and a viral vector.
  • Suitable vectors include a signal sequence or leader sequence for membrane targeting or secretion in addition to expression control elements such as promoter, operator, start codon, stop codon, polyadenylation signal and enhancer, and may be prepared in various ways depending on the purpose.
  • the promoter of the vector may be constitutive or inducible.
  • the signal sequence includes a PhoA signal sequence and an OmpA signal sequence when the host is Escherichia sp., and an ⁇ -amylase signal sequence and a subtilisin signal when the host is a Bacillus sp.
  • the vector may also contain a selection marker for selecting a host cell containing the vector, and in the case of a replicable expression vector, an origin of replication.
  • vector refers to a carrier capable of inserting a nucleic acid sequence for introduction into a cell capable of replicating the nucleic acid sequence.
  • Nucleic acid sequences may be exogenous or heterologous.
  • Vectors include, but are not limited to, plasmids, cosmids, and viruses (eg, bacteriophages).
  • viruses eg, bacteriophages.
  • One skilled in the art can construct vectors by standard recombinant techniques (Maniatis, et al., Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1988; and Ausubel et al., In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, NY, 1994 et al.).
  • expression control sequences such as promoter, terminator, enhancer, etc., membrane targeting or secretion according to the type of host cell in which the antibody is to be produced. Sequences and the like can be appropriately selected and combined in various ways depending on the purpose.
  • vector includes transfer vectors and expression vectors.
  • the term "delivery vector” refers to a composition of a material that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid into a cell.
  • the transfer vector comprises a self-replicating plasmid or virus. It should be construed that the term may additionally include non-plasmid and non-viral compounds that promote transfer of nucleic acids into cells, such as polylysine compounds, liposomes, and the like.
  • Viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, and lentiviral vectors.
  • expression vector refers to a vector comprising a nucleic acid sequence encoding at least a portion of a transcribed gene product. In some cases, the RNA molecule is then translated into a protein, polypeptide, or peptide.
  • the expression vector may include various regulatory sequences. In addition to regulatory sequences that control transcription and translation, vectors and expression vectors may contain nucleic acid sequences that also serve other functions.
  • the recombinant vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are disclosed in Sambrook et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001). , this document is incorporated herein by reference.
  • the vector of the present invention may be constructed as a vector for gene cloning, a vector for protein expression, or a vector for gene delivery.
  • the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host.
  • a promoter derived from the genome of a mammalian cell eg, metallotionine promoter, beta-actin promoter, human hegglobin promoter and human muscle creatine promoter
  • promoters derived from mammalian viruses eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk promoter of HSV, mouse mammary tumor virus (MMTV) promoter
  • the LTR promoter of HIV, the promoter of Moloney virus, the promoter of Epstein Barr virus (EBV), and the promoter of Loose sarcoma virus (RSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.
  • the vector of the present invention may be fused with other sequences to facilitate purification of the antibody expressed therefrom.
  • the sequence to be fused includes, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA).
  • the protein expressed by the vector of the present invention is an antibody
  • the expressed antibody can be easily purified through a protein A column or the like without an additional sequence for purification.
  • the expression vector of the present invention may include a selectable marker gene and/or a reporter gene as a selection marker for evaluating the expression of the antibody or antigen-binding fragment thereof of the present invention, and a CAR polypeptide comprising the same.
  • Selectable marker genes include antibiotic resistance genes commonly used in the art, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and tetracycline. There is a resistance gene. Reporter genes include, but are not limited to, genes such as luciferase, beta-galactosidase, chloramphenicol acetyl transferase, or green fluorescent protein.
