WO2022067257A1 - Products and methods for treating muscular dystrophy - Google Patents

Products and methods for treating muscular dystrophy Download PDF

Info

Publication number
WO2022067257A1
WO2022067257A1 PCT/US2021/052425 US2021052425W WO2022067257A1 WO 2022067257 A1 WO2022067257 A1 WO 2022067257A1 US 2021052425 W US2021052425 W US 2021052425W WO 2022067257 A1 WO2022067257 A1 WO 2022067257A1
Authority
WO
WIPO (PCT)
Prior art keywords
raav
dose
test
subject
dystrophin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/052425
Other languages
English (en)
French (fr)
Inventor
Kevin FLANIGAN
Nicolas Sebastien WEIN
Tabatha SIMMONS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nationwide Childrens Hospital Inc
Original Assignee
Nationwide Childrens Hospital Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nationwide Childrens Hospital Inc filed Critical Nationwide Childrens Hospital Inc
Priority to US18/246,594 priority Critical patent/US20240261434A1/en
Priority to EP21806444.2A priority patent/EP4217375A1/en
Priority to JP2023519230A priority patent/JP2023543029A/ja
Priority to AU2021349277A priority patent/AU2021349277A1/en
Priority to CA3194122A priority patent/CA3194122A1/en
Publication of WO2022067257A1 publication Critical patent/WO2022067257A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4707Muscular dystrophy
    • C07K14/4708Duchenne dystrophy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0083Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the administration regime
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/072Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the disclosure relates to the field of gene therapy for the treatment and/or prevention of muscular dystrophy. More particularly, the disclosure provides products and methods for treating or preventing muscular dystrophies in patients with duplications of exon 2 in their DMD gene or DMD mutations of any class that maintain a functional IRES sequence within exon 5, and an open reading frame from exon 6 though the end of the DMD gene.
  • Gene therapy vectors such as adeno-associated virus (AAV) vectors, and methods of using these vectors to express DMD are provided.
  • AAV adeno-associated virus
  • the products and methods are used for treating and/or preventing muscular dystrophies such as Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.
  • MDs Muscular dystrophies
  • the group is characterized by progressive weakness and degeneration of the skeletal muscles that control movement. Some forms of MD develop in infancy or childhood, while others may not appear until middle age or later. The disorders differ in terms of the distribution and extent of muscle weakness (some forms of MD also affect cardiac muscle), the age of onset, the rate of progression, and the pattern of inheritance.
  • the MDs are a group of diseases without identifiable treatment that gravely impact individuals, families, and communities.
  • the costs are incalculable. Individuals suffer emotional strain and reduced quality of life associated with loss of self-esteem. Extreme physical challenges resulting from loss of limb function creates hardships in activities of daily living. Family dynamics suffer through financial loss and challenges to interpersonal relationships. Siblings of the affected feel estranged, and strife between spouses often leads to divorce, especially if responsibility for the muscular dystrophy can be laid at the feet of one of the parental partners.
  • the burden of quest to find a cure often becomes a life-long, highly focused effort that detracts and challenges every aspect of life.
  • the community bears a financial burden through the need for added facilities to accommodate the handicaps of the muscular dystrophy population in special education, special transportation, and costs for recurrent hospitalizations to treat recurrent respiratory tract infections and cardiac complications.
  • Financial responsibilities are shared by state and federal governmental agencies extending the responsibilities to the taxpaying community.
  • DMD Duchenne Muscular Dystrophy
  • Symptoms of generalized muscle weakness first appear at ages 3-5 and progress into a loss of ambulation by age 13, with death typically occurring in the third decade of life due to cardiomyopathy or respiratory insufficiency (Passamano et aL, Acta Myol 31 , 121 -125 (2012); Duchenne, The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J 2, 541-542 (1867)).
  • DMD is caused by mutations that disrupt the open reading frame in the DMD gene, which encodes dystrophin (Juan-Mateu et aL, PLoS One 10, e0135189 (2015)), a large (427 kDa) multifunctional protein that is localized at the subsarcolemmal region of myofibers, where it plays an important role in protecting the sarcolemma from mechanical damage caused by muscle contraction (Petrof et aL, Proc Natl Acad Sci USA 90, 3710-3714 (1993)).
  • BMD Becker Muscular Dystrophy
  • ORF open reading frame
  • BMD is a genetic disorder that gradually makes the body's muscles weaker and smaller. BMD affects the muscles of the hips, pelvis, thighs, and shoulders, as well as the heart, but is known to cause less severe problems than DMD. Because of the variety of in-frame mutations resulting in a variety of partially functional proteins, BMD has a broad phenotypic spectrum with, for example, loss of ambulation ranging from the late teenage years to late adulthood.
  • Promising therapeutic approaches to DMD are based on the replacement of a functional version of DMD, or its repair at the DNA or pre-mRNA level. Both approaches aim at restoration of an open reading frame, leading to expression of a partially function, BMD- like dystrophin.
  • Gene replacement trials using modified adeno-associated viruses (AAVs) have been reported (Muzyczka, Curr Top Microbiol Immunol 158, 97-129 (1992); Carter, Mol Ther 10, 981-989 (2004); Samulski et aL, Annu Rev Virol 1 , 427-451 (2014)), but transgene packaging capacity of AAV is limited to ⁇ 5 kb.
  • DMD cDNA is 11 .4 kb
  • current viral vectors make use of one of several internally-deleted but in-frame microdystrophin cDNAs (Duan, Mol Ther 26, 2337-2356 (2018)).
  • An alternate approach is to restore the mRNA reading frame by delivering an antisense sequence that binds to key exon definition elements in the pre-mRNA, inhibiting the recognition of a specific exon by the spliceosome, leading to exclusion of the target exon from the mature RNA.
  • Such antisense sequences can consist of antisense oligonucleotides (AONs), or phoshphorodiamidate morpholino oligomers (PMO), such as eteplirsen, the first such therapy approved by the FDA for treatment of DMD due to mutations amenable to skipping of exon 51 (Barthelemy et aL, Neuromuscul Disord 28, 803-824 (2016); Wein et aL, Pediatr Clin North Am 62, 723-742 (2015); Alfano et aL, Medicine (Baltimore) 98, e15858 (2019)).
  • AONs antisense oligonucleotides
  • PMO phoshphorodiamidate morpholino oligomers
  • the disclosure provides products and methods for preventing disease, delaying the progression of disease, and/or treating disease in patients with one or more 5' mutations of the DMD gene. More particularly, the disclosure provides products and methods using a U7snRNA approach to induce skipping of DMD exon 2, with a particular goal of restoring wild-type dystrophin rather than an internally-deleted BMD-like dystrophin.
  • the disclosure provides a nucleic acid comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence comprising at least 80% identity to the sequence set forth in SEQ ID NO: 1 ; a nucleotide sequence complementary to the nucleotide sequence comprising at least 80% identity to the sequence set forth SEQ ID NO: 1 ; a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 ; and a nucleotide sequence complementary to the nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 .
  • the disclosure provides a recombinant adeno-virus associated (rAAV) comprising such nucleic acid.
  • the rAAV is rAAV1 , rAAV2, rAAV3, rAAV4, rAAV5, rAAV6, rAAV7, rAAV8, rAAV9, rAAV10, rAAV1 1 , rAAV12, rAAV13, rAAV-anc80, rAAV rh.74, rAAV rh.8, rAAVrh.10, or rAAV-B1 .
  • the rAAV is rAAV9.
  • the rAAV is self-complementary.
  • composition comprising such a nucleic acid or rAAV and a carrier, diluent, excipient, and/or adjuvant.
  • the disclosure provides a method of treating, preventing or ameliorating a muscular dystrophy in a subject in need thereof comprising the step of administering to the subject such an rAAV or a composition comprising the rAAV, wherein the rAAV is administered at a dose of about 1 .0x10 10 vg/kg to about 1 .0x10 16 vg/kg.
  • the dose is about 1.0x10 11 vg/kg to about 1.0x10 15 vg/kg.
  • the dose is about 1 .0x10 13 vg/kg to about 5.0x10 13 vg/kg.
  • the dose is about 2.0x10 13 vg/kg to about 4.0x10 13 vg/kg.
  • the dose is about 3.0x10 13 vg/kg.
  • the method comprises administering an initial dose followed by a second greater dose.
  • the initial dose is about 1 .0x10 13 vg/kg to about 5.0x10 13 vg/kg.
  • the second dose is about 6.0x10 13 vg/kg to about 4.0x10 14 vg/kg.
  • the initial dose is about 2.0x10 13 vg/kg to about 4.0x10 13 vg/kg.
  • the initial dose is about 3.0x10 13 vg/kg.
  • the second dose is about 7.0x10 13 vg/kg to about 9.0x10 13 vg/kg.
  • the second dose is about 8.0x10 13 vg/kg.
  • the rAAV is administered via a systemic route.
  • the systemic route is by injection, infusion or implantation.
  • the systemic route is an intravenous route.
  • the rAAV is administered by infusion over approximately one hour.
  • the disclosure provides products, methods, and uses for treating muscular dystrophy.
  • the muscular dystrophy is Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.
  • the level of functional dystrophin gene expression or protein expression in a cell or tissue of the subject is increased after administration of the rAAV as compared to the level of functional dystrophin gene expression or protein expression before administration of the rAAV.
  • the expression of functional dystrophin in the cell is detected by measuring the dystrophin protein level by Western blot, immunofluorescence, or immunohistochemistry in muscle biopsied before and after administration of the rAAV.
  • the level of serum creatinine kinase in the subject is decreased after administration of the rAAV as compared to the level of serum creatinine kinase before administration of the rAAV.
  • the methods and uses of the disclosure result in improved muscle strength, improved muscle function, improved mobility, improved stamina, or a combination of two or more thereof in the subject.
  • the disclosure provides products, methods and uses, wherein muscular dystrophy progression in the subject is delayed or wherein muscle function in the subject is improved after administration of the rAAV.
  • this delay in progression or improvement in muscle function is measured by the six minute walk test, time to rise test, ascend 4 steps test, ascend and descend 4 steps test, North Star Ambulatory Assessment (NSAA), the forced vital capacity (FVC) test, 10 meter timed test, 100 meter timed test, hand held dynamometry (HHD) test, Timed Up and Go test, Gross Motor Subtest Scaled (Bayley-Ill) score, maximum isometric voluntary contraction test (MVICT), or a combination of two or more thereof.
  • the methods or uses of the disclosure further comprise a second or combination therapy or administering a second or combination therapy. In some aspects, the methods or uses of the disclosure further comprise a glucocorticoid or administering a glucocorticoid.
  • the disclosure provides a method of expressing a dystrophin gene in a cell of a subject comprising administering to the subject a nucleic acid comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence comprising at least 80% identity to the sequence set forth in SEQ ID NO: 1 ; a nucleotide sequence complementary to the nucleotide sequence comprising at least 80% identity to the sequence set forth SEQ ID NO: 1 ; a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 ; and a nucleotide sequence complementary to the nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 .
  • the disclosure provides a method of expressing a dystrophin gene in a cell of a subject comprising administering to the subject an rAAV or a composition comprising an rAAV comprising a nucleic acid comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence comprising at least 80% identity to the sequence set forth in SEQ ID NO: 1 ; a nucleotide sequence complementary to the nucleotide sequence comprising at least 80% identity to the sequence set forth SEQ ID NO: 1 ; a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 ; and a nucleotide sequence complementary to the nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 , wherein the rAAV is administered to the subject at a dose of about 1 .0x10 10 vg/kg to about 1.0x10 16 vg/kg.
  • the disclosure provides the use of an rAAV comprising a nucleic acid comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence comprising at least 80% identity to the sequence set forth in SEQ ID NO: 1 ; a nucleotide sequence complementary to the nucleotide sequence comprising at least 80% identity to the sequence set forth SEQ ID NO: 1 ; a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 ; and a nucleotide sequence complementary to the nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 , wherein the rAAV is at a dose of about 1.0x10 1 ° vg/kg to about 1 .0x10 16 vg/kg.
  • the dose of rAAV is about 1 .0x10 11 vg/kg to about 1.0x10 15 vg/kg. In some aspects, the dose is about 1 .0x10 13 vg/kg to about 5.0x10 13 vg/kg. In some aspects, the dose is about 2.0x10 13 vg/kg to about 4.0x10 13 vg/kg. In some aspects, the dose is about 3.0x10 13 vg/kg.
  • the rAAV is administered or formulated at an initial dose and is followed by a second greater dose.
  • the initial dose is about 1 .0x10 13 vg/kg to about 5.0x10 13 vg/kg.
  • the initial dose is about 2.0x10 13 vg/kg to about 4.0x10 13 vg/kg.
  • the initial dose is about 3.0x10 13 vg/kg.
  • the second dose is about 6.0x10 13 vg/kg to about 4.0x10 14 vg/kg.
  • the second dose is about 7.0x10 13 vg/kg to about 9.0x10 13 vg/kg.
  • the second dose is about 8.0x10 13 vg/kg.
  • the rAAV is administered or formulated for delivery via a systemic route.
  • the systemic route is by injection, infusion or implantation.
  • the systemic route is an intravenous route.
  • the rAAV is administered by infusion over approximately one hour.
  • the muscular dystrophy is Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.
  • the level of functional dystrophin gene expression or protein expression in a cell of the subject is increased after administration of the rAAV as compared to the level of functional dystrophin gene expression or protein expression before administration of the rAAV.
  • the level of expression of functional dystrophin in the cell is detected by measuring the dystrophin protein level by Western blot, immunofluorescence, or immunohistochemistry in muscle biopsied before and after administration of the rAAV.
  • the level of serum creatinine kinase is decreased in the subject after administration of the rAAV as compared to the level of serum creatinine kinase before administration of the rAAV.
  • the disclosure provides products, methods and uses which result in improved muscle strength, improved muscle function, improved mobility, improved stamina, or a combination of two or more thereof in the subject.
  • the disclosure provides products, methods and uses wherein muscular dystrophy progression in the subject is delayed or wherein muscle function in the subject is improved after administration of the rAAV as measured by the six minute walk test, time to rise test, ascend 4 steps test, ascend and descend 4 steps test, North Star Ambulatory Assessment (NSAA), the forced vital capacity (FVC) test, 10 meter timed test, 100 meter timed test, hand held dynamometry (HHD) test, Timed Up and Go test, Gross Motor Subtest Scaled (Bayley- Ill) score, maximum isometric voluntary contraction test (MVICT), or a combination of two or more thereof.
  • NSAA North Star Ambulatory Assessment
  • FVC forced vital capacity
  • HHD hand held dynamometry
