WO2022071436A1

WO2022071436A1 - Method for measuring rna capable of detecting biological and physiological processes

Info

Publication number: WO2022071436A1
Application number: PCT/JP2021/035970
Authority: WO
Inventors: 友則木村; 悠介塚本
Original assignee: 国立研究開発法人医薬基盤・健康・栄養研究所
Priority date: 2020-09-30
Filing date: 2021-09-29
Publication date: 2022-04-07
Also published as: JPWO2022071436A1

Abstract

Provided are: a method for detecting the aminoacylation profile of target RNA, particularly tRNA-functional RNA or small RNA, rapidly, with high accuracy, in a simple manner and at low cost; a method for screening for tRNA-functional RNA based on the aminoacylation profile thereof; a pharmaceutical composition for a disease; a gene therapy; a biomarker; and others.　The present invention includes inventions each relied on a method for measuring a single nucleotide difference in a single molecule of target RNA qualitatively or quantitatively, in which the single nucleotide difference is the presence or absence of a nucleotide A in a 3'-terminal sequence, i.e., a CCA-CC pair, in the target RNA, and the method comprises (a-1) providing an RT primer comprising an adapter linked to the 3'-terminal of the target RNA and a sequence complementary to the sequence for the adapter, a specific amplification primer set, and a probe set that targets a single nucleotide difference, (b-1) linking the adapter to the target RNA by the action of an RNA ligase for the adapter to produce a linked product, and forming cDNA using the linked product as a template, and (β) amplifying a target region located on the cDNA and containing the single nucleotide difference by PCR and, at the same time, measuring the single nucleotide difference qualitatively or quantitatively.

Description

Methods for measuring RNA that sense biological and physiological processes

The present invention generally belongs to the fields of molecular biology and biochemistry of RNA, specifically tRNA-functional RNA and small RNA, including tRNA. In particular, the present invention relates to a simple method for measuring tRNA-functional RNA and small RNA, and more specifically to tRNA-functional RNA and small RNA, particularly related to diagnostic, pharmaceutical and therapeutic applications related to tRNA. ..

The central dogma of molecular biology is a continuous flow of information from genes to proteins (Non-Patent Document 1). Protein synthesis is carried out by translating into transfer RNA (tRNA) having an anticodon complementary to the codon of messenger RNA (mRNA) on the ribosome to the amino acid corresponding to that codon. The specificity of this tRNA is the source of the genetic code (Non-Patent Document 2), and the genetic code consists of 61 sense triplet codons encoding 20 amino acids.

TRNA is an RNA biochemically identified as an amino acid receptor (Non-Patent Document 3). At one end of the tRNA structure is an anticodon loop, which specifically pairs with the mRNA's codon. At the other end is the 3'end ribonucleotide alignment "CCA" conserved between tRNAs, called the acceptor stem. Aminoacyl-tRNA synthetase (aaRS) binds (charges) a codon-specific amino acid to this "CCA" to generate aminoacyl-tRNAed tRNA (charged tRNA) (Non-Patent Document 4). Amino acids aminoacylated to tRNA are integrated into the protein during translation, and at the same time tRNA is deaminoacylated because it reaminoacylates the next amino acid. Such vibrational fluctuations of aminoacylation and deaminoacylation of tRNA provide interesting implications for the boundary between molecular biology and biochemistry.

Surprisingly, the eukaryotic genome carries a large number of tRNA genes, and so far, more than 500 tRNA genes have been identified in the human genome (Non-Patent Document 5). This diversity of tRNAs derives from variations of "isoacceptors" and "isodecoders". The tRNA isoacceptor has different anticodons that aminoacylate the same amino acid. On the other hand, the "isodecoder" of tRNA shares the same anticodon, but the other sequences are different (Non-Patent Document 6). This multifaceted aspect of tRNA, the genomic variation and the vibrational variation of aminoacylation described above, is the origin of the profound world of tRNA.

The aminoacyllation rate of tRNA is the ratio of aminoacylated tRNA to the total amount of tRNA that aminoacylates amino acids (aminoacylated tRNA) and tRNA that is not aminoacylated (non-aminoacylated tRNA) (Non-Patent Document 7). It has been reported that the aminoacylation rate of tRNA is closely related to some biological phenomena and diseases (Non-Patent Document 8; Non-Patent Document 9). The aminoacylation rate of tRNA varies in response to amino acid starvation (Non-Patent Document 10; Non-Patent Document 11), growth conditions (Non-Patent Document 12), and external stress (Non-Patent Document 13). It has been proposed to change the aminoacylation rate of tRNA and affect the translation efficiency of proteins (Non-Patent Document 14; Non-Patent Document 15). Disease-related mutations in tRNA and aminoacyl-tRNA synthesizers are widely known (Non-Patent Document 16; Non-Patent Document 17), and the aminoacylation rate of tRNA is associated with aging and cell activity (Non-Patent Document 16; Non-Patent Document 17). Non-Patent Document 18; Non-Patent Document 19; Non-Patent Document 20).

Several methods have been developed for measuring the aminoacylation rate of tRNA (Non-Patent Document 10; Non-Patent Document 21; Non-Patent Document 22; Non-Patent Document 23). Acid-urea polyacrylamide gel electrophoresis followed by Northern blot hybridization is commonly used to measure the aminoacyllation rate of tRNA at the isoacceptor level (Non-Patent Document 24). Recently, a high-throughput method for detecting the tRNA aminoacylation rate has been developed based on either a microarray (Non-Patent Document 10) or next-generation sequencing (Non-Patent Document 21). By using a chemical step to remove the 3'-terminal adenine residue of the non-aminoacylated tRNA and an enzymatic step to remove the tRNA modification, the tRNA is sequenced and the aminoacylation rate of the tRNA is comprehensive. Can be measured (Non-Patent Document 21). On the other hand, convenient quantitative PCR (qPCR) -based methods are preferred for measuring the aminoacylation rate of individual tRNAs, while currently available qPCR-based methods allow only relative quantification. (Non-Patent Document 23).

Many patent documents describe a method for amplifying or measuring RNA, and various primers and probes used in the method (for example,

Patent Documents

1, 2 and 3). However, no patent literature has been found that is oriented towards aminoacylation of RNA, especially tRNA.

Special Table 2015-530113 Gazette WO2014 / 157377 Gazette Special Table 2014-512834 Gazette

As described above, various methods for detecting the aminoacylation profile of tRNA-functional RNA represented by tRNA have been proposed, but all of them are complicated, time-consuming, and accurate. It has some drawbacks such as inferiority and too high cost. Therefore, a method capable of detecting the aminoacylation profile of RNA, particularly tRNA-functional RNA or small RNA, with high accuracy, rapidity, convenience and low cost is still desired.

In the present invention, by finding a method capable of easily measuring tRNA having a higher-order structure and having a complicated modification, and applying it to a simple search for the molecular biology and biochemical aspects of tRNA, the present invention is made. Completed the invention.
In the present invention, a simplified sequencing method for determining the aminoacylization rate of tRNA (hereinafter referred to as "simplified aminoacyl-tRNAseq method") was developed, and the state of tRNA aminoacylation in cells was verified. In naturally established human diploid fibroblasts, the aminoacylation level of tRNA ^Gln (tRNA that aminoacylates Gln) is significantly reduced in response to amino acid starvation, unlike tRNA that aminoacylates other amino acids. I found out to do. Next, in order to easily investigate the dynamics of specific tRNAs, we developed a PCR method (hereinafter referred to as "i-tRAP method") that can measure individual aminoacyl-tRNAs. The i-tRAP method revealed nutrient-sensitive vibrational variability of tRNAaminoacylation and aging-related inhibition of tRNAaminoacylation. Our method highlights a dynamic and profound tRNA aminoacylation cycle that predicts cell condition and aging.

Therefore, the present invention includes the following aspects.
<I-tRAP method>
[1]
In a method of qualitatively or quantitatively measuring the difference of a single nucleotide in one target RNA, here the difference of a single nucleotide is the 3'end sequence of the target RNA: the presence or absence of nucleotide A in CCA vs. CC. It ’s a way of being,
α) Create cDNA for target RNA and
β) A method of amplifying a target region containing a single nucleotide difference on the cDNA by PCR and simultaneously measuring the single nucleotide difference qualitatively or quantitatively.
[2]
Step α),
a-1) Adapter linked to the 3'end of the target RNA, RT primer containing a sequence complementary to the sequence of the adapter, one primer having a sequence specific to the target RNA, and specific to the RT primer. Prepare an amplification primer set consisting of the other primer having a sequence, and a probe set targeting the difference of a single nucleotide.
b-1) RNA ligase for the adapter is used to ligate the adapter to the target RNA, and the formed ligation product is used as a template to prepare cDNA.
a-2) An arbitrary RNA adapter and a DNA primer having a sequence complementary to the RNA adapter and having the 3'end protruding by only one base were prepared and annealed to the RNA adapter. A hybrid primer, an amplification primer set consisting of one primer having a sequence specific to the target RNA and the other primer having a sequence specific to the RT primer, and a probe set targeting the difference of a single nucleotide. Prepare each and
b-2) Anneal the hybrid primer to the 3'end of the target RNA and generate cDNA by reverse transcriptase with template switching activity.
The method according to [1], including the above.
[3]
The probe set that targets the difference between single nucleotides in step a-1) is a fluorescently labeled probe set that recognizes the difference between single nucleotides, and the fluorescence emitted during amplification in step β). The method according to [2], wherein the difference between single nucleotides is measured qualitatively or quantitatively using the intensity as an index.
[4]
The method according to [1] or [2], wherein the target RNA is a tRNA-functional RNA, preferably a tRNA, or a tRF or tRNA half having a 3'end of the tRNA.
[5]
tRNA-The method according to [4], wherein the functional RNA is tRNA.
[6]
Further, the following γ) step:
γ) Calculate the ratio of the quantitative value of the target RNA having CCA to the total amount of the quantitative value of the target RNA having CCA and the quantitative value of the target RNA having CC.
The method according to any one of [1] to [5], which comprises.
[7]
[6] A method for measuring the aminoacylation rate of one target RNA by the method described.

<The kit>
[8]
In the method of any of claims 1-7, wherein the single nucleotide difference in one target RNA is measured qualitatively or quantitatively, where the single nucleotide difference is the 3'end sequence of the target RNA. : An assay kit used for the method in which nucleotide A is present or absent in CCA vs. CC.
A) Adapter that connects to the 3'end of the target RNA,
B) RT primer containing a sequence complementary to the sequence of the adapter,
C) Amplification primer set consisting of one primer having a sequence specific to the target RNA and the other primer having a sequence specific to the RT primer,
D) Probe sets that target single nucleotide differences,
E) RNA ligase for the adapter, and f) demethylase, if necessary,
Including, kit; or service) any RNA adapter,
B) A DNA primer containing a sequence complementary to the adapter and having the 3'end protruding only one base from the RNA adapter.
S) An amplification primer set consisting of one primer having a sequence specific to the target RNA and the other primer having a sequence specific to the DNA primer.
C) Probe sets that target single nucleotide differences,
S) Reverse transcriptase with template switching activity, and Ta) Demethylase, if necessary,
Including, kit.

<Simplified aminoacyl-tRNAseq method>
[9]
tRNA-A method for comprehensively measuring the base sequence, expression level, and aminoacylation rate of functional RNA.
a-10) TRNA-functional RNA extracted from biological specimens is treated to remove terminal bases in non-aminoacylated RNA (non-aminoacylated RNA), while aminoacylated RNA (aminoacylated). By removing amino acids from RNA), non-aminoacylated RNA and aminoacylated RNA are prepared, respectively.
b-10) Connect the adapter to the 3'-end and 5'-end of both obtained RNAs.
c-10) Reverse transcription is performed using the produced linked RNA as a template.
d-10) Amplify the obtained cDNA to create a cDNA library,
e-10) Sequencing each cDNA in the library to obtain sequence data,
tRNA-A method for measuring the base sequence, expression level and aminoacylation rate of functional RNA.
[10]
The method according to [9], wherein in step a-10), the treatment of RNA is periodic acid oxidation, β-desorption and terminal repair for non-aminoacylated RNA and weak alkaline treatment for aminoacylated RNA.
[11]
The method according to [9] or [10], wherein the RNA extracted from the biological sample is subjected to size fractionation, RNA of 20 bases to 150 bases is extracted, and the following steps are performed.
[12]
The method according to [11], wherein the 20-base-150-base RNA is a tRF or tRNA half having a tRNA or a 3'end of the tRNA.
[13]
In measuring the aminoacyllation rate of tRNA-functional RNA, the ratio of the expression level of aminoacyl-tylated RNA to the total expression level of aminoacyl-tylated RNA and non-aminoacylated RNA is calculated from [9] to [12]. ] Any of the methods described.

<The kit>
[14]
An assay kit for the method according to any one of [11] to [13], which comprehensively measures the base sequence, expression level, and aminoacylation rate of tRNA-functional RNA.
A-10) tRNA-adapter that connects to the 3'-end and 5'-end of functional RNA,
B-10) RT primer containing a sequence complementary to the sequence of the adapter,
C-10) A kit containing RNA ligase for the adapter and d-10) demethylase.

<Screening method>
[15]
A method for screening substances that vary the aminoacylation rate of tRNA.
a-20) Add the test substance to the cells and add
b-20) Measure the aminoacylation rate of tRNA in the cells, and
c-20) When the measured value is changed compared to the case where the aminoacyllation rate is measured in the absence of the test substance, the test substance is a substance that changes the aminoacylation rate of tRNA. How to determine that there is.
[16]
The method according to [15], wherein the aminoacylation rate is measured by the method according to any one of [1] to [7] and [9] to [13].
[17]
A method for screening substances that vary the aminoacylation rate of tRNA.
a-30) Administer the test substance to the animal and
b-30) Collect cells of a predetermined organ from the animal and collect them.
c-30) Measure the aminoacylation rate of tRNA in the cells, and
c-30) When the measured value is changed compared to the case where the aminoacyllation rate is measured in the absence of the test substance, the test substance is a substance that changes the aminoacylation rate of tRNA. How to determine that there is.
[18]
Prescribed organs include blood, urine, spinal fluid, saliva, tears, semen, brain, heart, kidneys, liver, lungs, spleen, blood vessels, blood cells, muscles, fat, skin, pancreas, intestines, endocrine organs, nerves, The method according to [17], which is a sensory organ.
[19]
The method according to any one of [15] to [18], wherein the aminoacylation rate is measured by the method according to any one of [1] to [7] and [9] to [13].

<Pharmaceutical composition>
[20]
A pharmaceutical composition for adjusting the effect on biological and physiological processes in a subject, which comprises a substance that varies the aminoacylation rate of tRNA.
[21]
The pharmaceutical composition according to [20], wherein the substance that changes the aminoacylation rate of tRNA is a substance screened by the method according to any one of [15] to [19].
[22]
The substance that fluctuates the aminoacylation rate of tRNA is an aminoacylation rate-increasing substance selected from amino acids and protein synthesis inhibitors (eg, cyclohexamide), or aminoacylasease inhibitors (eg, mupyrosin, borelidine, etc.). Selected from among halofuginone, neomycin, pentamidine, purplomycin), autophagy lithosome inhibitors (eg, chlorokin), proteasome inhibitors (eg MG132), and inhibitors of integrated stress response (eg ISRIB). The pharmaceutical composition according to [20] or [21], which is a substance for reducing the aminoacylation rate.
[23]
A pharmaceutical composition comprising a tRNA inhibitor for adjusting the effect on a biological and physiological process in a subject.
[24]
23. The pharmaceutical composition according to [23], wherein the inhibitor of tRNA is one or more selected from the group consisting of siRNA, shRNA, miRNA, antisense and ribozyme.
[25]
The pharmaceutical composition according to any one of [20] to [24] for treating cancer, age-related diseases, and nutritional status.
[26]
A pharmaceutical composition containing a specific tRNA or an analog thereof for reducing the effect on biological and physiological processes in a subject.
[27]
The pharmaceutical composition according to [26] for treating mitochondrial disease.

<Judgment method>
[28]
A method for determining the presence or absence of effects on biological and physiological processes in a subject.
a-40) Step of measuring the aminoacylation rate (test aminoacylation rate) of tRNA in the cells of the subject,
b-40) A step of comparing the test aminoacylation rate with the aminoacyllation rate of tRNA of the reference cell (control aminoacylation rate), and
c-40) When the test aminoacylation rate fluctuates compared to the control aminoacylation rate, the subject has an effect on the biological and physiological processes in the subject. How to judge.
[29]
28. The method of [28], wherein the effect on a biological and physiological process in a subject is one or more events selected from among cellular activity, nutritional status, body, psychiatry and pathology.
[30]
Events include mitochondrial disease, age-related disease, lifestyle disease, mental illness, intractable disease, hereditary disease, life course-related disease, gastrointestinal disease, cancer, cardiovascular disease, kidney disease and neurological disease. The method according to [29], which is one or more selected.

<Gene therapy>
[31]
A method of reducing the aminoacylation rate of a corresponding tRNA by knocking down a nucleic acid molecule encoding a particular aminoacyl-tRNA synthetase, thereby reducing its effect on biological and physiological processes in the subject.
[32]
31. The method of [31], wherein the effect on a biological and physiological process in a subject is one or more events selected from among cellular activity, nutritional status, body, psychiatry and pathology.
[33]
Events include mitochondrial disease, age-related disease, lifestyle disease, mental illness, intractable disease, hereditary disease, life course-related disease, gastrointestinal disease, cancer, cardiovascular disease, kidney disease and neurological disease. The method according to [32], which is one or more selected.
[34]
The method according to any of [31] to [33], wherein the specific aminoacyl-tRNA synthetase is a glutaminyl tRNA synthetase.

<Biomarkers, etc.>
[35]
One or more selected from tRNA ^Leu , mt-tRNA ^His , tRNA ^Ser , tRNA ^Asn , tRNA ^Phe , tRNA ^Thr , tRNA ^Ile , tRNA ^Arg , tRNA ^Gln , and mt-tRNA ^Val . A biomarker for determining the effect on biological and physiological processes in the examiner.
[36]
tRNA ^Leu -CAG, mt-tRNA ^His -CAC, tRNA ^Ser -CGA, tRNA ^Asn -GTT, tRNA ^Phe -GAA, tRNA ^Ser -GCT, tRNA ^Thr -TGT, tRNA ^Thr -CGT, tRNA ^Ile -TAT, tRNA ^Arg- Determine the effect on biological and physiological processes in a subject, one or more selected from TCT, tRNA ^Gln -CTG, tRNA ^Gln -TTG, and mt-tRNA ^Val -GUA. The biomarker according to [35].
[37]
Effects on biological and physiological processes in a subject are events associated with one or more selected from cellular activity, nutritional status, physical, mental and pathological conditions, [35] or [36]. The biomarker described.
[38]
Events include mitochondrial disease, age-related disease, lifestyle disease, mental illness, intractable disease, hereditary disease, life course-related disease, gastrointestinal disease, cancer, cardiovascular disease, kidney disease and neurological disease. The biomarker according to any one of [35] to [37], which is one or more selected.
[39]
Biomarkers of tRNA ^Gln and tRNA ^Glu for determining nutritional status, body, health and aging.
[40]
The biomarker according to [39], wherein tRNA ^Gln is tRNA ^Gln -CTG.

According to the present invention, the simplified aminoacyl-tRNAseq method or the i-tRAP method of the present invention makes it possible to detect the aminoacylation profile of all tRNAs with greatly improved resolution.

FIG. 1 shows the reaction scheme of pretreatment before sequencing tRNA. After a series of chemical and enzymatic treatments, aminoacylated and non-aminoacylated tRNAs are distinguished by 3'end CCA (3'CCA-tRNA) and CC (3'CC-tRNA), respectively. PNK: Polynucleotide Kinase-3'-Phosphatase. FIG. 2 is an experimental scheme for culturing TIG-1 cells under amino acid starvation or amino acid supplementation. FIG. 3 is a plot showing the aminoacyllation rate of individual tRNAs in an amino acid starved state. The tRNA aminoacylation rate on the horizontal axis is the SD value (mean = 81.8%, SD = 13.4) from the average of the tRNA aminoacylation rates of all tRNAs under amino acid starvation (Fig. 4) for each tRNA. And plot. Ala-AGC at the top of the vertical axis means tRNA ^Ala -AGC derived from nuclear DNA, and mtAla-GCA means tRNA ^Ala -GCA derived from mitochondrial DNA. Others mean individual tRNAs as well. The average of n = 3 is plotted. n means the number of samples in one sample consisting of tens of thousands of cells. FIG. 4 is a graph showing the aminoacylation rate of tRNA in cells cultured in amino acid starvation and amino acid replacement medium, measured according to the scheme of FIG. 2 (n = 3). The data are shown as SD values from the average of all tRNA aminoacylation rates (mean = 81.8, SD = 13.4). The data are mean ± SE. FIG. 5 is a plot showing the aminoacylation rate of tRNA under amino acid supplementation (black dot, n = 3) or amino acid starvation state (ash dot, n = 3). Here, as shown in FIG. 2, it is the result of plotting first in the starvation state and then in the replenishment state. The tRNA aminoacylation rate (%) is the ratio of the readings aligned to the 3'end CCA to the sum of the readings aligned to the 3'end CCA and the 3'end CC. n means the number of samples in one sample consisting of tens of thousands of cells.

FIG. 6 is a plot showing the overall aminoacylation rate of nuclei and mitochondrial DNA-derived tRNAs in cells cultured in amino acid supplement medium. Average ± SE (n = 3). FIG. 7 is a graph showing the aminoacyllation rate of amino acid supplemented (black) or amino acid starved (ash) states in tRNA derived from nuclear and mitochondrial DNA (n = 3). The data are shown as SD values from the average of all tRNA aminoacylation rates (mean = 80.7, SD = 10.6). The data are mean ± SE. FIG. 8A is a plot showing the aminoacylation rates of individual tRNAs based on homologous amino acids under amino acid supplementation (black spots) or amino acid starvation (ash spots) (n = 3). The data are mean ± SE. Individual plots show tRNA isoacceptors for each homologous amino acid. The tRNA aminoacylation rate (%) is the ratio of the readings aligned to the 3'end CCA to the sum of the readings aligned to the 3'end CCA and the 3'end CC. 8B and 8C are bar graphs showing tRNAs showing statistically significant differences in the aminoacylation rates of individual tRNAs based on their homologous amino acids in amino acid starvation (dark gray) or amino acid supplementation (light gray) conditions. (N = 3). FIG. 8B shows a marked decrease in the aminoacylation ratio in the amino acid supplemented state with respect to amino acid starvation, and FIG. 8C shows a marked increase in the aminoacylation ratio in the amino acid supplemented state with respect to amino acid starvation. The data are mean ± SE. *: P <0.05, t-test. FIG. 9 is a plot showing the change in tRNA aminoacylation rate when amino acid supplementation is performed for starvation (n = 3). The SD value from the average change of tRNA aminoacylation is shown (mean = 1.00, SD = 0.18). tRNA ^Gln -CTG was 5SD above average. n = 3. The data is mean ± SE.