  • Vectors can be readily introduced into host cells, eg, mammalian, bacterial, yeast, or insect cells by methods known in the art.
  • a vector may be delivered into a host cell by physical, chemical, or biological means.
  • the physical means include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like.
  • Such chemical means include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • the biological means includes, but is not limited to, the use of DNA or RNA vectors, such as the above-described lentiviruses and retroviruses.
  • the term "host cell” includes eukaryotes and prokaryotes, and refers to any transformable organism capable of replicating the vector or expressing a gene encoded by the vector.
  • a host cell may be transfected or transformed by the vector, which refers to a process in which an exogenous nucleic acid molecule is delivered or introduced into a host cell.
  • a host cell capable of stably and continuously cloning and expressing the vector of the present invention is known in the art and any host cell may be used.
  • suitable eukaryotic host cells of the vector include yeast (Saccharomyce cerevisiae), insect cells. , monkey kidney cells (COS7), NSO cells, SP2/0, Chinese hamster ovary (CHO) cells, W138, baby hamster kidney (BHK) cells, MDCK, myeloma cell line , HuT 78 cells and HEK-293 cells.
  • transformed As used herein, the terms “transformed”, “transduced” or “transfected” refer to the process by which an exogenous nucleic acid is transferred or introduced into a host cell. "Transformed”, “transduced” or “transformed” An “infected” cell is a cell that has been transformed, transduced, or transfected with an exogenous nucleic acid, including the cell and progeny cells resulting from subculture thereof.
  • Methods for delivering the vector of the present invention into host cells include microinjection (Capecchi, M.R., Cell, 22:479 (1980)), calcium phosphate precipitation (Graham, F.L. et al. , Virology, 52:456 (1973)), electroporation (Neumann, E. et al., EMBO J., 1:841 (1982)), liposome-mediated transfection (Wong, T.K. et al., Gene) , 10:87 (1980)), DEAE-dextran treatment (Gopal, Mol. Cell Biol., 5:1188-1190 (1985)), and gene bambadment (Yang et al., Proc. Natl. Acad. Sci., 87:9568-9572 (1990)) can inject vectors into host cells.
  • the recombinant vector contained in the host cell may express the above-mentioned antibody or antigen-binding fragment, or a fusion protein comprising the same, recombined in the host cell.
  • a large amount of the antibody or antigen-binding fragment, or fusion get protein.
  • the expression vector includes the lac promoter
  • the host cell may be treated with IPTG to induce gene expression.
  • the culture is usually carried out under aerobic conditions such as shaking culture or rotation on a rotary machine.
  • the culture temperature is preferably in the range of 10 to 40° C., and the culture time is generally 5 hours to 7 days.
  • the pH of the medium is preferably maintained in the range of 3.0 to 9.0 during culture.
  • the pH of the medium can be adjusted with inorganic or organic acids, alkaline solutions, urea, calcium carbonate, ammonia, and the like.
  • antibiotics such as ampicillin, streptomycin, chloramphenicol, kanamycin and tetracycline may be added for maintenance and expression of the recombinant vector.
  • a suitable inducer may be added to the medium.
  • a suitable inducer may be added to the medium.
  • IPTG isopropyl-beta-D-thiogalactopyranoside
  • indoleacrylic acid may be added to the medium.
  • the host cell may be a bacterium or an animal cell
  • the animal cell line may be a CHO cell, a HEK cell or an NSO cell
  • the bacterium may be E. coli.
  • the present invention relates to a pharmaceutical composition for preventing or treating neurodegenerative diseases comprising the antibody or immunologically active fragment thereof of the present invention as an active ingredient.
  • the neurodegenerative disease is Parkinson's disease, Huntington's disease, multiple system neuronal atrophy, amyotrophic lateral sclerosis, Lou Gehrig's disease, polyglutamine ectasia, spinocerebellar ataxia, spinal and soft muscle atrophy, tauosis, dystonia , serpin deficiency, cirrhosis, type II diabetes mellitus, primary systemic amyloidosis, secondary systemic amyloidosis, pronto-transient dementia, geriatric systemic amyloidosis, familial amyloid polyneuropathy, hereditary cerebral amyloid vasculopathy, hemodialysis-associated amyloidosis, macular degeneration, dementia , Alzheimer's disease, familial AD, Lewy body dementia, radiation therapy-induced dementia, boxer's dementia, Down syndrome, Gerstmann-Straussler-Scheinker disease, inclusion body myositis, prion protein brain amyloid angiopathy,