  • HHD Hand held dynamometry
  • Timed Up and Go test Timed Up and Go test
  • MVICT maximum isometric voluntary contraction test
  • the disclosure provides methods and uses further comprising administering a second or combination therapy. In some aspects, such methods and uses further comprise administering a glucocorticoid.
  • the disclosure provides methods and uses wherein expression of the dystrophin gene in the cell is measured in the subject by detecting greater than 1 rAAV vector genome copy per nucleus.
  • Figs. 1 A-E show dystrophin restoration following systemic delivery of scAAV9.U7- ACCA in adult Dup2 mice and efficient exon skipping. Mice were injected via tail vein at 2 months of age with scAAV9.U7-ACCA (7.6e13vg/kg) and sacrificed 3 months later. Mice were also injected with 6a-methylprednisolone 21 -hemisuccinate sodium salt (PDN) or an equivalent volume of saline.
  • PDN 6a-methylprednisolone 21 -hemisuccinate sodium salt
  • RNA from treated Dup2 mice compared to TA from WT and non-treated Dup2 mice.
  • Primers are located in exon 1 and exon 3, resulting in three amplicons that contained either two copies (Dup2; 340 base pairs (bp)), one copy (WT; 278 bp), or no copies (Del2; 216 bp) of exon 2.
  • Fig. 1C shows immunostaining for dystrophin expression in muscles from a WT control, untreated Dup2, and treated Dup2 mice. Scale bars, 100 pm. Fig.
  • FIG. 1 D shows representative images from hematoxylin and eosin (H&E) staining of TA and diaphragm from WT, untreated, and treated Dup2 mice showing diminished centronucleation and fiber size variation in ACCA-treated animals.
  • Fig. 1 E shows quantification of centronucleation of myofibers from TA and diaphragm. Due to sample size, normality was tested using a Shapiro-Wilk test and significance was tested using a one-way ANOVA.
  • H&E hematoxylin and eosin
  • Data are represented as means ⁇ SD of the percentage of centronucleated fibers.
  • Figs. 2A-G show that the restoration of dystrophin following systemic delivery of scAAV9.U7-ACCA in adult Dup2 mice results in sarcolemmal localization of dystrophin binding partners and improves muscle pathology, membrane integrity, and contraction- induced damage.
  • Fig. 2A shows immunostaining of p-sarcoglycan (P-SG), p-dystroglycan (P-DG) and neuronal nitric oxidase synthetase (nNOS) in tibialis anterior of treated Dup2 mice three months post-injection.
  • P-SG p-sarcoglycan
  • P-DG p-dystroglycan
  • nNOS neuronal nitric oxidase synthetase
  • EBD Evans blue dye
  • Fig. 2C shows absolute and Fig. 2D shows normalized specific force following tetanic contraction. Due to sample size, normality was tested using a Shapiro-Wilk test and significance was tested using a one-way ANOVA.
  • Data are represented as means ⁇ SD of the force generated.
  • Fig. 2E shows loss of force following repetitive eccentric contractions.
  • Fig. 2F shows the cumulative ribosome footprint (RPF) coverage from scAAV9.U7-ACCA treated (red) and untreated (blue) mouse Dup2 tibialis (TA) muscle. The arrow indicates the location of the 5’ end of the Dp71 transcript.
  • Fig. 2G shows Dup2 mouse genome-wide levels of RPF-Seq reads from scAAV9.U7-ACCA treated versus untreated TA muscle.
  • Figs. 3A-E show early systemic delivery of scAAV9.U7-ACCA in young Dup2 mice allowing long lasting efficient exon 2 skipping and dystrophin expression. Mice were injected via facial vein at P0-P1 days of age with scAAV9.U7-ACCA (1 ,8e14vg/kg) and sacrificed 6 months later.
  • Fig. 3A shows RT-PCR analysis of RNA from TA, Gas, Tri, Hrt and Dia from Dup2 mice compare to a TA from WT and non-treated Dup2 mice using primers located in exon 1 and exon 3.
  • Fig. 3C shows representative immunofluorescence of dystrophin in muscles from WT control, untreated and treated Dup2 mice. Scale bars, 100 pm.
  • Fig. 3D shows representative images from H&E- stained TA, Gas, Tri, Hrt and Dia muscles from WT control, untreated and treated Dup2 mice. Fig.
  • 3E shows quantification of centronucleation from treated and untreated TA and diaphragm. Due to the sample size, normality was tested using a Shapiro-Wilk test and significance was tested using a Mann-Whitney test.
  • TA Dup2 versus WT
  • **P 0.0062
  • Data are represented as means ⁇ SD of the percent of centronucleated fiber.
  • Figs. 4A-G show early systemic delivery of scAAV9.U7-ACCA in young Dup2 mice prevents muscle pathology at least 6 months after injection.
  • Fig. 4A shows absolute and
  • Fig. 4B shows normalized specific force following tetanic contraction in tibialis anterior 3 months after injection. Due to sample size, normality was tested using a Shapiro-Wilk test, and significance was tested using a one-way ANOVA.
  • Data are represented as means ⁇ SD of the force generated.
  • Fig. 4C shows loss of force following repetitive eccentric contractions. Two-way analysis of variance (ANOVA) of WT versus Dup2, or Dup2+ACCA versus Dup2, ****P ⁇ 0.001 . Bonferroni’s post hoc analysis for contractions 2-10.
  • Fig. 4D shows absolute and Fig. 4E shows normalized specific force following tetanic contraction 6 months after injection.
  • Figs. 5A-B show efficient in-frame and out of frame exon skipping using scAAVI .117- ACCA in patient cells harboring mutations within exons 1-4 results in dystrophin expression.
  • Five different patient fibroblasts cell lines were transdifferentiated into myoblasts (referred as FibroMyoD) and transduced with scAAVI .U7-ACCA (1 ,5e11 vg total).
  • Fig. 5A shows RT- PCR results that were obtained 3 days post infection. On the left of each gel image are the exon splicing outcomes resulting in each amplicon (as confirmed by sequencing).
  • Results were obtained either following PDN alone, scAAVI .U7-ACCA alone, or scAAVI .U7-ACCA combined with PDN.
  • Fig. 5B shows Western blot of dystrophin following of FibroMyoD cell lines for 14 days. Myosin heavy chain (MHC) was used as a loading control.
  • MHC Myosin heavy chain
  • Figs. 6A-D show increased amount of dystrophin following treatment three months after injection.
  • Fig. 6A shows representative Western blot of dystrophin obtained from muscles of treated adult mice. Results were obtained either following glucocorticoid treatment (PDN) alone, scAAV9.U7-ACCA alone, or scAAV9.U7-ACCA combined with PDN. Arrow points out full-length dystrophin protein.
  • Fig. 5B shows Western blot quantification of dystrophin restoration. Data are represented as means ⁇ SD and as a percent of WT dystrophin expression (blue bar).
  • TA Tibialis anterior
  • Figs. 7A-C show restoration of dystrophin following systemic delivery of scAAV9.U7- ACCA in adult Dup2 mice allows sarcolemmal localization of dystrophin binding partners three months post-injection in different muscles.
  • Immunostaining of p-sarcoglycan (P-SG) Fig. 7A
  • p-dystroglycan (P-DG) Fig. 7B
  • nNOS neuronal nitric oxidase synthetase
  • Figs. 8A-B show dystrophin expression following scAAV9.U7-ACCA treatment in adult Dup2 mice at 1 , 3 and 6 months post-injection.
  • Fig. 8A shows representative Western blot of dystrophin obtained in tibialis anterior (TA), gastrocnemius (Gas), triceps (Tri), heart (Hrt), and diaphragm (Dia) from treated mice compared to tibialis anterior from a WT or a non-treated Dup2 mouse.
  • Alpha (a)-actinin was used as a loading control.
  • Figs. 9A-E show efficient exon skipping following scAAV9.U7-ACCA treatment in young Dup2 mice 1 month post-injection. Mice were injected via facial vein at P0-1 day of age with scAAV9.U7-ACCA (1 ,8e14vg/kg) and sacrificed 1 month later.
  • Fig. 9A shows RT- PCR analysis from tibialis anterior (TA), gastrocnemius (Gas), triceps (Tri), heart (Hrt), and diaphragm (Dia) in Dup2 treated mice compare to TA of WT and non-treated mice.
  • TA tibialis anterior
  • Gas gastrocnemius
  • Tri triceps
  • Dia diaphragm
  • Fig. 9C shows immunofluorescence of dystrophin in several muscles from WT control, untreated and treated Dup2, 1 month post-injection. Scale bars, 100 pm.
  • Fig. 9D shows representative images from hematoxylin and eosin staining of TA and Gas, Tri, Hrt and Dia from WT control, untreated and treated Dup2. Fig.
  • FIGs. 10A-E show exon skipping following scAAV9.U7-ACCA treatment in young Dup2 mice 3 months post-injection. Mice were injected via facial vein at P0-1 day of age with scAAV9.U7-ACCA (1 ,8e14vg/kg) and sacrificed 3 months later.
  • Fig. 10A shows RT-PCR analysis from tibialis anterior (TA), gastrocnemius (Gas), triceps (Tri), heart (Hrt) and diaphragm (Dia) in Dup2 treated mice compare to TA of WT and non-treated mice.
  • Fig. 10B shows quantification of RT-PCR transcripts (obtained as in Fig.
  • Fig. 10C shows immunofluorescence of dystrophin in several muscles from WT control, untreated and treated Dup2. Scale bars, 100 pm.
  • Fig. 10D shows representative images from hematoxylin and eosin staining of TA and Gas, Tri, Hrt and Dia from WT control, untreated and treated Dup2.
  • Fig. 10E shows quantification of centronucleation in tibialis anterior and diaphragm from treated and untreated mice.
  • Figs. 13 shows immunofluorescence staining of dystrophin with a C-terminal antibody showing abundant expression 4-5 weeks after a single intramuscular (TA) injection.
  • Figs. 14A-B shows immunofluorescence staining of dystrophin with a C-terminal antibody showing abundant expression 4-5 weeks after a single intramuscular (TA) injection.
  • Data were tested for normality using the D’Agostino-Pearson and Shapiro-Wilk normality test. If normal, a one-way ANOVA analysis was conducted. If not normal, a two- tailed Kruskal-Wallis test was used to analyze absolute and specific force. A two-way ANOVA test was used to analyze eccentric contraction.
  • Figs. 15A-C shows results of physiology testing conducted on 12-13 week-old Dup2 mice following a single intramuscular (TA) injection at 8-9 weeks of age.
  • a nearly complete rescue of absolute force was seen (Fig. 15A), while a partial rescue of specific force (Fig. 15B) and force drop following repeated contractions (Fig. 15C) was seen in the injected Dup2 mice compared to un-injected Dup2 controls.
  • Quantification of absolute and specific force are reported as the mean and standard deviation (s.d.).
  • Eccentric contraction values are reported as mean and standard error of the mean (s.e.m.) (* 0.5 ⁇ P ⁇ 0.005;** 0.05 ⁇ P ⁇ 0.005; *** 0.005 ⁇ P ⁇ 0.0005; **** 0.0005 ⁇ P).
  • Figs. 16A-B shows images of RT-PCR (Fig. 16A) and transcript quantification (Fig. 16B) of dystrophin expression after injection with various doses of scAAV9.U7ACCA.
  • TA Gas, Triceps, Diaphragm, and Heart from Dup2 mice treated at 8-9 weeks of age were examined at 4 weeks post-injection for the amount of each transcript including two (Dup2, 340 bp), one (WT, 278 bp), or zero (A2, 216 bp) copies of exon 2.
  • FIG. 17 shows representative images of dystrophin staining after injection of various doses scAAV9.U7.ACCA.
  • Four weeks post-injection TA, Gas, Triceps, Diaphragm, and Heart were stained to show amount of properly localized dystrophin (red staining).
  • Figs. 18A-B shows dystrophin expression and quantification after injection with various doses of scAAV9.U7.ACCA.
  • Dup2 mice were treated for 4 weeks with either 5.8 E13, 1 .8 E14 or 4.7 E14 vg/kg scAAV9.U7.ACCA.
  • Figs. 19A-B shows dystrophin expression and quantification after injection with various doses of scAAV9.U7.ACCA.
  • TA Gas, Triceps, Diaphragm, and Heart from Dup2 mice treated at 8-9 weeks of age were examined at 12 weeks post-injection for the amount of each transcript including two (Dup2, 340 bp), one (WT, 278 bp), or zero (A2, 216 bp) copies of exon 2.
  • Three doses (5.8 E13, 1 .8 E14 or 4.7 E14 vg/kg) of scAAV9.U7ACCA were examined for exon 2 skipping and showed a dose-related response.
  • Figs. 20 shows dystrophin expression in Dup2 mice after treatment with various doses of scAAV9.U7.ACCA.
  • Figs. 21A-B shows dystrophin expression in various muscles of Dup2 mice using immunoblot analysis after treating with various doses of scAAV9.U7.ACCA.
  • dystrophin expression increases with the dose and reached its maximum at 4.7 E14 vg/kg dose with levels comparable to WT in the triceps, diaphragm and heart.
  • Quantification (Fig. 21 B) is reported as the mean and s.d. of at least three muscles per dose (* 0.5 ⁇ P ⁇ 0.005;** 0.05 ⁇ P ⁇ 0.005. Data were tested for normality using the D’Agostino-Pearson and Shapiro-Wilk normality test. If normal, a one-way ANOVA analysis was conducted. If not normal, a two-tailed Kruskal-Wallis test was used for analysis).
  • Figs. 22A-C shows results of electrophysiology studies on TA muscle of Dup2 mice after administering various intravenous doses.
  • Dup2 mice were treated at 1 month with the three highest doses (i.e. , 5.8 E13, 1 .8 E14 or 4.7 E14 vg/kg) of scAAV9.U7.ACCA.
  • TA physiology was performed on 20-21 week old mice that show a dose-response curve and significant correction in absolute force in treated animals in comparison to WT controls (Fig. 22A).
  • Fig. 22B there was only a partial improvement in specific fore
  • Fig. 22C Quantification of absolute force and specific force is reported as the mean and s.d.
  • Eccentric contraction (ECC) values are reported as mean and s.e.m. (* 0.5 ⁇ P ⁇ 0.005; “ 0.05 ⁇ P ⁇ 0.005; 0.005 ⁇ P ⁇ 0.0005; ““
  • Fig. 23 shows percent dystrophin expression measured by Western blotting following systemic delivery of scAAV9.U7.ACCA alone or in combination with glucocorticoid.
  • Dup2 mice were treated at 2 months with either 4.7E14 vg/kg scAAV9.U7.ACCA alone or in combination with PDN.
  • Dystrophin protein expression in each of TA, Gas, Diaphragm (Dia), and Heart (Hrt) was quantified using Western blot analysis carried out 12-14 weeks postinjection.
  • Figs. 24A-C show muscle strength/force following systemic delivery of scAAV9.U7.ACCA alone or in combination with glucocorticoid.
  • Dup2 mice were treated at 2 months with either 4.7E14 vg/kg scAAV9.U7.ACCA alone or in combination with PDN (labeled as GC).
  • TA force was measured 15-16 weeks post-injection (* 0.5 ⁇ P ⁇ 0.005;** 0.05 ⁇ P ⁇ 0.005; *** 0.005 ⁇ P ⁇ 0.0005; **** 0.0005 ⁇ P.
  • Two-tailed Kruskal-Wallis tests were used to analyze absolute and specific force. 2 way ANOVA tests were used to analyze eccentric contraction).
  • Fig. 25 shows that treatment of human subjects is associated with mild transient elevation of transaminases and sustained decrease in serum creatinine kinase (CK).
  • Fig. 25 shows levels of transaminases, alanine transaminase (ALT) and aspartate transaminase (AST) in both human subjects before treatment and through 90 days after treatment.
  • Fig. 25 shows levels of serum CK in both human subjects before treatment and through 90 days after treatment. There was a 95% decrease in serum CK level from baseline (13,495 to 560 u/L) in U7-Dup2-01. There was an 81% decrease in serum CK level from baseline (5,103 to 947 u/L).
  • Fig. 26 shows the expression of apparently normal size dystrophin at 3 months postinjection in both subjects as demonstrated by the on-gel standard curve (normal muscle dilution series). Western blot was performed in duplicate and the mean is reported.
  • Fig. 27 shows exon skipping by RT-PCR demonstrated a biologic effect. At 3 months post-treatment, there was an increase in both WT and Del2 transcripts over baseline, and an increase in total therapeutic transcript in both subjects over baseline. Quantification of vector genomes in skeletal muscle 3 months post-treatment also is shown.
  • Fig. 28 shows that dystrophin expression was markedly improved in subject 1 at 3 months post-treatment over baseline.
  • the products and methods described herein are used for preventing disease, delaying the progression of disease, and/or treating muscular dystrophies in patients with one or more 5' mutations of the DMD gene. More particularly, the disclosure provides products and methods using a U7snRNA approach to induce skipping of DMD exon 2, with a particular goal of restoring wild-type dystrophin rather than an internally-deleted BMD-like dystrophin.
  • the disclosure provides products and methods to target exon 2 of the DMD gene.
