WO2022108634A1 - Procédé, système et appareil de détection - Google Patents

Procédé, système et appareil de détection Download PDF

Info

Publication number
WO2022108634A1
WO2022108634A1 PCT/US2021/045630 US2021045630W WO2022108634A1 WO 2022108634 A1 WO2022108634 A1 WO 2022108634A1 US 2021045630 W US2021045630 W US 2021045630W WO 2022108634 A1 WO2022108634 A1 WO 2022108634A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
sample
amplification
seq
virus
Prior art date
Application number
PCT/US2021/045630
Other languages
English (en)
Inventor
John F. Davidson
Arnau CASANOVAS-MASSANA
Zheng XUE
Tony JOAQUIM
Original Assignee
Tangen Bioscience Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tangen Bioscience Inc. filed Critical Tangen Bioscience Inc.
Priority to PCT/US2021/057146 priority Critical patent/WO2022108728A1/fr
Priority to PCT/US2021/060581 priority patent/WO2022109480A1/fr
Priority to US17/533,829 priority patent/US20220081730A1/en
Publication of WO2022108634A1 publication Critical patent/WO2022108634A1/fr

Links

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
    • B01L3/5027—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
    • B01L3/502761—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip specially adapted for handling suspended solids or molecules independently from the bulk fluid flow, e.g. for trapping or sorting beads, for physically stretching molecules
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/508—Containers for the purpose of retaining a material to be analysed, e.g. test tubes rigid containers not provided for above
    • B01L3/5085—Containers for the purpose of retaining a material to be analysed, e.g. test tubes rigid containers not provided for above for multiple samples, e.g. microtitration plates
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L7/00—Heating or cooling apparatus; Heat insulating devices
    • B01L7/52—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples
    • B01L7/525—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples with physical movement of samples between temperature zones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00—Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/10—Integrating sample preparation and analysis in single entity, e.g. lab-on-a-chip concept
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00—Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/16—Reagents, handling or storing thereof
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/08—Geometry, shape and general structure
    • B01L2300/0803—Disc shape