  • the pharmaceutical composition of the present invention may further include an adjuvant.
  • the adjuvant may be used without limitation as long as it is known in the art, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase the immunity thereof.
  • treatment means, unless otherwise stated, the disease or condition to which the term applies, or one or more symptoms of the disease or condition, which reverses, ameliorates, inhibits the progression, or It means to prevent, and the term treatment as used herein refers to the act of treating.
  • a composition is indicated to be "pharmaceutically or physiologically acceptable” if the recipient animal can tolerate administration of the composition, or if administration of the composition to that animal is suitable.
  • the agent can be said to have been administered in a "therapeutically effective amount”.
  • An agent is physiologically meaningful if the presence of the agent results in a physiologically detectable change in the recipient patient.
  • the therapeutically effective amount of the composition of the present invention may vary depending on several factors, for example, the administration method, the target site, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined as an appropriate amount in consideration of both safety and efficiency. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These considerations in determining effective amounts are found, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.
  • the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount refers to an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not to cause side effects, and the effective dose level is determined by the patient's Health status, disease type, severity, drug activity, sensitivity to drug, administration method, administration time, administration route and excretion rate, treatment period, factors including drugs used in combination or concurrently, and other factors well known in the medical field can be determined according to
  • the composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.
  • compositions of the present invention may also include carriers, diluents, excipients or combinations of two or more commonly used in biological agents.
  • a pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc.
  • Compounds described in , saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components can be mixed and used, and if necessary, other antioxidants, buffers, bacteriostats, etc. Conventional additives may be added.
  • diluents, dispersants, surfactants, binders and lubricants may be additionally added to form an injectable dosage form such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets.
  • injectable dosage form such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets.
  • it can be preferably formulated according to each disease or component using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).
  • the pharmaceutical composition of the present invention can be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions according to conventional methods, respectively. have.
  • the term “pharmaceutically acceptable” refers to exhibiting properties that are not toxic to cells or humans exposed to the composition.
  • the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additive includes starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate. , lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, Calcium stearate, sucrose, dextrose, sorbitol and talc and the like may be used.
  • the pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.
  • administration means providing a predetermined substance to a patient by any suitable method, and parenteral administration (eg, intravenous, subcutaneous, intramuscular, intrathecal) according to a desired method. , intracerebral, intrasternal, intranasal, intrapulmonary, rectal, intraperitoneal or topical injection) or oral administration, but is not limited thereto.
  • the dosage of the pharmaceutical composition of the present invention depends on factors such as formulation method, administration method, patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, reaction sensitivity, and severity of disease. These vary, and an ordinarily skilled practitioner can readily determine and prescribe a dosage effective for the desired treatment or prophylaxis.