  • Targeting of exon 2 duplication mutations provides a very wide therapeutic window. For example, skipping of a single copy results in a full-length wild-type dystrophin, and skipping of both copies results in alternate translational initiation from a highly functional internal ribosome entry site (IRES) within exon 5 (Wein et aL, Pediatr Clin North Am 62, 723-742 (2015)).
  • Wild-type dystrophin is a 427kD protein and the IRES-driven form of dystrophin is a 413kD protein.
  • the disclosure provides antisense targeting sequences embedded into a modified U7 small nuclear RNA (U7snRNA) (Gorman et aL, Proc Natl Acad Sci USA 95, 4929-4934 (1998)).
  • U7snRNA modified U7 small nuclear RNA
  • snRNP small nuclear ribosomal protein complex
  • the disclosure provides such U7snRNA for the prevention, treatment, or amelioration of diseases or disorders resulting from mutations of the DMD gene.
  • the disclosure provides a vector for delivering antisense targeting sequences.
  • the vector contains four copies of the U7snRNA in a self- complementary genome, with two copies targeting the splice acceptor site (sequence A) and two copies targeting the splice donor site (sequence C), encapsidated in AAV9 (scAAV9.U7- ACCA).
  • the disclosure provides experimental results from an investigation of the efficacy of exon 2 skipping induced by this vector following systemic delivery in the Dup2 mouse (which carries the analogous mutation) (Vulin et aL, Neuromuscul Disord 25, 827-834 (2015)), with or without co-treatment with prednisolone, as steroids are the only treatment shown to slow progression of DMD, and it has been shown previously that the DMD IRES is glucocorticoid responsive (Wein et aL, Pediatr Clin North Am 62, 723-742 (2015)).
  • the disclosure provides experimental results showing that one-time tail vein injection of scAAV9.U7 into 2-month old Dup2 mice results in highly efficient exon skipping, translation of both full-length and IRES-driven dystrophin proteins, and correction of clinical, histopathological, and physiologic markers of disease. Similarly, a single neonatal injection of this vector results in highly efficient exon skipping, protein production, and almost complete reversion of the disease phenotype at 6 months. Such vectorized exon skipping holds significant clinical promise. Although antisense oligonucleotides or oligomers (AONs) approaches are promising, AON therapies require weekly (or similar) reinjections.
  • AONs antisense oligonucleotides or oligomers
  • U7snRNA mediated skipping offers the advantage of continuous antisense sequence transcription and accumulation in the nucleus after a single injection.
  • U7snRNA-mediated exon skipping has shown promising results in the golden retriever muscular dystrophy (GRMD) dog model (Kornegay, Skelet Muscle 7, 9 (2017)) in which injection of an AAV.U7 vector, targeted to exons 6 and 8, restored the reading frame, leading to significant expression of dystrophin and long-lasting improvements in muscle function (Bish et al., Mol Ther 20, 580-589 (2012)).
  • GRMD golden retriever muscular dystrophy
  • AAV.U7 vector targeted to exons 6 and 8 restored the reading frame, leading to significant expression of dystrophin and long-lasting improvements in muscle function
  • the disclosure provides experimental results of investigating whether exon 2 skipping could lead to IRES activation in cells derived from patients with other mutations within exons 1 -4, which account for ⁇ 5-6% of DMD patients (https://www.dmd.nl), confirming efficient exon 2 skipping in the presence of other 5' mutations, and leading to IRES-driven dystrophin expression.
  • the experimental results provided herein support a therapeutic option for patients with mutations within exons 1 -4.
  • the disclosure in part provides products and methods, based on the identification of a glucocorticoid-inducible IRES in exon 5 of the DMD gene, the activation of which can generate a functional N- terminally truncated dystrophin isoform, and the use of exon 2-targeted antisense in a nucleic acid construct.
  • the disclosure provides a nucleic acid comprising the U7- ACCA nucleotide sequence.
  • the U7-ACCA nucleotide sequence is set out in SEQ ID NO: 1 below.
  • the U7-ACCA is reverse complement, as it was inserted in the AAV backbone. This sequence does not contain the ITR and the probe and spacer.
  • SEQ ID NO: 1 cacatacg eg tttcctagg aaaccag ag aag g atcaaag cccctctcacacaccg gg g ag eg gg g aag ag aactg ttttg ett tcattg tag accag tg aaattg gg ag gg g ttttccg accg aag tcag aaacctg ctccaaaaatttag atg aaag ag aag atet tcaaaagaaaacttgcggaagtgcgtctgtagcgagccagggaaggacatcaactccactttcgatgagggtgagatcaaggt g ccattccacacccctccactg atg t t
  • the disclosure includes a nucleic acid comprising a nucleotide sequence that has at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence set forth in SEQ ID NO: 1 .
  • the disclosure includes a nucleic acid comprising a nucleotide sequence that is complementary to a nucleotide sequence that has at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to a sequence set forth in SEQ ID NO: 1 .
  • the disclosure includes a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 .
  • the disclosure includes a nucleotide sequence complementary to the nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 .
  • the disclosure includes such nucleic acid under the control of a U7 promoter.
  • the disclosure includes the delivery of such nucleic acid in a U7 small nuclear RNA (snRNA).
  • the disclosure provides small nuclear ribonucleic acids (snRNAs), also commonly referred to as U-RNAs, to affect DMD expression.
  • snRNAs are a class of small RNA molecules that are found within the splicing speckles and Cajal bodies of the cell nucleus in eukaryotic cells.
  • Small nuclear RNAs are associated with a set of specific proteins, and the complexes are referred to as small nuclear ribonucleoproteins (snRNP, often pronounced "snurps").
  • snRNP particle is composed of a snRNA component and several snRNP-specific proteins (including Sm proteins, a family of nuclear proteins).
  • snRNAs ribonucleoprotein complexes
  • snRNPs ribonucleoprotein complexes
  • Sm-class snRNA consists of U1 , U2, U4, U4atac, U5, U7, U1 1 , and U12.
  • Sm-class snRNA are transcribed by RNA polymerase II.
  • Lsm-class snRNA The second class, known as Lsm-class snRNA, consists of U6 and U6atac. Lsm-class snRNAs are transcribed by RNA polymerase III and never leave the nucleus, in contrast to Sm-class snRNA.
  • the disclosure includes the production and administration of an AAV vector comprising U7 snRNA for the delivery of DMD antisense sequences, such as the U7-ACCA nucleotide sequence set out in SEQ ID NO: 1 or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence set forth in SEQ ID NO: 1 .
  • the disclosure provides small nuclear ribonucleic acids (snRNAs), also commonly referred to as U-RNAs, to affect DMD expression.
  • snRNAs are a class of small RNA molecules that are found within the splicing speckles and Cajal bodies of the cell nucleus in eukaryotic cells.
  • Small nuclear RNAs are associated with a set of specific proteins, and the complexes are referred to as small nuclear ribonucleoproteins (snRNP, often pronounced "snurps").
  • snRNP particle is composed of a snRNA component and several snRNP-specific proteins (including Sm proteins, a family of nuclear proteins).
  • snRNAs ribonucleoprotein complexes
  • snRNPs ribonucleoprotein complexes
  • Sm-class snRNA consists of U1 , U2, U4, U4atac, U5, U7, U11 , and U12.
  • Sm-class snRNA are transcribed by RNA polymerase II.
  • Lsm-class snRNA The second class, known as Lsm-class snRNA, consists of U6 and U6atac. Lsm-class snRNAs are transcribed by RNA polymerase III and never leave the nucleus, in contrast to Sm-class snRNA.
  • the disclosure provides U7 snRNA molecules to interfere with DMD gene expression.
  • U7 snRNA is normally involved in histone pre-mRNA 3' end processing but, in some aspects, is converted into a versatile tool for splicing modulation or as antisense RNA that is continuously expressed in cells [Goyenvalle et aL, Science 306(5702): 1796-9 (2004)].
  • these small RNAs can be permanently expressed inside the target cell after a single injection [Levy et aL, Eur. J. Hum. Genet. 18(9): 969-70 (2010); Wein et aL, Hum. Mutat.
  • the disclosure utilizes AAV to deliver inhibitory U7snRNA to deliver a DMD antisense sequence, e.g., U7-ACCA, which binds to key exon definition elements in the pre-mRNA, inhibiting the recognition of a specific exon by the spliceosome, leading to exclusion of the target exon from the mature RNA, resulting in the expression of dystrophin.
  • U7 snRNA is normally involved in histone pre-mRNA 3' end processing but, in some aspects, is converted into a versatile tool for splicing modulation or as antisense RNA that is continuously expressed in cells [Goyenvalle et aL, Science 306(5702): 1796-9 (2004)].
  • these small RNAs when embedded into a gene therapy vector, these small RNAs can be permanently expressed inside the target cell after a single injection [Levy et aL, Eur. J. Hum. Genet. 18(9): 969-70 (2010); Wein et aL, Hum. Mutat. 31 (2): 136-42, (2010); Wein et aL, Nat. Med. 20(9): 992-1000 (2014)].
  • AAV.U7 AAV.U7
  • a single injection of this AAV9.U7 targeting the defective RNA of a mouse model of Duchenne muscular dystrophy, results in long term correction of the disease in every muscle, including heart and diaphragm.
  • the ability to target the heart is really important since DM1 patients display cardiac abnormalities.
  • the disclosure provides one or more copies of the nucleic acid is combined into a single vector.
  • the disclosure includes a vector or vectors comprising a nucleic acid of the disclosure or a combination of nucleic acids of the disclosure.
  • Such vectors include, for example, viral vectors, such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, pox virus, herpes virus, herpes simplex virus, polio virus, Sindbis virus, vaccinia virus or a synthetic virus, e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and/or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule, to deliver one or more of the nucleic acids disclosed herein.
  • the viral vector is an AAV.
  • U7snRNA is delivered via a viral vector, such as AAV.
  • the AAV lacks rep and cap genes.
  • the AAV is a recombinant AAV (rAAV).
  • the rAAV is a single-stranded AAV (ssAAV) or a self-complementary AAV (scAAV).
  • the viral vector is an adeno-associated virus (AAV), such as an AAV1 (i.e., an AAV containing AAV1 inverted terminal repeats (ITRs) and AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 ITRs and AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 ITRs and AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 ITRs and AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 ITRs and AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 ITRs and AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 ITRs and AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 I
  • AAV1 i
  • an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid proteins AAVrh.10 (i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid proteins), AAV11 (i.e., an AAV containing AAV11 ITRs and AAV11 capsid proteins), AAV12 (i.e., an AAV containing AAV12 ITRs and AAV12 capsid proteins), AAV13 (i.e., an AAV containing AAV13 ITRs and AAV13 capsid proteins), AAV-anc80, AAV rh.74, AAV rh.8, AAVrh.10, or AAV-B1 .
  • AAVrh.10 i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid proteins
  • AAV11 i.e., an AAV containing AAV11 ITRs and AAV11 capsi
  • AAV is a replication-deficient parvovirus, the single-stranded DNA genome of which is about 4.7 kb in length including 145 nucleotide inverted terminal repeat (ITRs).
  • ITRs nucleotide inverted terminal repeat
  • AAV serotypes of AAV for example, as set out herein above.
  • the nucleotide sequences of the genomes of the AAV serotypes are known.
  • the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077
  • the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45: 555- 564 (1983)
  • the complete genome of AAV-3 is provided in GenBank Accession No. NC_1829
  • the complete genome of AAV-4 is provided in GenBank Accession No.
  • AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV-8); the AAV-9 genome is provided in Gao etal., J. Virol., 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol.
  • Cis-acting sequences directing viral DNA replication (rep), encapsidation/packaging and host cell chromosome integration are contained within the AAV ITRs.
  • Three AAV promoters (named p5, p19, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes.
  • the two rep promoters (p5 and p19), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene.
  • Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome.
  • the cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1 , VP2, and VP3.
  • Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins.
  • a single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).
  • AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy.
  • AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic.
  • AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo.
  • AAV transduces slowly dividing and nondividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element).
  • the AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible.
  • the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA.
  • the rep and cap proteins are provided in trans.
  • Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56° to 65°C for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.
  • DNA plasmids of the disclosure comprise rAAV genomes of the disclosure.
  • the DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1 -deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles.
  • a helper virus of AAV e.g., adenovirus, E1 -deleted adenovirus or herpes virus
  • helper virus functions e.g., adenovirus, E1 -deleted adenovirus or herpes virus
  • the AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11 , AAV-12, AAV-13, AAV-anc80, AAV rh.74, AAV rh.8, and AAVrh.10.
  • AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11 , AAV-12, AAV-13, AAV-anc80, AAV rh.74, AAV rh.8, AAVrh.10, and AAV-B1 .
  • Other types of rAAV variants for example rAAV with capsid mutations, are also included in the disclosure.
  • recombinant AAV genomes of the disclosure comprise one or more AAV ITRs flanking a polynucleotide sequence, for example, one or more an antisense sequences that bind to key exon definition elements in the pre-mRNA, inhibiting the recognition of a specific exon by the spliceosome, leading to exclusion of the target exon of DMD from the mature RNA.
  • rAAV genomes of the disclosure comprise one or more AAV ITRs flanking a polynucleotide encoding, for example, one or more DMD antisense sequences.
  • Commercial providers such as Ambion Inc. (Austin, TX), Darmacon Inc.
  • RNA molecules include SILENCERTM siRNA Construction Kit (Ambion Inc., Austin, TX) or psiRNA System (InvivoGen, San Diego, CA).
  • the U7 snRNA gene comprising the DMD inhibitory nucleic acid is cloned as U7-ACCA into an rAAV vector.
  • embodiments of the disclosure include an rAAV genome comprising a nucleic acid comprising the nucleotide sequence set out in SEQ ID NO: 1 or a variant thereof comprising a nucleotide sequence having sequence identity to SEQ ID NO: 1 as disclosed herein in the detailed description.
  • the viral vector is a pseudotyped AAV, containing ITRs from one AAV serotype and capsid proteins from a different AAV serotype.
  • the pseudo-typed AAV is AAV2/9 (i.e., an AAV containing AAV2 ITRs and AAV9 capsid proteins).
  • the pseudotyped AAV is AAV2/8 (i.e., an AAV containing AAV2 ITRs and AAV8 capsid proteins).
  • the pseudotyped AAV is AAV2/1 (i.e., an AAV containing AAV2 ITRs and AAV1 capsid proteins).
  • the AAV contains a recombinant capsid protein, such as a capsid protein containing a chimera of one or more of capsid proteins from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-anc80, AAVrh74, AAVrh.8, or AAVrh.10, AAV10, AAV11 , AAV12, AAV13, or AAV-B1.
  • Other types of rAAV variants for example rAAV with capsid mutations, are also contemplated. See, for example, Marsic et aL, Molecular Therapy, 22(11): 1900-1909 (2014).