Definitions

  • This invention relates generally to nucleic acid amplification, and more particularly to methods, compositions, systems and technologies for amplification of nucleic acids for the detection of particular microorganisms such as viruses and bacteria in a mammal.
  • Nucleic acid analysis methods based on the complementarity of nucleic acid nucleotide sequences can analyze genetic traits directly. Thus, these methods are a very powerful means for identification of genetic diseases, cancer, microorganisms etc.
  • Nucleic acid amplification technologies allow detection and quantification of a nucleic acid in a sample with high sensitivity and specificity. NAAT techniques may be used to determine the presence of a particular template nucleic acid in a sample, as indicated by the presence of an amplification product (i.e., amplicon) following the implementation of a particular NAAT. Conversely, the absence of any amplification product indicates the absence of template nucleic acid in the sample. Such techniques are of great importance in diagnostic applications, for example, for determining whether a pathogen is present in a sample. Thus, NAAT techniques are useful for detection and quantification of specific nucleic acids for diagnosis of infectious and genetic diseases.
  • RNA detection technologies typically have high analytical sensitivity and specificity compared to antigen and antibodybased methods. Detection of specific genomic DNA or RNA is achieved via amplification of small unique regions of the genome viaNAATs such as polymerase chain reaction (PCR, RT-PCR) as well as isothermal methods including loop mediated isothermal amplification (LAMP, RT-LAMP), nucleic acid sequencebased amplification (NASBA), nicking enzyme amplification reaction (NEAR) and rolling circle amplification (RCA), for example.
  • PCR polymerase chain reaction
  • RT-PCR isothermal methods
  • LAMP loop mediated isothermal amplification
  • NASBA nucleic acid sequencebased amplification
  • NEAR nicking enzyme amplification reaction
  • RCA rolling circle amplification
  • LAMP unlike PCR, does not require rapid temperature cycling and so the power demands of the instrument are much lower. This enables a low-cost alternative to the traditional lab-based PCR thermocycler. In addition, LAMP has a short time to positivity - as fast as 5 minutes for strongly positive samples and the degree of sample purity required is much lower while still having analytical sensitivity comparable or superior to PCR. In order to detect RNA, a LAMP based system requires an enzyme or enzymes that can reverse transcribe the RNA template before LAMP amplification and detection.
  • the RT- LAMP assay can therefore be either 1- step or 2-step, with the first step being a dedicated reverse transcriptase enzyme copying the RNA template into cDNA followed by the geometric LAMP amplification of the target, or preferably a single enzyme RT-LAMP process such as the Lava LAMPTM enzyme from Lucigen Inc., Middleton, WI.
  • a single-step enzyme RT-LAMP system reduces assay time as reverse transcription and LAMP amplification occur simultaneously and allows for detection of RNA based pathogens including the majority of respiratory viruses such as influenza A and B, coronaviruses including SARS-CoV-2, and Respiratory Syncytial Virus (RSV).
  • RNA based pathogens including the majority of respiratory viruses such as influenza A and B, coronaviruses including SARS-CoV-2, and Respiratory Syncytial Virus (RSV).
  • a system that was able to look for a panel of multiple potential virus pathogens from a single sample would enable definitive diagnosis of the common early upper respiratory symptoms; sore throat, cough, mild fever and running nose to distinguish serious infections such as Sars-CoV-2 or influenza from mild disease caused by rhinovirus or adenovirus, for example.
  • the Tangen GeneSparkTM instrument was designed with all these features in mind - rapid highly accurate LAMP amplification detection with a low-cost disposable assay disk that affords a panel of up to 32 different pathogen targets from a single patient sample and portability, connectivity, and ease of use to allow for point of care results.
  • the SARS- Cov-2 pandemic has underscored the pressing need for rapid accurate testing outside of the laboratory setting at the point of care, with the information getting immediately the patient so they can manage their exposure to others, as well delivering the result to public health databases, so that the pandemic can be tracked, traced, and controlled.
  • novel embodiments of the invention described are useful for the detection of bacteria and viruses using novel NAAT and primers.
  • the inventions have other benefits, including significant improvements to the reaction sensitivity and specificity and allowing fewer primer designs to be developed and screened for amplification reactions.
  • aspects of the invention relate to apparatuses, compositions, methods, and systems for detecting or quantifying a target nucleic acid in a nucleic acid sample, and in particular for detecting target nucleic acids from microorganisms and pathogens, such as bacterial and viral, in a host, patient or subject animal.
  • aspects of the invention relate to system, method and apparatus for extracting particles from biological fluids (mammalian blood, saliva, urine, nasopharyngeal fluid, bronchoalveolar lavage, and other fluids, such as from other biological matrices, etc.).
  • biological fluids mammalian blood, saliva, urine, nasopharyngeal fluid, bronchoalveolar lavage, and other fluids, such as from other biological matrices, etc.
  • the further processing of the particles may include, lysing a cell associated with the particle to extract the cells nucleic acid and sequencing the cell's nucleic acid to determine its identity.
  • particles may include, but are not limited to, pathogens, such as bacterial and viral microorganisms.
  • kits for detecting or quantifying a target nucleic acid in a blood sample includes (i) a blood processing unit to extract particles from mammalian blood; (ii) sample prep section for separating nucleic acid associated with the extracted particles; (iii) a solid phase disc for identifying nucleic acids having one or more amplification primer sets and one or more second primer sets; and (iv) instructions for use of the disc for a method of detecting a microorganism in a nucleic acid sample from a subject on an apparatus, instrument, or system described herein or in related applications.
  • particles may be further processed to identify the presence (or absence) of a disease.
  • the further processing of the particles may include, lysing a cell associated with the particle to extract the cells nucleic acid and sequencing the cell's nucleic acid to determine its identity.
  • particles may include, but are not limited to, pathogens, such as bacterial and viral microorganisms.
  • methods of detecting a nucleic acid of one or more microorganism in a subject are provided. The sample collection and other steps of these methods may vary depending on the type of tissue sample that is being collected and what microorganism is suspected of being present.
  • An exemplary embodiment of a method of detecting a nucleic acid of one or more microorganism in a subject includes, independent of order, the following steps: obtaining an upper respiratory sample from a subject; processing the upper respiratory sample in an apparatus to capture and lyse microorganisms from the sample, and obtaining a nucleic acid extract from microorganisms in the upper respiratory sample of a subject; selecting one or more target sequence from a microorganism of interest, and selecting one or more nucleic acid amplification primer set that is complementary to at least a portion of a target sequence from a microorganism of interest; incubating the target sequence with the one or more nucleic acid amplification primer set in a reaction mixture and performing an amplification reaction; and detecting one or more target sequence from a microorganism of interest.
  • the incubation step includes a pre-amplification step that uses random primers and reagents for the nonselective amplification of nucleic acid from microorganisms in the sample to produce a pre-amplification product.
  • an upper respiratory sample from a subject includes samples from a nasal pharyngeal swab, a nasal swab, a throat swab, saliva, a nasal aspirate, and any other method suitable to obtain sufficient sample.
  • more than one microorganism in a subject's upper respiratory sample can be detected.
  • the microorganism detected is a virus.
  • the virus is a coronavirus.
  • the virus is a SARS-CoV-2 type virus.
  • the virus is selected from Adenovirus, Coronavirus HKU1, Coronavirus NL63, Coronavirus 229E, Coronavirus OC43, Human Metapneumovirus, Human Rhinovirus/Enterovirus, Influenza A, Influenza B, Parainfluenza Virus 1, Parainfluenza Virus 2, Parainfluenza Virus 3, Parainfluenza Virus 4Respiratory Syncytial Virus, and SARS-CoV-2 type virus.
  • the amplified template is detected or quantified in real time. In some embodiments, between about 100 and about 1000 of amplicon products from a first stage amplification are inputted into a second stage amplification reaction. In some embodiments, the amplification is isothermal.
  • the target sequence comprises a SARS-CoV-2 type virus nucleic acid sequence in the nucleocapsid recombinant N2 fragment domain or in the nucleocapsid recombinant N3 fragment domain. In some embodiments, the target sequence comprises a SARS-CoV-2 type virus nucleic acid sequence in the nucleocapsid recombinant N2 fragment domain the target sequence comprises a nucleocapsid recombinant N3 fragment domain.
  • Another exemplary embodiment of a method of detecting a nucleic acid of one or more microorganism in a subject includes, independent of order, the following steps: obtaining a blood or blood fraction sample from a subject; processing the blood sample in an apparatus to capture and lyse microorganisms from the sample, and obtaining a nucleic acid extract from microorganisms in the blood sample of a subject; selecting one or more target sequence from a microorganism of interest, and selecting one or more nucleic acid amplification primer set that is complementary to at least a portion of a target sequence from a microorganism of interest; incubating the target sequence with the one or more nucleic acid amplification primer set in a reaction mixture and performing an amplification reaction; and detecting one or more target sequence from a microorganism of interest.
  • the incubation step includes a pre-amplification step that uses random primers and reagents for the nonselective amplification of nucleic acid from
  • microorganism in a subject's blood sample can be detected.
  • the microorganism comprises one or more bacteria species.