  • the daily dose of the pharmaceutical composition of the present invention is 0.0001-100 mg/kg.
  • composition of the present invention may be administered parenterally (eg, intravenously, subcutaneously, intraperitoneally or topically) or orally according to a desired method, and the dosage may vary depending on the subject's age, weight, sex, physical condition, etc. is selected taking into account.
  • concentration of the active ingredient included in the pharmaceutical composition can be variously selected depending on the subject, and is preferably included in the pharmaceutical composition at a concentration of 0.01 to 5,000 ⁇ g/ml. If the concentration is less than 0.01 ⁇ g/ml, pharmaceutical activity may not appear, and if it exceeds 5,000 ⁇ g/ml, it may be toxic to the human body.
  • compositions of the present invention may be formulated in various oral or parenteral dosage forms.
  • Formulations for oral administration include, for example, tablets, pills, hard, soft capsules, solutions, suspensions, emulsifiers, syrups, granules, and the like.
  • the tablet may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and optionally starch, agar, alginic acid or disintegrants such as sodium salts thereof or effervescent mixtures and/or absorbents, coloring, flavoring and sweetening agents.
  • the formulation may be prepared by conventional mixing, granulating or coating methods.
  • representative formulations for parenteral administration are injection formulations, and water, Ringer's solution, isotonic saline, or suspension can be exemplified as a solvent for the injection formulation.
  • the sterile, fixed oil of the injectable preparation can be used as a solvent or suspending medium, and any non-irritating fixed oil including mono- and di-glycerides can be used for this purpose.
  • the injection preparation may use a fatty acid such as oleic acid.
  • prevention refers to any action that inhibits or delays the occurrence, spread, and recurrence of the disease or disorder by administration of the pharmaceutical composition according to the present invention.
  • the present invention relates to a composition for diagnosing a neurodegenerative disease comprising the antibody or immunologically active fragment thereof of the present invention.
  • the presence or amount (level) of an AIMP2 monomer or AIMP2 aggregate is detected in a biological sample isolated from a subject using a composition for diagnosing a neurodegenerative disease comprising an antibody or immunologically active fragment thereof of the present invention can be measured.
  • the term “detection” or “measurement” refers to quantifying the concentration of a detected or measured target.
  • the kit may further include tools and/or reagents for collecting a biological sample from a subject or patient, as well as tools and/or reagents for preparing an AIMP2 protein or an aggregate thereof from the sample.
  • the present invention relates to a kit for diagnosing a neurodegenerative disease comprising the composition.
  • the term “neurodegenerative disease diagnosis kit” refers to a kit containing the composition for diagnosing neurodegenerative disease of the present invention. Therefore, the expression “neurodegenerative disease diagnosis kit” can be used interchangeably or mixed with the “neurodegenerative disease diagnosis composition”.
  • diagnosis refers to determining a subject's susceptibility to a specific disease or disorder, determining whether an object currently has a specific disease or disorder, or having a specific disease or disorder.
  • Determining a subject's prognosis e.g., identifying a neurodegenerative disease state, determining the stage or subtype of a neurodegenerative disease, or determining the responsiveness of a neurodegenerative disease to treatment), or therametrics ( monitoring the condition of the subject to provide information on treatment efficacy).
  • composition or kit for diagnosing neurodegenerative diseases includes an antibody specific for AIMP2 or a fragment having immunological activity thereof of the present invention, basically it is suitable for various immunoassays or immunostaining.
  • the immunoassay or immunostaining may include radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or competition assay, sandwich assay, flow cytometry, immunofluorescence staining and immunoaffinity tablets, but are not limited thereto.
  • the immunoassay or immunostaining method is described in Enzyme Immunoassay, E. T.
  • an antibody labeled with a radioisotope eg, C14, I125, P32 and S35
  • a radioisotope eg, C14, I125, P32 and S35