  • the nucleotide sequences of the genomes of various AAV serotypes are known in the art.
  • DNA plasmids are provided which comprise rAAV genomes as described herein.
  • the DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1 -deleted adenovirus or herpesvirus) for assembly of the rAAV genome into infectious viral particles.
  • a helper virus of AAV e.g., adenovirus, E1 -deleted adenovirus or herpesvirus
  • helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e.
  • the AAV rep and cap genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11 , AAV-12, AAV-13, AAV-B1 and AAV rh74.
  • Production of pseudotyped rAAV is disclosed in, for example, WO 01/83692 which is incorporated by reference herein in its entirety.
  • packaging cells are provided.
  • Packaging cells are created in order to have a cell line that stably expresses all the necessary components for AAV particle production. Retroviral vectors are created by removal of the retroviral gag, pol, and env genes. These are replaced by the therapeutic gene. In order to produce vector particles, a packaging cell is essential. Packaging cell lines provide all the viral proteins required for capsid production and the virion maturation of the vector. Thus, packaging cell lines are made so that they contain the gag, pol and env genes. Following insertion of the desired gene into in the retroviral DNA vector, and maintenance of the proper packaging cell line, it is now a simple matter to prepare retroviral vectors
  • a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell.
  • AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et aL, 1982, Proc. Natl. Acad. S6.
  • packaging cells that produce infectious rAAV.
  • Packaging cells may be stably transformed cancer cells such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line).
  • packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).
  • a method of generating a packaging cell to create a cell line that stably expresses all the necessary components for AAV particle production is provided.
  • a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell.
  • AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et aL, 1982, Proc. Natl. Acad. S6.
  • Recombinant AAV (/.e., infectious encapsidated rAAV particles) are thus provided herein.
  • genomes of the rAAV lack AAV rep and cap genes; that is, there is no AAV rep or cap DNA between the ITRs of the genomes of the rAAV.
  • the AAV is a recombinant linear AAV (rAAV), a single-stranded AAV (ssAAV), or a recombinant self-complementary AAV (scAAV).
  • rAAV recombinant linear AAV
  • ssAAV single-stranded AAV
  • scAAV recombinant self-complementary AAV
  • packaging cells are stably transformed cancer cells, such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line).
  • packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), Wl- 38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).
  • the rAAV in some aspects, are purified by methods standard in the art, such as by column chromatography or cesium chloride gradients.
  • Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark et al., Hum. Gene Then, 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002); U.S. Patent No. 6,566,118 and WO 98/09657.
  • compositions comprising a nucleic acid or a vector, e.g., such as a viral vector, as described herein.
  • compositions comprising delivery vehicles (such as rAAV) described herein are provided.
  • delivery vehicles such as rAAV
  • such compositions also comprise a pharmaceutically acceptable carrier.
  • such compositions also comprise other ingredients, such as a diluent, excipients, and/or adjuvant.
  • Acceptable carriers, diluents, excipients, and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).
  • buffers such as phosphate, citrate, or other organic acids
  • antioxidants such
  • Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization.
  • dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-f iltered solution thereof.
  • Titers of rAAV to be administered in methods of the disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1 x10 6 , about 1 x10 7 , about 1 x10 8 , about
  • DNase resistant particles [or viral genomes (vg)] per ml.
  • the dose of rAAV administered is about 1 .0x10 10 vg/kg to about 1 .0x10 16 vg/kg.
  • 1 .0x10 10 vg/kg is also designated 1.0 E10 vg/kg, which is simply an alternative way of indicating the scientific notation.
  • 10 11 is equivalent to E1 1 , and the like.
  • the dose of rAAV administered is about 1.0x10 11 vg/kg to about 1.0x10 15 vg/kg.
  • the dose of rAAV is about 1.0x10 1 ° vg/kg, about 2.0x10 1 ° vg/kg, about 3.0x10 1 ° vg/kg, about 4.0x10 1 ° vg/kg, about 5.0x10 1 ° vg/kg, about 6.0x10 1 ° vg/kg, about 7.0x10 10 vg/kg, about 8.0x10 10 vg/kg, about 9.0x10 10 about 1.0x10 11 vg/kg, about 2.0x10 11 vg/kg, about 3.0x10 11 vg/kg, about 4.0x10 11 vg/kg, about 5.0x10 11 vg/kg, about 6.0x10 11 vg/kg, about 7.0x10 11 vg/kg, about 8.0x10 11 vg/kg, about 9.0x10 11 vg/kg, about 1.0x10 12 vg/kg, about 2.0x10 12 vg/kg, about 2.0x
  • the dose is about 1 .0x10 11 vg/kg to about 1 .0x10 15 vg/kg. In some aspects, the dose is about 1 .0x10 13 vg/kg to about 5.0x10 13 vg/kg. In some aspects, the dose is about 2.0x10 13 vg/kg to about 4.0x10 13 vg/kg. In some aspects, the dose is about 3.0x10 13 vg/kg.
  • an initial dose is followed by a second greater dose. In some aspects, an initial dose is followed by a second same dose. In some aspects, an initial dose is followed by one or more lesser doses. In some aspects, an initial dose is followed by multiple doses which are the same or greater doses.
  • the initial dose is about 1 .0x10 13 vg/kg to about 5.0x10 13 vg/kg. In some aspects, the initial dose is about 2.0x10 13 vg/kg to about 4.0x10 13 vg/kg. In some aspects, the initial dose is about 3.0x10 13 vg/kg. In some aspects, the second dose is about 6.0x10 13 vg/kg to about 4.0x10 14 vg/kg. In some aspects, the second dose is about 7.0x10 13 vg/kg to about 9.0x10 13 vg/kg. In some aspects, the second dose is about 8.0x10 13 vg/kg.
  • Methods of transducing a target cell with a delivery vehicle such as rAAV
  • a delivery vehicle such as rAAV
  • Transduction of cells with an rAAV of the disclosure results in sustained expression of antisense sequence that binds to key exon definition elements in the pre-mRNA of the DMD gene, inhibiting the recognition of a specific exon by the spliceosome, leading to exclusion of the target exon from the mature DMD RNA.
  • the disclosure thus provides rAAV and methods of administering/delivering rAAV which express antisense sequence that binds to key exon definition elements in the pre-mRNA, inhibiting the recognition of a specific exon by the spliceosome, leading to exclusion of the target exon from the mature RNA to a subject.
  • the subject is a mammal.
  • the mammal is a human.
  • These methods include transducing cells and tissues (including, but not limited to, tissues such as muscle) with one or more rAAV described herein. Transduction may be carried out with gene cassettes comprising cell-specific control elements.
  • transduction is used to refer to, as an example, the administration/delivery of u7snRNA comprising antisense sequence, e.g., U7-ACCA, to a target cell either in vivo or in vitro, via a replication-deficient rAAV described herein resulting in the expression of functional forms of the dystrophin protein by the target cell.
  • u7snRNA comprising antisense sequence
  • U7-ACCA antisense sequence
  • the in vivo methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a delivery vehicle (such as rAAV) to a subject (including a human subject) in need thereof.
  • a delivery vehicle such as rAAV
  • methods are provided of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV described herein to a subject in need thereof. If the dose or doses is administered prior to development of a disorder/disease, the administration is prophylactic. If the dose or doses is administered after the development of a disorder/disease, the administration is therapeutic.
  • An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder/disease state being treated, that slows or prevents progression to a disorder/disease state, that slows or prevents progression of a disorder/disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and/or that prolongs survival.
  • compositions and methods of the disclosure are used in treating, ameliorating, or preventing a disease, such as a muscular dystrophy (MD).
  • MD is Duchenne Muscular Dystrophy (DMD).
  • DMD Duchenne Muscular Dystrophy
  • X-linked degenerative muscle disorder is the most common severe childhood form of muscular dystrophy affecting around 1 :5200 male births (Mendell et aL, Ann Neurol 71 , 304-313 (2012)).
  • Symptoms of generalized muscle weakness first appear at ages 3-5 and progress into a loss of ambulation by age 13, with death typically occurring in the third decade of life due to cardiomyopathy or respiratory insufficiency (Passamano et aL, Acta Myol 31 , 121 -125 (2012); Duchenne, The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J 2, 541 -542 (1867)).
  • DMD is caused by mutations that disrupt the open reading frame in the DMD gene, which encodes dystrophin (Juan-Mateu et aL, PLoS One 10, e0135189 (2015)), a large (427 kDa) multifunctional protein that is localized at the subsarcolemmal region of myofibers, where it plays an important role in protecting the sarcolemma from mechanical damage caused by muscle contraction (Petrof et aL, Proc Natl Acad Sci USA 90, 3710-3714 (1993)).
  • BMD Becker Muscular Dystrophy
  • BMD milder allelic disorder
  • DMD open reading frame
  • BMD is a genetic disorder that gradually makes the body's muscles weaker and smaller. BMD affects the muscles of the hips, pelvis, thighs, and shoulders, as well as the heart, but is known to cause less severe problems than DMD. Because of the variety of in-frame mutations resulting in a variety of partially functional proteins, BMD has a broad phenotypic spectrum with, for example, loss of ambulation ranging from the late teenage years to late adulthood.
  • the methods of the disclosure are methods of preventing disease and they are carried out before the onset of disease. In other various aspects, the methods of the disclosure are carried out after diagnosis and, therefore, are methods of treating or ameliorating disease.
  • Outcome measures demonstrate the therapeutic efficacy of the methods. Outcome measures are described, for example, in Chapters 32, 35 and 43 of Dyck and Thomas, Peripheral Neuropathy, Elsevier Saunders, Philadelphia, PA, 4 th Edition, Volume 1 (2005) and in Burgess et aL, Methods MoL Biol. , 602: 347-393 (2010). Outcome measures include, but are not limited to, one or more of the exclusion of the target exon from the mature RNA, reduction or elimination of mutant DMD mRNA or protein in affected tissues, and the expression of a functional form of dystrophin.
  • the expression of functional dystrophin in the cell is detected by measuring the dystrophin protein level by methods known in the art including, but not limited to, Western blot, immunofluorescence, or immunohistochemistry in muscle biopsied before and after administration of the rAAV to determine the improvement.
  • the level of functional dystrophin gene expression or protein expression in a cell of the subject is increased after administration of the rAAV as compared to the level of functional dystrophin gene expression or protein expression before administration of the rAAV.
  • expression of a functional form of dystrophin is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100%.
  • improved muscle strength, improved muscle function, and/or improved mobility and stamina show an improvement by at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100%.
  • CK serum creatinine kinase
  • Other outcome measures include measuring the level of serum creatinine kinase (CK) in the subject before and after treatment. Increased CK levels are a hallmark of muscle damage. In Duchenne patients, CK levels are significantly increased above the normal range (10 to 100 times the normal level since birth). When elevated CK levels are found in a blood sample, it usually means muscle is being disintegrated by some abnormal process, such as a muscular dystrophy or inflammation. Thus, a positive therapeutic outcome for treatment with the methods of the disclosure is a reduction in the level of serum creatinine kinase after administration of the rAAV as compared to the level of serum creatinine kinase before administration of the rAAV.
  • outcome measure include measuring to determine if there is improved muscle strength, improved muscle function, improved mobility, improved stamina, or a combination of two or more thereof in the subject after treatment. Such outcome measures are important in determining muscular dystrophy progression in the subject and are measured by various tests known in the art.
  • Combination therapies are also contemplated by the disclosure. Combination as used herein includes both simultaneous treatment and sequential treatments. Combinations of methods described herein with standard medical treatments and supportive care are specifically contemplated, as are combinations with therapies, such as glucocorticoids.
  • glucocorticoids are included for use in the combination therapies disclosed herein.
  • glucocorticoids include, but are not limited to, prednisone, prednisolone, dexamethasone, deflazacort, beclomethasone, betamethasone, budesonide, cortisone, hydrocortisone, methylprednisolone, and triamcinolone.
  • an effective dose of a nucleic acid, viral vector, or composition of the disclosure may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal.
  • an effective dose is delivered by a systemic route of administration, i.e., systemic administration.
  • Systemic administration is a route of administration into the circulatory system so that the entire body is affected.
  • Such systemic administration takes place via enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (generally via injection, infusion, or implantation).
  • an effective dose is delivered by a combination of routes.
  • an effective dose is delivered intravenously and/or intramuscularly, or intravenously and intracerebroventricularly, and the like.
  • an effective dose is delivered in sequence or sequentially.
  • an effective dose is delivered simultaneously.
  • Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure are chosen and/or matched by those skilled in the art taking into account the condition or state of the disease or disorder being treated, the condition, state, or age of the subject, and the target cells/tissue(s) that are to express the nucleic acid or protein.
  • actual administration of delivery vehicle may be accomplished by using any physical method that will transport the delivery vehicle (such as rAAV) into a target cell of an animal.
  • Administration includes, but is not limited to, injection into muscle, the bloodstream and/or directly into the nervous system or liver. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV).
  • Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02/053703, the disclosure of which is incorporated by reference herein.
  • Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the disclosure.
  • the delivery vehicle (such as rAAV) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.
  • a dispersion of delivery vehicle (such as rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the sterile aqueous media employed are all readily obtainable by standard techniques known to those skilled in the art.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization.
  • dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-f iltered solution thereof.
  • kits comprising a nucleic acid, vector, or composition of the disclosure or produced according to a process of the disclosure.
  • kit means two or more components, one of which corresponds to a nucleic acid, vector, or composition of the disclosure, and the other which corresponds to a container, recipient, instructions, or otherwise.
  • a kit therefore, in various aspects, is a set of products that are sufficient to achieve a certain goal, which can be marketed as a single unit.