  • one or more bacteria species that is detected is selected from Bordetella parapertussis, Bordetella pertussis, Chlamydia pneumoniae, Mycoplasma pneumoniae, Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Salmonella spp., Proteus mirabilis, Citrobacter freundii, Serratia marcescens, Enterococcus faecalis, Enterococcus faecium, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus lugdunensis, and Streptococcus pneumoniae.
  • one or more bacterium species is a pathogenic bacterium.
  • the bacterium Bacillus anthracis is detected and the target nucleic acids comprise pXOl and pXO2 nucleic acid sequences from bacterium B. anthracis.
  • a target sequence comprises nucleic acids from genes that confer antimicrobial resistance (AMR) to bacteria.
  • AMR antimicrobial resistance gene
  • one or more antimicrobial resistance gene (AMR) is detected from one or more bacterial pathogen species suspected of being present in a subject's blood sample.
  • at least 10 species of bacteria and their corresponding antibiotic resistance genes are analyzed.
  • between about 10 and about 20 species of bacteria and their corresponding antibiotic resistance genes are analyzed.
  • the amplified template is detected or quantified in real time.
  • between about 100 and about 1000 of amplicon products from a first stage amplification are inputted into a second stage amplification reaction.
  • the amplification is isothermal.
  • kits for detecting or quantifying a target nucleic acid in a nucleic acid sample an exemplary kit includes a solid phase disc for detecting nucleic acids having one or more amplification primer sets and one or more second primer sets; and ii) instructions for use of the disk for a method of detecting a microorganism in a nucleic acid sample from a subject on an apparatus, instrument, or system described herein.
  • Figure 1 shows an embodiment used for the detection of Candida auris.
  • Fig. 1A illustrates the primers used for LAMP reaction and their location in the target sequence.
  • Fig. IB is an illustration of the Candida auris TangenDXTM assay disks.
  • Wells in black contained positive controls, wells in grey contain the Candida auris LAMP primers, and wells in white are empty. The arrangement/assignment of the wells does not have be in consecutive order.
  • Figure 2 shows the distribution of the quantification cycles (Cq) (Fig. 2A) and percentage of positive wells (PPW) (Fig. 2B) for each set of LAMP primers tested. Dark grey circles indicate the results for blank runs and light grey circles results for runs containing 2,000 genomes of C. auris M5658.
  • Figure 3 shows components of a TangenDxTM - Candida auris assay, which is provided as a kit in some embodiments.
  • a kit may include all or some of the following: a BD ESwab collection and transport system (1); a capped 20mL syringe prefilled with 5mL of lysis buffer (2); a 2.5” 18-gauge blunt needle (3); a large volume concentrator (LVC) unit attached to an LVC-adaptor (4) ; a capped 20mL syringe prefilled with 12mL of wash buffer (5) ; a bottle with 10mL assay buffer (6) a 400 ⁇ L transfer pipette (7) ; a LVC cap with a lyticase enzyme bead (8) ; a LVC holder (9) ; a LVC tightening wrench (10) ; and a waste container (11).
  • a kit may include all or some of the following: a BD ESwab collection and transport system (1); a
  • Figure 4 shows a comparison of percentage of positive wells (PPW) with and without filtration.
  • Figure 5 shows results of a LoD Range Finding - Reference Method Comparison experiment.
  • Figure 6 shows more results of a LoD Range Finding - Reference Method Comparison experiment.
  • “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) or hybridize with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types.
  • “hybridization” refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under low, medium, or highly stringent conditions, including when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. See e.g. Ausubel, et al., Current Protocols In Molecular Biology, John Wiley & Sons, New York, N.Y., 1993.
  • a nucleotide at a certain position of a polynucleotide is capable of forming a Watson-Crick pairing with a nucleotide at the same position in an anti-parallel DNA or RNA strand
  • the polynucleotide and the DNA or RNA molecule are complementary to each other at that position.
  • the polynucleotide and the DNA or RNA molecule are "substantially complementary" to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hybridize or anneal with each other in order to affect the desired process.
  • a complementary sequence is a sequence capable of annealing under stringent conditions to provide a 3'-terminal serving as the origin of synthesis of complementary chain.
  • Identity is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences.
  • identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as determined by the match between strings of such sequences.
  • Identity and similarity can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.
  • values for percentage identity can be obtained from amino acid and nucleotide sequence alignments generated using the default settings for the AlignX component of Vector NTI Suite 8.0 (Informax, Frederick, Md.).
  • Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and FASTA (Atschul, S. F. et al., J. Molec. Biol. 215:403-410 (1990)).
  • the BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBINLM NIH Bethesda, Md. 20894: Altschul, S., et al., J. Mol. Biol. 215:403-410 (1990).
  • the well-known Smith Waterman algorithm may also be used to determine identity.
  • the additional nucleic acid molecule optionally includes sequence that is substantially identical or substantially complementary to at least some portion of the template nucleic acid molecule.
  • the template nucleic acid molecule can be single-stranded or double-stranded and the additional nucleic acid molecule can independently be single-stranded or double -stranded.
  • amplification includes a template-dependent in vitro enzyme-catalyzed reaction for the production of at least one copy of at least some portion of the nucleic acid molecule or the production of at least one copy of a nucleic acid sequence that is complementary to at least some portion of the nucleic acid molecule.
  • Amplification optionally includes linear or exponential replication of a nucleic acid molecule.
  • such amplification is performed using isothermal conditions; in other embodiments, such amplification can include thermocycling.
  • the amplification is a multiplex amplification that includes the simultaneous amplification of a plurality of target sequences in a single amplification reaction.
  • amplification includes amplification of at least some portion of DNA- and RNA-based nucleic acids alone, or in combination.
  • the amplification reaction can include single or double-stranded nucleic acid substrates and can further including any of the amplification processes known to one of ordinary skill in the art.
  • the amplification reaction includes polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the synthesis of nucleic acid in the present invention means the elongation or extension of nucleic acid from an oligonucleotide serving as the origin of synthesis. If not only this synthesis but also the formation of other nucleic acid and the elongation or extension reaction of this formed nucleic acid occur continuously, a series of these reactions is comprehensively called amplification.
  • target primer or “target-specific primer” and variations thereof refer to primers that are complementary to a binding site sequence.
  • Target primers are generally a single stranded or double-stranded polynucleotide, typically an oligonucleotide, that includes at least one sequence that is at least partially complementary to a target nucleic acid sequence.
  • Forward primer binding site and reverse primer binding site refers to the regions on the template DNA and/or the amplicon to which the forward and reverse primers bind.
  • the primers act to delimit the region of the original template polynucleotide which is exponentially amplified during amplification.
  • additional primers may bind to the region 5' of the forward primer and/or reverse primers. Where such additional primers are used, the forward primer binding site and/or the reverse primer binding site may encompass the binding regions of these additional primers as well as the binding regions of the primers themselves.
  • the method may use one or more additional primers which bind to a region that lies 5' of the forward and/or reverse primer binding region. Such a method was disclosed, for example, in W00028082 which discloses the use of "displacement primers" or "outer primers”.
  • amplification can be performed using multiple target-specific primer pairs in a single amplification reaction, wherein each primer pair includes a forward target-specific primer and a reverse target-specific primer, each including at least one sequence that substantially complementary or substantially identical to a corresponding target sequence in the sample, and each primer pair having a different corresponding target sequence.
  • the target-specific primer can be substantially non-complementary at its 3' end or its 5' end to any other target-specific primer present in an amplification reaction.
  • the target-specific primer can include minimal cross hybridization to other target-specific primers in the amplification reaction.
  • targetspecific primers include minimal cross-hybridization to non-specific sequences in the amplification reaction mixture. In some embodiments, the target-specific primers include minimal self-complementarity. In some embodiments, the target-specific primers can include one or more cleavable groups located at the 3' end. In some embodiments, the target-specific primers can include one or more cleavable groups located near or about a central nucleotide of the target-specific primer. In some embodiments, one of more targets- specific primers includes only non-cleavable nucleotides at the 5' end of the target-specific primer.
  • a target specific primer includes minimal nucleotide sequence overlap at the 3'end or the 5' end of the primer as compared to one or more different target-specific primers, optionally in the same amplification reaction.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, target-specific primers in a single reaction mixture include one or more of the above embodiments.
  • substantially all of the plurality of target-specific primers in a single reaction mixture includes one or more of the above embodiments.
  • identity when used in reference to two or more nucleic acid sequences, refer to similarity in sequence of the two or more sequences (e.g., nucleotide or polypeptide sequences).
  • percent identity or homology of the sequences or subsequences thereof indicates the percentage of all monomeric units (e.g., nucleotides or amino acids) that are the same (i.e., about 70% identity, preferably 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity).