  • a specific embodiment of the present invention comprises the steps of (i) coating a sample to be analyzed on the surface of a solid substrate; (ii) reacting the sample with an antibody that specifically binds to AIMP2 of the present invention as a primary antibody; (iii) reacting the product of step (ii) with an enzyme-conjugated secondary antibody; and (iv) measuring the activity of the enzyme.
  • Suitable as the solid substrate are hydrocarbon polymers (eg, polystyrene and polypropylene), glass, metal or gel, most specifically microtiter plates.
  • the enzyme bound to the secondary antibody includes, but is not limited to, an enzyme catalyzing a color reaction, a fluorescence reaction, a luminescence reaction, or an infrared reaction, for example, alkaline phosphatase, beta-galactosidase, hose Radish peroxidase, luciferase and cytochrome P450.
  • alkaline phosphatase When alkaline phosphatase is used as the enzyme binding to the secondary antibody, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate (naphthol-AS) as substrates -B1-phosphate) and ECF (enhanced chemifluorescence) are used, and when horse radish peroxidase is used, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis -N-methylacridinium nitrate), resorufin benzyl ether, luminol, Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2
  • a specific embodiment of the present invention comprises the steps of: (i) coating an antibody that specifically binds AIMP2 as a capturing antibody to the surface of a solid substrate; (ii) reacting the capture antibody with the sample; (iii) reacting the result of step (ii) with a detecting antibody to which a label generating signal is bound; and (iv) measuring a signal generated from the label.
  • the detection antibody of the present invention has a label that generates a detectable signal.
  • the label may include chemicals (eg biotin), enzymes (alkaline phosphatase, beta-galactosidase, horse radish peroxidase and cytochrome P450), radioactive materials (eg C14, I125, P32 and S35). , a fluorescent material (eg, fluorescein), a luminescent material, a chemiluminescent material, and fluorescence resonance energy transfer (FRET).
  • chemicals eg biotin
  • enzymes alkaline phosphatase, beta-galactosidase, horse radish peroxidase and cytochrome P450
  • radioactive materials eg C14, I125, P32 and S35
  • a fluorescent material eg, fluorescein
  • a luminescent material e.g, chemiluminescent material
  • FRET fluorescence resonance energy transfer
  • the final enzyme activity measurement or signal measurement may be performed according to various methods known in the art. If biotin is used as a label, the signal can be easily detected with streptavidin and with luciferin when luciferase is used.
  • the capture antibody and the detection antibody two types of antibodies or fragments having immunological activity thereof that bind to different epitopes among clones of the AIMP2 specific antibody or fragment having immunological activity of the present invention may be used. .
  • Samples that can be applied to the kit of the present invention include, but are not limited to, cell, tissue or tissue-derived extract, lysate or purified product, blood, plasma, serum, lymph or ascites.
  • the present invention relates to an information providing method for diagnosing a neurodegenerative disease comprising detecting AIMP2 monomer or AIMP2 aggregate in a biological sample isolated from a subject using the antibody or immunologically active fragment thereof of the present invention. it's about
  • sample refers to a biological sample obtained from a subject or patient.
  • Sources of biological samples may include fresh, frozen and/or preserved organ or tissue samples or solid tissue from biopsies or aspirates; blood or any blood component; The cells may be at any point in the pregnancy or development of the subject.
  • the present invention comprises the steps of reacting a candidate compound with an AIMP2 aggregate; quantifying the AIMP2 aggregate using the antibody of the present invention or a fragment having immunological activity specific for the AIMP2 aggregate; And it relates to a method for screening a substance that inhibits or inhibits the formation of AIMP2 aggregates, comprising the step of selecting a compound having a reduced amount of AIMP2 aggregates compared to a control group not treated with the candidate compound.