  • the kit may comprise one or more recipients (such as vials, ampoules, containers, syringes, bottles, bags) of any appropriate shape, size and material containing the nucleic acid, vector, or composition of the disclosure in an appropriate dosage for administration (see above).
  • the kit may additionally contain directions or instructions for use (e.g. in the form of a leaflet or instruction manual), means for administering the nucleic acid, vector, or composition, such as a syringe, pump, infuser or the like, means for reconstituting the nucleic acid, vector, or composition and/or means for diluting the nucleic acid, vector, or composition.
  • kits for a single dose of administration unit or for multiple doses are provided.
  • the disclosure provides kits containing singlechambered and multi-chambered pre-filled syringes.
  • nucleic acid includes one or more of such different nucleic acids
  • method includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.
  • the mouse U7 snRNA gene and smOPT sequences were cloned as U7-ACCA containing two U7snRNA antisense masking the acceptor site and two U7snRNA antisense masking the splice donor site (Wein et aL, Nature Medicine 20, 992-1000 (2014); Goyenvalle et aL, Science 306, 1796-1799 (2004)). These were cloned in tandem in a self- complementary AAV vector using an Xbal restriction site. All plasmids constructs were sequence verified. Both ITR and self-complementary AAV backbone were checked using respectively Smal and Mscl.
  • rAAV9 vectors were produced by a modified cross-packaging approach using an adenovirus-free, triple plasmid DNA transfection (CaPO 4 precipitation) method in human embryonic kidney 293 cells (Rabinowitz et aL, J. ViroL 2002; 76: 791-801).
  • the production plasmids were: (i) scAAV9.U7.ACCA, (ii) rep2- cap9 AAV helper plasmids encoding cap serotype 9, and (iii) an adenovirus type 5 helper plasmid (pAdhelper) expressing adenovirus E2A, E4 ORF6, and VA l/ll RNA genes.
  • scAAV9.U7-ACCA and scAAVI .U7-ACCA also were produced in the Viral Vector Core at The Research Institute at National Children’s Hospital via three plasmid DNA transfection of human HEK 293 VVC Master Cell Bank cells with: (i) the pAAV.U7-ACCA vector plasmid, (ii) an AAV9 or AAV1 helper plasmid containing the AAV rep2 and cap9 or cap1 wild-type genes, and (iii) the helper adenovirus plasmid pHELP. Cells were cultivated in Corning Cell Stacks (Corning) and lysed, using methodology standard to the NCH VVC. Two days post transfection, both cells and media were collected.
  • the DRP quantitative PCR (qPCR) assay involves serial dilution of the test sample (10 -2 to 10 -5 ) and sequential digestion with DNase I and Proteinase K, followed by qPCR analysis. DNA detection was accomplished using sequence specific primers targeting a primer/probe combination specific to the construct sequence (probe: 5’- ACGTAGATAAGTAGCATGGCGGGTTA-3’ (SEQ ID NO: 4); Fw primer: 5’- agctcctatgttgttaTCTAGAG-3’ (SEQ ID NO: 5); Rv primer: 5’- CTAGGGGTTCCTTGTAGTTAATG-3’ (SEQ ID NO: 6)) and amplified using a fluorescently tagged probe hybridizing to the U7 amplicon. Titration of the encapsidated viral genome were performed using quantitative PCR-based titration method runned on a Prism 7500 Taqman detector system (PE Applied Biosystems).
  • mice were housed in a barrier facility with HEPA-filtered air that is AAALAC accredited, and maintained with a 12-hour light/dark cycle. Animals were clustered by groups; no randomization was used. AAV injections were conducted in a nonblinded fashion, but all dissection and most experiments were performed in blinded approaches since animals were clustered by groups. The sample sizes were determined based on previous experience and every legend contains the number of animals used in the study. No statistical methods were used to predetermine sample size prior to experimentation.
  • Injection was performed using a tail vein apparatus. The tail was warmed via light bulb to enlarge the veins. Once visible, AAV9 or PBS was injected with 1 ,9e12vg (7.6e13vg/kg) of scAAV9.U7-ACCA in 300pl total of PBS, or PBS alone, using a 33G gastight Hamilton syringe. Following injection, a sterile cotton pad was placed on the injection site and held with pressure until bleeding ceased.
  • PDN Alpha-methylprednisolone
  • IP intraperitoneal injection
  • PBS phosphate buffered saline
  • mice dissection was using standard techniques. Muscles were collected and were either snap frozen or mounted for cryosections, which were cut at 10pM for immunofluorescence and H&E staining. The tibialis anterior (ta), gastrocnemius (gastroc), quadriceps (quad) and triceps from the right side of all treatment groups were analyzed. Tissues/organs for histopathology studies were collected and fixed in 10% neutral buffered formalin (10% NBF).
  • Fibroblasts were seeded in a 10cm coated dish at 50% confluency. When cells reached 70% confluency, media was changed to complete myoblast media ((SkBM-2 complete, Promocell) +4pg/ml of freshly made doxycycline). Medium was switched to myotube media ((C-23061 , Skeletal Muscle Cell Differentiation Medium, Promocell) +4pg/ml of fresh doxycycline (Wein et al., (2010), supra) when myoblasts reached 95% confluent. Medium was changed every 4 days and cells were collected for protein extraction at day 7-14 post-differentiation, depending on the maturation of myotubes, which varied between cell lines.
  • scAAV1.U7-ACCA (3x10 10 for a 6 well plate, or 1.5x10 11 vg for a 10 cm plate) was added when myoblast proliferation media was switched to myotube media.
  • Cells were lysed either 3 days post infection for RNA analysis or 7-14 days post infection for protein extraction.
  • RNA extractions were performed using 1 ml of TRIzol (Life Technologies) per well of 6-well plate, according to the manufacturer’s instructions.
  • 1 pg of total RNA was used to generate cDNA by RT-PCR using random hexamer primers according to the manufacturer’s protocol (Thermo Scientific, Ferk1672) and then used for a single PCR of 35 cycles using 1 pg of RNA and a mixture of random hexamer and oligo(dT) for each RT reaction.
  • PCR amplification was performed using 2 x Master Mix (K0172, ThermoScientific) and 150 ng of RT product as template, using a forward primer - 5’UTR Forward: (5’-TACCTAAGCCTCCTGGAGCA-3’ (SEQ ID NO: 2) and a reverse primer to the junction of exon 3 and 4 - Exon 3/4 Junction Reverse: (5’-CTTTTGGCAGTTTTTGCCCTGTA-3’ (SEQ ID NO: 3)).
  • the possible transcripts included a duplicated exon 2 (340 bp), wild type with a single copy of exon 2 (278 bp) and a A2 transcript that had zero copies of exon 2 (216 bp).
  • PCR products were electrophoresed on a 2% agarose gel and imaged using a Gel Logic 200 Imaging System (Kodak). Quantification of Dup2, WT or Del2 transcript was performed using ImageJ (an open source platform for scientific image analysis), and each band plotted in Prism (GraphPad) as a percentage of the overall dystrophin transcript. The images were then used to quantify the relative amount of each transcript using Imaged software 14.
  • Cryopreserved tissues were used for immunofluorescence staining to identify muscle fibers expressing dystrophin protein (DMD).
  • Sections (10 pM) of frozen muscle were permeabilized (phosphate buffered saline (PBS), 2% Normal goat serum (NGS) and 0.1% TritonTM-X (Sigma-Aldrich)) and then blocked with 15% NGS in PBS.
  • the primary antibody was a rat monoclonal anti-dystrophin (1 :400, Abeam, ab15277) and the secondary antibody (Goat anti-Rabbit, Thermo Fisher A-11011 ) was conjugated with AlexaFluor 568 (1 :250; Invitrogen, A21069).
  • Slides were then mounted using a 2.5% polyvinyl alcohol/1 ,4 diazabicyclo[2.2.2]octane solution. Sections were imaged under a fluorescent microscope.
  • Protein extractions were conducted starting with 25 sections (40 pM) and 100 pl of lysis buffer containing a base buffer, a phosphatase inhibitor (PhosStop, Roche, 4906845001 ) and a protease inhibitor (Halt Protease Inhibitor Cocktail, Fisher, 78430). Steel beads were added to the tissue, which was homogenized using the Tissuelyser II (Qiagen) for 2 min at a rate of 30/sec. Lysates were then incubated on ice and spun down; the supernatant was removed and stored at -80° C until immunoblotting, and the cell debris was discarded.
  • a phosphatase inhibitor PhosStop, Roche, 4906845001
  • a protease inhibitor Halt Protease Inhibitor Cocktail
  • the membranes were then exposed using a rat monoclonal anti-dystrophin primary antibody (1 :200, Abeam, ab15277) and mouse monoclonal a-actinin primary antibody (1 :5000, Fisher, MA122863) followed by IRDye a-rabbit 680 and a-mouse 800 (Licor, 926-68071 and 926-32210) secondary antibody.
  • the membrane was scanned on the Odyssey CLx and imaged using Image Studio 14. Single color channel images were using Image Studio and then imported into Imaged for quantification. For each channel, a box was drawn in each lane around the protein band using the “Gel” function in Imaged. A histogram of each sample was then generated and the area under the curve was measured.
  • Dystrophin was normalized to a- actinin by dividing the area of the dystrophin band by the area of the a-actinin band for each sample. If the same sample was run on multiple immunoblots, the median was taken to represent that particular sample. The C57BL/6 measurement was determined by taking the mean of all wild type samples. Both treated Dup2 and control Dup2 measurements were reported as a percentage of the wild type (n > 3).
  • mice Initial anesthetization of mice was conducted by giving an intraperitoneal injection of a cocktail containing five times their weight (i.e., the weight of the mouse) of 25 mg/mL ketamine and twice their weight of 2.5 mg/mL xylazine.
  • the skin fascia and connective tissue were removed from around the tibialis anterior (TA).
  • TA tibialis anterior
  • a knot was tied to the distal TA tendon with a 4-0 suture and the tendon was cut.
  • the excess suture thread was then knotted again, leaving a loop to attach the tendon to the force transducer.
  • the mouse was then positioned on the platform which was kept at 37 e for the duration of the experiment.
  • the leg limb was secured to the platform by putting a pin through the knee cap and taping down the foot.
  • the loop of suture attached to the TA tendon was then attached to a 205B dual-mode servomotor transducer (Aurora Scientific, Aurora, ON, Canada).
  • the resting force was set to between 3-4 g for a 10 minute equilibrium period.
  • the TA muscle was then stimulated at the optimal length (L o , mm) and active tetanic muscle force was recorded to give the absolute force measurement using the Lab View-based DMC program (Aurora Scientific).
  • the muscle was then run through a 10-step passive stretch protocol during which stimulation was applied to determine the force drop following repeated eccentric contractions. At each step, the TA muscle was passively strained 10% of the L o . Once the protocol was complete, the mice were given a lethal dose of ketamine/xylazine and the TA muscle was removed and weighed.
  • the cross-sectional area measured as mass (g)/(muscle density x ratio of fiber length x L o ) where muscle density is 1 .06 mg/mm 3 and the ratio of fiber length in the TA is 0.6 (Burkholder et aL, J Morphol 1994; 221 :177-190).
  • the cross-sectional area using the muscle weight and L o were applied to the absolute force measurement to give the specific force measurement.
  • Statistical significance was assessed using a Kruskal-Wallace test assuming nonparametric data in the GraphPad Prism (version 6.03 for Windows, GraphPad Software, San Diego California USA). For all data, the mean and standard deviation were determined for each measurement and subsequently measurements that were more than ⁇ 1 standard deviation were removed as outliers. The tenth recording for eccentric contractions was used to determine outliers.
  • mice To induce muscle injury for Evans blue dye (EBD) analysis, a treadmill exercise program was used. In the first week, four month old mice were trained three times on a treadmill at 10° inclination, running as follows: 0 m/min for 2 min, 5 m/min for 5min, 10m/min for 15 min, and 12 m/min for 5-10 min. In the following three weeks (3x/week), mice ran on the treadmill at 2 m/min for 30 min. Before mice euthanasia, the treadmill was used at the same inclination at 5 m/min for 5 min. Following this initial warming up, the speed was increased to +1 m/min until exhaustion.
  • ESD Evans blue dye
  • EBD solution (10 mg/ml in PBS) was filtered and injected intraperitoneally (IP) into mice after the last treadmill exercise, and mice were sacrificed 24 hrs later.
  • IP intraperitoneally
  • muscle sections were stained with a-laminin to distinguish myofibers, and the percentage of positive Evans blue fibers (labeled in red) were then quantified using Imaged software.
  • H&E staining was performed using standard technique, and fiber counting was performed manually using Imaged.
  • three sections were processed and counted for each animal. Analysis of the data was performed blindly, but not randomly.
  • Muscle force assessment in the tibialis anterior (TA) muscle was performed using standard techniques (Hakim et aL, Methods Mol Biol 709, 75-89 (2011)) modified elsewhere (Wein et aL, (2014), supra).
  • In vivo muscle strength was determined by isolating each TA tendon of anesthetized mice. Electrical stimulation was conducted on the muscle to determine force and force drop following repeated eccentric contractions. Specific force was obtained by dividing the maximum tetanic force by the TA muscle cross sectional area. After the eccentric contractions, the mice were then euthanized and the TA muscle was dissected out, weighed and frozen for analyses. Analysis of the data was performed blindly, but not randomly.
  • H&E staining was performed using standard protocol. Quantification of both centronucleation and Evans blue dye (EBD) was performed manually using Imaged. Three sections were processed and counted for each animal. Analysis of the data was performed blindly, but not randomly.
  • Ribosome-protected mRNA fragments (RPF)-Seq libraries were prepared using the TruSeq Small RNA Sample Kit (Illumina) according to the manufacturer’s directions, and 50 bp reads were generated on an Illumina HiSeq instrument. Trimmed and filtered RPF-Seq and RNA-Seq reads were mapped to reference genomes using the STAR aligner or to transcript sequences using cross_match. Custom Perl scripts were used to generate read count tables from mapped RPF-Seq and RNA-Seq reads, and edgeR (Bioconductor) was used for model-based read count normalization. The RPF-Seq and RNA-Seq data have been deposited in NCBI's Gene Expression Omnibus and are accessible through GEO Series accession number GSE56148.
  • scAAV9.U7-ACCA mediates efficient exon skipping and dystrophin expression
  • the scAAV9.U7-ACCA vector was injected into 2- month-old Dup2 mice via tail vein injection at 7.6e13vg/kg. Because the activity of the exon 5 IRES is increased in the presence of a glucocorticoid (6a-methylprednisolone 21- hemisuccinate sodium salt (PDN); (Millipore Sigma), two additional groups of mice were also included (PDN alone or ACCA+PDN).
  • glucocorticoid 6a-methylprednisolone 21- hemisuccinate sodium salt (PDN); (Millipore Sigma)
  • TA tibialis anterior
  • Gas gastrocnemius
  • Tri triceps
  • Tri heart
  • Hrt heart
  • Dia diaphragm
  • RT-PCR reverse transcription polymerase chain reaction
  • Both WT and Del2 transcripts are therapeutic, because they result in translation of either the wild type or IRES-driven dystrophin.
  • F1 ratio of utrophin/a-actinin
  • H&E histopathologic analyses of hematoxylin and eosin stained sections of TA and Dia muscles were performed in the two ACCA-treated groups, as well as in PDN-treated Dup2, untreated Dup2, and WT mice (Fig. 1 D).
  • ACCA-treated muscles showed decreased signs of myofiber necrosis, and decreased central nucleation compared to controls with best results seen in Dia, where combined treatment resulted in less than 40% centrally nucleated fibers as compared to 70% in the untreated Dup2 mice.