  • the percent identity can be over a specified region, when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection. Sequences are said to be "substantially identical" when there is at least 85% identity at the amino acid level or at the nucleotide level. Preferably, the identity exists over a region that is at least about 25, 50, or 100 residues in length, or across the entire length of at least one compared sequence.
  • a typical algorithm for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al, Nuc. Acids Res. 25:3389-3402 (1977).
  • the polynucleic acid produced by an amplification technology employed is generically referred to as an "amplicon" or "amplification product.”
  • amplicon or "amplification product.”
  • NAATs such as PCR may produce amplicon which is substantially of identical size and sequence.
  • Other NAATs produce amplicon of very varied size wherein the amplicon is composed of different numbers of repeated sequences such that the amplicon is a collection of concatamers of different length. The repeating sequence from such concatamers will reflect the sequence of the polynucleic acid which is the subject of the assay being performed.
  • the simple expression "5'-side” or “3'-side” refers to that of a nucleic acid chain serving as a template, wherein the 5' end generally includes a phosphate group and a 3' end generally includes a free --OH group.
  • an apparatus and methods for rapid isolation, concentration, and purification of microbes / pathogens of interest from a raw biological sample such as blood is described.
  • Samples may be processed directly from biological or clinical sample collection vessels, such as vacutainers, by coupling with the sample processing apparatus in such a manner that minimizes or eliminates user exposure and potential contamination issues.
  • the apparatus comprises a staged syringe or piston arrangement configured to withdraw a desired quantity of biological sample from a sample collection vessel. The sample is then mixed with selected processing reagents preparing the sample for isolation of microbes or pathogens contained therein.
  • Sample processing may include liquefying or homogenizing non-pathogenic components of the biological specimen and performing various fluidic transfer operations induced by operation of the syringe or piston.
  • the resulting sample constituents may be redirected to flow across a capture filter or membrane of appropriate size or composition to capture specific microbes / pathogens or other biological sample constituents. Additional operations may be performed including washing and drying of the filter or membrane by action of the syringe or piston.
  • sample backflow and cross-contamination within the device is avoided using one-way valves that direct sample fluids along desired paths while preventing leakage, backflow, and/or undesired sample movement.
  • the device may include a capture filter for retaining microbes / pathogens of interest allowing them to be readily separated from sample eluent or remaining fraction of the processed sample / waste.
  • the capture filter may be housed in a sealable container and can further be configured to be received directly by other sample processing / analytical instruments for performing downstream operations such as lysis, elution, detection, and identification of the captured microbes / pathogens retained on the filter / membrane.
  • the collector may comprise various features to facilitate automated or semi-automated sample processing and include additional reagents contained in at least one reservoir integrated into the collector to preserve or further process the isolated microbes / pathogens captured or contained by the filter / membrane.
  • the collector may contain constituents capable of chemically disinfecting the isolated microbes / pathogens or render the sample non-infectious while preserving the integrity of biological constituents associated with the microbe / pathogen such as nucleic acids and / or proteins that may be desirably isolated for subsequent downstream processing and analysis.
  • the collector and associated instrument components may desirably maintain the sample in an isolated environment avoiding sample contamination and / or user exposure to the sample contents.
  • this present disclosure describes an apparatus that permits rapid and semi-automated isolation and extraction of microorganisms such as bacteria, virus, spores, and fungi or constituent biomolecules associated with the microorganisms, such as nucleic acids and / or proteins from a biological sample without extensive hands-on processing or lab equipment.
  • the apparatus has the further benefit of concentrating the microbes, pathogens, or associated biomolecules / biomaterial of interest.
  • bacteria, virus, spores, or fungi present in the sample may be conveniently isolated from the original sample material and concentrated on the filter or membrane. Concentration in this manner increases the efficiency of the downstream assays and analysis improving detection sensitivity by providing lower limits of detection relative to the input sample.
  • the sample preparation apparatus of the present disclosure may further be adapted for use with analytical devices and instruments capable of processing and identifying the microorganisms and / or associated biomolecules present within the biological sample.
  • the sample collector and various other components of the system can be fabricated from inexpensive and disposable materials such as molded plastic that are compatible with downstream sample processing methods and economical to produce. Such components may be desirably sealed and delivered in a sterile package for single use thereby avoiding potential contamination of the sample contents or exposure of the user while handling.
  • the reagents of the sample collector provide for disinfection of the sample constituents such that may be disposed of without risk or remaining infectious or hazardous.
  • the sample collector provides simplified workflows and does not require specialized training or procedures for handling and disposal.
  • the automated and semi-automated processing capabilities of the system simplify sample preparation and processing protocols.
  • a practical benefit may be realized in an overall reduction in the number of required user operations, interactions, or potential sample exposures as compared to conventional sample processing systems. This results in lower user training requirements and fewer user-induced failure points.
  • the system advantageously provides effective isolation and/or decontamination of a sample improving overall user safety while at the same time preserving sample integrity, for example by reducing undesirable sample degradation. Further aspects of these embodiments are described in co-pending related applications.
  • an apparatus and methods for rapid isolation, concentration, and purification of microbes / pathogens of interest from a raw biological sample such as blood is described.
  • Samples may be processed directly from biological or clinical sample collection vessels, such as vacutainers, by coupling with the sample processing apparatus in such a manner that minimizes or eliminates user exposure and potential contamination issues.
  • the apparatus comprises a staged syringe or piston arrangement configured to withdraw a desired quantity of biological sample from a sample collection vessel. The sample is then mixed with selected processing reagents preparing the sample for isolation of microbes or pathogens contained therein.
  • Sample processing may include liquefying or homogenizing non-pathogenic components of the biological specimen and performing various fluidic transfer operations induced by operation of the syringe or piston.
  • the resulting sample constituents may be redirected to flow across a capture filter or membrane of appropriate size or composition to capture specific microbes / pathogens or other biological sample constituents. Additional operations may be performed including washing and drying of the filter or membrane by action of the syringe or piston.
  • sample backflow and cross-contamination within the device is avoided using one-way valves that direct sample fluids along desired paths while preventing leakage, backflow, and/or undesired sample movement.
  • the device may include a capture filter for retaining microbes / pathogens of interest allowing them to be readily separated from sample eluent or remaining fraction of the processed sample / waste.
  • the capture fdter may be housed in a sealable container and can further be configured to be received directly by other sample processing / analytical instruments for performing downstream operations such as lysis, elution, detection, and identification of the captured microbes / pathogens retained on the filter / membrane.
  • the collector may comprise various features to facilitate automated or semi-automated sample processing and include additional reagents contained in at least one reservoir integrated into the collector to preserve or further process the isolated microbes / pathogens captured or contained by the filter / membrane.
  • the collector may contain constituents capable of chemically disinfecting the isolated microbes / pathogens or render the sample non-infectious while preserving the integrity of biological constituents associated with the microbe /pathogen such as nucleic acids and/or proteins that may be desirably isolated for subsequent downstream processing and analysis.
  • the collector and associated instrument components may desirably maintain the sample in an isolated environment avoiding sample contamination and / or user exposure to the sample contents.
  • this present disclosure describes an apparatus that permits rapid and semi-automated isolation and extraction of microorganisms such as bacteria, virus, spores, and fungi or constituent biomolecules associated with the microorganisms, such as nucleic acids and / or proteins from a biological sample without extensive hands-on processing or lab equipment.
  • the apparatus has the further benefit of concentrating the microbes, pathogens, or associated biomolecules / biomaterial of interest.
  • bacteria, virus, spores, or fungi present in the sample may be conveniently isolated from the original sample material and concentrated on the filter or membrane. Concentration in this manner increases the efficiency of the downstream assays and analysis improving detection sensitivity by providing lower limits of detection relative to the input sample.
  • the sample preparation apparatus of the present disclosure may further be adapted for use with analytical devices and instruments capable of processing and identifying the microorganisms and / or associated biomolecules present within the biological sample.
  • the sample collector and various other components of the system can be fabricated from inexpensive and disposable materials such as molded plastic that are compatible with downstream sample processing methods and economical to produce. Such components may be desirably sealed and delivered in a sterile package for single use thereby avoiding potential contamination of the sample contents or exposure of the user while handling.