  • the present invention comprises the steps of reacting a candidate compound with an AIMP2 expressing cell or AIMP2 aggregate; quantifying the expression level of AIMP2 or the amount of AIMP2 aggregates using the antibody or fragment having immunological activity of the present invention; And it relates to a screening method for a therapeutic agent for a neurodegenerative disease, comprising the step of selecting a compound having a reduced amount of AIMP2 expression or AIMP2 aggregate compared to a control group not treated with the candidate compound.
  • Example 1 AIMP2 aggregate production and verification
  • a recombinant AIMP2 aggregate was prepared as an antigen. After transforming the vector encoding the GST-AIMP2 recombinant protein into BL21, it was cultured, eluted using GST beads, and purified to obtain the GST-AIMP2 recombinant protein. The purified GST-AIMP2 recombinant protein (GST-AIMP2 monomer) was incubated in a test tube at 37° C. at 250 rpm for 7 days to form a high molecular weight aggregate (GST-AIMP2 fibril).
  • GST-truncated AIMP2 (monomer) and AIMP2 aggregates were dialyzed against the GST-AIMP2 and GST-AIMP2 aggregates, and 100ul of Glutathione Sepharose 4B (GE Heathcare #17-0756-01) and Prescission protease (GE Heathcare) #27-0843-01) was treated with 10ul and incubated overnight.
  • the prepared GST-AIMP2 and GST-AIMP2 aggregates were analyzed by western blot using an AIMP2-specific antibody (Proteintech Group rabbit antibody), and the GST-AIMP2 aggregates were placed on an SDS-PAGE gel, followed by Coomassie blue staining.
  • Example 1 ELISA analysis was performed using GST-AIMP2 of FIG. 1c , which formed an aggregate in an amyloid structure, as an antigen, and did not react to GST, and either a GST-AIMP2 normal structure (monomer) or a GST-AIMP2 aggregate Eight hybridoma clones 3C2, 5B2, 6C7, 7G2, 10F3, 12D12 and 13H9 producing an antibody binding to (fibril) were selected (Table 1).
  • AIMP2 fibril AIMP2 mono GST 3C2 1.983 1.361 0.059 5B2 1.081 0.500 0.068 6C7 1.151 0.467 0.061 7G2 1.740 1.192 0.050 7H9 1.676 1.115 0.059 10F3 0.922 0.473 0.105 12D12 0.749 0.257 0.066 13H9 1.656 1.371 0.057
  • the antibody clones of 5B2 and 6C7 bound relatively well to AIMP2 aggregates, and the antibody clones of 3C2, 7H9 and 13H9 showed the same level of binding signal for both the normal structure and the aggregate structure of AIMP2 (Fig. 2a).
  • GST, GST-AIMP2 (Monomer) and GST-AIMP2 aggregates were separated according to size on SDS-PAGE through Western blot analysis and purified from each antibody clone. Selective reactivity was analyzed using one antibody.
  • the conventional Proteintech Group antibody not only labels the GST-AIMP2 normal structure (monomer) of about 60 kDa, but also shows the high molecular weight GST-AIMP2 aggregate structure.
  • the sequence of the antibody variable region (variable region) was secured. Specifically, for cDNA extracted from each hybridoma cell, the light and heavy chain variable regions were amplified by PCR using the primers in Table 4 below, cloned into a T vector, and the light chain variable region and heavy chain variable region were included. The cDNA sequence was obtained by sequencing the T vector, and the variable region sequence was analyzed using IgBlast (refer to the Igblast webpage of NCBI), and the sequence of complementarity determining region (CDR) amino acids was also analyzed.
  • IgBlast refer to the Igblast webpage of NCBI
  • Primer Name Forward or reverse Primer Sequence ISPCR Universal F primer 5' aagcagtggtatcaacgcagag 3' mIGK PCR R primer for kappa chain 5' acattgatgtctttggggtagaag 3' mIGL PCR R primer for lambda chain 5' atcgtacacaccagtgtggc 3' mIGHG PCR R primer for heavy chain 5' gggatccagagttccaggtc 3'
  • VH heavy chain variable region
  • VL light chain variable region
  • 13H9 an antibody clone that detects both AIMP2 and aggregates in the normal structure, showed an antibody amino acid sequence distinct from the other four clones (Table 9).
  • Table 9 also shows the amino acid sequence of the variable region and the CDR amino acid sequence.
  • VH heavy chain variable region
  • VL light chain variable region
  • Brain tissue samples were transferred to 12-wells containing 1X PBS, and washed with 1X PBS. Transfer to 0.1% TritonX-100 buffer (100 ul of 10% TritonX-100, 1 ml of 10X PBS, 8.9 ml of distilled water), store at room temperature for 10 minutes, and 5% blocking solution (4.75 ml of 0.1% TritonX-100 buffer and 100% goat) 250ul of serum) for 1 hour. The primary antibody was placed in a blocking solution at a ratio of 1:500 to 1:1000 and incubated at 4 °C overnight. Washed 3 times with 1X PBS, treated with secondary antibody (1:500 in 1X PBS), and reacted at room temperature for 1 hour. After washing 3 times with 1X PBS, DAPI staining was performed for 20 seconds. It was transferred to a slide, dried for one day, mounted, and the stained tissue was observed.