FIG. 10 is a schematic diagram showing a scheme for quantifying the tRNA aminoacylation rate based on a method called the i-tRAP method based on qPCR. The pretreated tRNA as described in FIG. 1 is ligated with an adapter, reverse transcribed, and then performed with two probe-based qPCR methods. Here, the fluorescent signal from VIC represents the amount of 3'CCA-tRNA and the signal from FAM represents the amount of 3'CC-tRNA. FIG. 11A is a graph showing the aminoacylation rates of the two tRNA ^Gln isoacceptors under amino acid starvation (black) and supplementation conditions (gray) (n = 3). The numbers on the horizontal axis indicate the type of isodecoder. The data are mean ± SE. nd: Not detected. FIG. 11B shows the ratio of reading counts of the tRNA ^Gln isoacceptor. The numbers indicate the type of isodecoder. The black part shows the Iso Decoder # 1 of interest. FIG. 11C shows the result of aligning each of the tRNA ^Gln isodecoders. The black part represents the nucleotide that is the same as Gln-CTG-1 in the uppermost row. The wavy line between Gln-CTG-1 and Gln-CTG-2 shows the primer sequence used in the i-tRAP method, and the dotted line shows the partial sequence of the probe in the i-tRAP method. The line indicates an anticodon nucleotide. FIG. 12A is a graph showing the aminoacylation rates of the three tRNA ^Gly isoacceptors under amino acid starvation (black) and supplementation conditions (gray) (n = 3). The numbers on the horizontal axis indicate the type of isodecoder. The data are mean ± SE. nd: Not detected. FIG. 12B is the ratio of the reading count of the tRNA ^Gly isoacceptor. The numbers indicate the type of isodecoder. The black part shows the Iso Decoder # 1 of interest. FIG. 12C shows the result of aligning each of the tRNA ^Gly isodecoders. The black part represents the nucleotide that is the same as Gly-GCC-1 in the uppermost row. The wavy line between Gly-GCC-1 and Gly-GCC-2 shows the primer sequence used for the i-tRAP method, and the dotted line shows the partial sequence of the probe for the i-tRAP method. The line indicates an anticodon nucleotide. FIG. 13A is a graph showing a real-time plot of the i-tRAP method using a synthetic DNA template containing a 3'CCA-tRNA ^Gln -CTG sequence. FIG. 13B is a graph showing a real-time plot of the i-tRAP method using a synthetic DNA template containing a 3'CC-tRNA ^Gln -CTG sequence. In both FIGS. 13A and 13B, the black line shows the VIC signal from the CCA probe and the gray line shows the FAM signal from the CC probe. FIG. 14A is a graph showing a real-time plot of the i-tRAP method using a synthetic DNA template containing a 3'CCA-tRNA ^Gly -GCC sequence. FIG. 14B is a graph showing a real-time plot of i-tRAP using a synthetic DNA template containing a 3'CC-tRNA ^Gly -GCC sequence. In both FIGS. 14A and 14B, the black line shows the VIC signal from the CCA probe and the gray line shows the FAM signal from the CC probe.

FIG. 15 is a graph showing a standard curve of ΔCt values obtained from VIC and FAM signals for the 3'CCA-tRNA ratio of tRNA ^Gln -CTG. DNA templates containing 3'CCA-tRNA and 3'CC-tRNA sequences in several proportions were mixed and used. FIG. 16 is a graph showing a standard curve of ΔCt values obtained from VIC and FAM signals for the 3'CCA-tRNA ratio of tRNA ^Gly -GCC. DNA templates containing 3'CCA-tRNA and 3'CC-tRNA sequences in several proportions were mixed and used. FIG. 17 is a standard curve of the ΔCt values of VIC and FAM for the ratio of tRNA ^Gln -CTG to 3'CCA with different template amounts. The synthesized DNA fragment was used as a template. FIG. 18A is a graph showing the effect of alkali treatment on the aminoacylation rate of tRNA ^Gln -CTG. FIG. 18B is a graph showing the effect of alkali treatment on the aminoacylation rate of tRNAGly-GCC. In both FIGS. 18A and 18B, tRNA extracted from HEK293 cells was treated with 150 mM Tris-HCl, pH 9.0, 37 ° C. for 30 minutes. n = 4. Data: Average ± SE. *: P <0.05, t-test. FIG. 19A is a graph showing the effect of amino acid deficiency on the aminoacylation rate of tRNA ^Gln -CTG. FIG. 19B is a graph showing the effect of amino acid deficiency on the aminoacylation rate of tRNAGly-GCC. In both FIGS. 19A and 19B, TIG-1 cells cultured in an amino acid-free medium and tRNA extracted from the cells exchanged for the amino acid-containing medium were incubated for 1 hour. n = 4. Data: Average ± SE. *: P <0.05, t-test; ns, not significant.

FIG. 20 shows an experimental scheme for obtaining the results of aminoacylation rate of tRNA ^Gln -CTG after amino acid deficiency (FIG. 21). TIG-1 cells cultured in an amino acid-rich medium were starved for amino acids, and RNA was extracted at a specified time after starvation. FIG. 21 is a graph showing the aminoacylation rate of tRNA ^Gln -CTG after amino acid deficiency. n = 5; ANOVA with Bonferroni's post-test. *: P <0.05 for 0 hours. Statistical analysis was performed in comparison with the aminoacylation rate at 0 hours. FIG. 22 is a graph showing the expression of glutaminyl tRNA synthesizer (QARS) after amino acid deficiency. n = 5; ANOVA with Bonferroni's post-test. *: P <0.05 for 0 hours. Statistical analysis was performed in comparison with the expression level at 0 hours.

FIG. 23 shows an siRNA experimental scheme to obtain results for QARS expression (FIG. 24) and aminoacylation rate of tRNA ^Gln -CTG (FIG. 25). TIG-1 cells cultured in amino acid-rich medium were transfected with the indicated siRNA and cultured for an additional 2 days. FIG. 24 is a graph showing the expression level of QARS. Mean ± SE (n = 4), *: P <0.05, t-test. FIG. 25 is a graph showing the aminoacylation rate of tRNA ^Gln -CTG. Mean ± SE (n = 4), *: P <0.05, t-test. FIG. 26 shows an experimental scheme for obtaining the results of aminoacylation rates of tRNA ^Gln -CTG cultured with CHX (FIG. 27). TIG-1 cells were cultured in amino acid-free medium in the presence of chlorhexidine (CHX) for 6 hours. FIG. 27 is a graph showing the aminoacylation rate of tRNA ^Gln -CTG cultured with CHX. Mean ± SE (n = 4), *: P <0.05, t-test. FIG. 28 shows an experimental scheme for obtaining aminoacylation rates of tRNA ^Gln -CTG (FIG. 29) and QARS (FIG. 30) in young and aged TIG-1 cells. RNA was prepared 0, 3, 6, 9 and 15 hours after amino acid starvation for young and old TIG-1 cells cultured in amino acid-free medium. FIG. 29 is a graph showing the aminoacylation rate of tRNA ^Gln -CTG in young and old TIG-1 cells. Mean ± SE (n = 5), *: P <0.05, 2-factor ANOVA posterior Bonferroni. FIG. 30 is a graph showing quantitative RT-PCR analysis of QARS in young and aged TIG-1 cells of amino acid starvation. ATP5F1 was used as a reference. Mean ± SE (n = 5), *: P <0.05, 2 factor ANOVA ex post Bonferroni.

FIG. 31A shows the intracellular amino acid concentrations in TIG-1 cells before amino acid starvation and in amino acid starvation for 3, 6 and 9 hours under the conditions of the experimental scheme shown in FIG. 20 by high performance liquid chromatography (HPLC). It is a graph which shows the result. It is shown by the amino acid concentration (nmol) per protein unit amount (mg) of the cell extract. n = 3; ANOVA with Bonferroni's post-test. *: P <0.05 for 0 hours. Statistical analysis was performed in comparison with the intracellular amino acid concentration at 0 hours. FIG. 31B shows the intracellular amino acid concentration in TIG-1 cells measured by high performance liquid chromatography (HPLC) based on the intracellular amino acid concentration before amino acid starvation under the conditions of the experimental scheme shown in FIG. 20 (0 o'clock, relative). Concentration: 1) is a graph showing the relative concentration of intracellular amino acid concentration during amino acid starvation for 3, 6 and 9 hours. FIG. 32A is the result of high performance liquid chromatography (HPLC) measurement of the intracellular amino acid concentration in TIG-1 cells cultured with CHX under the conditions of the experimental scheme shown in FIG. 26. It is shown by the amino acid concentration (nmol) per protein unit amount (mg) of the cell extract. n = 3; ANOVA with Bonferroni's post-test. *: P <0.05 for 0 hours. Statistical analysis was performed in comparison with the intracellular amino acid concentration at 0 hours. FIG. 32B shows the intracellular amino acid concentration in TIG-1 cells cultured with CHX under the conditions of the experimental scheme shown in FIG. 26, based on the intracellular amino acid concentration cultured by adding DMSO instead of CHX (DMSO, relative concentration). : 1.0) is a graph showing the relative concentration of intracellular amino acid concentration in the amino acid starvation state for 6 hours. FIG. 33A is a graph showing the results of measuring the intracellular amino acid concentration in TIG-1 cells cultured with chloroquin (CQ) by high performance liquid chromatography (HPLC). It is shown by the amino acid concentration (nmol) per cell unit amount (mg). n = 3; t-test. *: P <0.05 for 0 hours. Statistical analysis was performed in comparison with the intracellular amino acid concentration of the cells treated with solvent (PBS). FIG. 33B shows the intracellular amino acid concentration in TIG-1 cells cultured with chloroquin (CQ) based on the intracellular amino acid concentration cultured by adding PBS to the medium instead of CQ (PBS, relative concentration: 1.0). It is a graph which shows the relative concentration of the intracellular amino acid concentration at the time of the amino acid starvation state for 4 hours. FIG. 33C is a graph showing the aminoacylation rate of tRNA ^Gln -CTG in TIG-1 cells cultured with chloroquine (CQ). Mean ± SE (n = 4), *: P <0.05, t-test. Statistical analysis was performed in comparison with the intracellular amino acid concentration of the cells treated with solvent (PBS).

Hereinafter, the present invention will be described with reference to embodiments illustrated together with preferred methods and materials that can be used in carrying out the present invention, but the scope of the present invention is not limited to these descriptions. Unless otherwise noted, the technical and scientific terms used herein have the same meaning as would be commonly understood by anyone with ordinary knowledge in the field of technology to which the invention belongs. There is.

<I-tRAP method>
The present invention is, in one form, a method of qualitatively or quantitatively measuring the difference of a single nucleotide in one target RNA, where the difference of a single nucleotide is the 3'end sequence of the target RNA: CCA. A method in which nucleotide A is present or absent in anti-CC.
α) Create cDNA for target RNA and
β) The present invention relates to a method of amplifying a target region containing a single nucleotide difference on the cDNA by PCR and simultaneously measuring the single nucleotide difference qualitatively or quantitatively.

In the present invention, the "target RNA" to be measured may be RNA existing in nature or artificially synthesized RNA. Typically, it is an RNA of 20 to 150 bases (nt, nucleotide length), and specifically, it is an RNA of 20 to 80 bases. The "target RNA" is preferably tRNA-functional RNA, where "tRNA-functional RNA" is tRNA, or in the same manner as tRNA, its 3'end is aminoacylated (charged) or deaminoacylated. It means an RNA-like molecule that is converted (decharged), a portion thereof, or a derivative thereof. Specifically, such "RNA-like molecule or a portion thereof or a derivative thereof" is a microRNA derived from tRNA, for example, tRF or tRNA half having a 3'end of tRNA (Front. Genet., 11 June 2014 | https: // Doi.org/10.3389/fgene.2014.00171 tRNAs as regulators of biological processes), and RNA having tRNA-like activity, for example, RNA synthetic products having tRNA-like activity having a 3'end of tRNA. Further, the molecule is not limited to a molecule having a total length of RNA, and may be a partially modified RNA, or may be a partially modified RNA or an RNA which is a DNA or an artificial nucleic acid. For the purpose of clinical diagnosis, it is preferable to use an artificially extracted natural RNA existing in the living body as a “target RNA”. Natural RNA existing in the living body is not limited to these, but for example, transfer RNA (tRNA, translocated RNA), mtRNA (mitomitrimal tRNA), messenger RNA (mRNA), ribosome RNA (rRNA), nuclei. Examples thereof include small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), and small interfering RNA (siRNA).

In the present invention, the "target RNA" is preferably "small RNA". The small RNA is a single-stranded RNA having a base length of about 200 bases or less, preferably 100 bases, and more preferably 80 bases or less. The small RNA may or may not be a functional RNA such as, for example, tRNA, small nuclear RNA, small nucleolar RNA, microRNA, or small interfering RNA.

In the present invention, "difference of a single nucleotide in one target RNA" means the presence or absence of nucleotide A in the 3'end sequence of one target RNA: CCA vs. CC. As described above, the target RNA is preferably tRNA, a microRNA derived from tRNA, for example, tRF or tRNA half-small RNA having a 3'end of tRNA, and more preferably tRNA. At one end of the tRNA structure is the 3'end ribonucleotide alignment "CCA" that is conserved between tRNAs, which is codon-specific bound (charged) by aminoacyl-tRNA synthetase (aaRS). It is the 3'end portion of the tRNA that gives the aminoacylated tRNA (charged tRNA). On the other hand, RNA that is not aminoacylated, that is, corresponds to a state in which amino acids are not bound, undergoes a series of chemical and enzymatic treatments such as periodic acid oxidation, β desorption, and terminal repair described in FIG. 1A. When it is received, its terminal base "A" is removed and becomes "CC". The presence or absence of nucleotide A in this "CCA" and "CC" is the "difference of a single nucleotide in one target RNA" in the present invention. Here, the significance of the "difference of a single nucleotide in one target RNA" in the present invention is that in one tRNA, a tRNA in which amino acids are aminoacylated (aminoacylated tRNA) and a tRNA in which amino acids are not aminoacylated (non-aminoacylated tRNA) are used. ) Is used for measuring the "aminoacylation rate of tRNA", which is the ratio of aminoacylated tRNA to the total amount. The "aminoacylation rate of tRNA" is also referred to as "charging rate of tRNA" or "charging rate of tRNA". It has been reported that "tRNA represented by tRNA-aminoacylation rate of functional RNA" is closely related to some biological phenomena and diseases. See literature below:

1. Gong, S. et al .; Overexpression of mitochondrial histidyl-tRNA synthetase restores mitochondrial dysfunction caused by a deafness-associated tRNA (His) mutation.) J Biol Chem 295, 940-954 (2020).
2. Loayza-Puch, F. et al .; Tumor-specific proline vulnerability uncovered by differential ribosome codon reading. Nature 530, 490-494 ( 2016).
3. Zhou, Y., Goodenbour, J.M., Godley, L.A., Wickrema, A. & Pan, T .; High levels of tRNA abundance in multiple myeloma and changes in tRNA charge (aminoacylation) due to bortezomib (High) levels of tRNA abundance and alteration of tRNA charging by bortezomib in multiple myeloma.) Biochemical and Biophysical Research Communications 385, 160-164 (2009).
4. Ho, J. M., Bakkalbasi, E., Soll, D. & Miller, C. A .; Pharmaceutical tRNA aminoacylation. RNA Biol 15, 667-677 (2018).
5. Bock, A., Faiman, L. E. & Neidhardt, F. C .; Biochemical and genetic characterization of a mutant of Escherichia coli with a temperature-sensitive valyl ribonucleic acid synthetase.) J Bacteriol 92, 1076-1082 (1966).
6. Kwon, N.H., Fox, P.L. & Kim, S .; Aminoacyl-tRNA synthetases as therapeutic targets. Nat Rev Drug Discov 18, 629-650 (2019).
7. Sorensen, M. A .; Charging levels of four for the effect of ppGpp on translation accuracy: charging levels of four tRNA species in E. coli Rel (+) and Rel (-) strains during amino acid starvation. tRNA species in Escherichia coli Rel (+) and Rel (-) strains during amino acid starvation: a simple model for the effect of ppGpp on translational accuracy.) J Mol Biol 307, 785-798 (2001).
8. Sorensen, M. A. et al .; Overexpression of tRNA (Leu) isoacceptors alters the charging (aminoacylation) pattern of leucine tRNA, revealing new codon readings (Over expression of a tRNA (Over expression of a tRNA). Leu) isoacceptor changes charging pattern of leucine tRNAs and reveals new codon reading. J Mol Biol 354, 16-24 (2005).
9. Girstmair, H. et al .; Depletion of cognate charged transfer RNA causes translational frameshifting within the expanded CAG stretch in huntingtin.) Cell Rep 3, 148-159 (2013).
10. Dittmar, K.A., Mobley, E.M., Radek, A.J. & Pan, T .; Exploring the regulation of tRNA distribution on the genomic scale. J Mol Biol 337, 31- 47 (2004).
11. Vanlander, A.V. et al .; Two siblings with homozygous pathogenic splice-site variant in mitochondrial asparaginyl-tRNA synthetase (NARS2) ).) Human mutation 36, 222-231 (2015).
12. Coughlin, C.R., 2nd et al .; Mutations in the mitochondrial cysteinyl-tRNA synthase gene, CARS2, lead to a severe epileptic encephalopathy and complex movement disorder.) J Med Genet 52, 532-540 (2015).
13. Zaborske, J.M. et al .; Genome-wide analysis of tRNA charging and activation of the eIF2 kinase Gcn2p. J Biol Chem 284, 25254- 25267 (2009).
14. Suzuki, T., Nagao, A. & Suzuki, T .; Human mitochondrial tRNAs: biogenesis, function, structural aspects, and diseases. Annu Rev Genet 45, 299-329 (2011).
15. Jiang, P. et al .; tRNA Ala mutations associated with hypertension alter tRNA metabolism and mitochondrial function (A Hypertension-Associated tRNAAla Mutation Alters tRNA Metabolism and Mitochondrial Function.) Mol Cell Biol 36, 1920-1930 (2016).
The description of each document cited herein is incorporated herein by reference in this specification.

In the present invention, "qualitatively measuring" is to investigate what kind of RNA is contained in a certain sample, and is also referred to as identification. "Measuring quantitatively" refers to absolute or relative quantification when used in situations where the abundance or concentration of target RNA is quantified. In the present invention, both are meant. Absolute quantification is performed, for example, by generating a standard curve by assuming one or more known concentrations of RNA, eg control RNA, and querying the known symmetric RNA for the intensity signal of an unknown amount of target RNA. Will be. Relative quantification is performed by comparing the intensity signals of two or more RNAs and quantifying the change in intensity.

In step α) of the method of the present invention, any cDNA preparation method known to those skilled in the art can be used as the method for preparing the cDNA of the target RNA. For example, a method of adding an RNA strand of an arbitrary sequence to the 3'end of a target RNA and performing reverse transcription using a DNA having a sequence complementary to that sequence can be mentioned. There are two methods of reverse transcription: "method of attaching an adapter by ligation" and "template switching method".

In the present invention, as described above, the target RNA is preferably "small RNA" and does not have a poly A tail. Therefore, the method for creating the cDNA of the target RNA preferably uses an adapter. And a method using reverse transcriptase such as template switching method using reverse transcriptase such as TGIRT (Thermostable Group II intron reverse transcriptase).

In the preferred embodiment described above, the adapter-based approach is a method of qualitatively or quantitatively measuring the difference in a single nucleotide in one target RNA, where the difference in a single nucleotide is 3'of the target RNA. End sequence: A method in which nucleotide A is present or absent in CCA vs. CC.
a-1) It has an adapter linked to the 3'end of the target RNA, an RT primer containing a sequence complementary to the sequence of the adapter, one primer specific to the target RNA, and a sequence specific to the RT primer. Prepare an amplification primer set consisting of the other primer and a probe set targeting the difference between single nucleotides.
b-1) RNA ligase for the adapter is used to ligate the adapter to the target RNA, and cDNA is prepared using the formed ligation product as a template.
β) PCR can include a method of amplifying a target region containing a single nucleotide difference on the cDNA and simultaneously measuring the single nucleotide difference qualitatively or quantitatively.

In the measurement method of the present invention, in step a-1), an adapter linked to the 3'end of the target RNA, an RT primer containing a sequence complementary to the sequence of the adapter, one primer specific to the target RNA, and Prepare and prepare an amplification primer set consisting of the other primer having a sequence specific to the RT primer, and a probe set targeting the difference of a single nucleotide.

In step a-1), the "adapter ligating to the 3'end of the target RNA" is introduced prior to the reverse transcription reaction when constructing a cDNA library of RNA without poly A tail, such as tRNA, miRNA or snoRNA. Although the base length is not limited, it is usually 6 to 25 bases, preferably 15 to 23 bases, and more preferably 17 to 21 bases. Further, in the i-tRAP method of the present invention, since the fluorescent probe is annealed on the reverse transcriptase of the adapter sequence, it is preferable that the sequence is not significantly biased in AUGC, and it is considered that the detection efficiency is improved.

In step a-1), the "RT primer containing a sequence complementary to the sequence of the adapter" is a primer for reverse transcription reaction, which is single-stranded DNA, and is a primer for reverse transcription of the target RNA. Is. The RT primer contains a sequence for amplifying a template that is a linkage product between the target RNA and the adapter, and may specifically complement a part of the target RNA and a part of the adapter. That is, the base sequence of the RT primer contains a sequence complementary to the 3'end adapter sequence. Alternatively, the base sequence of the RT primer can include any sequence of a certain length that can exhibit amplification primer function, in addition to a sequence complementary to the 3'end adapter sequence. That is, in the latter, the base sequence of the RT primer contains a sequence complementary to the 3'end adapter sequence and any sequence of a certain length capable of exhibiting an amplification primer function. When the base sequence of the RT primer contains only a sequence complementary to the 3'end adapter sequence, the adapter sequence may be a part of the probe sequence and an arbitrary sequence of a certain length capable of exhibiting the primer function for amplification. Since it is necessary to include the full length, the length of the adapter sequence in that case is 15 bases or more, preferably 25 bases or more, and more preferably 35 bases or more.