  • dystrophin is to link the cytoskeleton to the extracellular matrix via the dystrophin-glycoprotein complex (DGC). If dystrophin is missing or nonfunctional, this complex is completely disrupted or mislocalized, and restoration of the complex would be expected from therapeutic dystrophin re-expression. Restoration of the DGC proteins, a-sarcoglycan (a-SG) and p-dystroglycan (P-DG), and of neuronal nitric oxide synthase (nNOS) was carried out.
  • DGC dystrophin-glycoprotein complex
  • nNOS is a protein that binds to dystrophin to localize to the subsarcolemma region, where it plays a role in signal transduction and has been implicated in DMD pathogenesis (Chang et aL, Proc Natl Acad Sci USA 93, 9142-9147 (1996)).
  • Treatment with ACCA or ACCA+PDN resulted in complete recovery of a-SG in skeletal muscle, with less complete restoration in the diaphragm (Figs. 2A and 7A).
  • the relocalization of p-DG and nNOS after treatment was less evenly distributed, but restoration was observed compared to the non-treated mice, with the exception of the diaphragm where nNOS was not completely restored.
  • RNA from TA specimens was analyzed by ribosome protected fragment analysis (RPF) (Fig. 2F), which allows inferences regarding the translational activity of the mRNA by mapping the distribution of RPFs onto the DMD transcript. It was found that the cumulative distribution of DMD RPF reads covered most of the DMD transcript in the untreated sample. Although the source of this coverage is unknown, it is consistent with a model that would have the source near the 5’ end of the mRNA. Interestingly, there is an inflection point of coverage near the beginning of the Dp71 isoform. In the untreated samples, more than 30% of the total RPF coverage is generated from the Dp71 region. In contrast, the treated sample demonstrated less than 15% of the total RPF coverage mapped to the Dp71 region and had a more uniform coverage across the length of the transcript, consistent with an increased translation from the 5’ end of the mRNA.
  • RPF ribosome protected fragment analysis
  • RNA-Seq data (Table 3) indicated that treatment restored a ‘non-dystrophic’ gene expression profile by reversing the direction and magnitude of differentially expressed genes previously identified in dystrophic skeletal muscle from DMD patients. Genome-wide normalized RPF-Seq data also showed that untreated Dup2 TA samples have a dystrophic transcriptional profile, whereas treatment resulted in a general correction in the level of expression.
  • Haslett et aL Gene expression comparison of biopsies from Duchenne muscular dystrophy (DMD) and normal skeletal muscle. PNAS November 12, 2002 99 (23) 15000-15005; https://doi.org/10.1073/pnas.192571199
  • Example 7 scAAV9.U7-ACCA skipping of exon 2 results in dystrophin expression in human cells harboring non-Dup2 exon 1-4 mutations
  • fibroblasts that were transdifferentiated into myoblasts (FibroMyoD) were used to evaluate exon skipping and dystrophin expression following treatment with scAAVI .U7-ACCA, with or without PDN.
  • the five cell lines each carried different mutations (Fig. 5A).
  • Three cell lines have nonsense mutations within exons 1 -3; one cell line carries a splice site mutation in the -1 position relative to exon 3 that results in an in-frame exon 3-deleted transcript; and one cell line carries an in-frame duplication of exons 3-4.
  • all cell lines with nonsense mutations displayed a transcript corresponding to nearly 100% exon 2 skipping.
  • This transcript leads mainly to expression of the N-truncated but highly functional dystrophin.
  • AAV transduction in the c.94-1G>T cells led to transcripts missing both exon 2 and exon 3, and in the exon 3-4 duplication cells led to two main bands that correspond to the non-skipped and exon 2-skipped transcripts along with two fainter bands corresponding to the wild-type and exons 2-3-4 skipped transcript.
  • These two transcripts lead to expression of both the N- truncated but highly functional dystrophin and the full length dystrophin.
  • Fig. 5B quantifiable blots for two cell lines were obtained (Fig. 5B).
  • the c.94-1 G>T line expressed low levels of dystrophin, but exon 2 skipping resulted in significantly increased dystrophin expression, suggesting that inducing an early premature termination codon results in IRES activation.
  • the second cell line harbors an exon 3 nonsense mutation (c.133C>T, p.Q45X); it already expresses a low level of dystrophin, suggesting utilization of the IRES as we previously demonstrated with frame-truncating mutations in this region (Wein et al., (2014), supra), but increased dystrophin expression is seen with skipping of exon 2 (Fig. 5B).
  • the treatment described herein resulted in significantly greater levels of expression of the IRES-driven dystrophin isoform compared to the c.9G>A founder allele mutation, which results in dystrophin levels of 5-15% of normal, associated with ambulation into the seventh or eighth decade (Gurvich et aL, Hum Mutat 30, 633-640 (2009)).
  • Inducing expression of these full- length and/or IRES-driven dystrophins resulted in significant improvements of muscle function.
  • the muscle with the greatest degree of dystrophin restoration i.e., expression showing nearly 100% of wildtype, was the diaphragm. Such finding was very significant given that respiratory failure is the most common cause of death in DMD.
  • this isoform is able to protect muscle from contraction-induced injury and correct muscle force to near control levels, despite missing half of the canonical actin binding domain 1 (ABD1 ), as translation beginning in exon 6 results in a protein lacking the first of two calponin homology domains (CH1 and CH2).
  • VVC viral vector core
  • CMF Clinical Manufacturing Facility
  • the objective of this study was to determine the potential toxicity of scAAV9.U7.ACCA when given once on Day 1 by intravenous (IV) infusion to male juvenile cynomolgus monkeys.
  • the data provided herein reflect data from an Interim Report of a toxicity study of single dose of scAAV9.U7.ACCA by intravenous infusion in male juvenile cynomolgus monkeys. Time points, procedures, and results described herein this section applied to all the animals through Day 91 . Applicable time points and procedures through Day 182 are described herein, but the additional results will be included in a Final Report, and are not described in this example.
  • the study design was as follows:
  • test and control articles were administered to the appropriate animals (Groups 1 to 3) via IV infusion into a suitable peripheral vein once on Day 1 using a calibrated infusion pump (target 30 minutes infusion).
  • the actual start and stop times of dose administration were recorded in the study record.
  • a hemostat clamp was placed on the infusion line after dose completion and dosing syringes were delivered in vertical position to the Formulations Laboratory for collection of dose formulation analysis samples.
  • the dose volume for each animal was based on the most recent body weight measurement.
  • the animals were temporarily restrained for dose administration and were not sedated. The first day of dosing was designated as Day 1 .
  • the IV route of exposure was selected because this is the intended route of human exposure.
  • Dose levels were based on prior studies that demonstrated the minimal efficacious dose (MED) in Dup2 transgenic mice was about 3 x 10 13 vg/kg/d.
  • the MED and a dose higher i.e., 8 x 10 13 vg/kg/d were evaluated to provide a safety margin for clinical dosing in patients.
  • the test article, scAAV9.U7.ACCA was provided at a concentration of 2.18 x 10 13 vg/mL.
  • scAAV9.U7.ACCA-related changes in hematology parameters were limited to minimally increased monocytes and large unstained cells at both dose levels on Day 7 and at 3 x 10 13 vg/kg/d on Day 14, which were generally comparable to control and/or baseline by Day 28.
  • scAAV9.U7.ACCA-related changes in clinical chemistry parameters included mildly increased triglycerides at 8 x 10 13 vg/kg/d between Days 7 to 70 with values that were comparable to control and/or baseline by Day 84.
  • ALT alanine aminotransferase
  • AST aspartate aminotransferase
  • LDH lactate dehydrogenase
  • scAAV9.U7.ACCA-related microscopic findings were observed in the liver at 3 x 10 13 vg/kg/d and increased in incidence in a dose dependent fashion.
  • Minimal single cell, hepatocyte necrosis was observed at 3 x 10 13 vg/kg/d.
  • mild, diffuse hepatocellular vacuolization was observed in one 8 x 10 13 vg/kg/d dose group animal.
  • RT-PCR was used to evaluate the amount of exon 2 skipping seen at the mRNA level, where potential transcripts include a duplication of exon 2 (Dup2), a single copy of exon 2 (WT), or zero copies of exon 2 (A2) ( Figures 12A-B).
  • the results show an expected dose response, with the lowest dose of 2.0 x 10 10 vg resulting in 1 1% WT transcript, and the incremental dose of 5.6 x 10 10 vg showing both the WT and A2 transcripts each comprising at least 10% of the total transcript.
  • the highest dose of 2.0 x 10 12 vg only 20% of the transcript is Dup2, while the A2 transcript represents almost 75% of the total transcript (Figure 12A-B).
  • Dystrophin immunofluorescence (IF) analysis on frozen sections shows proper sarcolemmal localization at all five doses tested ( Figure 13). Staining can be seen at the lowest dose and increases with each successive dose, consistent with the RT-PCR analysis. Qualitatively, by 5.6 x 10 11 vg fiber membranes are almost completely stained and maintain this level of staining in the highest dose, 2.0 x 10 12 vg. Dystrophin protein was quantified by immunoblot (IB), confirming the dose response; at the highest dose, 2.0 x 10 12 vg, dystrophin restoration reaches almost 35% of the level seen in control animal muscle ( Figure 14A-B).
  • MED minimally efficacious dose
  • scAAV self-complementary adeno-associated viral vector expressing an U7.snRNA (U7.ACCA) under the control of the mouse U7 promoter in Dup2 mice
  • PDN 6-methyl-prednisolone
  • IV dose escalation studies were carried out in order to establish a possible minimal efficacious dose (MED) necessary for designing IND- enabling toxicology studies, as well as for eventual clinical translation.
  • MED minimal efficacious dose
  • IF immunofluorescence
  • WB Western blot
  • Quantification of dystrophin expression by immunoblot shows a dose-related increase in dystrophin protein, with levels in the gastrocnemius and heart reaching 100% and 85% that of WT muscle at 4.7 x 10 14 vg/kg ( Figure 18A-B), consistent with the RT-PCR and immunofluorescence results. Staining showed proper sarcolemmal localization of the dystrophin protein at all doses when present with the heart and gastrocnemius showing the greatest dystrophin signal. Staining was not seen at the lowest dose except for the occasional revertant fiber but gradually increased with each successive dose. The heart is the first muscle to show dystrophin expression and remains one of the highest transduced muscles throughout each dose.
  • Protein was isolated from 5 muscles (TA, Gas, Triceps, Diaphragm and Heart) from each mouse and quantification was performed using Western blots on the three highest doses (5.8x10 13 , 1 .8x10 14 or 4.7x10 14 vg/kg) following 4 weeks and 12 weeks of treatment. Dystrophin expression increased in a linear dose-dependent response in each muscle for both time-points. Following 12 weeks of therapy, Western blot analysis corroborated the immunofluorescence results and demonstrated a restoration of 90% wild type levels in the heart, 108% in the triceps, and 65% in the diaphragm.
  • Immunofluorescence shows an increase in dystrophin at the lowest dose of 5.8 x 10 13 vg/kg and nearly complete restoration of sarcolemmal dystrophin at the highest dose in all muscles (Figure 20). Immunoblot analysis again corroborates the immunofluorescence results, showing levels of 90% of WT muscle in the heart, 108% in the triceps, and 65% in the diaphragm at the highest dose of 4.7 x 10 14 vg/kg ( Figure 21A-B).
  • scAAV9.U7.ACCA results in complete restoration of absolute force, as well as a partial rescue in both specific force and force drop following repeated eccentric contractions, at least in the TA muscle, given the protection that expression of the N-deleted isoform confers on patients who express it as a founder allele (Flanigan et aL, NeuromuscuL Disord. 2009; 19: 743-8).
  • RT-PCR and dystrophin expression following IM injection is useful in measures of potency for comparing vectors or vector lots, successful systemic delivery is critical to therapeutic translation, given that muscle represents 30-40% of adult body mass.
  • Protein was isolated from 5 muscles (TA, Gas, Triceps, Diaphragm and Heart) from each mouse and quantification was performed using Western blots following 12-14 weeks of treatment with scAAV9.U7.ACCA either alone or in combination with one month of treatment with PDN ( Figure 23). Dystrophin was present following treatment with scAAV9.U7.ACCA in every muscle and a one-fold increase was seen in some muscle with PDN addition.
  • Tibialis Anterior (TA) muscle strength of mice was assessed through in vivo force analysis following systemic delivery of 4.7x1014vg/kg of scAAV9.U7.ACCA alone or in combination with PDN. Both absolute and specific force increased following treatment of scAAV9.U7.ACCA alone or in combination with PDN (Figs. 24A-B). In addition, there was also improvement in force drop following repeated eccentric contractions (Fig. 24C).
  • U7-Dup2-01 is a 9-year-old male with a confirmed duplication of exon 2 in the DMD gene. Symptoms were first noticed around age 3, falling more frequently, and genetic testing was done at age 5. He has been on daily deflazacort since April 22, 2017 and his dose was increased to 18mg total daily on October 16, 2019.
  • U7-Dup2-02 is a 14-year-old male with a confirmed duplication of exon 2 in the DMD gene. He was born full term and early milestones were all on time. Symptoms were first noticed around age 4 or 4.5 with some toe walking, and generally appearing to be walking differently. He was diagnosed incidentally around age 4.5 and started deflazacort in January of 2014. He was on deflazacort 30mg daily prior to study enrollment.
  • NCH National Children’s Hospital
  • Treatment is associated with mild transient elevation of transaminases, alanine transaminase (ALT) and aspartate transaminase (AST) and sustained decrease in serum creatinine kinase (CK) (Fig. 25). There was a 95% decrease in serum CK level from baseline (13,495 to 560 u/L) in U7-Dup2-01. There was an 81% decrease in serum CK level from baseline (5,103 to 947 u/L). [270] Table 7. Functional outcomes.
  • Fig. 26 shows on-gel standard curve (normal muscle dilution series). Western blot was performed in duplicate and the mean is reported.
  • Fig. 27 shows exon skipping by RT-PCR demonstrated a biologic effect. At 3 months posttreatment, there was an increase in both WT and Del2 transcripts over baseline, and an increase in total therapeutic transcript in both subjects over baseline. Quantification of vector genomes in skeletal muscle 3 months post-treatment also is shown.
  • Fig. 28 shows that dystrophin expression was markedly improved in subject 1 at 3 months post-treatment over baseline.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Neurology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Dermatology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2021/052425 2020-09-28 2021-09-28 Products and methods for treating muscular dystrophy Ceased WO2022067257A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US18/246,594 US20240261434A1 (en) 2020-09-28 2021-09-28 Products and methods for treating muscular dystrophy
EP21806444.2A EP4217375A1 (en) 2020-09-28 2021-09-28 Products and methods for treating muscular dystrophy
JP2023519230A JP2023543029A (ja) 2020-09-28 2021-09-28 筋ジストロフィーの治療のための製品及び方法
AU2021349277A AU2021349277A1 (en) 2020-09-28 2021-09-28 Products and methods for treating muscular dystrophy
CA3194122A CA3194122A1 (en) 2020-09-28 2021-09-28 Products and methods for treating muscular dystrophy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063084259P 2020-09-28 2020-09-28
US63/084,259 2020-09-28