  • the reagents of the sample collector provide for disinfection of the sample constituents such that may be disposed of without risk or remaining infectious or hazardous.
  • the sample collector provides simplified workflows and does not require specialized training or procedures for handling and disposal.
  • the automated and semi-automated processing capabilities of the system simplify sample preparation and processing protocols.
  • a practical benefit may be realized in an overall reduction in the number of required user operations, interactions, or potential sample exposures as compared to conventional sample processing systems. This results in lower user training requirements and fewer user-induced failure points.
  • the system advantageously provides effective isolation and/or decontamination of a sample improving overall user safety while at the same time preserving sample integrity, for example by reducing undesirable sample degradation.
  • more than one amplification is performed and the separate amplifications are referenced herein as stages or stages of amplification.
  • any of the amplification techniques orNAAT's described herein can be used in combination in some embodiments of the methods of increasing the performance and specificity of amplification reactions described herein.
  • an isothermal type amplification reaction such as LAMP can be combined with a non-isothermal amplification such as PCR, or as another example, another isothermal amplification such as a Helicase Dependent Amplification (HAD) reaction.
  • HAD Helicase Dependent Amplification
  • the amplification that is performed first sequentially is the first-stage amplification reaction
  • the amplification that is performed second sequentially is termed the second-stage amplification reaction
  • the amplification that is performed third sequentially is termed the third-stage amplification reaction, and so on.
  • Isothermal amplification techniques can be utilized in embodiments of the invention. Many of these approaches are mentioned above, and some in particular will be described in greater detail.
  • Isothermal amplification techniques typically utilize DNA polymerases with strand-displacement activity, thus eliminating the high temperature melt cycle that is required for PCR. This allows isothermal techniques to be faster and more energy efficient than PCR, and also allows for simpler and lower cost instrumentation since rapid temperature cycling is not required.
  • some methods of the instant invention are directed toward the improvement of conventional iNAAT's such as Strand Displacement Amplification (SDA; G. T. Walker, et at. 1992. Proc. Natl. Acad. Sci. USA 89, 392-396; G.
  • SDA Strand Displacement Amplification
  • NASBA Nucleic Acid Sequence Based Amplification
  • TMA Transcription Mediated Amplification
  • RNA amplification includes, but are not limited to, polymerase chain reaction (PCR) and related amplification processes (see, e.g., U.S. Pat. Nos. 4,683,195, 4,683,202, 4,800,159, 4,965,188, to Mullis, et al.; U.S. Pat. Nos. 4,795,699 and 4,921,794 to Tabor, et al; U.S. Pat. No. 5,142,033 to Innis; U.S. Pat. No. 5,122,464 to Wilson, et al.; U.S. Pat. No.
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • in vitro amplification methods can also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucleic acid sequencing, or for other purposes.
  • examples of techniques sufficient to direct persons of skill through in vitro amplification methods are found in Berger, supra, Sambrook, supra, and Ausubel, supra, as well as Mullis, et al., U.S. Pat. No.
  • a common characteristic of the NAATs described herein is that they provide for both copying of a polynucleic acid via the action of a primer or set of primers and for re-copying of said copy by a reverse primer or set of primers.
  • the first-stage primer-dependent amplification reaction is relatively slow as compared to the second-stage reaction.
  • a primer-generated amplicon gives rise to further generations of amplicons through repeated amplification reactions of the target nucleic acid template as well as priming of the amplicons themselves. It is possible for amplicons to be comprised of combinations with the target template.
  • the amplicon may be of very variable length as the target template can be copied from the first priming site beyond the region of nucleic acid delineated by the primers employed in a particular NAAT.
  • a key feature of a NAAT in an embodiment herein will be to provide a method by which the amplicon can be made available to another primer employed by the methodology so as to generate (over repeated amplification reactions) amplicons that will be of a discrete length delineated by the primers used.
  • a key feature of the NAAT is to provide a method by which the amplicons are available for further priming by a reverse primer in order to generate further copies.
  • the later generation amplicons may be substantially different from the first-generation amplicon, in particular, the formed amplicon may be a concatamer of the first- generation amplicon.
  • An exemplary target template used in the present invention includes any polynucleic acid that comprises suitable primer binding regions that allow for amplification of a polynucleic acid of interest.
  • the skilled person will understand that the forward and reverse primer binding sites need to be positioned in such a manner on the target template that the forward primer binding region and the reverse primer binding region are positioned 5' of the sequence which is to be amplified on the sense and antisense strand, respectively.
  • the target template may be single or double stranded. Where the target template is a single stranded polynucleic acid, the skilled person will understand that the target template will initially comprise only one primer binding region. However, the binding of the first primer will result in synthesis of a complementary strand which will then contain the second primer binding region.
  • the target template may be derived from an RNA molecule, in which case the RNA needs to be transcribed into DNA before practicing the method of the invention.
  • Suitable reagents for transcribing the RNA are well known in the art and include, but are not limited to, reverse transcriptase.
  • the terms "nucleic acid,” “polynucleotides,” and “oligonucleotides” refers to biopolymers of nucleotides and, unless the context indicates otherwise, includes modified and unmodified nucleotides, and both DNA and RNA, and modified nucleic acid backbones.
  • the nucleic acid is a peptide nucleic acid (PNA) or a locked nucleic acid (LN A).
  • PNA peptide nucleic acid
  • LN A locked nucleic acid
  • the methods as described herein are performed using DNA as the nucleic acid template for amplification.
  • nucleic acid whose nucleotide is replaced by an artificial derivative or modified nucleic acid from natural DNA or RNA is also included in the nucleic acid of the present invention insofar as it functions as a template for synthesis of complementary chain.
  • the nucleic acid of the present invention is generally contained in a biological sample.
  • the biological sample includes animal, plant or microbial tissues, cells, cultures, and excretions, or extracts therefrom.
  • the biological sample includes intracellular parasitic genomic DNA or RNA such as virus or mycoplasma.
  • the nucleic acid may be derived from nucleic acid contained in said biological sample.
  • genomic DNA, or cDNA synthesized from mRNA, or nucleic acid amplified on the basis of nucleic acid derived from the biological sample are preferably used in the described methods.
  • oligonucleotide sequence is represented, it will be understood that the nucleotides are in 5' to 3' order from left to right and that "A” denotes deoxyadenosine, “C” denotes deoxycytidine, “G” denotes deoxyguanosine, “T” denotes thymidine, and "U 1 denotes deoxyuridine.
  • Oligonucleotides are said to have "5' ends” and "3' ends” because mononucleotides are typically reacted to form oligonucleotides via attachment of the 5' phosphate or equivalent group of one nucleotide to the 3' hydroxyl or equivalent group of its neighboring nucleotide, optionally via a phosphodiester or other suitable linkage.
  • a template nucleic acid in exemplary embodiments is a nucleic acid serving as a template for synthesizing a complementary chain in a nucleic acid amplification technique.
  • a complementary chain having a nucleotide sequence complementary to the template has a meaning as a chain corresponding to the template, but the relationship between the two is merely relative. That is, according to the methods described herein a chain synthesized as the complementary chain can function again as a template. That is, the complementary chain can become a template.
  • the template is derived from a biological sample, e.g., plant, animal, virus, micro-organism, bacteria, fungus, etc.
  • the animal is a mammal, e.g., a human patient.
  • a template nucleic acid typically comprises one or more target nucleic acid.
  • a target nucleic acid in exemplary embodiments may comprise any single or double-stranded nucleic acid sequence that can be amplified or synthesized according to the disclosure, including any nucleic acid sequence suspected or expected to be present in a sample.
  • the target sequence is present in double-stranded form and includes at least a portion of the particular nucleotide sequence to be amplified or synthesized, or its complement, prior to the addition of target-specific primers or appended adapters.
  • Target sequences can include the nucleic acids to which primers useful in the amplification or synthesis reaction can hybridize prior to extension by a polymerase.
  • the term refers to a nucleic acid sequence whose sequence identity, ordering or location of nucleotides is determined by one or more of the methods of the disclosure.
  • a primer pair for a target nucleic acid typically has at least a region that is complementary to a target nucleic acid template in the sample.
  • NAAT primers used in the compositions, methods, and other inventions described herein typically at least 75% complementary or at least 85% complementary, more typically at least 90% complementary, more typically at least 95% complementary, more typically at least 98% or at least 99% complementary, or identical, to at least a portion of a nucleic acid molecule that includes a target sequence.
  • the target primer or target-specific primer and target sequence are described as "corresponding" to each other.
  • the target-specific primer is capable of hybridizing to at least a portion of its corresponding target sequence (or to a complement of the target sequence); such hybridization can optionally be performed under standard hybridization conditions or under stringent hybridization conditions. In some embodiments, the target-specific primer is not capable of hybridizing to the target sequence, or to its complement, but is capable of hybridizing to a portion of a nucleic acid strand including the target sequence, or to its complement.