Specific examples of "any sequence of a certain length that can exhibit the function of an amplification primer" include:
-Arbitrary sequence 1: AATGGCAATGGTCACGCCGACTGG (SEQ ID NO: 23)
From the Dilp1 gene of Drosophila melanogaster
Dev Cell. 2009, 17 (6): 885-91.A fat body-derived IGF-like peptide regulates postfeeding growth in Drosophila;
-Arbitrary sequence 2: GCTGTTGCCCAGCAAGCTTTCACG (SEQ ID NO: 24)
From the Dilp1 gene of Drosophila melanogaster
Dev Cell. 2009, 17 (6): 885-91.A fat body-derived IGF-like peptide regulates postfeeding growth in Drosophila;
-Arbitrary sequence 3: AGGAGGAAGTGCGCACGCAA (SEQ ID NO: 25)
From the ApoLpIII gene of the cricket (Gryllus bimaculatus)
PLoS ONE 11 (5): e0154841.2016.Hemolymph Lipid Levels Affect Feeding Motivation in the Two-Spotted Cricket, Gryllus bimaculatus;
-Arbitrary sequence 4: GCAGTCTTGAGGGACTCTGCGA (SEQ ID NO: 26)
From the ApoLpIII gene of the cricket (Gryllus bimaculatus)
PLoS ONE 11 (5): e0154841.2016.Hemolymph Lipid Levels Affect Feeding Motivation in the Two-Spotted Cricket, Gryllus bimaculatus;
-Arbitrary sequence 5: TCGAGGAAGGGACTCCAGTAATAGC (SEQ ID NO: 27)
From the shadow gene of silk moth (Bombyx mori)
Biosci. Biotechnol. Biochem., 71 (11), 2808-2814, 2007.Differential Regulation of Ecdysteroidogenic P450 Gene Expression in the Silkworm, Bombyx mori;

-Arbitrary sequence 6: CAAATGGCAGTGTGGCAGATGGTAC (SEQ ID NO: 28)
From the shadow gene of silk moth (Bombyx mori)
Biosci. Biotechnol. Biochem., 71 (11), 2808-2814, 2007.Differential Regulation of Ecdysteroidogenic P450 Gene Expression in the Silkworm, Bombyx mori;
-Arbitrary sequence 7: AGTATGCTCAGGCTTCAGAAGA (SEQ ID NO: 29)
From the human (homo spiens) RPL19 gene
Transforming Growth Factor (TGF)-β promotes de novo serine synthesis for collagen production.J Biol Chem. 2016 Dec 30; 291 (53): 27239-27251;
-Arbitrary sequence 8: CATTGGTCTCATTGGGGTCTAAC (SEQ ID NO: 30)
From the human (homo spiens) RPL19 gene
Transforming Growth Factor (TGF)-β promotes de novo serine synthesis for collagen production.J Biol Chem. 2016 Dec 30; 291 (53): 27239-27251;
-Arbitrary sequence 9: CACCGCACGCAGATCCTCTACT (SEQ ID NO: 31)
From the human (homo spiens) TRM61 gene
TRM6 / 61 connects PKCα with translational control through tRNAi (Met) stabilization: impact on tumorigenesis.Oncogene. 2016 Apr 7; 35 (14): 1785-96;
-Arbitrary sequence 10: CCACTGCCGGTGCCAGACT (SEQ ID NO: 32)
From the human (homo spiens) TRM61 gene
TRM6 / 61 connects PKCα with translational control through tRNAi (Met) stabilization: impact on tumorigenesis.Oncogene. 2016 Apr 7; 35 (14): 1785-96.

The "arbitrary sequence of a certain length capable of exhibiting the primer function for amplification" is at least 15 bases long, preferably 15 to 30 bases, and more preferably 18 to 25 bases. The base length of the reverse transcription primer sequence is not particularly limited, but must have at least the base length of the adapter and the base length of the amplification primer, which is at least 30 base lengths, preferably 30 to 80 bases. More preferably, it is 40 to 60 bases.

In step a-1), the "amplification primer set" is a primer set for amplifying a nucleic acid containing a specific base sequence of RNA or a complementary sequence of a specific base sequence using the RT-PCR method. In the i-tRAP method of the present invention, the "amplification primer set" amplifies the cDNA of a target RNA consisting of one primer having a sequence specific to the target RNA and the other primer having a sequence specific to the RT primer. Here, "specific sequence" means the same or complementary sequence, and in the "primer set for amplification" of the present invention, one primer is complementary to the target RNA. If it has a sequence, the other primer has the same sequence as the RT primer, or if one primer has the same sequence as the target RNA, the other primer has a sequence complementary to the RT primer. Each primer in the primer set is not limited to its position if it is selected to sandwich the 3'end sequence of target RNA: CCA and CC, which is the difference of a single nucleotide in the present invention. For example, if one primer is specific to any position in the target RNA, the other primer is specific to any position in the RT primer, i.e. a sequence complementary to the 3'end adapter sequence in the RT primer. And can be specific to any position in any sequence of constant length that may exhibit amplification primer function and positions that straddle its boundaries. The length of each primer is usually 18-30 bases.

As used herein, "complementary," "complementary," or "complementary" refers to the ability to accurately pair between two nucleotides. That is, if a nucleotide at a given position in a nucleic acid sequence has the ability to hydrogen bond with a nucleotide in another nucleic acid sequence to form a base pair, the two nucleic acid sequences are complementary to each other at that position. Complementarity between two single-stranded nucleic acid sequences may be "partial" to which only a portion of the nucleotide binds.

The “probe set targeting the difference of a single nucleotide” in step a-1) will be described.
The "probe set targeting a single nucleotide difference" is the 3'end sequence of the target RNA that is the difference in a single nucleotide in the present invention: a probe that targets the presence of nucleotide A in CCA vs. CC, and a nucleotide. A probe set used for probe qPCR, consisting of probes that target the absence of A. Here, in the real-time PCR method, a fluorescent dye as a reporter is used at the 5'end of the sequence-specific oligonucleotide, and a probe set labeled with a quencher at the 3'end is used. Preferably, the probe set includes a Tm enhancer MGB (Minor Groove Binder) structure in the probe so that a probe having a high Tm value can be designed with a length of 20 bases or less. In this case, the Tm difference due to the difference of one base can be made remarkable, so that the probes corresponding to each of CCA and CC are annealed in a sequence-specific manner between CCA and CC. By binding different fluorescent substances to the probes corresponding to CCA and CC, cDNA with CCA and CC sequences can be quantified separately. Incorporating a non-fluorescent quencher also suppresses background signals and increases quantification.

The length of the individual probes in the probe set can be adjusted as needed and according to the desired specificity, for example, the total length is about 3 to 300 bases, preferably about 5 to 100 bases. It is more preferably about 6 to 50 bases, and even more preferably 15 to 34 bases.

Each probe in the probe set contains labeled nucleotides within it. Generally, any reporter dye suitable for labeling nucleic acids can be used. In one embodiment of the invention, the reporter dye is selected from the group consisting of fluorophores, chromophores, radioisotopes, chemical luminescent materials and enzymes. Reporter dyes are preferably 5-carboxyfluorescein or 6-carboxyfluorescein (FAM®), VIC®, NED®, fluorescein, fluorescein isothiocyanate (FITC), IRD-700 / 800, Cyanine dyes such as CY3®, xanthene, 6-carboxy-2', 4', 7', 4,7-hexachlorofluorescein (HEX), 6-carboxy-1,4-dichloro-2', 7'-dichloro-fluorescein (TET®), 6-carboxy-4', 5'-dichloro-2', 7'-dimethoxyfluorescein (JOE®), N, N, N', N '-Tetramethyl-6-Rhodamine (TAMRA®), 6-carboxy-X-Rhodamine (ROX), 5-Rhodamine-6G (R6G5), 6-Rhodamine-6G (RG6), Rhodamine, Rhodamine Green, Rhodamine Red, Rhodamine 110, RhoDamiN6G®, BODIPY dyes such as BODIPYTMR, OregoNGreeN, coumariNe such as Umberiferon, Benzimide such as Hoechst33258; CaliforNiaReD®, YakimaYellow, AlexaFluor® 350, etc., PET®, ethidium bromide, acridinium dye, carbazole dye, phenoxazine dye, porphyrin dye, polymethine dye, Atto390, Atto425, Atto465, etc., AttoRhoG6 , BMN-5 ™, CEQ8000D2, etc., DY-480XL, DY-485XL, DY-495, DY-505, etc., 6-carboxy-4', 5'-dichloro-2', 7'-dimethoxyfluorescein ( JOE), TET (trademark), CALFluor (registered trademark) GolD540, CALFluorRED590, CALFluorReD610, CALFluorReD635, IRDYe (registered trademark) 700Dx, IRDYe (registered trademark) 800CW, MariNaBlue (registered trademark), PacificBlue (registered trademark), YakimaYellow (registered trademark) Trademarks), 6- (4,7-dichloro-2', 7'-diphenyl-3', 6'-dipivalo Ilfluorescein-6-carboxamide) -hexyl-1-O- (2-cyanoethyl)-(N, N-diisopropyl) -phosphorumidite (SIMA), CALFluor® GolD540, CALFluor® OraNge560, CALFluorReD635 , Quasar570, Quasar670, LIZ, SuNNyvaleReD, LCReD® 610, LCReD® 640, LCReD® 670, and LCReD® 705. More preferred reporter dyes are Atto465, DY-485XL, FAM ™, AlexaFluor® 488, DY-495, Atto495, DY-510XL, JOE, TET ™, CALFluor® GolD540, DY- 521XL, RhoDamiN6G®, YakimaYellow®, Atto532, AlexaFluor® 532, HEX, SIMA, AttoRhoG6, VIC, CALFluorOraNge560, DY-530, TAMRA®, Quasar570, CY3®, NED ™, DY-550, Atto550, AlexaFluor® 555, PET®, CALFluorRED590, ROX, TexasReD®, CALFluorReD610, CALFluorReD635, Atto633, AlexaFluor® 633, DY-630, It is selected from the group consisting of DY-633, DY-631, LIZ, Quasar670, DY-635 and CY5 ™. More preferred reporter dyes are selected from the group of fluorophores consisting of FAM ™, DY-510XL, DY-530, and Atto550. Preferred are FAM, VIC, HEX, JOE, TET, NED, or TAMRA. From the above dyes, a combination of fluorescent dyes having different fluorescent wavelengths is selected.

As one embodiment of the present invention, each probe in the probe set comprises a "modified nucleotide". The modified nucleotide can be a nucleotide containing a quencher in addition to the above-mentioned nucleotide containing a reporter dye. One of ordinary skill in the art can select an appropriate nucleotide as a modified nucleotide, if necessary.

Quenching refers to any process that reduces the fluorescence intensity of a substance. The "quenching agent" in the present invention relates to, for example, residues suitable for quenching the basic fluorescence of a label without activation. A variety of processes can result in quenching, such as quenching by excited reactants, quenching by energy transfer, quenching by complex formation, and quenching by collisions. As a result, quenching is often highly dependent on pressure and temperature. Oxygen molecules and iodide ions are common chemical quenchers. Quenching raises the issue of non-immediate spectrophotometry, such as laser-induced fluorescence. Quenching is the basis of a fluorescence resonance energy transfer (FRET) assay. Quenching and quenching when interacting with a particular molecular biological target is the basis of an activable optical contrast agent for molecular imaging. There are several different mechanisms by which energy can be transferred non-radiatively (without photon absorption or radiation) between the two dyes, donor and acceptor. Those skilled in the art can select the quenching agent as needed.

In one embodiment of the invention, the probes in the probe set are usually labeled with a reporter dye, which is used to detect genes in real-time PCR. It is necessary to excite the selected reporter dye in the same well with a real-time PCR device and detect it accurately. The manufacturer of the device introduces the recommended dyes for each device. The reporter dye does not need to be selected according to the type of target RNA or gene product, but the assay can be simplified by selecting an appropriate dye. For example, the Invitrogen® FAM® dye is the most common reporter dye used in TaqMan probes. In one embodiment of the invention, the 3'end sequence of target RNA, which is the difference between single nucleotides in the invention: Invitrogen® VIC (registered trademark) as a reporter in a probe targeting the presence of nucleotide A in CCA vs. CC. The registered trademark) dye can be selected and the FAM dye can be selected as a reporter in probes targeting the absence of nucleotide A. This combination makes it possible to perform assays that combine two types of dyes, FAM dyes and VIC dyes.

In the measurement method of the present invention, in step b-1), the adapter is ligated to the target RNA by the RNA ligase suitable for the adapter prepared in step a-1), and the cDNA formed is used as a template for cDNA. This is the process of creating.
Detection of naturally occurring RNA, especially small RNA, associated with ligating the adapter to the target RNA is difficult due to their number, small size and low number in the cell. Therefore, using RNA ligase, an appropriate adapter is ligated to the target RNA to obtain an appropriate base length. The adapter is as described above.

Ligase ligation can be achieved by RNA ligase. In some embodiments, the RNA ligase may be an ATP-dependent ligase. The RNA ligase may be a family of Rnl1 or Rnl2 ligases. Exemplary Rnl1 family ligases include, for example, T4 RNA ligase, Thermosscitoductus bacteriophage TS2126-derived thermostable RNA ligase 1 (CircLigase), or CircLigase II. These ligases generally catalyze the formation of ATP dependence of phosphodiester bonds between nucleotide 3-OH nucleophiles and 5'phosphate groups. In general, Rnl2 family ligases can seal nicks in double-stranded RNA. Examples of the Rnl2 family ligase include T4RNA ligase 2. This RNA ligase may be an Archaeal RNA ligase, for example, an archaeal RNA ligase derived from the thermophilic archaea Methanobacterium thermoautotrophicum (MthRnl).

Preferably, the ligase used for ligation is selected according to the arrangement of the adapters to be used. For example, Custom AIR® adenylation adapter / linker (5'-rAppCTGTAGGCACCATCAAT / 3ddC / -3', which is a 5'adenylation adapter with a 3'end block) used in the examples. (PerkinElmer (Waltham, MA)) ”), the AIR adenylation linker is a 5'-adenylation / 3'protective oligo, and RNA ligase 2 is used as the ligase. In this case, ATP is not required, which is a preferable embodiment. In addition, a synthetic oligo modified with 5'-adenylation or an oligo with a phosphorylated 5'end 5'-adenylated with a 5'DNA Adenylation Kit is used as an adapter.

After sufficient time to achieve ligation of the adapter to the target RNA, the unreacted adapter can be filtered by any means known to those of skill in the art, eg by molecular weight cutoff, size exclusion chromatography, use of spin columns, It may be removed by selective precipitation with polyethylene glycol (PEG), selective precipitation with PEG on a silica matrix, alcohol precipitation, sodium acetate precipitation, PEG and salt precipitation, or high stringency washing.

In connection with the preparation of cDNA using the formed linkage product as a template, cDNA is prepared by a method well known to those skilled in the art. In one embodiment of the present invention, an RT primer, a linkage product of a target RNA and an adapter, and a reverse transcriptase are mixed, and the cDNA is synthesized using the linkage product as a template. In this synthetic method, the RT primer has a region at the 3'end that hybridizes to the linkage product. By placing the mixture under temperature conditions suitable for the reverse transcription reaction, the action of reverse transcriptase extends the 3'end of the RT primer hybridized with the linkage product, and cDNA is synthesized.

In the measuring method of the present invention, step β) amplifies the target region containing the difference of a single nucleotide on the cDNA by PCR, and at the same time, measures the difference of a single nucleotide qualitatively or quantitatively.
In the present invention, "simultaneously" in step β) means a form in which a target region containing a difference of a single nucleotide on cDNA is amplified and the difference is measured at the same time.
The measurement of the amplification product may be a sequencing of the amplification product or a measurement of the intensity of the reporter dye that reflects the difference of a single nucleotide in the amplification product. Preferably, it is a measurement of the intensity of the reporter dye.

In step β), the 3'end sequence of the target RNA, which is the difference between single nucleotides: probe qPCR consisting of a probe targeting the presence of nucleotide A in CCA vs. CC and a probe targeting the absence of nucleotide A. The "probe set that targets single nucleotide differences" works. Here, in the real-time PCR method, a fluorescent dye as a reporter is used at the 5'end of the sequence-specific oligonucleotide, and a probe set labeled with a quencher at the 3'end is used. In real-time PCR using a probe, the probe (for detection) and the primer (for amplification) are used at the same time. If the quencher is near the fluorochrome (on the same probe), it absorbs the fluorescence and no fluorescence is detected. Therefore, in the normal probe state, there is no fluorescent signal. The probe hybridizes to the template cDNA during the PCR process, and no fluorescence is detected at this point. On the other hand, the primer also binds to the template, and the DNA strand is synthesized and amplified by the polymerase from that point. When the polymerase reaches the position where the probe is bound, it begins to break the probe apart. As a result, the fluorescent substance and the quencher are separated from the probe, and the fluorescent substance and the quencher are physically separated from each other, so that the fluorescent signal can be detected. In this way, the amplification of the template by the polymerase starting from the primer and the detection of the fluorescent signal due to the destruction of the probe are performed in one reaction, so that it is “simultaneous”.

In one embodiment of the present invention, in step a), the probe set targeting the difference of a single nucleotide is a fluorescently labeled probe set that recognizes the difference of a single nucleotide, and in step β). The present invention relates to a method for qualitatively or quantitatively measuring a single nucleotide difference in a target tRNA, which qualitatively or quantitatively measures a single nucleotide difference using the emitted fluorescence intensity as an index during amplification.
Here, "as an index" is typically meant to compare fluorescence intensities that vary with different single nucleotides.
The fluorescently labeled probe set that recognizes the difference between single nucleotides for realizing such an embodiment is a probe set containing a modified nucleotide containing a reporter dye in the present invention. As a typical example of such a probe set, a set in which the reporter dyes are VIC (registered trademark) and FAM (registered trademark) will be described below.

As a probe set, one probe has a sequence complementary to the VIC® labeled 3'CCA-tRNA and the other probe is complementary to the FAM® labeled 3'CC-tRNA. Prepare a probe set having a specific sequence. Fluorescent signals from VIC® and FAM® are quenched by a quencher attached to the probe. These probes can bind to the minor groove binder (MGB) moiety. The MGB moiety is commonly used to detect single nucleotide polymorphisms because it increases the higher melting temperature of the probe through increased binding affinity to the target sequence (Nagy, A., Vitaskova, E. , Cernikova, L., Krivda, V., Jirincova, H., Sedlak, K., Hornickova, J., and Havlickova, M. (2017). Teoh, B.T., Chee, C.M., Mohamed-Romai-Noor, N.A., Abd-Jamil, J., Loong, S.K., Khor, C.S., Tan, K.K., and AbuBakar, S. (2018). 2-8.). Mix the same amount of VIC and FAM labeled probes and use them for qPCR. When extended using Taq polymerase, the probe is degraded and either VIC or FAM is released, and the resulting fluorescent signal allows quantification of the amplification product. The fluorescent signal from VIC represents the amount of 3'CCA-tRNA and the signal from FAM represents the amount of 3'CC-tRNA.

Using the amount of 3'CCA-tRNA derived from the VIC fluorescence signal and the amount of 3'CC-tRNA derived from the FAM fluorescence signal thus obtained, the aminoacyllation rate, that is, the 3'-terminal CCA and CC are aligned. The ratio of the readings aligned to the 3'end CCA to the sum of the readings made is determined.
Therefore, as one embodiment, the present invention is in addition to the steps a-1), b-1) and β) described above.
γ) Quantitative value of tRNA having CCA-quantitative value of tRNA having CCA to the total amount of quantitative value of tRNA having CCA-quantitative value of tRNA having CC Calculate the ratio,
The present invention relates to a method for qualitatively or quantitatively measuring the difference between a single nucleotide of a target RNA including.
The present invention is represented by one target RNA, preferably one tRNA, by performing each step of the above steps a-1), b-1), β) and γ) as one embodiment. The amino acylation rate of tRNA-functional RNA can be measured. As mentioned above, it has been reported that "tRNA represented by tRNA-aminoacylation rate of functional RNA" is closely related to some biological phenomena and diseases.

Such a method of the present invention is a PCR method capable of detecting the acylation of one tRNA-functional RNA, that is, a PCR method capable of quantifying individual tRNA aminoacyllation rates, and can be referred to as an i-tRAP method. ..
The i-tRAP method of the present invention is very advantageous in terms of ease of use and convenience. The previously reported tRNA sequencing method has significantly improved the resolution in detecting the aminoacylation profile of tRNA (Evans, ME, Clark, WC, Zheng, G., and Pan, T. (2017). Nucleic Acids Res. 45. , e133.), In comparison, the present invention simplifies the preparation of cDNA. Evans et al. Utilized thermostable Group II intron reverse transcriptase (TGIRT) for template switching reverse transcription and DNA circligase to generate cyclized cDNA (Evans, ME, Clark, WC, Zheng, G). ., and Pan, T. (2017). Nucleic Acids Res. 45, e133.). Instead, the present invention is an improvement on the small RNA sequencing method. That is, ligation of the adapter sequence to the 5'and 3'ends of RNA and subsequent reverse transcription (Lau, NC, Lim, LP, Weinstein, EG, and Bartel, DP (2001). Science (80-.). 294, 858-862.). Both cDNA preparation methods are biased towards reaction efficiency and artificial by-products that require careful evaluation (Jackson, TJ, Spriggs, R.V., Burgoyne, NJ, Jones, C., and Willis, AE (2014). BMC Genomics. 15, 1-9 .; Viollet, S., Fuchs, RT, Munafo, DB, Zhuang, F., and Robb, GB (2011). BMC Biotechnol. 11, 1-14 .; Zhuang, F., Fuchs, RT, Sun, Z., Zheng, Y., and Robb, GB (2012). Nucleic Acids Res. 40.).