Publications (1)

Publication Number Publication Date
WO2022067257A1 true WO2022067257A1 (en) 2022-03-31

Family

ID=80846947

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/052425 Ceased WO2022067257A1 (en) 2020-09-28 2021-09-28 Products and methods for treating muscular dystrophy

Country Status (6)

Country Link
US (1) US20240261434A1 (https=)
EP (1) EP4217375A1 (https=)
JP (1) JP2023543029A (https=)
AU (1) AU2021349277A1 (https=)
CA (1) CA3194122A1 (https=)
WO (1) WO2022067257A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12037588B2 (en) 2022-03-04 2024-07-16 Locanabio, Inc. Compositions and methods comprising engineered short nuclear RNA (snRNA)
WO2025072530A3 (en) * 2023-09-26 2025-05-08 Regeneron Pharmaceuticals, Inc. Compositions and methods comprising small nuclear rna (snrna) for treating dmd

Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1995013392A1 (en) 1993-11-09 1995-05-18 Medical College Of Ohio Stable cell lines capable of expressing the adeno-associated virus replication gene
WO1995013365A1 (en) 1993-11-09 1995-05-18 Targeted Genetics Corporation Generation of high titers of recombinant aav vectors
WO1996017947A1 (en) 1994-12-06 1996-06-13 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant aav vectors
WO1997006243A1 (fr) 1995-08-10 1997-02-20 Pasteur Merieux Serums Et Vaccins Procede de purification de virus par chromatographie
WO1997008298A1 (en) 1995-08-30 1997-03-06 Genzyme Corporation Chromatographic purification of adenovirus and aav
WO1997009441A2 (en) 1995-09-08 1997-03-13 Genzyme Corporation Improved aav vectors for gene therapy
WO1997021825A1 (en) 1995-12-15 1997-06-19 Systemix, Inc. Method for obtaining retroviral packaging cell lines producing high transducing efficiency retroviral supernatant
WO1998009657A2 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania Method for recombinant adeno-associated virus-directed gene therapy
US5786211A (en) 1994-06-06 1998-07-28 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
WO1999011764A2 (en) 1997-09-05 1999-03-11 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of recombinant aav vectors
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
WO2002053703A2 (en) 2001-01-05 2002-07-11 Children's Hospital, Inc. Aav2 vectors and methods
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US7282199B2 (en) 2001-12-17 2007-10-16 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same, and uses therefor
WO2014172669A1 (en) * 2013-04-20 2014-10-23 Research Institute At Nationwide Children's Hospital Recombinant adeno-associated virus delivery of exon 2-targeted u7snrna polynucleotide constructs
WO2016025339A2 (en) * 2014-08-09 2016-02-18 Research Institute At Nationwide Children's Hospital Methods and materials for activating an internal ribosome entry site in exon 5 of the dmd gene
US9614423B2 (en) 2012-04-07 2017-04-04 Traugott Weller Method for producing rotating electrical machines
US9613872B2 (en) 2014-09-29 2017-04-04 Kabushiki Kaisha Toshiba Method of manufacturing semiconductor device
US9620777B2 (en) 2013-09-30 2017-04-11 Tdk Corporation Positive electrode and lithium ion secondary battery using thereof
US9818600B2 (en) 2014-03-21 2017-11-14 Hitachi Kokusai Electric, Inc. Substrate processing apparatus and method of manufacturing semiconductor device