  • TritonX-100 buffer 100 ul of 10% TritonX-100, 1 ml of 10X PBS, 8.
  • FIG. 3D The results of confocal immunofluorescence imaging using the pS129- ⁇ -synuclein antibody and the 5B2 antibody on the autopsied temporal lobe brain tissue of a Parkinson's disease patient are shown in FIG. 3D .
  • DAB staining was performed on autopsied temporal lobe brain tissues of Parkinson's disease patients and age-matched normal controls using the 5B2 antibody.
  • the primary antibody (1:1000 in the blocking solution) was treated and incubated at 4° C., 15 rpm in a rocker overnight.
  • Blocking solution Final 2ml 4ml 8ml 10ml 1X PBS 1X 1.8ml 3.6ml 7.2ml 8.8ml 10% tritonX-100 0.2% 40ul 80ul 160ul 200ul 10% sodium azide 0.02% 4ul 8ul 16ul 20ull 100% goat serum 10% 200ul 400ul 800ul 1ml
  • PBS with TritonX-100 (1 ml 1X PBS and 10 ul TritonX-100 per well) was put in a 12-well plate and prepared. The brain tissue samples incubated overnight were washed twice with PBS with TritonX-100 for 10 minutes each. The secondary antibody of Table 11 was added and placed on a rocker at room temperature for 1 hour.
  • the brain tissue sample slides in a cage dedicated to staining, 100% ethanol for 5 minutes, 95% ethanol for 2 minutes, distilled water for 2 minutes, staining solution for 1 minute, distilled water 3 times for 2 minutes each Treatment, treatment with destaining solution twice for 5 minutes each, treatment with distilled water three times for 2 minutes each, treatment with 100% ethanol twice for 5 minutes each, and treatment with xylene for 10 minutes.
  • the bottom part of the slide was wiped, DPX was put in, and then dried in a hood.
  • the amount of AIMP2 aggregates in plasma of normal controls and patients with Parkinson's disease was analyzed by dot blot analysis (FIG. 3f). As shown in FIG. 3f , it was confirmed that AIMP2 aggregates appearing in Parkinson's disease patients could be detected by the 5B2 antibody.
  • a humanized chimeric antibody was prepared by recombination of the light chain variable region and heavy chain variable region sequences of the 5B2 antibody obtained in Example 4 and the light chain constant region and heavy chain constant region of a human IgG antibody through cloning.
  • the light chain variable region and heavy chain variable region sequences of mouse IgG of the 5B2 antibody are amplified through PCR.
  • the amplified mouse IgG light chain variable region and heavy chain variable region sequences were cloned into VRC01 mAb Heavy and Light Chain Expression Vector, which is a plasmid encoding a human IgG framework, respectively, using quick ligation or T4 ligation, and then transferred to HEK-293T cells. speculated.
  • the obtained colonies were cultured for 7 days, and the culture supernatant was collected to finally obtain the heavy and light chains of the humanized chimeric 5B2 antibody.
  • the produced antibody was purified in the same manner as in Example 2.
  • the amino acid sequence of the humanized 5B2 chimeric antibody is shown in Table 12, and the nucleotide sequence encoding the humanized 5B2 chimeric antibody is shown in Table 13.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Organic Chemistry (AREA)
  • Neurosurgery (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Neurology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne des anticorps se liant spécifiquement à AIMP2 et/ou à des agrégats d'AIMP2. Des anticorps produits à partir du clone 5B2 et du clone 6C7 ou des fragments immunologiquement actifs correspondants se lient spécifiquement aux agrégats d'AIMP2. Des anticorps produits à partir du clone 3C2 et du clone 7H9 ou des fragments immunologiquement actifs correspondants se lient spécifiquement à des monomères AIMP2 dans une structure normale. Un anticorps produit à partir du clone 13H9 ou un fragment immunologiquement actif correspondant se lie spécifiquement à un agrégat d'AIMP2 et à un monomère AIMP2 dans une structure normale. Ainsi, les anticorps ou leurs fragments immunologiquement actifs selon la présente invention peuvent être avantageusement appliqués au diagnostic et au traitement de maladies associées à AIMP2 ou à des agrégats d'AIMP2, en particulier de maladies neurodégénératives.
PCT/KR2021/018007 2020-12-01 2021-12-01 Anticorps se liant spécifiquement à aimp2 et/ou à un agrégat d'aimp2 WO2022119310A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200165379A KR20220076658A (ko) 2020-12-01 2020-12-01 Aimp2 및/또는 aimp2 응집체에 특이적으로 결합하는 항체
KR10-2020-0165379 2020-12-01