In one embodiment of the present invention, the commercially available TaqMan probe (registered trademark) can be used as a preferred embodiment because MGB, FAM (registered trademark), VIC (registered trademark), and quencher are specified. .. The TaqMan probe® is manufactured by Thermo fisher scientific. In addition, the following probes are available.
-MGB probe: The 5'side is modified with a reporter fluorescent dye, and the 3'side is modified with MGB (minor groove binder, Minor Groove Binder) and Eclipse quencher (EQ). Probes with MGB form a very stable double-stranded structure with the template DNA, resulting in higher melting temperatures (Tm values). It is possible to design a probe shorter than the conventional DLP probe (double fluorescent labeled probe) (from 13 bases), and the specificity and the degree of freedom in probe design are improved. (Https://www.eurofinsgenomics.jp/jp/product/oligo-dna/qpcr-probe.aspx)
-PrimeTime (registered trademark) real-time PCR probe: Real-time PCR-hybridization method (probe method, 5'nuclease assay method) can be performed at a relatively low cost. Unlike the intercalation method, it is highly specific and does not require the creation of melting curves or post-PCR sample electrophoresis. It provides a reliable method for gene expression analysis. (Https://sg.idtdna.com/jp/site/primetime.html)

Some embodiments of the present invention are typical:
A. A method of measuring target RNA with a single nucleotide resolution in the terminal sequence.
a-11) 5'adenylation / 3'protective oligo adapters linked to the 3'end of the target RNA, RT primers; reverse primers; and forward primers, and TaqMan probes targeting the boundary between the target RNA and the adapter, respectively. Prepare and
b-11) Rnl2 ligation ligates the adapter to the target RNA to form a ligation product.
c-11) A method for amplifying and quantifying linked products by TaqMan RT-PCR;

B. A method for determining, detecting or analyzing CCA vs. CC, which is the difference between single nucleotides in the 3'end sequence of the target tRNA.
a-12) Target the 5'adenylation / 3'protective oligo adapter, RT primer; reverse primer; and forward primer linked to the 3'end of the target RNA, and the CCA and CC boundaries of the target RNA and the adapter. Prepare two TaqMan probes respectively
b-12) Rnl2 ligation ligates the adapter to the target RNA to form two ligation products.
c-12) A method for amplifying and quantifying two linkage products by TaqMan RT-PCR;

C. A method for measuring the aminoacylation rate of a target tRNA having CCA vs. CC, which is a single nucleotide difference in the 3'end sequence.
a-13) Target the 5'adenylation / 3'protective oligo adapter, RT primer; reverse primer; and forward primer linked to the 3'end of the target RNA, and the CCA and CC boundaries of the target RNA and the adapter. Prepare two TaqMan probes respectively
b-13) Rnl2 ligation ligates the adapter to the target RNA to form two ligation products.
c-13) Amplify and quantify the two linkage products by TaqMan RT-PCR.
d-13) A method for calculating the ratio of the quantitative value of the target aminoacyl-tRNA to the total amount of the quantitative value of the target aminoacyl-tRNA having CCA and the quantitative value of the target non-aminoacylated tRNA having CC.

In the step α) for preparing the cDNA of the target RNA of the present invention, the template switching method using reverse transcriptase using an enzyme such as TGIRT as the above preferred embodiment is a single nucleotide in one target RNA. In the method of measuring the difference qualitatively or quantitatively, here the difference of a single nucleotide is the 3'end sequence of the target RNA: the presence or absence of nucleotide A in CCA vs. CC.
a-2) A DNA primer that has an arbitrary RNA adapter and a sequence complementary to the RNA adapter, and the 3'end protrudes from the RNA adapter by only one base (the protruding bases are A and G). For amplification, which consists of a hybrid primer obtained by annealing these, one primer having a sequence specific to the target RNA, and the other primer having a sequence specific to the RT primer. Prepare a primer set and a probe set that targets the difference between single nucleotides.
b-2) The hybrid primer is annealed to the 3'end of the target RNA, and cDNA is prepared by reverse transcriptase having template switching activity.
β) PCR can include a method of amplifying a target region containing a single nucleotide difference on the cDNA and simultaneously measuring the single nucleotide difference qualitatively or quantitatively.

When using a reverse transcriptase having template switching activity, for example, TGIRT, the adapter used in step a-1) above is an RNA / DNA hybrid in which a DNA strand complementary to the RNA adapter is annealed. Corresponding to this, ligation and reverse transcription are possible at the same time, and the step of "linking the adapter to the target RNA by RNA ligase" in the above step b-1) becomes unnecessary. Here, an RNA / DNA hybrid annealed with a DNA strand complementary to the prepared RNA adapter is mixed with the target RNA. For the RNA strand used for the RNA / DNA hybrid, the DNA strand to be annealed has only one base protruding at the 3'end. The base to be overhanged preferably contains 50% each of T and G. One protruding base on the 3'side of the RNA / DNA hybrid primer annealed to the 3'end of RNA, and TGIRT-III was used for RNA / DNA hybrids because it extends cDNA from the DNA strand of the RNA / DNA hybrid primer. A cDNA with a DNA strand at the 5'end is obtained.

It is desirable that A and G are 50% each for the "protruding base" in the "DNA primer whose 3'end protrudes only 1 base with respect to the RNA adapter" in step a-2). When the target RNA is tRNA, it is desirable to use TGIRT, which can act at high temperature, as an enzyme.

In addition, the significance of "arbitrary RNA adapter", "DNA primer", "primer set for amplification" such as "primer", and "probe set targeting the difference of a single nucleotide" in step a-2). Is the same as in step a-1). Similarly, the cDNA preparation in step b-2) is the same as that in step b-1).

In principle, the i-tRAP method of the present invention can obtain the same effect as multiplex PCR (multiplex polymerase chain reaction, Multiplex PCR) by using 4 or 6 fluorescences. Multiplex PCR is a modification of the polymerase chain reaction, which is a method of amplifying and specifically detecting two or more types of gene sequences in the same reaction. A primer set corresponding to a tRNA-functional RNA represented by a plurality of tRNAs and a probe set corresponding to the CC-terminal and CCA-terminals of the tRNA-functional RNA represented by each tRNA are reacted at the same time. All fluorescent dyes used in the probe set must have different fluorescent wavelengths. By the above method, it is possible to measure the aminoacylation rate of tRNA-functional RNA represented by a plurality of tRNAs in one reaction.

Hereinafter, the qPCR method for measuring the aminoacyllation rate of tRNA-functional RNA represented by tRNA, which is schematically shown in FIG. 10, will be specifically described. This makes it possible to easily investigate the dynamic change in the aminoacylation rate of tRNA.
A series of chemical and enzymatic treatments described in FIG. 1, for example, are applied to tRNA extracted from cells to demethylate aminoacylated and non-aminoacylated tRNA, respectively, 3'CCA-tRNA and 3'CC-tRNA. Process to. The resulting tRNA is ligated to the 5'adenylation linker by T4 RNA ligase 2 (T4Rnl2). The ligation product is used as a template for reverse transcription to generate cDNA. Two probe-based qPCR assays are utilized to detect single nucleotide differences in the 3'end sequence of tRNA, CCA vs. CC. To perform the qPCR assay, a probe set of two probes with different sequences corresponding only to the sequence at the 3'end of the tRNA, ie one probe has a sequence complementary to the 3'CCA-tRNA and the other For one probe, prepare a probe set having a sequence complementary to 3'CC-tRNA.

For the RNA extraction method from cells, it is better to use a small / large RNA protocol properly in consideration of efficiency, but although the efficiency is slightly reduced, there is no problem even if it is started from all RNA.
Further, the cell from which RNA is extracted is not particularly limited, and means a cell containing RNA regardless of the type and content of RNA. For example, cells containing RNA from mammalian tissue, organ or blood such as human tissue, organ or human blood can be mentioned, preferably derived from human peripheral blood which does not burden the subject and is easy to collect. It is a cell containing the RNA of.

RNA extracted from cells needs to be demethylated.
Some bases and ribose in the RNA sequence undergo chemical modifications such as methylation after transcription. There are many types of RNA modifications, and more than 130 types have been identified in eukaryotes. Most of them are found in tRNAs and are known to affect the stability and translation efficiency of tRNAs. In addition, the presence of modified nucleosides has been reported in rRNA, mRNA, and ncRNA. These modifications affect the measurements, quantifications, and tests in the present invention and should be removed. Typically, multiple enzymes are used for demethylation.

Demethylase will be described by taking Dai et al, Angew. Chem. Int. Ed. 2017, 56, 5017-5020 as an example.
Methylation of the abundant Watson-Crick surface in biological RNAs such as N1-methyladenosine (m1A), N1-methylguanosine (m1G), N3-methylcytosine (m3C), and N2, N2-dimethylguanosine (m22G). Will impair cDNA synthesis and interfere with RNA sequencing. One strategy to overcome this obstacle is to use enzymes to remove the methyl groups of these modified bases before synthesizing the cDNA. Wild-type E. coli AlkB and its D135S mutants can remove most of the m1A, m1G, and m3C modifications of tRNA. In addition, the model RNA substrate containing m22G is efficiently and selectively converted to N2-methylguanosine (m2G) by the AlkB D135S / L118V mutant.

Thus, in one embodiment, the invention treats target RNA extracted from a biological sample to remove terminal bases in non-aminoacylated RNA (non-aminoacylated RNA), while aminoacylated. By removing amino acids from the RNA (aminoacylated RNA), a step of preparing non-aminoacylated RNA and aminoacylated RNA can be included. Here, the treatment of the target RNA is periodic acid oxidation, β desorption and terminal repair for non-aminoacylated RNA, and weak alkaline treatment for aminoacylated RNA.

The present invention, as another embodiment, in the method of the invention for qualitatively or quantitatively measuring the difference in a single nucleotide in one target small RNA, where the difference in a single nucleotide is 3'of the target RNA. End sequence: Assay kit used in the method in which nucleotide A is present or absent in CCA vs. CC.
A) Adapter that connects to the 3'end of the target small RNA,
B) RT primer containing a sequence complementary to the sequence of the adapter,
C) Amplification primer set consisting of one primer having a sequence specific to the target small RNA and the other primer having a sequence specific to the RT primer,
D) Probe sets that target single nucleotide differences,
E) RNA ligase for the adapter, and f) demethylase, if necessary,
Including, kit, or service) any RNA adapter,
B) A DNA primer containing a sequence complementary to the adapter and having the 3'end protruding only one base from the RNA adapter.
S) An amplification primer set consisting of one primer having a sequence specific to the target RNA and the other primer having a sequence specific to the DNA primer.
C) Probe sets that target single nucleotide differences,
S) Reverse transcriptase with template switching activity, and Ta) Demethylase, if necessary,
Including, kit,
Regarding. The kit of the present invention can include instructions for use. In embodiments of this kit, demethylation with a demethylase improves the efficiency of reverse transcription, but the demethylase is not essential, and even without it, the difference between single nucleotides. It may be qualitatively or quantitatively measurable.

<Simplified aminoacyl-tRNAseq method>
As another aspect, the present invention is a method for comprehensively measuring the sequence, expression level and aminoacylation rate of tRNA-functional RNA.
a-10) TRNA-functional RNA extracted from biological specimens is treated to remove terminal bases in non-aminoacylated RNA (non-aminoacylated RNA), while aminoacylated RNA (aminoacylated). By removing amino acids from RNA), non-aminoacylated RNA and aminoacylated RNA are prepared, respectively.
b-10) Connect the adapter to the 3'-end and 5'-end of both obtained RNAs.
c-10) Reverse transcription is performed using the produced linked RNA as a template.
d-10) Create a cDNA library by PCR and
e-10) Sequencing each cDNA in the library to obtain sequence data,
tRNA-A method for measuring the base sequence, expression level and aminoacylation rate of a functional RNA.

The "tRNA-functional RNA" in the present embodiment of the present invention is an RNA of 20 to 150 bases (nt, nucleotide length), specifically the same as tRNA or tRNA which is 20 to 80 bases. In an embodiment, it means an RNA-like molecule or a portion thereof or a derivative thereof whose 3'end is aminoacylated (charged) or deaminoacylated (decharged). Specifically, such "RNA-like molecule or a portion thereof or a derivative thereof" is a tRF or tRNA half (Raina, M. & Ibba, M. tRNAs as regulators of) having a microRNA derived from tRNA, for example, a 3'end of tRNA. Biological processes. Frontiers in genesics 5, 171 (2014)), and RNA having tRNA-like activity, for example, RNA synthetic products having tRNA-like activity having a 3'end of tRNA. More specifically, RNA obtained by extracting RNA of 20 to 150 bases by subjecting RNA extracted from a biological sample to size fractionation can be mentioned.

"Measuring RNA sequence" in the present embodiment of the present invention means RNA sequencing, that is, RNA sequencing, which is well known to those skilled in the art.
"Measuring the expression level of tRNA" in the present embodiment of the present invention means measuring the amount of RNA contained in a biological sample, specifically, all sequences of tens of thousands sequenced by this method. Of these, the expression level is evaluated as the ratio of the target RNA sequence, so to be precise, it means the ratio of each tRNA contained in the biological sample.

"Measuring the amino acylation rate of tRNA-functional RNA" in the present embodiment of the present invention means, as described above, tRNA-functional RNA (aminoacylation) in which an amino acid is aminoacylated in one tRNA-functional RNA. It means calculating the ratio of aminoacylated tRNA-functional RNA to tRNA-functional RNA) and non-aminoacylated tRNA-functional RNA (non-aminoacylated tRNA-functional RNA).
As described above, in the sequence determination performed in the present embodiment, tens of thousands of DNA strands contained in the sample are read, and as a result, information on the sequence and how many sequences there are can be obtained. As shown in FIG. 1, after the step a-10), the sequence of the tRNA-functional RNA to which the amino acid is bound and the tRNA-functional RNA to which the amino acid is not bound is different by one base. The ratio can be calculated from the information on how many of the sequences are. For example, if the information obtained for a specific tRNA is 1500, 1000 out of 1500 are CCA, and 500 are CC, then from this information, CCA: CC is 2. It is 1 and the aminoacylation rate can be measured to be 66%.

"Comprehensive measurement" in the present embodiment of the present invention means that all RNA contained in the sample is targeted, and when the RNA is tRNA, it is encoded by the human genome and mitochondrial DNA. It means that all of the approximately 300 types of tRNA expressed are individually measured. Since it can be measured comprehensively, it has the advantage that the aminoacylation rates of all RNAs can be analyzed at once regardless of the level of expression.

In step a-10) of the present embodiment, the "biological sample" is blood, urine, cerebrospinal fluid, saliva, tears, semen, brain, heart obtained from humans or animals such as pets and domestic animals. , Kidney, liver, lungs, spleen, blood vessels, blood cells, muscles, fat, skin, pancreas, intestines, endocrine organs, nerves, biological specimens selected from sensory organs, preferably blood, serum, plasma, urine, tissues , Saliva, lymph, tissue fluid (interstitial fluid, interstitial fluid, dry and wet fluid), body cavity fluid (joint fluid, cerebrospinal fluid, serous cavity fluid, atrioventricular fluid), biological specimens, and cultured cells It means a sample of origin.
Examples of biological specimens are human-derived blood, serum, plasma, urine, tissue, cerebrospinal fluid, preferably blood, and more preferably serum or plasma, which is a liquid component of blood. Conventionally known methods can be used as the method for preparing serum and plasma.
Examples of cultured cells include CHO (Chinese hamster ovary), HEK293 (human fetal kidney), adenoviral vector packaging cells, HL-60 (derived from human leukemia cells), HeLa (derived from human cervical cancer), MDCK. (Canine kidney epithelium, epithelial cells), NIH3T3 (mouse fetal skin), PC12 (rat adrenal medulla-neural cell differentiation), S2 (Drosophila-recombinant protein expression), Sf9 (Spodoptera frugiperda (moth) -recombinant protein expression ), Vero (African Midori monkey kidney-virus infection experiment, measurement of verotoxin activity), etc., including primary cultures and immortalized cell types established from humans and animals, and genetic variants of these cells. can.

In the present embodiment of the present invention, preferably in step a-10), the treatment of RNA is periodic acid oxidation, β desorption and terminal repair for non-aminoacylated RNA and deaminosylated for aminoacylated RNA. be.
For non-aminoacylated RNA, "periodic acid oxidation" is an oxidative cleavage reaction that targets the carbon bonds at the 2nd and 3rd positions of ribose at the 3'end of the RNA chain. Here, periodic acid or sodium periodate is used to carry out an oxidative cleavage reaction.
For non-aminoacylated RNA, "β elimination" is a reaction in which the carbon at the 5-position of ribose and the phosphate group adjacent to it are eliminated after the oxidative cleavage reaction.
For non-aminoacylated RNA, "terminal repair" is a reaction in which the phosphate group bound to the carbon at the 3-position after β-elimination is removed by an enzyme.
About Aminoacyl TRNA Deaminoacylation is a weak alkaline treatment that cleaves the aminoacyl bond and releases the amino acid bound to the aminoacylized RNA.

These operations were performed on the target RNA, and the free 3'end of the non-aminoacylated RNA was oxidized by periodic acid oxidation (Neu, H.C., and Heppel, L.A. (1964). J. Biol. Chem. 239, 2927. -2934.), Then by β-desorption at weakly basic pH, oxidized 3'-adenylate ribonucleotide (A) residues at the terminal 3'-citidirate ribonucleotide (C) residues 3 It is selectively converted to'phosphate, which is then removed with T4 polynucleotide kinase (PNK), resulting in a'C'of the 3'terminal nucleotide of the non-aminoacylated tRNA. Instead, in aminoacylated tRNAs, the 3'end is bound to an amino acid, so it is not oxidized by periodic acid treatment and then desorbed by the same β desorption step as above at weakly basic pH. It is acylated and becomes an "A" at the 3'nucleotide of the amino acid-free tRNA. See Figure 1.

The "adapter" in step b-10) of the present embodiment is an RNA strand sometimes referred to as a linker. The 3'-end adapter is an RNA whose 5'-end is adenylated and whose 3'-end is modified with -NH ₂ or ddC to prevent self-ligation at the 3'end. It is a chain, and its length is not particularly limited, but it may have a length of at least about 20 bases and may be longer than that. The 5'-terminal adapter is an RNA strand having a length of about 25 bases, although it is not particularly limited.
Adapter ligation to both RNAs is performed using a predetermined ligase. The ligase here is the same as that in the i-tRAP method of the present invention. In this respect, the method of Evans et al. (Non-Patent Document 21) does not have an RNA ligase step, but the present invention is new in that it includes an RNA ligase step. The feature in this embodiment is that Evans et al. Used TGIRT, whereas the present invention uses a normal reverse transcriptase. In the present invention, it is an unexpected result that comprehensive analysis was possible even by using a normal reverse transcriptase. Here, comparing the method of Evans et al. And the method of the present invention, the former performs reverse transcription with TGIRT, cyclization with Circuligase, and then PCR, whereas in the present invention, 3'adapter linkage is performed. , 5'adapter ligation, and reverse transcription, followed by PCR.

In step c-10) of the present embodiment, cDNA is prepared by performing reverse transcription using the produced linked RNA as a template by a method well known to those skilled in the art.

Step d-10) of this embodiment is a step of amplifying cDNA and creating a cDNA library. Amplification can be performed by various amplification methods well known to those skilled in the art. In one embodiment of the invention, amplification is carried out by polymerase chain reaction (PCR), isothermal amplification (Walker et al., "Strand displacement amplification--anisothermal, invitro DNA amplification technique", Nucleic Acids Res., Vol. 20 (No. 7)). : Isothermal amplification on pages 1691-6 (1992), ligase chain reaction (LCR; Landegren et al., "A Ligase-Mediated Gene Detection Technique", Science, Volume 241: 1077-1080, 1988, or Wiedmann et al. , "Ligase Chain Reaction (LCR)-Overview and Applications", PCR Methods and Applications (Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY, 1994), ligase chain reaction in S51-S64), transcription, etc. Nucleic acid sequence-based amplification system (TAS), nucleic acid sequence-based amplification (NASBA; Kievits et al. (1991), J Virol Methods, Vol. 35: pp. 273-286), rolling circle amplification (RCA; Liu et al., “Rolling circle DNA synthesis” : Small circular oligonucleotides as modulus templates for DNA polymerases ”, J. Am. Chem. Soc., Volume 118: Rolling circle amplification in pp. 1587-1594 (1996), transcription mediation amplification (TMA; Vuorinen et al. (1995)) ), J Clin Microbiol, Vol. 33: pp. 1856-1859), self-sustaining sequence replication (3SR), Qβ amplification, chain substitution amplification (SDA) (Walker et al. (1992), Nucleic Acids Res , Volume 20 (No. 7): pp. 1691-6), Multiple Substitution Amplification (MDA) (Dean et al. (2002), Proc Natl Acad Sci USA, Volume 99 (No. 8): 52 61-5266), Restriction aided RCA (Wang et al. (2004), GenomeRes, Vol. 14, pp. 2357-2366), Isothermal amplification with a single primer (SPIA; Dafforn et al. (2004), Biotechniques, Vol. 37 (No. 5): pp. 854-7), Loop-mediated isothermal amplification (LAMP; Notomi et al. (2000), Nucleic Acids Res, Vol. 28 (No. 12): e63), Transfer-mediated amplification (TMA) , Helicase-dependent amplification (HDA), Thermal stability HDA (tHDA) (An et al. (2005), J Biol Chem, Vol. 280 (No. 32): pp. 28952-28958), smart-amplification process ) (SMAP; Mitani et al. (2007), Nat Methods, Volume 4 (No. 3): pp. 257-62)), Quantitative real-time PCR (qPCR), reverse transcription PCR (RT-PCR), and Sanger sequencing. Perform by the method selected from the group. Preferably, amplification is performed by PCR.

In step e-10) of this embodiment, each cDNA in the library is sequenced and sequence data is acquired. For sequences in which sequenced reads were mapped to human tRNA sequences and aligned to at least 25 nucleotides at the 3'end of the tRNA sequence without mismatch, the reads with CCA at the 3'end were derived from aminoacylated tRNA. The reads ending at the 3'end CC were considered to be derived from unaminoacylated tRNA. The aminoacylation rate is calculated from the total number of reads including 3'end CCA and CC and the ratio of 3'end CCA.

In this embodiment, preferably, RNA extracted from a biological sample is subjected to size fractionation to extract 50-150 nt RNA, and the subsequent steps are performed. Typically, it is 20-150 nt (nucleotide length) RNA, and specifically, 20-80 nt RNA is used. Preferably, tRNA, microRNA derived from tRNA, for example, tRF or tRNA half having a 3'end of tRNA (Raina, M. & Ibba, M. tRNAs as regulators of biological processes. Frontiers in genesics 5, 171 (2014)). , And RNA having tRNA-like activity, eg, an RNA synthesis product having tRNA-like activity having a 3'end of tRNA.