  • the target-specific primer includes at least one sequence that is at least 75% complementary, typically at least 85% complementary, more typically at least 90% complementary, more typically at least 95% complementary, more typically at least 98% complementary, or more typically at least 99% complementary, to at least a portion of the target sequence itself; in other embodiments, the target-specific primer includes at least one sequence that is at least 75% complementary, typically at least 85% complementary, more typically at least 90% complementary, more typically at least 95% complementary, more typically at least 98% complementary, or more typically at least 99% complementary, to at least a portion of the nucleic acid molecule other than the target sequence.
  • the target-specific primer is substantially non-complementary to other target sequences present in the sample; optionally, the target-specific primer is substantially non-complementary to other nucleic acid molecules present in the sample.
  • nucleic acid molecules present in the sample that do not include or correspond to a target sequence (or to a complement of the target sequence) are referred to as "non-specific" sequences or "non-specific nucleic acids”.
  • the target-specific primer is designed to include a nucleotide sequence that is substantially complementary to at least a portion of its corresponding target sequence.
  • a target-specific primer is at least 95% complementary, or at least 99% complementary, or identical, across its entire length to at least a portion of a nucleic acid molecule that includes its corresponding target sequence.
  • a target-specific primer can be at least 90%, at least 95% complementary, at least 98% complementary or at least 99% complementary, or identical, across its entire length to at least a portion of its corresponding target sequence.
  • a forward target-specific primer and a reverse target-specific primer define a target-specific primer pair that can be used to amplify the target sequence via templatedependent primer extension.
  • the primer comprises one or more mismatched nucleotides (i.e., bases that are not complementary to the binding site).
  • the primer can comprise a segment that does not anneal to the polynucleic acid or that is complementary to the inverse strand of the polynucleic acid to which the primer anneals.
  • a primer is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more nucleotides in length.
  • the primer comprises from 2 to 100 nucleotides.
  • primer lengths are in the range of about 10 to about 60 nucleotides, about 12 to about 50 nucleotides, about 15 to about 50 nucleotides, about 18 to 50 nucleotides in length, about 6 to 50 nucleotides in length, about 10 to about 40 nucleotides in length, about 15 to about 40 nucleotides in length, about 18 to 40 nucleotides in length, or a different length.
  • a primer is capable of hybridizing to a corresponding target sequence and undergoing primer extension when exposed to amplification conditions in the presence of dNTPS and a polymerase.
  • the particular nucleotide sequence or a portion of the primer is known at the outset of the amplification reaction or can be determined by one or more of the methods disclosed herein.
  • the primer includes one or more cleavable groups at one or more locations within the primer.
  • Primers and oligonucleotides used in embodiments herein comprise nucleotides.
  • a nucleotide comprises any compound, including without limitation any naturally occurring nucleotide or analog thereof, which can bind selectively to, or can be polymerized by, a polymerase. Typically, but not necessarily, selective binding of the nucleotide to the polymerase is followed by polymerization of the nucleotide into a nucleic acid strand by the polymerase; occasionally however the nucleotide may dissociate from the polymerase without becoming incorporated into the nucleic acid strand, an event referred to herein as a "non-productive" event.
  • nucleotides include not only naturally occurring nucleotides but also any analogs, regardless of their structure, that can bind selectively to, or can be polymerized by, a polymerase. While naturally occurring nucleotides typically comprise base, sugar and phosphate moieties, the nucleotides of the present disclosure can include compounds lacking any one, some or all of such moieties.
  • the nucleotide can optionally include a chain of phosphorus atoms comprising three, four, five, six, seven, eight, nine, ten or more phosphorus atoms.
  • the phosphorus chain can be attached to any carbon of a sugar ring, such as the 5' carbon.
  • the phosphorus chain can be linked to the sugar with an intervening O or S.
  • one or more phosphorus atoms in the chain can be part of a phosphate group having P and O.
  • the phosphorus atoms in the chain can be linked together with intervening O, NH, S, methylene, substituted methylene, ethylene, substituted ethylene, CNH 2 , C(O), C(CH 2 ), CH 2 CH 2 , or C(OH)CH 2 R (where R can be a 4- pyridine or 1 -imidazole).
  • the phosphorus atoms in the chain can have side groups having O, BH3, or S.
  • a phosphorus atom with a side group other than O can be a substituted phosphate group.
  • phosphorus atoms with an intervening atom other than O can be a substituted phosphate group.
  • nucleotide analogs are described in Xu, U.S. Pat. No. 7,405,281.
  • the nucleotide comprises a label and referred to herein as a "labeled nucleotide”; the label of the labeled nucleotide is referred to herein as a "nucleotide label".
  • the label can be in the form of a fluorescent moiety (e.g. dye), luminescent moiety, or the like attached to the terminal phosphate group, i.e., the phosphate group most distal from the sugar.
  • nucleotides that can be used in the disclosed methods and compositions include, but are not limited to, ribonucleotides, deoxyribonucleotides, modified ribonucleotides, modified deoxyribonucleotides, ribonucleotide polyphosphates, deoxyribonucleotide polyphosphates, modified ribonucleotide polyphosphates, modified deoxyribonucleotide polyphosphates, peptide nucleotides, modified peptide nucleotides, metallonucleosides, phosphonate nucleosides, and modified phosphate- sugar backbone nucleotides, analogs, derivatives, or variants of the foregoing compounds, and the like.
  • the nucleotide can comprise non-oxygen moieties such as, for example, thio- or borano-moieties, in place of the oxygen moiety bridging the alpha phosphate and the sugar of the nucleotide, or the alpha and beta phosphates of the nucleotide, or the beta and gamma phosphates of the nucleotide, or between any other two phosphates of the nucleotide, or any combination thereof.
  • non-oxygen moieties such as, for example, thio- or borano-moieties, in place of the oxygen moiety bridging the alpha phosphate and the sugar of the nucleotide, or the alpha and beta phosphates of the nucleotide, or the beta and gamma phosphates of the nucleotide, or between any other two phosphates of the nucleotide, or any combination thereof.
  • Nucleotide 5'-triphosphate refers to a nucleotide with a triphosphate ester group at the 5' position, and are sometimes denoted as “NTP", or “dNTP” and “ddNTP” to particularly point out the structural features of the ribose sugar.
  • the triphosphate ester group can include sulfur substitutions for the various oxygens, e.g. ⁇ -thio- nucleotide 5'-triphosphates.
  • nucleic acid polymerases can be used in the NAATs utilized in certain embodiments provided herein, including any enzyme that can catalyze the polymerization of nucleotides (including analogs thereof) into a nucleic acid strand. Such nucleotide polymerization can occur in a template-dependent fashion.
  • Such polymerases can include without limitation naturally occurring polymerases and any subunits and truncations thereof, mutant polymerases, variant polymerases, recombinant, fusion or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives or fragments thereof that retain the ability to catalyze such polymerization.
  • the polymerase can be a mutant polymerase comprising one or more mutations involving the replacement of one or more amino acids with other amino acids, the insertion or deletion of one or more amino acids from the polymerase, or the linkage of parts of two or more polymerases.
  • the polymerase comprises one or more active sites at which nucleotide binding and/or catalysis of nucleotide polymerization can occur.
  • Some exemplary polymerases include without limitation DNA polymerases and RNA polymerases.
  • polymerase and its variants, as used herein, also includes fusion proteins comprising at least two portions linked to each other, where the first portion comprises a peptide that can catalyze the polymerization of nucleotides into a nucleic acid strand and is linked to a second portion that comprises a second polypeptide.
  • the second polypeptide can include a reporter enzyme or a processivity-enhancing domain.
  • the polymerase can possess 5' exonuclease activity or terminal transferase activity.
  • the polymerase can be optionally reactivated, for example through the use of heat, chemicals or re-addition of new amounts of polymerase into a reaction mixture.
  • the polymerase can include a hot-start polymerase or an aptamer-based polymerase that optionally can be reactivated.
  • a microorganism that is detected is a virus
  • the virus that is detected is selected from Adenovirus, Coronavirus HKU1, Coronavirus NL63, Coronavirus 229E, Coronavirus OC43, Human Metapneumovirus, Human Rhinovirus/Enterovirus, Influenza A, Influenza B, Parainfluenza Virus 1, Parainfluenza Virus 2, Parainfluenza Virus 3, Parainfluenza Virus 4Respiratory Syncytial Virus, and SARS-CoV-2 type virus.
  • viruses Adeno-Associated Virus Parvovirus ‘AAV’, Adenovirus, Arena virus (Lassa virus), Astrovirus, Bacille Calmette-Guerin ‘BDG’, BK virus (including associated with kidney transplant patients), Papovavirus, Bunyavirus, Burkett's Lymphoma (Herpes), Calicivirus, California, encephalitis (Bunyavirus), Colorado tick fever (Reovirus), Corona virus, Coronavirus, Coxsackie, Coxsackie virus A, B (Enterovirus), Crimea-Congo hemorrhagic fever (Bunyavirus), Cytomegalovirus, Cytomegaly, Dengue (Flavivirus), Diptheria (bacteria), Ebola, Ebola/Marburg hemorrhagic fever (Filoviruses), Epstein-Barr Virus ‘EBV’
  • a microorganism that is detected is a bacteria, such as a pathogenic bacteria, and in certain embodiments the bacteria that is detected is selected from one or more of the following bacteria species: Bacillus anthraci, Bordetella parapertussis, Bordetella pertussis, Chlamydia pneumoniae, Mycoplasma pneumoniae, Escherichia Coli, Klebsiella pneumoniae, Klebsiella oxytoca, Salmonella, Proteus mirabilis, Citrobacter freundii, Serratia marcescens, Enterococcus faecalis, Enterococcus faecium, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus lugdunensis, and Streptococcus pneumoniae.