Publications (1)

Publication Number Publication Date
WO2022119310A1 true WO2022119310A1 (fr) 2022-06-09

Family

ID=81854246

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/018007 WO2022119310A1 (fr) 2020-12-01 2021-12-01 Anticorps se liant spécifiquement à aimp2 et/ou à un agrégat d'aimp2

Country Status (2)

Country Link
KR (1) KR20220076658A (fr)
WO (1) WO2022119310A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170041363A (ko) * 2015-10-07 2017-04-17 원광대학교산학협력단 신경질환 예방 또는 치료를 위한 aimp2-dx2를 포함하는 약학 조성물 및 이의 용도
KR20170105763A (ko) * 2016-03-10 2017-09-20 재단법인 의약바이오컨버젼스연구단 Aimp2-dx2 단백질에 특이적으로 결합하는 항체
KR20190113033A (ko) * 2018-03-27 2019-10-08 성균관대학교산학협력단 콧물액을 이용한 파킨슨 질환의 진단 방법, 이를 위한 조성물 및 이를 포함하는 키트

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170041363A (ko) * 2015-10-07 2017-04-17 원광대학교산학협력단 신경질환 예방 또는 치료를 위한 aimp2-dx2를 포함하는 약학 조성물 및 이의 용도
KR20170105763A (ko) * 2016-03-10 2017-09-20 재단법인 의약바이오컨버젼스연구단 Aimp2-dx2 단백질에 특이적으로 결합하는 항체
KR20190113033A (ko) * 2018-03-27 2019-10-08 성균관대학교산학협력단 콧물액을 이용한 파킨슨 질환의 진단 방법, 이를 위한 조성물 및 이를 포함하는 키트

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein ANONYMOUS : "hypothetical protein [Homo sapiens] ", XP055936155, retrieved from NCBI *
DATABASE Protein ANONYMOUS : "monoclonal IgM antibody light chain [Homo sapiens] - ", XP055936153, retrieved from NCBI *
KIM, HYO SEONG: "A Study on the Genetic Correlation between AIMP2 and Mortalin in Parkinson's Disease.", MASTER THESIS, 1 August 2019 (2019-08-01), Korea, pages 1 - 57, XP009537151 *

Also Published As

Publication number Publication date
KR20220076658A (ko) 2022-06-08

Similar Documents

Publication Publication Date Title
WO2020111913A1 (fr) Anticorps anti-4-1bb et son utilisation
WO2019098682A1 (fr) Anticorps anti-her2 ou fragment de liaison à l'antigène de celui-ci, et récepteur antigénique chimérique le comprenant
WO2021010712A1 (fr) Anticorps anti-tau et son utilisation
WO2016137108A1 (fr) Nouvel anticorps se liant à la tfpi et composition le comprenant
WO2019112347A2 (fr) Anticorps ou son fragment de liaison à l'antigène pour reconnaître spécifiquement une malignité de cellule b, récepteur d'antigène chimérique le comprenant, et son utilisation
WO2018128454A1 (fr) ANTICORPS ANTI-α-SYN ET SON UTILISATION
WO2014077648A1 (fr) Anticorps se liant spécifiquement à la protéine l1cam humaine et murine, et son utilisation
WO2020101365A1 (fr) Anticorps anti-c-met présentant une stabilité améliorée ou des fragments de liaison à l'antigène de celui-ci
WO2022085905A1 (fr) Anticorps se liant spécifiquement à la protéine de spicule du sars-cov-2 et utilisation associée
WO2021101346A1 (fr) Anticorps bispécifiques anti-ror1/anti-4-1bb et leurs utilisations
WO2022119310A1 (fr) Anticorps se liant spécifiquement à aimp2 et/ou à un agrégat d'aimp2
WO2020116963A1 (fr) Anticorps de régulation de l'activité de type a du récepteur de l'endothéline
WO2017074013A1 (fr) Anticorps destiné à être réticulé à la sema3a humaine et de souris, et son utilisation
WO2017179862A1 (fr) Anticorps à stabilité améliorée et se liant spécifiquement à her2
WO2022154288A1 (fr) Anticorps monoclonal se liant de manière spécifique à la protéine kinase a d'une sous-unité catalytique alpha, et son utilisation pour le diagnostic du cancer
WO2022231320A1 (fr) Anticorps se liant de manière spécifique à la protéine s de sars-cov-2 ou à un fragment de liaison à l'antigène de celle-ci, et ses utilisations
WO2019235856A1 (fr) Anticorps se liant à tie2 et son utilisation
WO2023033363A1 (fr) Anticorps bispécifique se liant de manière spécifique au sars-cov-2
WO2021029746A2 (fr) Anticorps anti-tie 2 et son utilisation
WO2019088658A1 (fr) Anticorps à double ciblage ciblant le scf et la galectine-1 et son utilisation
WO2017142294A1 (fr) Anticorps anti-egfrviii et utilisation correspondante
WO2018182266A1 (fr) Anticorps anti-emap ii et son utilisation
WO2023128550A1 (fr) Anticorps se liant de manière spécifique à asm et son utilisation
WO2017200173A1 (fr) Mutant de fragment de liaison au vegf, et protéine de fusion comprenant le mutant de fragment de liaison au vegf et anticorps anti-c-met
WO2022250502A1 (fr) Agoniste ox40 et son utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21900998

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21900998

Country of ref document: EP

Kind code of ref document: A1