In the present embodiment, in measuring the aminoacyllation rate of tRNA-functional RNA represented by tRNA, the ratio of the expression level of aminoacylated RNA to the total expression amount of aminoacylated RNA and non-aminoacylated RNA. Is calculated.

In this embodiment, RNA extracted from a biological sample needs to be demethylated. The demethylation treatment is the same as the method in the i-tRAP method of the present invention.

As another embodiment, the present invention is an assay kit used in the method of the present invention for comprehensively measuring the "base sequence, expression level and amino acylation rate" of tRNA-functional RNA.
A-10) tRNA-adapter that connects to the 3'-end and 5'-end of functional RNA,
B-10) RT primer containing a sequence complementary to the sequence of the adapter,
C-10) RNA ligase for the adapter, and d-10) a kit containing a demethylase.

Both the i-tRAP method and the simplified aminoacylated tRNAseq method for evaluating the tRNA aminoacylation rate in the present invention can be used for evaluating the functional intracellular amino acid concentration. "Functional amino acid" means an amino acid actually used for protein synthesis in a cell, that is, an aminoacylated amino acid. For example, in cancer cells, certain anti-cancer drug treatments reduce the intracellular amino acid concentration of the cancer cells, thereby reducing the activity of the cancer cells and suppressing protein synthesis to induce cell death. .. At this time, by measuring the tRNA aminoacylation rate in cancer cells and confirming whether or not the functional amino acid concentration is actually decreased, it can be applied to the determination of the therapeutic effect and the selection of the therapeutic drug. In the measurement of intracellular amino acid concentration in cancer cells, for example, it is assumed that the amino acid content differs depending on the acquired cancer tissue. The issue is what to do with the concentration measurement and measurement method when amino acids are low. Therefore, it is considered meaningful to evaluate not only the intracellular amino acid concentration measurement but also the aminoacylation level. In addition, as revealed in Examples 6, 7 and 8 below in the present specification, even if the amino acid concentration decreases, it does not affect the aminoacylation rate of tRNA as long as the degree of decrease is slight. .. When the concentration drops below a certain level, the aminoacylation rate of tRNA decreases, which affects protein synthesis and the like.

<Screening method>
As another aspect, the present invention provides a method for screening a substance that varies the aminoacylation rate of tRNA.
Specifically, the present invention is a method for screening a substance that changes the aminoacylation rate of tRNA.
a-20) Add the test substance to the cells and add
b-20) Measure the aminoacylation rate of tRNA in the cells, and
c-20) When the measured value is changed compared to the case where the aminoacyllation rate is measured in the absence of the test substance, the test substance is a substance that changes the aminoacylation rate of tRNA. Regarding the method of determining that there is. Hereinafter, a specific description will be given.

The "cell" in the present invention is not particularly limited as long as it is a cell expressing a protein, and is obtained from a living body capable of detecting a change in the rate in a test substance using the "aminoacyllation rate of tRNA" as an index. Any cell may be used. For example, as cells that can be used, blood, spinal fluid, semen, brain, heart, kidney, liver, lung, spleen, blood vessels, blood cells, muscles, fat, skin, pancreas, which are obtained from humans or animals such as pets and domestic animals. Examples include living-derived cells selected from the intestine, endocrine system, nerves, and sensory organs, as well as cultured cells. Examples of cultured cells include CHO (Chinese hamster ovary), HEK293 (human fetal kidney), adenoviral vector packaging cells, HL-60 (derived from human leukemia cells), HeLa (derived from human cervical cancer), MDCK. (Canine kidney epithelium, epithelial cells), NIH3T3 (mouse fetal skin), PC12 (rat adrenal medulla-nerve cell differentiation), S2 (Drosophila-recombinant protein expression), Sf9 (Spodoptera frugiperda (moth)-recombinant protein expression) ), Vero (African Midori monkey kidney-virus infection experiment, measurement of verotoxin activity), etc., including primary culture and immortalized cell types established from humans and animals, and genetic variants of these cells. can.

The term "test substance" in the present invention is used to test any natural or non-natural molecule, such as a biological polymer such as a nucleic acid, polypeptide or protein, an organic or inorganic molecule, or an organism for testing the activity of interest. It means an extract prepared from a scientific material such as a cell or tissue such as a bacterium, a fungus, a plant or an animal, particularly a mammal, a human or the like. Not limited, but refers to natural and non-natural compound libraries, medicinal plant extracts, peptides, antibodies, nucleic acid libraries, etc. owned by universities, companies, etc.

The cells used in the screening method of the present invention can be prepared by a technique well known to those skilled in the art, and the cells can be obtained, for example, by collecting blood from a patient or a healthy person or by biopsy.

The cells used in the present invention are cultured according to standard cell culture techniques. For example, cells are placed in a suitable container in an incubator containing a humidified 5% CO2 atmosphere and grown in a sterile environment at 37 ° C. The container contains agitated or standing medium. As the medium, various cell culture media may be used, and for example, a medium containing fetal bovine serum or the like, 293SFM serum-free medium (Invitrogen Corp., Carlsbad, CA) can be used. Cell culture techniques are well known in the art and established protocols are available for culturing a variety of cell types (eg, R.I. Freshney, "Culture of Animal Cells: A Manual of Basic Technique", See 2nd Edition, 1987, Alan R. Liss, Inc.).

In a particular embodiment, the screening method of the present invention is performed using cells contained in a plurality of wells of a multi-well assay plate. Such assay plates include, for example, Stratgene Corp. (La Jolla, CA) and Corning Inc. (Acton, MA) commercial products, including, for example, 48-well, 96-well, 384-well, and 1536-well plates. ..

Whether or not the test substance changes the aminoacyllation rate of tRNA can be easily determined by the i-tRAP method or the simplified aminoacyl-tRNAseq method of the present invention according to the method described in the present specification.

Specifically, the screening method of the present invention is useful for the treatment or prevention of diseases. For example, if there is a cell corresponding to mitochondrial disease, for example, a cell derived from a mitochondrial disease patient or a cell derived from a mitochondrial gene disease model mouse, it can be used. Various causes of mitochondrial disease are known, but when they are derived from tRNA, aminoacylation becomes difficult. Therefore, a substance that improves the aminoacylation rate may be screened. Thereby, substances that can treat or prevent mitochondrial disease can be screened.

Mitochondrial diseases represented by MELAS show various symptoms such as short stature, general muscle atrophy, hearing loss, diabetes, headache, epileptic seizures, and lactic acidosis, and the most characteristic symptom is recurrent stroke-like seizures. Mitochondrial disease causes symptoms such as sudden inability to speak, half of the visual field, and paralysis of limbs, such as a stroke. While repeating these stroke-like attacks, disorders of physical function and cognitive function accumulate. A mutation in the tRNA gene encoded by mitochondrial DNA (mtDNA) is known to be the cause of patients with mitochondrial diseases such as MELAS (Transfer RNA and human disease Jamie A. Abbott, Christopher S. Francklyn and Susan M. Robey-Bond. Front. Genet., 2014).

In the case of a specific cancer, there is a cancer that highly requires a specific amino acid, for example, methionine, and in that case, if a substance that lowers the aminoacylation rate of that amino acid can be screened, a substance that can treat or prevent the specific cancer. It will be possible to obtain it.

The screening method of the present invention can be made into a kit. For example, the cells disclosed herein can be packaged in various containers such as vials, tubes, microtiterwell plates, bottles, and other reagents can be included in another container to form a kit. This includes a positive control sample or compound, a negative control sample or compound, a buffer solution, a cell culture solution, a specific detection probe, and the like, which can be collectively referred to as a kit.

The present invention, as another embodiment, is a method for screening a substance that changes the aminoacylation rate of tRNA.
a-30) Administer the test substance to the animal and
b-30) Collect cells of a predetermined organ from the animal and collect them.
c-30) Measure the aminoacylation rate of tRNA in the cells, and
c-30) When the measured value is changed compared to the case where the aminoacyllation rate is measured in the absence of the test substance, the test substance is a substance that changes the aminoacylation rate of tRNA. Regarding how to determine that there is. Hereinafter, a specific description will be given.

The "animal" in the present invention includes wild-type mice, rodents such as rats, animals often used in animal experiments such as marmosets and monkeys, or genetically modified substances thereof.

The "predetermined organ" in the present invention means blood, urine, spinal fluid, saliva, tears, semen, brain, heart, kidney, liver, lung, spleen, blood vessel, blood cell, muscle, fat, skin, pancreas, intestine. , Endocrine, nerve, sensory.

The "cell" in the present invention is not particularly limited as long as it is a cell expressing a protein, and is obtained from a living body capable of detecting a change in the rate in a test substance using the "aminoacyllation rate of tRNA" as an index. Any cell may be used. For example, as cells that can be used, blood, spinal fluid, semen, brain, heart, kidney, liver, lung, spleen, blood vessels, blood cells, muscles, fat, skin, pancreas, which are obtained from humans or animals such as pets and domestic animals. Examples include living-derived cells selected from the intestine, endocrine system, nerves, and sensory organs, as well as cultured cells. Examples of cultured cells are the same as above.

The term "test substance" in the present invention is as described above. In certain embodiments, the screening method of the invention is performed using cells contained in multiple wells of a multi-well assay plate, as described above. Whether or not the test substance changes the aminoacyllation rate of tRNA can be easily determined by the i-tRAP method or the simplified aminoacylated tRNAseq method of the present invention according to the method described herein.

Specifically, the screening method of the present invention is useful for the treatment or prevention of diseases as described above. For example, substances that can treat or prevent mitochondrial diseases and cancer, that is, substances that can improve the abnormal aminoacylation rate (charge rate) occurring in these diseases, can be screened.

<Pharmaceutical composition>
In another aspect, the present invention relates to a pharmaceutical composition comprising a substance that varies the aminoacylation rate of tRNA, for adjusting the effect on a biological and physiological process in a subject. Specifically, the substance that changes the aminoacylation rate of tRNA is the substance that is screened by the screening method of the present invention.

Substances that change the aminoacyllation rate of tRNA include substances that increase the aminoacylation rate and substances that decrease the aminoacylation rate. Aminoacylation rate increasing substances are specifically selected from amino acids, proteins synthesis inhibitors (eg, cyclohexamides), etc., and aminoacylating rate decreasing substances are specifically aminoacylase enzyme inhibitors. (Eg, mupyrosine, borelidine, halofuginone, neomycin, pentamidin, purpuromycin), autophagy lithosome inhibitors (eg, chlorokin), proteasome inhibitors (eg, MG132), and inhibitors of integrated stress response (eg, eg). It is selected from ISRIB) and so on.

In the present invention, the "subject" of "adjusting the effects on biological and physiological processes in a subject" means a human or an animal such as a pet or livestock.
In the present invention, "coordinating the effects on biological and physiological processes" is an event related to one or more selected from cell activity, nutritional status, body, mental and pathological conditions in a subject. Means to adjust the effect on.
In the present invention, "adjusting the effect" means returning it to a desirable state if it is a bad effect, returning it to a good state if it is not bad but not good. .. In particular, it means improving indicators of health and illness.
In the present invention, specific examples of "events related to one or more selected from cell activity, nutritional status, physical, mental and pathological conditions in a subject" are, for example, mitochondrial diseases, age-related diseases, and the like. One or more selected from lifestyle-related diseases, mental diseases, intractable diseases, hereditary diseases, life-course-related diseases, digestive diseases, cancers, cardiovascular diseases, kidney diseases and neurological diseases.

Mitochondrial disease is a general term for diseases that occur due to functional deterioration in mitochondria that are present in cells throughout the body and have the function of producing energy. Causes blood flow disorders and motility disorders in muscle cells. Mitochondrial diseases include, for example, MELAS, which presents with various symptoms such as short stature, generalized muscle atrophy, hearing loss, diabetes, headache, epileptic seizures, and lactic acidosis, and the most characteristic symptom is recurrent stroke-like seizures.

Aging-related diseases mean senile syndrome associated with aging phenomena and functional changes in the body organs of the elderly, and include various symptoms. For example, dizziness, shortness of breath, abdominal mass, chest and abdominal water, headache, consciousness disorder, insomnia, fall, fracture, abdominal pain, jaundice, lymph node swelling, diarrhea, hypothermia, obesity, sleep breathing, assuming no change with age. Disorders, edema, and nausea are included, and those that increase in the elderly in the early stages include dementia, dehydration, paralysis, bone joint deformity, decreased vision, fever, joint pain, lower back pain, sputum, coughing, and asthma. , Loss of appetite, edema, leanness, numbness, speech disorders, nausea and vomiting, constipation, dyspnea, weight loss, and increased in older people include decreased ADL, osteoporosis, vertebral fractures, difficulty swallowing, urine Incontinence, frequent urination, edema, depression, decubitus, hearing loss, anemia, hyponutrition, bleeding tendency, chest pain, arrhythmia.

Lifestyle-related diseases are a general term for diseases caused by lifestyle-related diseases. Lifestyle-related diseases such as cancer, cerebrovascular disease, cardiovascular disease, which are the three major causes of death in Japan, as well as arteriosclerosis, diabetes, hypertension, and dyslipidemia, which are risk factors for cerebrovascular disease and cardiovascular disease. I'm sick.

Mental illnesses include, for example, Alzheimer's disease, vascular dementia, Levy body dementia, dementia, alcohol addiction, caffeine addiction, drug addiction, schizophrenia, depression, panic disorder, Asperger syndrome, PTSD, ADHD, bipolar. Sexual disorders, anxiety disorders, compulsive disorders, adaptation disorders, dissecting disorders, feeding disorders, sleep disorders, sexual identity disorders, intellectual disorders, developmental disorders, tic disorders, drug addiction, addiction, alcohol addiction, gambling Addiction, personality disorder, withdrawal, neurological hyperphagia, learning disorder, organic psychiatric disorder, acute stress disorder, neurological thinness, borderline personality disorder, autism spectrum disorder, puerperal psychiatry, postoperative psychiatric illness, symptomatic psychiatry Disorders, psychosis, frontotemporal dementia, general anxiety disorders, social anxiety disorders, dementia, drug addiction, divorce disorders, senile depression, senile psychiatric disorders, Turret syndrome, anxiety , Drug addiction.

Intractable diseases mean diseases that are particularly difficult to treat, have long-lasting medical conditions, and place a heavy burden on daily life, including, for example, 333 designated intractable diseases, which include systemic erythematosus belonging to the family of allergies and rheumatism, microscopic polyangiitis. Vascular inflammation, eosinophilic polyangiitis granulomatosis; Parkinson's disease / Parkinson's syndrome belonging to neurology, polysclerosis, optic neuromyelitis; interstitial pneumonia belonging to respiratory medicine, refractory asthma; digestive organs Inflammatory bowel disease (Clone's disease / ulcerative colitis) belonging to internal medicine, liver cirrhosis, bile duct stone disease; idiopathic dilated myocardial disease belonging to cardiovascular medicine, cardiac amyloidosis; advanced deformity and osteotomy belonging to bone / joint orthopedic surgery Postoperative hip osteoarthritis; diabetic foot lesions belonging to dermatology; ANCA-related vasculitis otitis media belonging to otolaryngology, eosinophilia otolitis / eosinophilia sinusitis; complete macrovascular metastasis belonging to pediatrics Diseases, single room disease, Farrow quadruple disease, bilateral right ventricular origin, etc.

Hereditary disorders are syndromes with chromosomal or genetic changes, such as the following disorders:
Coffin-Lowry Syndrome, Sotos Syndrome, Smith-Magenis Syndrome, Rubinstein-Taybi Syndrome, Kabuki Syndrome, Weaver Syndrome, Cornelia Delange ( Cornelia de Lange Syndrome, Beckwith-Wiedemann Syndrome, Angelman Syndrome, 5p-Syndrome, 4p-Syndrome, Trisomy 18 Syndrome, Trisomy 13 Syndrome, Down Syndrome, Autosomal Abnormality ( Excluding Williams Syndrome and Prader-Willi Syndrome), CFC (cardio-facio-cutaneous) Syndrome, Marfan Syndrome, Royce Dietz Syndrome, Kamrathi Engelmann Syndrome, Costello ( Costello Syndrome, CHARGE Syndrome, Harraman Strife Syndrome, Pigment Impairment, Antley-Bixler Syndrome, Pfeiffer Syndrome, Coffin-Siris Syndrome, Simpson Gorabi Syndrome Simpson-Golabi-Behmel Syndrome, Smith-Lemli-Opitz Syndrome, Moebius Syndrome, Mowat-Wilson Syndrome, Young-Simpson Syndrome, VATER syndrome, MECP2 duplication syndrome, Takeuchi / Kozaki syndrome.

Life course-related illnesses develop after the biological, sociological, and psychological risks of health and illness are mutually accumulated, linked, and modified in the course of life throughout childhood, adolescence, and adulthood. It means chronic diseases after puberty and diseases in the previous stage. It is a disease concept derived from life course epidemiological studies.

Gastrointestinal disorders are disorders related to the gastrointestinal tract (esophagus, stomach, duodenum, small intestine, large intestine), liver, bile sac, pancreas, etc., and examples thereof include the following disorders:
Esophageal inflammation, gastroesophageal reflux disease, esophageal fissure hernia, esophageal varices, esophageal diverticulum, acute gastric inflammation, chronic gastric inflammation, ulcerative disease, gastric ulcer, duodenal ulcer, stress ulcer, steroid ulcer, helicobacter pylori, gastric ptosis, gastric atony, Duodenal diverticulum, gastric neuropathy, etc., infectious enteritis, acute colitis, abscess, chronic enteritis, ulcerative colitis, Crohn's disease, ischemic colitis, intestinal obstruction (ireus), obstructive (simple) ireus, strangulation (simple) Complexity) ileus, paralytic ileus, spasmodic ileus, irritable bowel syndrome, colonic diverticulum, malabsorption syndrome, gastric neuropathy, etc. , Viral hepatitis, congestive liver, hypertonic hypertension, fatty liver, liver abscess, liver abscess, hepatic abscess, hepatic hemangiomas, intrahepatic stones, pancreatitis, acute pancreatitis, chronic pancreatitis, pancreatic cysts, cholelithiasis (biliary duct) Stones / cholecystic stones), cholecystitis (acute cholecystitis / chronic cholecystitis), bile ductitis, total bile duct dilatation, cholecystic polyp.

Cancer is also called malignant tumor or malignant neoplasm, and includes cancer, sarcoma, leukemia and malignant lymphoma. For example, the following cancers:
Brain cancer, head and neck cancer, salivary adenocarcinoma, thyroid cancer, lung cancer, small cell lung cancer, breast cancer, mesenteric tumor, pancreatic cancer, liver cancer, biliary tract cancer, esophageal cancer, stomach cancer, GIST, small intestinal cancer , Colon cancer (colon cancer / rectal cancer), bile cancer, bile duct cancer, kidney cancer, renal pelvis / urinary tract cancer, bladder cancer, prostate cancer, cervical cancer, ovarian cancer, Uterine sarcoma, malignant lymphoma, leukemia, chronic lymphocytic leukemia (CLL), multiple myeloma, skin cancer, melanoma (malignant melanoma), sarcoma, cancer of unknown primary origin.

Cardiovascular disease, also called heart disease, is a disease of the coronary or aortic arteries connected to the heart and diseases of the circulatory system such as the heart itself. For example:
Angina, myocardial infarction, aortic aneurysm, aortic dissection, valvular disease, myocardium, atrial septal defect, heart tumor, heart failure, arrhythmia, cerebral infarction, cerebral hemorrhage, transient cerebral ischemic attack, obstructive arteriosclerosis ,heart failure.

Kidney diseases include nephritis caused by inflammation of the kidney and those that cause glomerular damage due to systemic diseases such as diabetes. For example:
Primary glomerular disease (nephritis) such as IgA nephropathy; secondary glomerular disease (nephritis) such as lupus nephritis, nodular polyarteritis, microscopic polyangiitis, diabetic nephropathy, nephrosclerosis; nephrosis syndrome Acute kidney injury (AKI); Chronic kidney disease (CKD); Chronic kidney disease.

Neurological disease is a general term for diseases that cause movement disorders due to lesions of the nerve itself such as the brain, spinal cord, and peripheral nerves or lesions of the muscle itself. For example:
Epilepsy, headache, stroke, Alzheimer's disease, Lewy body dementias, vascular dementia, Parkinson's disease, Parkinson's syndrome, ataxia, neuritis, meningitis, encephalitis, severe myopathy, immune neuropathy, metabolic・ Hereditary neuropathy, myopathy, muscular dystrophy, polymyositis, acute consciousness disorder, acute encephalopathy, amyotrophic lateral sclerosis (ALS), bulbous spinal cord atrophy.

The present invention, as a further embodiment, relates to a pharmaceutical composition containing a tRNA inhibitor for adjusting the effect on a biological and physiological process in a subject. In the present invention, the "tRNA inhibitor" is specifically one or more selected from the group consisting of siRNA, shRNA, miRNA, antisense and ribozyme.

In the present invention, "inhibition" of "inhibitor" means to inhibit tRNA expression or suppress tRNA activity.

In the present invention, examples of the substance that inhibits the expression of tRNA include a substance that inhibits the expression of the gene or nucleic acid shown in any of the following a-100) to d-100):
a-100) Each tRNA gene,
b-100) Nucleic acid containing a base sequence in which one or several bases are deleted, substituted or added in each tRNA gene,
c-100) Nucleic acid with a base sequence of 90% or more identity with the base sequence of each tRNA gene,
d-100) Nucleic acid that hybridizes with a base sequence complementary to each tRNA gene under stringent conditions.

In the above b-100), "one or several" may be, for example, a range in which the gene of the above b-100) encodes a substance having a tRNA function. "1 or several" is, for example, 1 to 10, preferably 1 to 7, more preferably 1 to 5, still more preferably 1 to 3, and particularly preferably 1 or 2 in the tRNA gene. be.

In the above c-100), "identity" is synonymous with homology or similarity. "90% or more" is preferably 93% or more, more preferably 95% or more, still more preferably 98% or more.