  • Bacillus anthraci Bordetella parapertussis, Bordetella pertussis, Chlamydia pneumoniae, Mycoplasma pneumoniae
  • This example describes a particular embodiment of the invention directed to a Point-of- care device for the detection of Candida auris.
  • Each LAMP primer set consists of 3 pairs of primers, that is 6 primers in total: external primers F3 and B3, internal primers FIP and BIP and loop primers FL and BL (Fig. 1A).
  • primer design were: (1) to minimize the sequence mismatches with Candida auris strains from clades I, II, III, and IV; (2) maximize the sequence mismatches with other species of the genus Candida and other phylogenetically close yeast species; (3) meet the melting temperature requirements for isothermal amplification, (4) minimize the formation of secondary structures such as primer-dimers and hairpins; and (5) not cross-react with other viral, prokaryotic or eukaryotic sequences available in the public databases.
  • Table 1 List of LAMP primer sets obtained and their location within the ribosomal region.
  • Candida auris strain B11245 is used as the reference for position.
  • Fig. IB shows the Candida auris TangenDXTM assay disks. Wells in black contained positive controls, wells in grey contain the Candida auris LAMP primers, and wells in white are empty.
  • the CDC recommended approach for screening of Candida auris colonization is using a composite swab of the patient's bilateral axilla and groin. These sites, which are the most common and consistent sites of colonization, are generally swabbed with a nylon-flocked swab (BD ESwab collection and transport system), and the swab introduced into a tube containing ImL of liquid Amies medium. This medium stabilizes the cells and prevent them from growing or lysing until before being delivered to the reference laboratory for testing.
  • BD ESwab collection and transport system nylon-flocked swab
  • This medium stabilizes the cells and prevent them from growing or lysing until before being delivered to the reference laboratory for testing.
  • the TangenDxTM - Candida auris assay will typically include the materials shown in Figure 3.
  • the filtration procedure has an approximate duration of 2 'A minutes and consists of the following steps:
  • This example describes a particular embodiment of the invention directed to the detection of live SARS-CoV-2.
  • the SARS-CoV-2 isolate used for these studies which is known as USA WA 1/ 2020, was isolated from the first documented US case of a traveler from Wuhan, China. 1 SARS-CoV-2 was sourced from the World Reference Center for Emerging Viruses and Arboviruses (WRCEVA). The SARS-COV-2 isolate was cultured in Vero E6 cells per established procedures.
  • Vero E6 cells were plated into a T75 flask with 15 mb infection media (Dulbecco's Modified Eagle's medium supplemented with 5% fetal bovine serum and nonessential amino acids) and incubated in a humidified incubator with 5% CO2. The following day the Vero cells were re-fed with infection media and inoculated with 0.5 ml of virus stock. Cells were incubated for 4 days at which point widespread cytopathic effect (CPE) was apparent. At this point, supernatant was collected and 1 mL aliquots of virus stock frozen at - 70°C.
  • CPE cytopathic effect
  • TCID 50 For determination of TCID 50 an aliquot of virus stock was thawed and TCID 50 determined following established procedures. In brief, 10-fold serial dilutions of virus stock were prepared and plated (8 wells per dilution) in a 96 well plate containing 10,000 Vero E6 cells/well. After 5 days of incubation, each well was scored as positive or negative for CPE and TCID 50 /mL, as determined by the Reed and Muench method. The coronavirus source information and TCID 50 /mL concentration of the neat virus stock prepared by MRIGlobal is summarized in Table 11.
  • the RT-qPCR procedure used the 2019-nCoV RUO Kit from Integrated DNA Technologies, which includes assays for N1, N2 and Rp with premixed primers and probes TaqPathTM 1 -step RT-qPCR Master Mix, CG was sourced from ThermoFisher ⁇ L. Thermal cycling conditions followed those published in the CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel Instructions for Use and are summarized in Table 12.
  • the gBIock standard curve consisted of the following concentrations: 1x101 , 1 xl02, 1x103, and 1 x 104 GC/ ⁇ L.
  • SARS-CoV-2 culture supernatant was diluted in nuclease-free water for testing at the following dilutions: 10-1, 1-0 2, 10-3, 104 , 1-0_5.
  • Master mix was prepared as shown in Table 13.
  • Range finding A preliminary LoD was determined by first testing a range of dilutions (120, 60, 30, 15, 4.5 and 0 copies/ ⁇ L) of SARS-CoV-2 Working Stock #5, diluted in simulated nasal matrix (Table 14). The simulated nasal matrix was made by eluting two negative donor nasopharyngeal swabs in 10mL of Tangen Assay Buffer v.5 (TAB). A 50 ⁇ L sample of SARS-CoV-2 diluted in SNM was added to a fresh, sterile NP swab, then eluted in a fresh, unused vial of 5mL Tangen Assay Buffer.
  • samples were prepared for testing with the CDC EUA RT-qPCR assay reference method.
  • sterile NP sw abs were spiked with 50 ⁇ L of SARS- COV-2 viral dilution and then eluted in 1 mL of viral transport media (VTM).
  • VTM viral transport media
  • 140 ⁇ L of the 1 mL volume was extracted in triplicate using the Qiagen QIAamp DSP Viral RNA Mini kit, with a final elution volume of 140 ⁇ L.
  • a method of detecting a nucleic acid of one or more microorganism in a subject comprising, independent of order, the following steps: a. obtaining an upper respiratory sample from a subject; b. processing the upper respiratory sample in an apparatus to capture and lyse microorganisms from the sample, and obtaining a nucleic acid extract from microorganisms in the upper respiratory sample of a subject; c. selecting one or more target sequence from a microorganism of interest, and selecting one or more nucleic acid amplification primer set that is complementary to at least a portion of a target sequence from a microorganism of interest; d. incubating the target sequence with the one or more nucleic acid amplification primer set in a reaction mixture and performing an amplification reaction; and e. detecting one or more target sequence from a microorganism of interest.
  • step d uses random primers and reagents for the nonselective amplification of nucleic acid from microorganisms in the sample to produce a pre-amplification product.
  • an upper respiratory sample from a subject comprised samples from a nasal pharyngeal swab, a nasal swab, a throat swab, saliva, a nasal aspirate, and any other method suitable to obtain sufficient sample.
  • the amplified template is detected or quantified in real time.
  • the target sequence comprises a SARS-CoV-2 type virus nucleic acid sequence in the nucleocapsid recombinant N2 fragment domain or in the nucleocapsid recombinant N3 fragment domain.
  • the target sequence comprises a SARS-CoV-2 type virus nucleic acid sequence in the nucleocapsid recombinant N2 fragment domain the target sequence comprises a nucleocapsid recombinant N3 fragment domain.
  • the target sequence comprises a SARS-CoV-2 type virus nucleic acid sequence and the primers that are complementary to at least a portion of that target sequence are selected from CTGAGGGAGCCTTGAATACACCAA (SEQ ID NO: 1); CGCCATTGCCAGCCATTCTAGC (SEQ ID NO:2); TCCCTTCTGCGTAGAAGCCTTTTGGC- CCCGCAATCCTGCTAACAATGCT (SEQ ID NO:3); CAGAGGCGGCAGTCAAGCCTCTTC- CCCCTACTGCTGCCTGGAGTT (SEQ ID NO:4); GTTGTTCCTTGAGGAAGTTGTAGCACGA (SEQ ID NO:5); CGTTCCTCATCACGTAGTCGCAACAG (SEQ ID NO:6);
  • ATGGAGAACGCAGTGGGGC (SEQ ID NO:7); TCATTTTACCGTCACCACCACGAA (SEQ ID NO: 8); GCCATGTTGAGTGAGAGCGGTGAACC-GCGATCAAAACAACGTCGGCC (SEQ ID NO:9); AATTCCCTCGAGGACAAGGCGTTCCA-TGGTAGCTCTTCGGTAGTAGCCAA (SEQ ID NO: 10); AGACGCAGTATTATTGGGTAAACCTTGG (SEQ ID NO: 11); and ATTAACACCAATAGCAGTCCAGATGACCA (SEQ ID NO: 12).
  • the target sequence comprises a C. auris nucleic acid sequence and the primers that are complementary to at least a portion of that target sequence are selected from CGGCGAG1TGTAGTCTGGA (SEQ ID NO: 13); TCCATCACTGTACTTGTTCGCT (SEQ ID NO: 14); GGGCCACAGGAAGCACTAGCACAGCAGGCAAGTCCTTTGG (SEQ ID NO: 14).
  • kits for detecting or quantifying a target nucleic acid in a nucleic acid sample comprising a solid phase disc for detecting nucleic acids comprising one or more amplification primer sets and one or more second primer sets; and ii) instructions for use of the disk for a method of detecting a microorganism in a nucleic acid sample from a subject on an apparatus, instrument, or system described herein.
  • a method of detecting a nucleic acid of one or more microorganism in a subject comprising, independent of order, the following steps: a) obtaining a blood or blood fraction sample from a subject; b) processing the blood sample in an apparatus to capture and lyse microorganisms from the sample, and obtaining a nucleic acid extract from microorganisms in the blood sample of a subject; c) selecting one or more target sequence from a microorganism of interest, and selecting one or more nucleic acid amplification primer set that is complementary to at least a portion of a target sequence from a microorganism of interest; d) incubating the target sequence with the one or more nucleic acid amplification primer set in a reaction mixture and performing an amplification reaction; and e) detecting one or more target sequence from a microorganism of interest.
  • the incubation step includes a pre -amplification step before step d) that uses random primers and reagents for the nonselective amplification of nucleic acid from microorganisms in the sample to produce a pre -amplification product.
  • microorganism comprises one or more bacteria species.
  • the one or more bacteria species is selected from Bordetella parapertussis, Bordetella pertussis, Chlamydia pneumoniae, Mycoplasma pneumoniae, Escherichia Coli, Klebsiella pneumoniae, Klebsiella oxytoca, Salmonella, Proteus mirabilis, Citrobacter freundii, Serratia marcescens, Enterococcus faecalis, Enterococcus faecium, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus lugdunensis, and Streptococcus pneumoniae.
  • target nucleic acids comprise pXOl and pXO2 nucleic acid sequences from bacterium B. anthracis.
  • a method according to embodiment 17, wherein a target sequence comprises nucleic acids from genes that confer antimicrobial resistance (AMR) to bacteria.
  • AMR antimicrobial resistance
  • AMR antimicrobial resistance gene
  • any of the terms “comprising”, “consisting essentially of’, and “consisting of’ may be replaced with either of the other two terms in the specification.
  • the terms “comprising”, “including”, containing”, etc. are to be read expansively and without limitation.
  • the methods and processes illustratively described herein suitably may be practiced in differing orders of steps, and that they are not necessarily restricted to the orders of steps indicated herein or in the embodiments. It is also that as used herein and in the appended embodiments, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise.