Patent Citations (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1995013392A1 (en) 1993-11-09 1995-05-18 Medical College Of Ohio Stable cell lines capable of expressing the adeno-associated virus replication gene
WO1995013365A1 (en) 1993-11-09 1995-05-18 Targeted Genetics Corporation Generation of high titers of recombinant aav vectors
US5658776A (en) 1993-11-09 1997-08-19 Targeted Genetics Corporation Generation of high titers of recombinant AAV vectors
US5786211A (en) 1994-06-06 1998-07-28 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
WO1996017947A1 (en) 1994-12-06 1996-06-13 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant aav vectors
WO1997006243A1 (fr) 1995-08-10 1997-02-20 Pasteur Merieux Serums Et Vaccins Procede de purification de virus par chromatographie
WO1997008298A1 (en) 1995-08-30 1997-03-06 Genzyme Corporation Chromatographic purification of adenovirus and aav
WO1997009441A2 (en) 1995-09-08 1997-03-13 Genzyme Corporation Improved aav vectors for gene therapy
WO1997021825A1 (en) 1995-12-15 1997-06-19 Systemix, Inc. Method for obtaining retroviral packaging cell lines producing high transducing efficiency retroviral supernatant
WO1998009657A2 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania Method for recombinant adeno-associated virus-directed gene therapy
WO1999011764A2 (en) 1997-09-05 1999-03-11 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of recombinant aav vectors
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
WO2002053703A2 (en) 2001-01-05 2002-07-11 Children's Hospital, Inc. Aav2 vectors and methods
US7282199B2 (en) 2001-12-17 2007-10-16 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same, and uses therefor
US7790449B2 (en) 2001-12-17 2010-09-07 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) serotype 8 sequences, vectors containing the same, and uses therefor
US9614423B2 (en) 2012-04-07 2017-04-04 Traugott Weller Method for producing rotating electrical machines
WO2014172669A1 (en) * 2013-04-20 2014-10-23 Research Institute At Nationwide Children's Hospital Recombinant adeno-associated virus delivery of exon 2-targeted u7snrna polynucleotide constructs
US9620777B2 (en) 2013-09-30 2017-04-11 Tdk Corporation Positive electrode and lithium ion secondary battery using thereof
US9818600B2 (en) 2014-03-21 2017-11-14 Hitachi Kokusai Electric, Inc. Substrate processing apparatus and method of manufacturing semiconductor device
WO2016025339A2 (en) * 2014-08-09 2016-02-18 Research Institute At Nationwide Children's Hospital Methods and materials for activating an internal ribosome entry site in exon 5 of the dmd gene
US9613872B2 (en) 2014-09-29 2017-04-04 Kabushiki Kaisha Toshiba Method of manufacturing semiconductor device

Non-Patent Citations (69)

* Cited by examiner, † Cited by third party
Title
"GenBank Accession", Database accession no. NC_001829
"GenBank", Database accession no. NC 00 1862
AARTSMA-RUS ET AL., J NEUROMUSCUL DIS, vol. 6, 2019, pages 147 - 159
ADELINE VULIN ET AL: "A New Mouse Model of DMD: A Tool for Therapeutic Development Directed at Exon Duplications", vol. 21, no. Suppl. 1, 1 June 2013 (2013-06-01), pages S71, XP002728583, ISSN: 1525-0016, Retrieved from the Internet <URL:http://www.distrofiamuscular.net/abstracts30.html> *
ALFANO ET AL., MEDICINE (BALTIMORE, vol. 98, 2019, pages e15858
BARBASH ET AL., GENE THER, vol. 20, 2013, pages 274 - 282
BARTHELEMY ET AL., NEUROMUSCUL DISORD, vol. 28, 2018, pages 116 - 121
BLADEN ET AL., HUM MUTAT, vol. 36, 2015, pages 395 - 402
BURGESS ET AL., METHODS MOL. BIOL., vol. 602, 2010, pages 347 - 393
BURKHOLDER ET AL., J MORPHOL, vol. 221, 1994, pages 177 - 190
CARTER, CURRENT OPINIONS IN BIOTECHNOLOGY, 1992, pages 1533 - 539
CARTER, MOL THER, vol. 10, 2004, pages 981 - 989
CHANG ET AL., PROC NATL ACAD SCI USA, vol. 93, 1996, pages 9142 - 9147
CLARK ET AL., GENE THERAPY, vol. 3, 1996, pages 1124 - 1132
CLARK ET AL., HUM. GENE THER., vol. 10, no. 6, 1999, pages 1031 - 1039
DECONINCK ET AL., CELL, vol. 90, 1997, pages 717 - 727
DUAN, MOL THER, vol. 26, 2018, pages 2337 - 2356
DUCHENNE: "The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy", BR MED J, vol. 2, 8 January 1967 (1967-01-08), pages 541 - 542
DYCKTHOMAS: "Peripheral Neuropathy", vol. 1, 2005, ELSEVIER
FLANIGAN ET AL., NEUROMUSCUL DISORD, vol. 19, 2009, pages 743 - 748
FLANIGAN ET AL., NEUROMUSCUL. DISORD., vol. 19, 2009, pages 743 - 8
GAO ET AL., J. VIROL., vol. 78, 2004, pages 6381 - 6388
GORMAN ET AL., PROC NATL ACAD SCI USA, vol. 95, 1998, pages 4929 - 4934
GOYENVALLE ET AL., HUM MOL GENET, vol. 21, 2012, pages 2559 - 2571
GOYENVALLE ET AL., SCIENCE, vol. 306, no. 5702, 2004, pages 1796 - 1799
GURVICH ET AL., HUM MUTAT, vol. 30, 2009, pages 633 - 640
HAKIM ET AL., J APPL. PHYSIOL., vol. 110, 1985, pages 1656 - 1663
HAKIM ET AL., METHODS MOL BIOL, vol. 709, 2011, pages 75 - 89
HASLETT ET AL., PROC NATL ACAD SCI USA, vol. 99, 2002, pages 15000 - 15005
HENDERSON ET AL., PROC NATL ACAD SCI USA, vol. 107, 2010, pages 9632 - 9637
HERMONAT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6466
JUAN-MATEU ET AL., PLOS ONE, vol. 10, 2015, pages e0135189
KANE L GREER ET AL: "Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene", vol. 3, no. 2014, 1 March 2014 (2014-03-01), pages e155.1 - e155.7, XP002728584, ISSN: 2162-2531, Retrieved from the Internet <URL:http://www.nature.com/mtna/journal/v3/n3/pdf/mtna20148a.pdf> [retrieved on 20140318], DOI: 10.1038/MTNA.2014.8 *
LAUGHLIN ET AL., GENE, vol. 23, 1983, pages 65 - 73
LEBKOWSKI ET AL., MOL. CELL. BIOL., vol. 7, 1988, pages 2072
LEVY ET AL., EUR. J. HUM. GENET., vol. 18, no. 9, 2010, pages 969 - 70
MARSIC ET AL., MOLECULAR THERAPY, vol. 22, no. 11, 2014, pages 1900 - 1909
MCCARTY, MOL. THER., vol. 16, no. 10, 2008, pages 1648 - 1656
MCLAUGHLIN ET AL., J. VIROL., vol. 62, 1988, pages 1963
MENDELL ET AL., ANN NEUROL, vol. 71, 2012, pages 304 - 313
MENDELL ET AL., N ENGL J MED, vol. 377, 2017, pages 1713 - 1722
MOL. THER., vol. 13, no. 1, 2006, pages 67 - 76
MONACO, TRENDS BIOCHEM SCI, vol. 14, 1989, pages 412 - 415
MUZYCZKA, CURR TOP MICROBIOL IMMUNOL, vol. 158, 1992, pages 97 - 129
MUZYCZKA, CURR. TOPICS IN MICROBIOL. AND IMMUNOL, vol. 158, 1992, pages 97 - 129
MUZYCZKA, CURRENT TOPICS IN MICROBIOLOGY AND IMMUNOLOGY, vol. 158, 1992, pages 97 - 129
PASSAMANO ET AL., ACTA MYOL, vol. 31, 2012, pages 121 - 125
PAUL ET AL., HUMAN GENE THERAPY, vol. 4, 1993, pages 609 - 615
PERRIN ET AL., VACCINE, vol. 13, 1995, pages 1244 - 1250
PETROF ET AL., PROC NATL ACAD SCI USA, vol. 90, 1993, pages 3710 - 3714
RABINOWITZ ET AL., J. VIROL., vol. 76, 2002, pages 791 - 801
SAMULSKI ET AL., ANNU REV VIROL, vol. 1, 2014, pages 427 - 451
SAMULSKI ET AL., J. VIROL., vol. 63, 1989, pages 3822 - 3828
SAMULSKI ET AL., PROC. NATL. ACAD. S6. USA, vol. 79, 1982, pages 2077 - 2081
SCHENPPCLARK, METHODS MOL. MED., vol. 69, 2002, pages 427 - 443
SENAPATHY ET AL., J. BIOL. CHEM., vol. 259, 1984, pages 4661 - 4666
SRIVASTAVA ET AL., J. VIROL., vol. 45, 1983, pages 555 - 564
SUTER ET AL., HUM MOL GENET, vol. 8, 1999, pages 2415 - 2423
TRATSCHIN ET AL., MO1. CELL. BIOL., vol. 5, 1985, pages 3251
TRENDS, BIOCHEM SCI, vol. 14, 1989, pages 412 - 415
VIROLOGY, vol. 330, no. 2, 2004, pages 375 - 383
VULIN ET AL., MOL THER, vol. 20, 2012, pages 2120 - 2133
VULIN ET AL., NEUROMUSCUL DISORD, vol. 25, 2015, pages 827 - 834
WEIN ET AL., HUM MUTAT, vol. 31, 2010, pages 136 - 142
WEIN ET AL., HUM. MUTAT., vol. 31, no. 2, 2010, pages 136 - 42
WEIN ET AL., NAT MED, vol. 20, 2014, pages 992 - 1000
WEIN ET AL., NAT. MED., vol. 20, no. 9, 2014, pages 992 - 1000
WEIN ET AL., NATURE MEDICINE, vol. 20, 2014, pages 992 - 1000
WEIN ET AL., PEDIATR CLIN NORTH AM, vol. 62, 2015, pages 723 - 742

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12037588B2 (en) 2022-03-04 2024-07-16 Locanabio, Inc. Compositions and methods comprising engineered short nuclear RNA (snRNA)
WO2025072530A3 (en) * 2023-09-26 2025-05-08 Regeneron Pharmaceuticals, Inc. Compositions and methods comprising small nuclear rna (snrna) for treating dmd

Also Published As

Publication number Publication date
US20240261434A1 (en) 2024-08-08
EP4217375A1 (en) 2023-08-02
JP2023543029A (ja) 2023-10-12
CA3194122A1 (en) 2022-03-31
AU2021349277A1 (en) 2023-05-11

Similar Documents

Publication Publication Date Title
AU2021203044B2 (en) Adeno-Associated Virus Vector Delivery Of B-Sarcoglycan And Microrna-29 And The Treatment Of Muscular Dystrophy
AU2020217441B2 (en) Recombinant Adeno-Associated Virus Delivery Of Exon 2-Targeted U7snRNA Polynucleotide Constructs
EP2097095B1 (en) Myostatin inhibition for enhancing muscle and/or improving muscle function
US10842886B2 (en) Guided injections for AAV gene transfer to muscle
US20240200066A1 (en) Products and methods for treating muscular dystrophy
KR20210133242A (ko) B-사르코글리칸의 아데노 관련 바이러스 벡터 전달 및 근이영양증의 치료
JP2023551279A (ja) 顔面肩甲上腕筋ジストロフィー(fshd)を治療するための組成物及び方法
US20240261434A1 (en) Products and methods for treating muscular dystrophy
WO2025212838A1 (en) Products and methods for treating diseases or disorders associated with dux4 overexpression
HK1221962B (en) Recombinant adeno-associated virus delivery of exon 2-targeted u7snrna polynucleotide constructs

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21806444

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2023519230

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3194122

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2021806444

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021806444

Country of ref document: EP

Effective date: 20230428

ENP Entry into the national phase

Ref document number: 2021349277

Country of ref document: AU

Date of ref document: 20210928

Kind code of ref document: A