In the above d-100), the "stringent condition" may be, for example, any of a low stringent condition, a medium stringent condition, and a high stringent condition. "Low stringent conditions" are, for example, 5 × SSC, 5 × Denhardt solution, 0.5% SDS, 50% formamide, 32 ° C. The "medium stringent conditions" are, for example, 5 × SSC, 5 × Denhardt solution, 0.5% SDS, 50% formamide, 42 ° C. "High stringent conditions" are, for example, 5 × SSC, 5 × Denhardt solution, 0.5% SDS, 50% formamide, 50 ° C. The degree of stringency can be set by those skilled in the art by appropriately selecting conditions such as temperature, salt concentration, probe concentration and length, ionic strength, and time. "Stringent conditions" are, for example, "Molecular Cloning: A Laboratory Manual 2nd Ed." Edited by Sambrook et al. [Cold Spring Harbor Laboratory Press (1989). )] Etc. can also be adopted.

In the present invention, in the embodiment of inhibiting the expression of a gene or nucleic acid, the gene or nucleic acid (hereinafter, may be referred to as “target nucleic acid”) is specifically any of the following a-100) to d-100). One or more selected from the group consisting of siRNA, shRNA, miRNA, antisense and ribozyme that inhibit the expression of the gene or nucleic acid shown in the above.

SiRNA (small interfering RNA) is a 21-23 base pair small double-stranded RNA used for gene silencing by RNA interference. The siRNA introduced into the cell binds to RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNA with a sequence complementary to siRNA. This suppresses gene expression in a sequence-specific manner. For siRNA, sense strand and antisense strand oligonucleotides are synthesized by a DNA / RNA automatic synthesizer, respectively, and denatured in an appropriate annealing buffer at 90 to 95 ° C for about 1 minute, and then 30 to 70 ° C. It can be prepared by annealing in for about 1 to 8 hours.

ShRNA (short hairpin RNA) is a hairpin-type RNA sequence used for gene silencing by RNA interference. The shRNA may be introduced into cells by a vector and expressed by the U6 promoter or the H1 promoter, or an oligonucleotide having an shRNA sequence may be synthesized by a DNA / RNA automatic synthesizer and self-annealed by the same method as siRNA. May be prepared by. The hairpin structure of the shRNA introduced into the cell is cleaved into siRNA and binds to RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNA with a sequence complementary to siRNA. This suppresses gene expression in a sequence-specific manner.

MiRNA (microRNA, microRNA) is a functional nucleic acid encoded on the genome and finally becomes a microRNA of about 20 bases through a multi-step production process. miRNAs are classified as functional ncRNAs (non-coding RNAs, non-coding RNAs: a general term for RNAs that are not translated into proteins), and play an important role in life phenomena by regulating the expression of other genes. There is. By administering a miRNA having a specific base sequence to a living body, the expression of tRNA can be inhibited.

The ribozyme of the present invention means an RNA molecule that specifically cleaves another single-stranded RNA molecule by a mechanism similar to that of a DNA-restricted endonuclease. By appropriately modifying the nucleic acid sequence of RNA by a known method, it is possible to prepare a ribozyme that recognizes and cleaves a specific base sequence in a single strand of RNA (Science, 239, p. 1412-1416, 1988). ..

Antisense nucleic acid is a nucleic acid complementary to the target sequence. Antisense nucleic acids inhibit transcription initiation by triple-strand formation, transcriptional repression by hybrid formation with a site where an open loop structure is locally formed by RNA polymerase, and transcriptional inhibition by hybrid formation with RNA whose synthesis is progressing. Suppression of splicing by hybrid formation at the junction of intron and exson, suppression of splicing by hybrid formation with sprisosome formation site, suppression of transcription from nucleus to cytoplasm by hybrid formation with mRNA, capping site and poly (A) addition site Suppression of splicing by hybrid formation with, suppression of translation initiation by hybrid formation with translation initiation factor binding site, translation inhibition by hybrid formation with ribosome binding site near the initiation codon, by hybrid formation with RNA translation region or polysome binding site The expression of the target gene can be suppressed by inhibiting the elongation of the peptide chain, suppressing the gene expression by forming a hybrid between the interaction site between the nucleic acid and the protein, and the like.

The siRNA of the present invention refers to a double-stranded RNA that suppresses the expression of a target nucleic acid, and means "RNAi agent", "short-chain interfering RNA", "short-chain interfering nucleic acid", "siRNA", and is sequence-specific. A nucleic acid molecule capable of inhibiting or downwardly regulating gene expression or viral replication through RNA interference (RNAi) or gene silencing. It may consist only of RNA or it may be a fusion of DNA and RNA.

SiRNAs, shRNAs, miRNAs, ribozymes and antisense nucleic acids may contain various chemical modifications to improve stability and activity. For example, in order to prevent degradation by a hydrolase such as a nuclease, the phosphate residue may be replaced with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, or phosphorodithionate. Further, at least a part thereof may be composed of a nucleic acid analog such as peptide nucleic acid (PNA).

As another embodiment, the present invention relates to a pharmaceutical composition containing a specific tRNA or an analog thereof for reducing the influence on biological and physiological processes in a subject. Typically, by transfecting a particular tRNA or an analog thereof into a subject, the aminoacylation rate of the particular tRNA and the protein translation efficiency of the amino acid encoded by the particular tRNA are increased in the subject. A pharmaceutical composition that treats or prevents mitochondrial disease.

In such an embodiment, the "specific tRNA" means tRNA of the causative gene of mitochondrial disease, tRNA whose aminoacylation rate fluctuates due to cancer or the like, and tRNA-Gln which reflects the state of nutrition and aging. do.
Further, "analog of a specific tRNA" means a synthesized unnatural tRNA.
Mitochondrial disease is as described above.

<Judgment method>
The present invention, as another aspect, is a method for determining the presence or absence of an effect on a biological and physiological process in a subject.
a-40) Step of measuring the aminoacylation rate (test aminoacylation rate) of tRNA in the cells of the subject,
b-40) A step of comparing the test aminoacylation rate with the aminoacyllation rate of tRNA of the reference cell (control aminoacylation rate), and
c-40) When the test aminoacylation rate fluctuates compared to the control aminoacylation rate, the subject has an effect on the biological and physiological processes in the subject. Regarding the method of determination.

As described above, the "effect on biological and physiological processes in a subject" in such an embodiment of the present invention is one selected from among cell activity, nutritional status, body, mental and pathological conditions in a subject. Or more related events, such as mitochondrial disease, age-related disease, lifestyle disease, mental illness, intractable disease, hereditary disease, life course-related disease, gastrointestinal disease, cancer, cardiovascular disease One or more selected from diseases, kidney diseases and neurological diseases.

In the present invention, "control aminoacyllation rate" typically means the aminoacylation rate obtained from a sample derived from a healthy person if the subject has adverse effects on biological and physiological processes. do. For example, when investigating whether or not a certain treatment method is functioning well, the control aminoacyllation rate is the aminoacylation rate of a subject before treatment, and aminoacylation in the same subject after treatment. The rate is the test aminoacylation rate. Further, for example, when tracking the diurnal variation in the case of sleep disorder, the aminoacylization rate at a certain time is set as the control aminoacylation rate, and the aminoacylation rate at another time is set as the test aminoacylation rate.

<Gene therapy>
In another aspect, the invention reduces the aminoacylation rate of the corresponding tRNA by knocking down a nucleic acid molecule encoding a particular aminoacyl-tRNA synthetase, thereby biologically and physiologically in the subject. On how to mitigate the impact on the process.
"Effects on biological and physiological processes in a subject" are, for example, one or more related events selected from among cellular activity, nutritional status, body, psychiatry and pathology. The events are specifically mitochondrial disease, age-related disease, lifestyle disease, mental illness, intractable disease, hereditary disease, life course-related disease, digestive disease, cancer, cardiovascular disease, kidney disease and neurology. One or more selected from the diseases.

The "specific aminoacyl-tRNA synthetase" means an aminoacyl-tRNA synthetase that is a causative gene of a disease and an aminoacyl-tRNA synthetase that is responsible for aminoacylation of the causative tRNA mutation. For example, for cancers that require high methionine, it is a methionylaminoacyl-tRNA synthetase responsible for aminoacylation of methionine. Further, as described above, in the case of MELAS, a mitochondrial-leucine tRNA synthesizer that adds leucine to mitochondrial leucine tRNA can also be mentioned.
In the case of suppressing the response of tRNA to amino acids, and in the case of aging, preferably the particular aminoacyl-tRNA synthesizer is a glutaminyl tRNA synthesizer.

It is considered that the present invention can reduce the influence on the biological and physiological processes in the subject by knocking down the nucleic acid molecule encoding a specific aminoacyl-tRNA synthetase. Here, the present invention relates to cells, organs and / or tissues having a disrupted gene in a nucleic acid molecule encoding a particular aminoacyl-tRNA synthetase. For example, disruption is expected to be a gene that exhibits at least about 50%, 60%, 70%, 80%, 90%, 99% or 100% homology (at the nucleic acid or protein level). Gene suppression is also possible. For example, gene expression can be reduced by knockdown, promoter modification of the gene, and / or administration of interfering RNA. In particular, it is preferable to knock down the expression of a nucleic acid molecule encoding a specific aminoacyl-tRNA synthetase in cells such as cancer cells, which preferably suppress proliferation. In addition, although cancer cells with high methionine requirement are known among cancer cells, amino acid requirement is also high in addition to methionine. For example, the requirements of arginine, serine, glutamine, asparagine, etc. are also known (Garcia-Bermudez, J., Williams, R. T., Guarecuco, R. & Birsoy, K. Targeting extracellular nutrient dependencies of cancer cells. Molecular metabolism 33, 67-82 (2020)), it is preferable to knock down the expression of nucleic acid molecules encoding specific aminoacyl-tRNA synthesizers in each cancer cell.

One or more genes in human or non-human animals can be knocked down using any method known in the art. For example, it involves deleting the gene for a particular aminoacyl-tRNA synthesizer from the genome of a human or non-human animal. Knockdown can also include removing all or part of a particular aminoacyl-tRNA synthetase gene sequence from a non-human animal. Knockdown can be performed on any cell, organ and / or tissue in human or non-human animals. For example, a knockdown can be a whole body knockout. For example, the expression of the gene for a particular aminoacyl-tRNA synthesizer is reduced in all cells of non-human animals. Knockdown can also be specific for one or more cells, tissues and / or organs of human or non-human animals.

Any combination of knockdown technology is possible. For example, tissue-specific knockdown can be combined with inducible technology to create tissue-specific inducible knockouts. In addition, other systems, such as development-specific promoters, can be used in combination with tissue-specific promoters and / or inducible knockouts. Knockdown techniques can also include gene editing. For example, gene editing can be performed using nucleases that include CRISPR-related proteins (Cas proteins such as Cas9), zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs) and meganucleases. The nuclease can be a naturally occurring nuclease, genetically modified, and / or recombinant. For example, the CRISPR / cas system may be suitable as a gene editing system.

<Biomarkers, etc.>
As another aspect of the present invention, one selected from tRNA ^Leu , mt-tRNA ^His , tRNA ^Ser , tRNA ^Asn , tRNA ^Phe , tRNA ^Thr , tRNA ^Ile , tRNA ^Arg , tRNA ^Gln , and mt-tRNA ^Val or More than that, with respect to biomarkers for determining the effects on biological and physiological processes in the subject.
Specifically, tRNA ^Leu -CAG, mt-tRNA ^His -CAC, tRNA ^Ser -CGA, tRNA ^Asn -GTT, tRNA ^Phe -GAA, tRNA ^Ser -GCT, tRNA ^Thr -TGT, tRNA ^Thr ^-CGT , tRNA Ile- Biological and physiological processes in the subject, one or more selected from TAT, tRNA ^Arg -TCT, tRNA ^Gln -CTG, tRNA ^Gln -TTG, and mt-tRNA ^Val -GUA. It is a biomarker for determining the effect on.
Here, the notation of tRNA is the notation for each codon. For example, tRNA ^Gln -CTG, or just "Gln-CTG", means a tRNA whose codon is CTG and Gln is aminoacylated.

In such embodiments, in one embodiment, the effect on the biological and physiological processes in the subject is an event associated with one or more selected from cellular activity, nutritional status, physical, mental and pathological conditions. Is. Specifically, the events include mitochondrial diseases, age-related diseases, lifestyle diseases, mental diseases, intractable diseases, hereditary diseases, life course-related diseases, digestive diseases, cancer, cardiovascular diseases, and kidney diseases. And one or more selected from among neurological disorders.

In one embodiment, the invention relates to biomarkers of tRNA ^Gln and tRNA ^Glu for determining nutritional status, body, and aging. Preferably, it relates to the biomarker of the present invention, wherein the tRNA ^Gln is tRNA ^Gln -CTG.

Further, another aspect of the present invention is selected from among tRNA ^Leu , mt-tRNA ^His , tRNA ^Ser , tRNA ^Asn , tRNA ^Phe , tRNA ^Thr , tRNA ^Ile , tRNA ^Arg , tRNA ^Gln , and mt-tRNA ^Val . With respect to use as a biomarker for determining the effect on a biological and physiological process in a subject in one or more. Specifically, tRNA ^Leu -CAG, mt-tRNA ^His -CAC, tRNA ^Ser -CGA, tRNA ^Asn -GTT, tRNA ^Phe -GAA, tRNA ^Ser -GCT, tRNA ^Thr -TGT, tRNA ^Thr ^-CGT , tRNA Ile- For biological and physiological processes in the subject in one or more selected from TAT, tRNA ^Arg -TCT, tRNA ^Gln -CTG, tRNA ^Gln -TTG, and mt-tRNA ^Val -GUA. It is used as a biomarker to determine the effect. As a biomarker of the present invention, the effect on a biological and physiological process in a subject is an event related to one or more selected from cellular activity, nutritional status, body, psychiatry and pathology. Regarding use. Specifically, the events include mitochondrial disease, age-related disease, lifestyle disease, mental illness, intractable disease, hereditary disease, life course-related disease, digestive disease, cancer, cardiovascular disease, kidney disease and It is used as a biomarker of the present invention, which is one or more selected from neurological diseases. Concerning the use of tRNA ^Gln and tRNA ^Glu as biomarkers for determining nutritional status, body, aging, preferably as biomarkers of the invention, where tRNA ^Gln is tRNA ^Gln -CTG.

Hereinafter, the present invention will be described in detail by way of examples, but it should be noted that these do not limit the scope of the present invention and are merely examples.

Sequence of human mature tRNA For the sequence information of tRNA used in the examples, refer to the genomic tRNA database (http://lowelab.ucsc.edu/GtRNAdb/) (Chan, PP, and Lowe, TM (2016). Nucleic. Acids Res. 44, D184-D189.) And the mitochondrial genome sequence (NC_012920) (Andrews et al., 1999) were referenced.
Statistics Unless otherwise noted, either one-way or two-way ANOVA with a two-sided t-test or a Bonferroni post-test was used. Statistical analysis was performed using GraphPad Prism 8 (GraphPad Software). Statistical significance was defined as P <0.05.

Example 1
Comprehensive profile of tRNA aminoacylation rates that reflect nutritional status

A sequence determination method (referred to as "simplified aminoacyl-tRNAseq method" in the present specification), which is an improvement of the previously reported scheme (Non-Patent Document 21) for determining the aminoacylation rate of tRNA, was developed and naturally established. We comprehensively profiled the aminoacylation status of tRNA in amino acid starvation and amino acid supplementation in human diploid fibroblasts.

Example 1-1: Preparation of cells TIG-1 cells (Ohashi, M., Aizawa, S., Ooka, H.), which are naturally established human diploid fibroblasts without artificial immortalization treatment. , Ohsawa, T., Kaji, K., Kondo, H., Kobayashi, T., Noumura, T., Matsuo, M., Mitsui, Y., et al. (1980). Exp. Gerontol. 15, 121 -133.) Was obtained from the JCRB (Japanese Collection of Research Bioresources) Cell Bank (TIG-1; # JCRB0501), National Institute of Pharmaceutical Sciences, Health and Nutrition. Cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Nakaraitesk, Kyoto) supplemented with 10% fetal bovine serum (Gibco, Waltham, Mass.) And maintained at 37 ° C in a humidified chamber supplemented with 5% CO ₂ . bottom.

Example 1-2: TIG-1 cells cultured under amino acid starvation or amino acid supplementation The TIG-1 cells prepared in Example 1-1 are treated with 0.5% amino acid-free bovine serum as shown in FIG. The cells were cultured in DMEM (Wako, Osaka, Japan) supplemented with fetal bovine serum (Gibco) for 15 hours. Then, for amino acid starvation, TIG-1 cells were cultured for an additional hour in amino acid-free medium (amino acid-free medium). Alternatively, the medium was replaced with a medium containing a MEM essential amino acid solution, a MEM non-essential amino acid solution and a 200 mM glutamine solution (Wako), and further incubated for 1 hour to obtain cells in an amino acid supplemented state.
The TIG-1 cells cultured in the amino acid starvation or amino acid supplemented state thus obtained were collected, and the following operations were carried out for each cell.

Example 1-3: Extraction of RNA Cells prepared and cultured in Example 1-2 using Isogen II reagent (Isogen II, Nippongene, Toyama, Japan) and Ethachin-mate (Nippongene) according to the manufacturer's instructions. RNA was extracted from each. Since Isogen II can extract small RNA (~ 200 nucleotides, small RNA) and large RNA (~ 200 nucleotides ~, large RNA) separately, small RNA was selected here to obtain tRNA. For alkaline treatment, tRNA was incubated with 150 mM Tris-HCl, pH 9.0 at 37 ° C. for 30 minutes.

Example 1-4: Periodic acid oxidation, β desorption and terminal repair of tRNA The extracted tRNA was subjected to periodic acid oxidation, β desorption and terminal repair (Fig. 1).
Periodic acid oxidation of tRNA was carried out with modifications to the previous report (Non-Patent Document 21). Briefly, the resulting small RNA was oxidized in 100 mM CH ₃ COONa, pH 5.2, and freshly prepared 50 mM NaIO ₄ at 27 ° C. for 30 minutes. 100 mM glucose was used at 27 ° C. for 5 minutes to terminate the reaction. In order to purify the tRNA and remove the periodate, the obtained RNA was run on a 15% denatured polyacrylamide gel (5M urea, 1 × TBE, Bio-craft, Tokyo, Japan), and the tRNA was excised and gelled. Was eluted in TE buffer and then precipitated with ethanol. For β-desorption and deacyllation, the purified tRNA was treated with 150 mM Tris-HCl, pH 9.0 at 37 ° C. for 30 minutes, and then ethanol precipitation was performed. The tRNA was then treated with T4 polynucleotide kinase (Thermo Fisher Scientific, Waltham, Mass.) At 37 ° C. for 30 minutes to remove 3'phosphate (terminal repair) and then ethanol precipitation. By these procedures, that is, by treating the extracted small RNA with periodated acid (IO4-), the free 3'end of the non-aminoacylated tRNA is oxidized, followed by β-desorption and β-desorption at weakly basic pH. Treatment with T4 polynucleotide kinase (PNK) results in a "C" of the 3'end nucleotide of the non-aminoacylated tRNA, while the aminoacylated tRNA is deacylated by the same β-desorption step at weakly basic pH. , The 3'end nucleotide of the aminoacylated tRNA becomes "A". See Figure 1.

Example 1-5: Demethylation reaction The demethylation reaction was carried out with modifications to the previous report (Zheng et al., Nat Methods., 2015 Sep; 12 (9): 835-837). Briefly, decapitated AlkB and its D135S mutant (Qing Dai et al., Angew. Chem. Int. Ed. 2017, 56, 5017-5020) with the 11 amino acids at the amino (N) terminal removed. It was cloned into a pETBA vector (Biodynamics Laboratory, Tokyo, Japan) and overexpressed in Zip Competent Cell BL21 (DE3) (Zip Competent Cell BL21 (DE3), Biodynamics Laboratory). Cells were grown at 37 ° C. in the presence of 50 μM ampicillin until OD600 reached 0.5-0.6. After adding 1 mM IPTG and 5 μM FeSO ₄ , cells were incubated at 30 ° C. for an additional 4 hours. Cells were collected, pelleted and resuspended in PBS containing protease inhibitors (cOmplete, Mini, EDTA-free, Roche, Basel, Switzerland). The cells were then lysed by sonication and centrifuged at 3000 g for 10 minutes. The soluble protein decapitation AlkB and its D135S mutant were purified using HisTrap FF Crude (Cytiva, Marlborough, MA) at 4 ° C. In a reaction buffer containing 300 mM KCl, 2 mM MgCl2, 50 μM (NH4) 2Fe (SO4) 2.6H2O, 300 μM 2-ketoglutamate, 2 mM L-ascorbic acid, 50 μg / ml BSA, 50 mM MES buffer (pH 5.0). , The reaction containing the tRNA obtained in Example 1-4 and the decapitated AlkB and its D135S variant was incubated at 27 ° C. for 2 hours. Demethylation is a base modification of the Watson-Crick interface that inhibits reverse transcription (Motorin, Y., Muller, S., Behm-Ansmant, I., and Branlant, C. (2007). Methods Enzymol. 425, 21 -53.) is removed (Trewick, SC, Henshaw, TF, Hausinger, RP, Lindahl, T., and Sedgwick, B. (2002). Nature 419, 174-178.).

Example 1-6: Sequencing of tRNA for measuring aminoacylation rate by next-generation sequencing (NGS) Sequencing of tRNA was carried out with modifications to the previous report (Non-Patent Document 21). Briefly, tRNAs (500 ng) subjected to periodic acid oxidation, β desorption, deaminoacylation, end repair and demethylation as described in Examples 1-4 and 1-5. Was used as a template for making a library. Using the NEBNext Small RNA Library Prep Set for Illumina (New England Biolabs, Ipswich, Mass.) According to the manufacturer's instructions, ligate adapter sequences to both the 5'and 3'ends of RNA to create a small RNAseq library. Prepared. The library size was selected using Super Sep Ace 10-20% (Wako).

Next, the concentration of the cDNA library was quantified using the GenNext NGS Library Prep Kit (TOYOBO, Osaka, Japan). Sequencing was performed on the Illumina Nextseq 500 platform (Illumina, San Diego, CA) in 150-base single-end mode. The output data was demultiplexed and BCL-to-Fastq conversion was performed using Illumina's bcl2fastq software.