Abstract

L'invention concerne l'utilisation de technologies d'amplification d'acide nucléique (aussi abrégé NAAT de « Nucleic Acid Amplification Technologies ») pour copier rapidement un fragment spécifique d'un ADN à partir de quelques molécules de départ utilisée pour déterminer la présence dudit ADN dans un échantillon. L'invention est importante pour diverses applications comprenant l'identification d'un agent pathogène dans un échantillon clinique. Les modes de réalisation divulgués décrivent un appareil, un disque, des procédés et un système de détection rapide de micro-organismes tels que des virus pathogènes et des bactéries.
PCT/US2021/045630 2014-11-03 2021-08-12 Procédé, système et appareil de détection WO2022108634A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
PCT/US2021/057146 WO2022108728A1 (fr) 2020-11-23 2021-10-28 Procédé, système et appareil pour une unité de traitement sanguin
PCT/US2021/060581 WO2022109480A1 (fr) 2020-11-23 2021-11-23 Procédé, système et appareil pour tests respiratoires
US17/533,829 US20220081730A1 (en) 2014-11-03 2021-11-23 Method, system and apparatus for respiratory testing

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US202063117434P 2020-11-23 2020-11-23
US202063117446P 2020-11-23 2020-11-23
US202063117442P 2020-11-23 2020-11-23
US63/117,446 2020-11-23
US63/117,434 2020-11-23
US63/117,442 2020-11-23

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US17/400,136 Continuation-In-Part US20220162714A1 (en) 2014-11-03 2021-08-12 Method, system and apparatus for detection

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/533,829 Continuation-In-Part US20220081730A1 (en) 2014-11-03 2021-11-23 Method, system and apparatus for respiratory testing

Publications (1)

Publication Number Publication Date
WO2022108634A1 true WO2022108634A1 (fr) 2022-05-27

Family

ID=81709543

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/045630 WO2022108634A1 (fr) 2014-11-03 2021-08-12 Procédé, système et appareil de détection

Country Status (1)

Country Link
WO (1) WO2022108634A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993009250A1 (fr) * 1991-11-01 1993-05-13 Adelaide Children's Hospital Procede d'amplification en phase solide
CN103789453A (zh) * 2014-02-24 2014-05-14 河南中医学院 一种甲型流感病毒亚型检测微孔板芯片
US20200224260A1 (en) * 2019-01-15 2020-07-16 Tangen Bioscience Inc. Method for suppressing non-specific amplification products in nucleic acid amplification technologies

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993009250A1 (fr) * 1991-11-01 1993-05-13 Adelaide Children's Hospital Procede d'amplification en phase solide
CN103789453A (zh) * 2014-02-24 2014-05-14 河南中医学院 一种甲型流感病毒亚型检测微孔板芯片
US20200224260A1 (en) * 2019-01-15 2020-07-16 Tangen Bioscience Inc. Method for suppressing non-specific amplification products in nucleic acid amplification technologies

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Tangen Biosciences Closes Oversubscribed $12.2M Series B Preferred Stock Financing", TANGEN BIOSCIENCES NEWS, TANGEN BIOSCIENCES, US, 6 August 2020 (2020-08-06), US, pages 1 - 3, XP055934023, Retrieved from the Internet <URL:https://tangenbiosciences.com/2020/08/06/tangen-biosciences-closes-oversubscribed-12-2m-series-b-preferred-stock-financing/> [retrieved on 20220622] *
SOARES RUBEN R. G., AKHTAR AHMAD S., PINTO INÊS F., LAPINS NOA, BARRETT DONAL, SANDH GUSTAF, YIN XIUSHAN, PELECHANO VICENT, RUSSOM: "Point-of-care detection of SARS-CoV-2 in nasopharyngeal swab samples using an integrated smartphone-based centrifugal microfluidic platform", MEDRXIV, 6 November 2020 (2020-11-06), pages 1 - 33, XP055857122, DOI: 10.1101/2020.11.04.20225888 *

Similar Documents

Publication Publication Date Title
US11274351B2 (en) Methods and compositions for detecting bacterial contamination
EP3495507B1 (fr) Amplification et detection directes d&#39;agents pathogènes viraux et bactériens
AU2003276634A1 (en) One step real-time rt pcr kits for the universal detection of organisms in industrial products
JP2016136968A (ja) デングウイルスアッセイ
CN105916998A (zh) 稀少微生物核酸的检测
DK3129499T3 (en) UNIVERSAL CHECK FOR SEQUENCE ASSAYS
Maiti et al. Isothermal amplification‐based assays for rapid and sensitive detection of severe acute respiratory syndrome coronavirus 2: Opportunities and recent developments
US20220162714A1 (en) Method, system and apparatus for detection
WO2022108634A1 (fr) Procédé, système et appareil de détection
CN101415844B (zh) 通过扩增和检测核壳rna序列分析sars冠状病毒
US20120028243A1 (en) Amplification genique statistique pour l&#39;identification sans a priori de micro-organismes par sequencage sans etape de clonage
WO2020154391A1 (fr) Procédés de détection d&#39;acide nucléique et de conception d&#39;amorces
US20120082995A1 (en) Method for quantitative pcr amplification of deoxyribonucleic acids from a sample containing pcr inhibitors
Wilbert Optimization of RT-qPCR protocols to quantify chuA gene expression in Campylobacter jejuni mutants under iron-limited conditions
Chetverin et al. Accurate diagnostics with the use of molecular colonies
CA2262527A1 (fr) Methode pour enlever les inhibiteurs d&#39;amplification des echantillons d&#39;essai

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21895294

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21895294

Country of ref document: EP

Kind code of ref document: A1