The sequenced readings (reads) were mapped to human tRNA sequencing using Blast version 2.2.26 and aligned to the 3'end 25 nucleotides of the tRNA sequence without mismatch. Reads aligned to the 3'end CCA were considered to be derived from aminoacylated tRNAs, and readings terminated at 3'end CCs were considered to be derived from non-aminoacylated tRNAs. That is, the aminoacylation rate of the tRNA is profiled by sequencing the final product of the above procedure, and the aminoacylated and non-aminoacylated tRNAs are 3'terminal CCA (3'CCA-tRNA) and CC (3'CC-), respectively. Distinguished by tRNA).
The aminoacylation rate was determined as the ratio of the readings aligned to the 3'end CCA to the sum of the readings aligned to the 3'end CCA and the 3'end CC. The abundance ratio of the tRNA isodecoder was calculated based on the sum of the 3'end CCA and CC-aligned readings of each isodecoder.

The tRNAs examined here are as follows.
tRNA ^Ala -AGC, tRNA ^Ala -CGC, tRNA ^Ala -TGC;
tRNA ^Arg -ACG, tRNA ^Arg -CCG, tRNA ^Arg -CCT, tRNA ^Arg -TCG, tRNA ^Arg -TCT;
tRNA ^Asn -GTT;
tRNA ^Asp -GTC ；
tRNA ^Cys -GCA;
tRNA ^Gln -CTG, tRNA ^Gln -TTG;
tRNA ^Glu -CTC, tRNA ^Glu -TTC;
tRNA ^Gly -CCC, tRNA ^Gly -GCC, tRNA ^Gly -TCC;
tRNA ^His -GTG;
tRNA ^Ile -AAT, tRNA ^Ile -TAT;
tRNA ^Leu -AAG, tRNA ^Leu -CAA, tRNA ^Leu -CAG, tRNA ^Leu -TAA, tRNA ^Leu -TAG;
tRNA ^Lys -CTT, tRNA ^Lys -TTT;
tRNA ^Met -CAT ；
tRNA ^Phe -GAA ；
tRNA ^Pro -AGG, tRNA ^Pro -CGG, tRNA ^Pro -TGG;
tRNA ^SeC -TCA, tRNA ^Ser -AGA, tRNA ^Ser -CGA, tRNA ^Ser -GCT, tRNA ^Ser -TGA;
tRNA ^Thr -AGT, tRNA ^Thr -CGT, tRNA ^Thr -TGT;
tRNA ^Trp -CCA;
tRNA ^Tyr -GTA ；
tRNA ^Val -AAC, tRNA ^Val -CAC, tRNA ^Val -TAC;
tRNA ^{iMet -CAT} ；
mt-tRNA ^Ala -TGC;
mt-tRNA ^Arg -TCG;
mt-tRNA ^Asn -GTT ；
mt-tRNA ^Asp -GTC ；
mt-tRNA ^Cys -GCA ；
mt-tRNA ^Gln -TTG;
mt-tRNA ^Glu -TTC;
mt-tRNA ^Gly -TCC;
mt-tRNA ^His -GTG ；
mt-tRNA ^Ile -GAT ；
mt-tRNA ^Leu -TAG, mt-tRNA ^Leu -TAA;
mt-tRNA ^Lys -TTT ；
mt-tRNA ^Met -CAT ；
mt-tRNA ^Phe -GAA ；
mt-tRNA ^Pro -TGG;
mt-tRNA ^Ser -GCT, mt-tRNA ^Ser -TGA;
mt-tRNA ^Thr -TGT ；
mt-tRNA ^Trp -TCA;
mt-tRNA ^Tyr -GTA ；
mt-tRNA ^Val -TAC.
Here, the notation of tRNA is the notation for each codon. For example, tRNA ^Gln -CTG, or just "Gln-CTG", means a tRNA whose codon is CTG and Gln is aminoacylated.

Example 1-7: Profile of aminoacylation rate of tRNA by sequencing the final product TRNA sequencing was performed according to Example 1-6, and it was confirmed that the aminoacyllation rate of a subset of tRNA was low under amino acid starvation. (Fig. 3 and Fig. 5). Specifically, it was found that tRNA ^Gln had the lowest aminoacylation rate under amino acid starvation (FIGS. 3 and 5). In addition, it has been reported that the aminoacyllation rate of tRNA ^Ser is low under amino acid starvation (Non-Patent Document 21). Similarly, in this example, the aminoacyl of tRNA ^Ser is included in the subgroup of isoacceptors. The conversion rate was shown to be characteristically low (64.5%, SD = 3.9). Further, in this example, under amino acid starvation, tRNA ^Glu , tRNA ^Tyr and tRNA ^Ala , tRNA ^Pro , tRNA ^Ser and tRNA ^Val derived from mitochondrial DNA were also shown to be low at an average amino acylation rate of less than 1 SD. Is the first event found this time (Figs. 3 and 5).

In addition, the overall aminoacylation rate of tRNA measured by tRNA sequencing was almost unchanged even after 15 hours of starvation in TIG-1 cells (Figs. 2 and 4). On the other hand, in yeast and some cancer cells, it is known that the overall aminoacylation rate decreases after about 1 hour of amino acid starvation (Non-Patent Documents 13 and 15). The overall aminoacylation rate of tRNA measured by tRNA sequencing was higher in TIG-1 cells than in yeast and cancer cells described below (80.7%, SD = 10.6) (Fig. 5). And Figure 4). From the above, it is considered that the aminoacylation dynamics of tRNA differs depending on the species and cell type.

Amino acid supplementation did not change the overall aminoacylation rate of tRNAs (80.7 ± 10.6%, Figure 4). In addition, it was possible to analyze that the overall aminoacylation rate in the amino acid supplemented state was similar between tRNAs derived from nuclear and mitochondrial DNA (Fig. 6).
At individual tRNA isoacceptor levels, the aminoacylation profile of tRNA varied dynamically (FIGS. 3 and 5). Amino acid supplementation restored tRNA ^Gln and tRNA ^Glu to an amino acylation rate of about 80%, while tRNA ^Ser , which was low in starvation, remained low after supplementation (Fig. 5). This tendency was similar to the analysis of tRNA aminoacylation dynamics at the homologous amino acid level, that is, the result of subgroup analysis of tRNA that aminoacylates homologous amino acids (FIG. 8A). When the change in tRNA amino acylation rate during amino acid supplementation was analyzed for starvation, and as a result of statistical analysis, tRNA ^Leu -CAG, mt-tRNA ^His -CAC, tRNA were analyzed for amino acid starvation in the amino acid supplementation state. ^Ser -CGA, tRNA ^Asn -GTT, tRNA ^Phe -GAA, tRNA ^Ser -GCT, tRNA ^Thr -TGT, tRNA ^Thr -CGT, tRNA ^Ile -TAT and tRNA ^Arg -TCT have significantly reduced amino acylation ratios (Fig. 8B), tRNA ^Gln -CTG, tRNA ^Gln -TTG, and mt-tRNA ^Val -GUA markedly increased amino acylation rates (FIG. 8C). In tRNA ^Gln -CTG, a maximum of 5 SD change was observed by amino acid supplementation for amino acid starvation (Fig. 9). This indicates that the aminoacylation rate of tRNA ^Gln -CTG reacts sensitively to amino acids.

In studies using proliferative species such as Escherichia coli (Non-Patent Document 10), yeast (Non-Patent Document 13) and cancer cells HEK293 cells (Non-Patent Document 15), the aminoacylation rate of tRNA decreases rapidly and globally. It is shown that. In particular, the aminoacylation rates of the remaining tRNAs, such as tRNA ^Leu , have been reported to decrease during starvation. On the other hand, in this example, unlike them, the fluctuation of the aminoacyllation rate of tRNA of TIG-1 cells during starvation was small, and rather the aminoacylation rate was conserved (FIGS. 3 and 5). This may be due to the fact that the cell lines used here are naturally established and have low proliferative properties.

Example 2
i-tRAP method which is a tRNA aminoacylation detection PCR method Example 2-1: Development of i-tRAP method In order to investigate the dynamic change in the aminoacylation rate of tRNA ^Gln -CTG, individual tRNA aminoacylation detection PCR methods are used. A method called i-tRAP (Fig. 10) was planned. This method involves the following steps:
Aminoacylated and non-aminoacylated tRNAs extracted from TIG-1 cells were transferred to demethylated 3'CCA-tRNA and 3'CC-tRNA, respectively, as described in Examples 1-1 to 1-4. processed. This tRNA (300 ng) is converted to an adenylation linker (5'-rAppCTGTAGGCACCATCAAT / 3ddC / -3') (SEQ ID NO: 1) (PerkinElmer (Waltham, MA)), which is a 5'adenylation adapter with a 3'end block. It was mixed with 20 pmol) and then treated with a ligated mixture (total volume 20 μL) containing 2 μL of 10X reaction buffer and 1 unit of T4 Rnl2 truncated form (tranlated T4 RNA ligase 2, truncated, New England Biolabs). The resulting mixture was incubated at 37 ° C. for 60 minutes. In the sequence "5'-rAppCTGTAGGCACCATCAAT / 3ddC / -3'", the sequence is "CTGTAGGCACCATCAATC", and "rApp" means that the base (C) at the end of 5'is adenylated. , "/ 3ddc" means that dideoxycytidine is bound at the end of 3'. In addition, "ddc" means that C is deoxidized.

In order to use the obtained ligation product as a template, RNA to which the adapter is ligated is incubated at 95 ° C. for 5 minutes, placed on ice for denaturation, and then the following reverse transcriptase (RT) primer (Fasmac) is used. Reverse transcribed by ReverTra Ace (TOYOBO).
Primer for reverse transcription (5'-3'):
ATGTACACCTTCGGCAACCACTACATTGATGGTGCCTACAG (SEQ ID NO: 2)

Since the tRNA sequence is too short to be used as a template and it is not possible to make a primer and probe set for subsequent qPCR, the RT primer sequence is derived from the sequence of the adenylated linker and the non-human species (Gryllus bimaculatus). It was determined based on the additional sequence of (Tsukamoto and Nagata, 2016). The reverse transcription reaction was carried out at 42 ° C. for 60 minutes. The obtained cDNA solution is diluted 1: 5 with water, and 1 μL of this solution is divided into 2X TaqMan Genotyping Master Mix (Thermo Fisher Scientific) 5 μL, and the specific primers and probes shown below (Table 1) (Thermo Fisher Scientific). ) Was added to a real-time PCR mixture containing 0.4 μL of Custom TaqMan SNP Genotyping Assays and 3.6 μl of distilled water.

Here, two probe-based qPCR assays are used to detect the single nucleotide difference in the 3'end sequence of the tRNA, ie CCA vs. CC. To perform the qPCR assay, a probe set of two probes with different sequences corresponding only to the sequence at the 3'end of the tRNA, ie one probe has a sequence complementary to the VIC-labeled 3'CCA-tRNA. Then, for the other probe, a probe set having a sequence complementary to the FAM-labeled 3'CC-tRNA was prepared. Specifically, the fluorescent signals from the VIC and FAM are quenched by a quencher attached to the probe. These probes are also bound to the minor groove binder (MGB) moiety. The same amount of VIC and FAM labeled probes were mixed and used for qPCR. When extended using Taq polymerase, the probe was degraded and either VIC or FAM was released, and the resulting fluorescent signal allowed quantification of the amplification product. The fluorescent signal from VIC represented the amount of 3'CCA-tRNA, and the signal from FAM represented the signal of 3'CC-tRNA.

In order to verify whether the i-tRAP method can quantitatively determine the aminoacylation rate, PCR products containing 3'CCA-tRNA and 3'CC-tRNA sequences were prepared.
As the tRNA sequence, tRNA ^Gln -CTG was selected for the amino acid responder, and tRNA ^Gly -GCC was selected for the non-responder as a control. The tRNA ^Gln contains two isoacceptors, tRNA ^Gln -CTG and tRNA ^Gln -TTG, the former having seven isodecoders. The detected tRNA ^Gln -CTG isodecoders responded to amino acids except # 7 (Fig. 11A), and the tRNA ^Gln -CTG isodecoder # 1 had the highest aminoacylation rate in this group: tRNA ^Gln . 79.1 ± 3.2% of, and 86.8 ± 2.1% of tRNA ^Gln -CTG (Fig. 11B). A set of primers and probes for tRNA ^Gln -CTG isocoder # 1 was prepared (FIG. 11C and Table 1).

The probes shown in Table 1 are isoacceptor-specific sequences of tRNA ^Gln -CTG that distinguish between tRNA ^Gln -CTG iso-decoder # 1 and tRNA ^Gln -CTG iso-acceptor and tRNA ^Gln -CTG iso-decoder # 6. Included. The forward primer contains an isoacceptor # 1 specific sequence of tRNA ^Gln -CTG. This sequence was 1 to 4 nucleotides different from other isodecoders. Annealing efficiency was assumed to be dominant in isodecoder # 1, but it did not rule out the possibility that other isodecoders would be detected. TRNA ^Gly -GCC was selected as the representative non-responder for amino acids to prepare the most abundant set of primers and probes for Isocoder # 2 (Fig. 12A-C).

Example 2-2: Verification of i-tRAP method For the verification of i-tRAP developed as described in Example 2-1 the detection specificity of the 3'end (CC vs CCA) of tRNA in this system. Was confirmed first. For this purpose, either 3'CCA-tRNA or 3'CC-tRNA was amplified by PCR and the amplified product was used as a template for i-tRAP.

That is, in the preparation of the PCR product containing the tRNA sequence for creating a standard curve, four oligonucleotides per tRNA shown in Table 2 were designed (Fasmac, Kanagawa, Japan).

The first forward (1F) oligonucleotide was 37 nucleotides containing the linker sequence, and the second, third, and fourth reverse primers (2R, 3R, and 4R) were 33-37 nucleotides containing the tRNA sequence. A 2R oligonucleotide was used to prepare a DNA fragment of 3'CCA-tRNA, and a 3R oligonucleotide was used to prepare a DNA fragment of 3'CC-tRNA. The primer extension reaction mixture contains 3 oligonucleotides (3'CCA-tRNA; 1F, 2R, 3R, 3'CC-tRNA; 1F, 3R, 4R) (25 pmol each) and 12.5 μL KOD One PCR in 25 μL. Master Mix-Blue- (TOYOBO) was included. After incubating the mixture at 98 ° C for 60 seconds, 12 cycles of 98 ° C for 10 seconds, 60 ° C for 5 seconds and 68 ° C for 5 seconds were performed. Using the obtained reaction mixture (10 μL) as a template, PCR containing 1F and 3R or 1F and 4R oligonucleotides (100 pmol) in 200 μl of the reaction mixture was performed. After incubating the mixture at 98 ° C for 60 seconds, 40 cycles of 98 ° C for 10 seconds, 60 ° C for 5 seconds and 68 ° C for 5 seconds were performed. The PCR product was visualized by electrophoresis on a 2% agarose gel and staining with Midori Green Direct (Nippon Genetics, Tokyo, Japan). The DNA of interest obtained from the agarose gel was purified with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and eluted with 30 μL of elution buffer. The concentration of the purified PCR product was determined using NanoDrop2000 (Thermo Fisher Scientific).

FIG. 13 is a graph showing a real-time plot of the i-tRAP method using a synthetic DNA template containing (A) 3'CCA-tRNA ^Gln -CTG sequence and (B) 3'CC-tRNA ^Gln -CTG sequence. The black line shows the VIC signal from the CCA probe and the gray line shows the FAM signal from the CC probe. FIG. 14 is a graph showing a real-time plot of i-tRAP using a synthetic DNA template containing (A) 3'CCA-tRNAGly-GCC sequence and (B) 3'CC-tRNAGly-GCC sequence. The black line shows the VIC signal from the CCA probe and the gray line shows the FAM signal from the CC probe. As a result, real-time plots using a mixture of VIC (for detection of 3'CCA-tRNA) and FAM (for detection of 3'CC-tRNA) probes show that the i-tRAP method is 3'CCA-tRNA or 3'CC-. It was shown that the sequence of tRNA can be accurately identified (FIGS. 13 and 14).

Next, it was examined whether the ratio of the fluorescent signal reflected the ratio of the amount of 3'CCA-tRNA and 3'CC-tRNA. For this purpose, PCR products containing 3'CCA-tRNA and 3'CC-tRNA sequences were mixed in several proportions and used as templates for i-tRAP. Specifically, two PCR products in several ratios (3'CCA-tRNA: 3'CC-tRNA; 10:90, 20:80, 30:70, 40:60, 50:50, 60:40. , 70:30, 80:20 and 90:10) together and used to establish a standard curve for qPCR. The total concentration of the standard solution was adjusted to 1 ag / μL and a linear calibration curve was prepared. A 7900HT real-time PCR system (Thermo Fisher Scientific) was used to determine the threshold cycle (Ct). The threshold cycle (Ct) is the number of cycles when a certain amount of PCR amplification product is reached. Cycling conditions are as follows: 95 ° C, 10 minutes initial denaturation, and 40 or 50 cycles at 95 ° C for 5 seconds and 60 ° C for 60 seconds. Fluorescent signals were collected at the 60 ° C. step of each cycle. All reactions were performed twice to determine the threshold cycle.
As a result, as shown in FIGS. 15 and 16, the proportion of PCR products derived from 3'CCA-tRNA in all products is the threshold cycle value (R2 = 1.00 and 0.98, respectively) between the FAM- and VIC-layers (R2 = 1.00 and 0.98, respectively). It was proportional to the difference in ΔCt). Notably, standard curves made with different amounts (0.1-100 attogram) of templates were not relevant, so tRNA concentrations in the sample were unlikely to affect quantification (Fig. 17).

Finally, using biological samples, the quantitativeness of the i-tRAP method was verified.
To this end, tRNAs were first prepared from commonly used cultured human cells, HEK293T cells, and treated with a weak alkali to deacylate the aminoacylated tRNAs. The culture of HEK293T cells was similar to the culture of TIG-1 cells in Example 1-1. By the i-tRAP method, the aminoacylation rates of tRNA ^Gln -CTG and tRNA ^Gly -GCC were high in a nutrient-rich state, and it was revealed that this was significantly reduced by the same alkaline treatment as in Examples 1-3. (Figs. 18A and B).

Next, as shown in FIG. 2, the aminoacylation rate was measured using tRNA from TIG-1 cells cultured in a medium containing or not containing amino acids. The results of the i-tRAP method showed that the aminoacylation rate of tRNA ^Gln -CTG was significantly reduced by amino acid starvation (Fig. 19A), and that of tRNA ^Gly -GCC was unchanged (Fig. 19B). This was consistent with the results of the simplified aminoacyl-tRNAseq method shown in Example 1 (FIG. 5). Therefore, it was verified that the i-tRAP method can quantify the aminoacylation rate of tRNA.

Example 3
Vibrational Fluctuations in the Aminoacyllation Rate of tRNA ^Gln Between Consumption and Supply of Amino Acids The dynamics of aminoacylation and deaminoacylation of tRNA ^Gln -CTG were evaluated by the i-tRAP method described in Example 2. The tRNA ^Gln -CTG that responded most significantly to amino acid supplementation was selected as the subject (Fig. 5). The selected tRNA ^Gln -CTG was deaminoacylated by starvation and at the same time reaminoacylated by amino acid supplementation. The experimental scheme shown in FIG. 20 was used to investigate at what stage tRNA ^Gln -CTG was deaminoacylated by amino acid starvation. The aminoacylation rates of tRNA ^Gln -CTG measured by the i-tRAP method were cross-validated with the results obtained by the simplified aminoacylated tRNAseq method. That is, under amino acid-rich conditions, the aminoacylation rate was 70.5% (SE = 4.4), which was deaminoacylated to 29.1% (SE = 1.89) 15 hours after starvation (FIGS. 3 and 21). .. After 3-6 hours of starvation, a decrease in aminoacylation rate was observed. The duration at which the aminoacylation rate of tRNA was maintained after starvation was relatively longer than the duration seen in E. coli (Non-Patent Document 10) and HEK293 cells (Non-Patent Document 15).

Next, the expression level of glutaminyl tRNA synthesizer (QARS), which adds glutamine to tRNA ^Gln , was examined. Specifically, large RNA was extracted from cells using Isogen II (Nippon gene) according to the manufacturer's protocol. The extracted RNA was treated with RQ1 DNase I (Promega, Madison, WI) at 37 ° C for 30 minutes. RNA (300 ng each) was then reverse transcribed using the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific). The procedure of real-time PCR was the same as the expression analysis of tRNA of Example 1. The RT mixture was incubated at 42 ° C for 60 minutes. The resulting cDNA solution is diluted 1: 5 with water and 1 μL of this solution contains 5 μL of 2xGeneAce SYBR qPCR Mix α (Nippon gene), 10 μM of each primer (sequence 3) 0.5 μL, and 3 μL of water. Added to real-time PCR mixture.

The 7900HT real-time PCR system (Thermo Fisher Scientific) was used. Cycling conditions are as follows: initial denaturation at 95 ° C for 10 minutes, and 40 cycles at 95 ° C for 15 seconds and 60 ° C for 30 seconds. Fluorescent signals were collected at the 60 ° C. step of each cycle. All reactions were performed twice to determine Ct. In order to evaluate the reaction using the ΔCT method, a primer set specific for ATP synthase peripheral stalk subunit B (ATP5F1) was used as a standard. The sequence was obtained from NCBI (QARS; NM_005051.3, ATP5F1; NM_001688.5).

As a result, the expression level of QARS did not change or slightly increased after 15 hours even in the amino acid starvation state (Fig. 22). Thus, the reduction in aminoacyl-tRNA did not up-regulate or down-regulate the expression level of QARS, but maintaining the expression level of QARS alone was not sufficient to maintain the aminoacylation rate of tRNA. there were. That is, the expression level of QARS does not affect the aminoacylation rate of glutamine.

Next, QARS was knocked down by siRNA. Prior to transfection, cells reached a confluency of 50-70% and were transfected with 50 nM siGenome Human-QARS siRNA-SMARTpool (Dharmacon, Waltham, MA). As a control, siGENOME Non-Targeting siRNA Pool # 1 (Dharmacon) was used. Transfection was performed using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. The cells were then incubated at 37 ° C. for 48 hours in a humidified chamber supplemented with 5% CO2 (FIG. 23).

We do not intend to underestimate the effect of QARS expression levels on tRNA aminoacylation. In fact, knockdown of QARS (Fig. 24) reduced the aminoacylation rate of tRNA ^Gln -CTG in cells cultured for 2 days in nutrient-rich medium (Fig. 25), which means that the expression level of QARS is tRNA. It has been shown to be one of the important factors that determine the aminoacylation rate of ^Gln -CTG. However, in the case of amino acid starvation, the aminoacylation rate of tRNA ^Gln -CTG was reduced in the presence of maintained expression levels of QARS (FIGS. 21 and 22).

Since the main function of tRNA is to transfer amino acids during translation, we investigated whether a decrease in the aminoacylation rate of tRNA ^Gln -CTG during starvation is associated with protein synthesis. Amino acid-starved cells were treated with cyclohexamide (CHX), which blocks the transfer of tRNA to the ribosome and blocks protein synthesis (FIG. 26). Amino acid starvation for 6 hours reduced the aminoacylation rate of tRNA ^Gln -CTG (Fig. 21), but blocking protein synthesis using CHX maintained the aminoacylation rate (Fig. 27).

Blocking protein synthesis suppressed the consumption of glutamine aminoacylated to tRNA, resulting in the preservation of the aminoacyllation rate of tRNA ^Gln -CTG (Fig. 27). From this, it is considered that the incorporation of glutamine aminoacylated to tRNA into the protein during protein synthesis caused a decrease in the aminoacylation rate of tRNA ^Gln -CTG.
The aminoacylation rate of tRNA ^Gln fluctuates oscillatingly and is balanced between amino acid consumption and supply.

Example 4
Use as a nutritional sensor for tRNA ^Gln -CTG The tRNA ^Gln -CTG identified in Example 1 can be used as a nutritional sensor in tRNA.
As shown in Example 3, the amount of amino acid aminoacylated to tRNA is balanced between consumption and supply of protein synthesis. Glutamine (MacLennan, PA, Brown, RA, and Rennie, MJ (1987). FEBS Lett. 215, 187-191.), A well-known stimulant in protein synthesis and cell proliferation, is rapidly depleted in starvation. [Onodera, J., and Ohsumi, Y. (2005). J. Biol. Chem. 280, 31582-31586.]. When the supply of glutamine is stopped due to starvation, the amount of glutamine aminoacylated to tRNA ^Gln is reduced because it is consumed for protein synthesis.
Therefore, tRNA ^Gln is a nutrition sensor.

Amino acid starvation slowly reduced the aminoacylation rate of tRNA ^Gln -CTG due to the consumption of protein synthesis (Fig. 21). On the other hand, amino acid supplementation rapidly reaminoacylated tRNA ^Gln -CTG (Fig. 29). Cells tend to maintain the aminoacylation rate of tRNA.

Regardless of the reason why the aminoacylation rate of tRNA ^Gln -CTG selectively reflects nutritional status, glutamine is an important amino acid in protein synthesis and cell proliferation, and its cellular level easily decreases when starved (" Onodera, J., and Ohsumi, Y. (2005). J. Biol. Chem. 280, 31582-31586.), Glutamine aminoacylating tRNAs may be the key to sensing nutrition. As a non-essential amino acid, the cellular level of glutamine dynamically fluctuates between consumption and biodevelopment, depending on nutrition and the external environment (Onodera, J., and Ohsumi, Y. (2005). J. Biol. Chem. . 280, 31582-31586.).

Next, fluctuations in the aminoacylation rate of tRNA are related to the activity of protein synthesis and may affect biological and physiological processes (Non-Patent Document 19; Non-Patent Document 23; Non-Patent Document 15). ). The aminoacylation rate of tRNA ^Gln -CTG may also function as an effector of cellular processes.

Example 5
Aging Affects TRNA's Aminoacylation Ability We investigated the effect of cellular senescence on deaminoacylation of tRNA ^Gln -CTG as a physiological condition that reduces protein synthesis.
Decreased protein synthesis is associated with decreased cell activity in senescent cells (Mainwaring, WIP (1969). Biochem. J. 113, 869-878.). As mentioned above, TIG-1 cells are naturally established cells and are used as a model of cellular senescence because they stop dividing at a high degree of passage. Here, young TIG-1 cells (population doubling level [PDL] 30) and old TIG-1 cells (PDL 50) were used and cultured under amino acid starvation.

Next, the aminoacylation dynamics of tRNA ^Gln -CTG were analyzed. The aminoacylation rate of tRNA ^Gln -CTG was examined in young TIG-1 cells starved for amino acids and aged TIG-1 cells supplemented with an amino acid mixture (Fig. 28). The aminoacylation rate of tRNA ^Gln -CTG in young TIG-1 cells recovered rapidly within 15 minutes upon supplementation, indicating that the supplemented amino acids rapidly induce aminoacylation of tRNA. (Fig. 29). This increase in aminoacylation rate occurred faster than the decrease in aminoacylation rate in starvation (Fig. 21). The aminoacylation rate of tRNA ^Gln -CTG also recovered rapidly in aged TIG-1 cells, but the rate was generally lower than that of young cells (Fig. 29). Expression levels of QARS did not change with amino acid supplementation in both young and old cells (Fig. 30).
Cells sense nutrients through the aminoacylylated dynamics of tRNA ^Gln -CTG, and inhibition of aminoacylated tRNA ^Gln -CTG is a hallmark of aging that can affect protein synthesis and cell activity.

The i-tRAP method used in this example demonstrated sufficient sensitivity to detect the aging-related decline in tRNA ^Gln -CTG aminoacylation rates. Aging cells were able to oscillate the aminoacylation rate of tRNA ^Gln -CTG in response to nutrition, but the aminoacylation rate was consistently low in senescent cells. The causal relationship between the low aminoacylation rate of tRNA ^Gln -CTG in aging cells is speculated, but the low aminoacylation rate of tRNA ^Gln -CTG suppresses protein synthesis in aging cells, and vice versa. possible. Aberrant aaRS with aging may suppress aminoacylation of tRNA (SEQ ID NO: 18; Takahashi, R., Mori, N., and Goto, S. (1985). Mech. Aging Dev. 33. , 67-75.).

Example 6
Measurement of Intracellular Amino Acid Concentration in TIG-1 Cells in Amino Acid Starvation Under the conditions of the experimental scheme shown in FIG. 20, the intracellular amino acid concentration in TIG-1 cells was measured over time by high performance liquid chromatography (HPLC). The results are shown in FIGS. 31A and 31B. FIG. 31A shows that many amino acids have decreased intracellular concentrations in response to amino acid starvation for 3, 6 and 9 hours. FIG. 31B shows the relative concentration (rate of change) of the intracellular amino acid concentration under the amino acid starvation state for 3, 6 and 9 hours based on the intracellular amino acid concentration before starvation. FIG. 31B shows that only Gln continues to decrease the intracellular amino acid concentration over time after the third hour of starvation. It is presumed that this is the cause of the remarkable decrease in the aminoacylation rate of tRNA ^Gln during 15 hours of amino acid starvation in FIG. As shown in FIG. 21, under these conditions, the aminoacyllation rate of Gln decreases after 6 hours of amino acid starvation. Therefore, in light of the time course of the relative concentration of Gln in FIG. 31B, the amino acid concentration before starvation was 3.5-. If it is less than about 7%, it is estimated that the aminoacylation rate will decrease. Since aminoacylated amino acids are used for protein synthesis, the tRNA aminoacylation rate is measured to measure aminoacylated amino acids, that is, functional amino acids, rather than simply measuring the intracellular amino acid concentration. It seems important to do. By measuring the tRNA aminoacylation rate, it is possible to confirm the fluctuation of the tRNAaminoacylation rate that can be used for protein synthesis, that is, to evaluate the fluctuation of the intracellular functional amino acid concentration.

Example 7
Measurement of intracellular amino acid concentration in TIG-1 cells cultured with CHX High performance liquid chromatography (HPLC) shows the intracellular amino acid concentration in TIG-1 cells cultured with cyclohexamide (CHX) under the conditions of the experimental scheme shown in FIG. ). The results are shown in FIG. 32A. On the other hand, FIG. 32B shows the relative concentration (rate of change) of the intracellular amino acid concentration in the amino acid starvation state for 6 hours when DMSO was added to the culture medium and cultured with CHX based on the cultured intracellular amino acid concentration.

As shown in FIGS. 32A and 32B, in response to the load of cyclohexamide (CHX) that blocks protein synthesis, amino acids such as Gln are not utilized for protein synthesis, so the intracellular amino acid concentration is increased by administration of CHX. Become. As a result, as shown in FIG. 27, it is assumed that the aminoacyllation rate of tRNA ^Gln was also increased by the administration of CHX. That is, it is assumed that the aminoacyllation rate of tRNA ^Gln -CTG was also increased by CHX administration, corresponding to the increased concentration of intracellular Gln. That is, in light of FIG. 31B, which showed that when the intracellular amino acid amount falls below a certain level, the aminoacylation rate decreases, and when the intracellular amino acid amount falls below a certain level, the intracellular amino acid amount and the aminoacyl of tRNA. It was shown that there is a correlation between the conversion rates.

Example 8
Measurement of intracellular amino acid concentration in TIG-1 cells cultured with CQ TIG-1 cells are cultured for a certain period of time in a medium starved for amino acids in the presence of chloroquin (CQ), which is an inhibitor of the autophagy-lysosomal system. bottom. The results of measuring the intracellular amino acid concentration in TIG-1 cells cultured for 4 hours by high performance liquid chromatography (HPLC) are shown in FIG. 33A. FIG. 33B shows the relative concentration (rate of change) of the intracellular amino acid concentration during the 4-hour amino acid starvation state in which PBS was added to the culture medium and cultured together with CQ based on the cultured intracellular amino acid concentration. .. The results of measuring the aminoacylation rate of tRNA ^Gln -CTG in TIG-1 cells cultured with CQ for 2, 4 and 6 hours are shown in FIG. 33C. Statistical analysis was performed in comparison with the intracellular amino acid concentration of the cells treated with solvent (PBS).

FIG. 33C shows that CQ administration resulted in a lower aminoacylation rate of tRNA ^Gln -CTG after 4 hours compared to the control (PBS). This result shows that CQ has the greatest effect on the aminoacylation rate of tRNA ^Gln -CTG after 4 hours. FIG. 33B shows that the concentration of glutamine at 4 hours of amino acid starvation was lowered by CQ administration as compared with the control. Since CQ is an inhibitor of the autophagy lysosome system, administration of CQ promotes the degradation of intracellular proteins by autophagy lysosome, which provides a general supply of amino acids and supplements the deficient glutamine. It is clear that the aminoacylation rate of tRNA ^Gln -CTG is increased as shown in FIG. 27.

FIG. 33A shows the change in intracellular amino acid concentration per protein unit amount after 4 hours by administration of CQ. After 4 hours of CQ administration, the intracellular concentration of amino acids is significantly reduced, as shown in FIG. 33B. As a result, as shown in FIG. 33C, the aminoacylation rate of tRNAGln-CTG is also significantly reduced after 4 hours by administration of CQ. That is, it was shown that when the amount of intracellular amino acids falls below a certain level, there is a correlation between the amount of intracellular amino acids and the aminoacylation rate of tRNA. In conclusion, in Example 8 as well, the correlation between the aminoacylation rate and the amount of amino acids was shown as in Example 7.

The present invention provides an overview of the aminoacylation profile of tRNAs, specifically identifying individual tRNA ^Gln -CTGs that sense nutrients. The aminoacylation profile of tRNA is an unexplored scientific field with profound significance in biology, physiology and disease. The combination of tRNA sequencing and i-tRAP allows us to explore the profound world of tRNA aminoacylation while cross-validating the results obtained.

By evaluating the functional intracellular amino acid concentration based on the evaluation of the tRNA aminoacylation rate, various uses are possible. For example, in cancer cells, certain anti-cancer drug treatments reduce the intracellular amino acid concentration of the cancer cells, thereby reducing the activity of the cancer cells and suppressing protein synthesis to induce cell death. .. At this time, by measuring the tRNA aminoacylation rate in cancer cells and confirming whether or not the functional amino acid concentration is actually decreased, it can be applied to the determination of the therapeutic effect and the selection of the therapeutic drug.

Claims

In a method of qualitatively or quantitatively measuring the difference of a single nucleotide in one target RNA, here the difference of a single nucleotide is the 3'end sequence of the target RNA: the presence or absence of nucleotide A in CCA vs. CC. It ’s a way of being,
α) Create cDNA for target RNA and
β) A method of amplifying a target region containing a single nucleotide difference on the cDNA by PCR and simultaneously measuring the single nucleotide difference qualitatively or quantitatively.

Step α),
a-1) Adapter linked to the 3'end of the target RNA, RT primer containing a sequence complementary to the sequence of the adapter, one primer having a sequence specific to the target RNA, and specific to the RT primer. Prepare an amplification primer set consisting of the other primer having a sequence, and a probe set targeting the difference of a single nucleotide.
b-1) RNA ligase for the adapter is used to ligate the adapter to the target RNA, and the formed ligation product is used as a template to prepare cDNA.
a-2) An arbitrary RNA adapter and a DNA primer having a sequence complementary to the RNA adapter and having the 3'end protruding by only one base were prepared and annealed to the RNA adapter. A hybrid primer, an amplification primer set consisting of one primer having a sequence specific to the target RNA and the other primer having a sequence specific to the RT primer, and a probe set targeting the difference of a single nucleotide. Prepare each and
b-2) Anneal the hybrid primer to the 3'end of the target RNA and generate cDNA by reverse transcriptase with template switching activity.
The method according to claim 1, comprising the above.

The probe set that targets the difference between single nucleotides in step a-1) is a fluorescently labeled probe set that recognizes the difference between single nucleotides, and the fluorescence emitted during amplification in step β). The method according to claim 2, wherein the difference between single nucleotides is measured qualitatively or quantitatively using the intensity as an index.

The method according to claim 1 or 2, wherein the target RNA is tRNA-functional RNA, preferably tRNA, or tRF or tRNA half having a 3'end of tRNA.

The method according to claim 4, wherein the tRNA-functional RNA is tRNA.

Further, the following γ) step:
γ) Calculate the ratio of the quantitative value of the target RNA having CCA to the total amount of the quantitative value of the target RNA having CCA and the quantitative value of the target RNA having CC.
The method according to any one of claims 1 to 5, comprising.

A method for measuring the aminoacylation rate of one target RNA by the method according to claim 6.

In the method of any of claims 1-7, wherein the single nucleotide difference in one target RNA is measured qualitatively or quantitatively, where the single nucleotide difference is the 3'end sequence of the target RNA. : An assay kit used for the method in which nucleotide A is present or absent in CCA vs. CC.
A) Adapter that connects to the 3'end of the target RNA,
B) RT primer containing a sequence complementary to the sequence of the adapter,
C) Amplification primer set consisting of one primer having a sequence specific to the target RNA and the other primer having a sequence specific to the RT primer,
D) Probe sets that target single nucleotide differences,
E) RNA ligase for the adapter, and f) demethylase, if necessary,
Including, kit; or service) any RNA adapter,
B) A DNA primer containing a sequence complementary to the adapter and having the 3'end protruding only one base from the RNA adapter.
S) An amplification primer set consisting of one primer having a sequence specific to the target RNA and the other primer having a sequence specific to the DNA primer.
C) Probe sets that target single nucleotide differences,
S) Reverse transcriptase with template switching activity, and Ta) Demethylase, if necessary,
Including, kit.

tRNA-A method for comprehensively measuring the base sequence, expression level, and aminoacylation rate of functional RNA.
a-10) Treat tRNA-functional RNA extracted from biological specimens to remove terminal bases in non-aminoacylated RNA (non-aminoacylated RNA), while aminoacylated RNA (aminoacylated). By removing amino acids from RNA), non-aminoacylated RNA and aminoacylated RNA are prepared, respectively.
b-10) Connect the adapter to the 3'-end and 5'-end of both obtained RNAs.
c-10) Reverse transcription is performed using the produced linked RNA as a template.
d-10) Amplify the obtained cDNA to create a cDNA library,
e-10) Sequencing each cDNA in the library to obtain sequence data,
tRNA-A method for measuring the base sequence, expression level and aminoacylation rate of functional RNA.

The method according to claim 9, wherein in step a-10), the RNA treatment is periodic acid oxidation, β-desorption and terminal repair for non-aminoacylated RNA, and weak alkaline treatment for aminoacylated RNA.

The method according to claim 9 or 10, wherein the RNA extracted from the biological sample is subjected to size fractionation, RNA of 20 bases to 150 bases is extracted, and the subsequent steps are performed.

The method according to claim 11, wherein the 20-150 base RNA is a tRF or a tRNA half having a 3'end of the tRNA or tRNA.

In measuring the aminoacyllation rate of tRNA-functional RNA, the ratio of the expression level of aminoacylated RNA to the total expression level of aminoacylated RNA and non-aminoacylated RNA is calculated, according to claims 9 to 12. Any method described.

An assay kit used for the method according to any one of claims 11 to 13, which comprehensively measures the base sequence, expression level, and aminoacylation rate of tRNA-functional RNA.
A-10) tRNA-adapter that connects to the 3'-end and 5'-end of functional RNA,
B-10) RT primer containing a sequence complementary to the sequence of the adapter,
C-10) A kit containing RNA ligase for the adapter and d-10) demethylase.

A method for screening substances that vary the aminoacylation rate of tRNA.
a-20) Add the test substance to the cells and add
b-20) Measure the aminoacylation rate of tRNA in the cells, and
c-20) When the measured value is changed compared to the case where the aminoacyllation rate is measured in the absence of the test substance, the test substance is a substance that changes the aminoacylation rate of tRNA. How to determine that there is.

The method according to claim 15, wherein the aminoacylation rate is measured by the method according to any one of claims 1 to 7 and claims 9 to 13.

A method for screening substances that vary the aminoacylation rate of tRNA.
a-30) Administer the test substance to the animal and
b-30) Collect cells of a predetermined organ from the animal and collect them.
c-30) Measure the aminoacylation rate of tRNA in the cells, and
c-30) When the measured value is changed compared to the case where the aminoacyllation rate is measured in the absence of the test substance, the test substance is a substance that changes the aminoacylation rate of tRNA. How to determine that there is.

Prescribed organs include blood, urine, spinal fluid, saliva, tears, semen, brain, heart, kidneys, liver, lungs, spleen, blood vessels, blood cells, muscles, fat, skin, pancreas, intestines, endocrine organs, nerves, 17. The method of claim 17, which is a sensory organ.

The method according to any one of claims 15 to 18, wherein the aminoacylation rate is measured by the method according to any one of claims 1 to 7 and claims 9 to 13.

A pharmaceutical composition for adjusting the effect on biological and physiological processes in a subject, which contains a substance that varies the aminoacylation rate of tRNA.

The pharmaceutical composition according to claim 20, wherein the substance that changes the aminoacylation rate of tRNA is a substance screened by the method according to any one of claims 15 to 19.

Substances that fluctuate the aminoacylation rate of tRNA are amino acids and aminoacylation rate-increasing substances selected from inhibitors of protein synthesis, or aminoacylasease inhibitors, autophagy lithosome inhibitors, proteasome inhibitors, and integration. The pharmaceutical composition according to claim 20 or 21, which is an aminoacylation-reducing substance selected from among inhibitors of a target stress response.

A pharmaceutical composition containing a tRNA inhibitor for adjusting the effect on biological and physiological processes in a subject.

The pharmaceutical composition according to claim 23, wherein the inhibitor of tRNA is one or more selected from the group consisting of siRNA, shRNA, miRNA, antisense and ribozyme.

The pharmaceutical composition according to any one of claims 20 to 24 for treating cancer, age-related diseases, and nutritional status.

A pharmaceutical composition containing a specific tRNA or an analog thereof for reducing the effect on biological and physiological processes in a subject.

The pharmaceutical composition according to claim 26 for treating mitochondrial disease.

A method for determining the presence or absence of effects on biological and physiological processes in a subject.
a-40) Step of measuring the aminoacylation rate (test aminoacylation rate) of tRNA in the cells of the subject,
b-40) A step of comparing the test aminoacylation rate with the aminoacyllation rate of tRNA of the reference cell (control aminoacylation rate), and
c-40) When the test aminoacylation rate fluctuates compared to the control aminoacylation rate, the subject has an effect on the biological and physiological processes in the subject. How to judge.

28. The method of claim 28, wherein the effect on the biological and physiological processes in the subject is an event related to one or more selected from cellular activity, nutritional status, physical, mental and pathological conditions.

Events include mitochondrial disease, age-related disease, lifestyle disease, mental illness, intractable disease, hereditary disease, life course-related disease, gastrointestinal disease, cancer, cardiovascular disease, kidney disease and neurological disease. 29. The method of claim 29, which is one or more chosen.

A method of reducing the aminoacylation rate of a corresponding tRNA by knocking down a nucleic acid molecule encoding a particular aminoacyl-tRNA synthetase, thereby reducing its effect on biological and physiological processes in the subject.

31. The method of claim 31, wherein the effect on the biological and physiological processes in the subject is an event related to one or more selected from cellular activity, nutritional status, physical, mental and pathological conditions.

Events include mitochondrial disease, age-related disease, lifestyle disease, mental illness, intractable disease, hereditary disease, life course-related disease, gastrointestinal disease, cancer, cardiovascular disease, kidney disease and neurological disease. 32. The method of claim 32, which is one or more selected.

The method according to any one of claims 31 to 33, wherein the specific aminoacyl-tRNA synthesizer is a glutaminyl tRNA synthesizer.

One or more selected from tRNA ^Leu , mt-tRNA ^His , tRNA ^Ser , tRNA ^Asn , tRNA ^Phe , tRNA ^Thr , tRNA ^Ile , tRNA ^Arg , tRNA ^Gln , and mt-tRNA ^Val . A biomarker for determining the effect on biological and physiological processes in the examiner.

tRNA ^Leu -CAG, mt-tRNA ^His -CAC, tRNA ^Ser -CGA, tRNA ^Asn -GTT, tRNA ^Phe -GAA, tRNA ^Ser -GCT, tRNA ^Thr -TGT, tRNA ^Thr -CGT, tRNA ^Ile -TAT, tRNA ^Arg- Determine the effect on biological and physiological processes in a subject, one or more selected from TCT, tRNA ^Gln -CTG, tRNA ^Gln -TTG, and mt-tRNA ^Val -GUA. 35. The biomarker according to claim 35.

35 or 36. Biomarker.

Events include mitochondrial disease, age-related disease, lifestyle disease, mental illness, intractable disease, hereditary disease, life course-related disease, gastrointestinal disease, cancer, cardiovascular disease, kidney disease and neurological disease. The biomarker of any of claims 35-37, which is one or more selected.

Biomarkers of tRNA ^Gln and tRNA ^Glu for determining nutritional status, body, health and aging.

39. The biomarker of claim 39, wherein the tRNA ^Gln is tRNA ^Gln -CTG.