WO2022066911A1 - Compositions and methods for inhibiting alpha-synuclein aggregation - Google Patents

Compositions and methods for inhibiting alpha-synuclein aggregation Download PDF

Info

Publication number
WO2022066911A1
WO2022066911A1 PCT/US2021/051758 US2021051758W WO2022066911A1 WO 2022066911 A1 WO2022066911 A1 WO 2022066911A1 US 2021051758 W US2021051758 W US 2021051758W WO 2022066911 A1 WO2022066911 A1 WO 2022066911A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
aav
promoter
composition
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/051758
Other languages
English (en)
French (fr)
Inventor
Raj Mehra
Timothy Whitaker
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Seelos Therapeutics Inc
Original Assignee
Seelos Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seelos Therapeutics Inc filed Critical Seelos Therapeutics Inc
Priority to CA3192936A priority Critical patent/CA3192936A1/en
Priority to EP21873431.7A priority patent/EP4216978A4/en
Priority to US18/027,250 priority patent/US20240025953A1/en
Priority to CN202180070652.0A priority patent/CN116457466A/zh
Priority to AU2021349261A priority patent/AU2021349261A1/en
Priority to JP2023518378A priority patent/JP2023542950A/ja
Publication of WO2022066911A1 publication Critical patent/WO2022066911A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00Modified animals
    • A01K2207/10Animals modified by protein administration, for non-therapeutic purpose
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/035Animal model for multifactorial diseases
    • A01K2267/0356Animal model for processes and diseases of the central nervous system, e.g. stress, learning, schizophrenia, pain, epilepsy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/42Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a HA(hemagglutinin)-tag
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/15Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/60Vector systems having a special element relevant for transcription from viruses

Definitions

  • This disclosure provides methods and compositions useful for the treatment of neurodegenerative diseases.
  • this disclosure provides methods and compositions useful for the treatment of neurodegenerative diseases such as Parkinson’s disease by administering an adeno-associated viral vector that encode one or more peptides that inhibit ⁇ -synuclein aggregation.
  • Synucleinopathies such as Parkinson's disease (PD), dementia with Lewy bodies (DLB) and multiple system atrophy (MSA) are a class of neurodegenerative diseases characterized by the abnormal accumulation of aggregates of ⁇ -synuclein ( ⁇ - syn) protein in the cytoplasm of selective populations of neurons and glia. These aggregates are the main component of both Lewy bodies, the defining histological feature of PD and DLB, and oligodendroglial inclusions, which are found in MSA. Such aggregates have been shown to accompany neuronal damage (Spillantini et al. Nature. 1997; 388(6645):839-40 and Ubhi et al.
  • compositions that include a viral vector, wherein the viral vector includes a coding sequence that encodes a peptide that include the amino acid sequence: AVVWGVTAV (SEQ ID NO: 1) or AVVTGVTAV (SEQ ID NO: 2).
  • the composition includes a coding sequence that encodes a peptide that include the amino acid sequence: GAVVWGVTAVKK (SEQ ID NO: 3) or RAVVTGVTAVAE (SEQ ID NO: 4).
  • the composition includes a coding sequence that encodes a peptide that include the amino acid sequence: GAVVWGVTAVKKGRKKRRQRRRPQ (SEQ ID NO: 6) or YGRKKRRQRRRAVVTGVTAVAE (SEQ ID NO: 7).
  • the peptide is from 9 to 45 amino acids in length.
  • the peptide is from 30 to 40 amino acids in length.
  • the peptide is 34 amino acids in length.
  • the peptide is 36 amino acids in length.
  • compositions that include a viral vector provided herein include a viral vector that includes a coding sequence that encodes a peptide that inhibits ⁇ -synuclein (SEQ ID NO: 8) aggregation by binding to residues 68-78 of ⁇ -synuclein.
  • the viral vector is an AAV vector.
  • the AAV vector is an AAV serotype 1 vector (AAV1), an AAV serotype 2 vector (AAV2), an AAV serotype 1 and 2 hybrid vector (AAV1/2), an AAV serotype 3 vector (AAV3), an AAV serotype 4 vector (AAV4), an AAV serotype 5 vector (AAV5), an AAV serotype 6 vector (AAV6), an AAV serotype 7 vector (AAV7), an AAV serotype 8 vector (AAV8), or an AAV serotype 9 vector (AAV9).
  • the AAV vector is an AAV1 vector, an AAV2 vector, an AAV1/2 vector, an AAV4 vector, an AAV5 vector, an AAV8 vector, or an AAV9 vector. In some embodiments, the AAV vector is an AAV1/2 vector.
  • compositions that include a viral vector provided herein include a viral vector that includes a coding sequence that encodes a heterologous peptide tag.
  • the heterologous peptide tag is coupled to the peptide.
  • the heterologous peptide tag is a human influenza hemagglutinin (HA) tag.
  • compositions that include a viral vector provided herein include a viral vector that includes a regulatory sequence.
  • regulatory sequence includes a promoter.
  • the promoter is an inducible promoter, a constitutive promoter, or a tissue-specific promoter.
  • the promoter is the JC polymovirus promoter, the platelet-derived growth factor B-chain (PDGF-beta) promoter, the chicken ⁇ -actin (CBA) promoter, or the cytomegalovirus (CMV) promoter.
  • the regulatory sequence is a SV40 early enhancer/promoter element, a hybrid CMV enhancer/PDGF-beta promoter element, or a hybrid CMV enhancer/CBA promoter element. In some embodiments, the regulatory sequence is a hybrid CMV enhancer/CBA promoter. In some embodiments, the hybrid CMV enhancer/CBA promoter includes a nucleic acid sequence of SEQ ID NO: 9. [0010] In some embodiments, compositions that include a viral vector provided herein include a viral vector that includes a post-transcriptional regulatory element. In some embodiments, the post-transcriptional regulatory element is a Woodchuck post- transcriptional regulatory element.
  • the Woodchuck post- transcriptional regulatory element includes a nucleic acid sequence of SEQ ID NO: 10.
  • compositions that include a viral vector provided herein include a viral vector that includes a scaffold attachment region sequence.
  • the scaffold attachment region sequence includes a nucleic acid sequence of SEQ ID NO: 12.
  • compositions that include a viral vector provided herein include a viral vector that includes a polyadenylation signal sequence.
  • the polyadenylation sequence is a bovine growth hormone (BGH) polyadenylation signal sequence.
  • BGH bovine growth hormone
  • the bovine growth hormone (BGH) polyadenylation signal sequence includes a nucleic acid sequence of SEQ ID NO: 11.
  • compositions that include a viral vector provided herein include a viral vector that includes a nucleic acid sequence of SEQ ID NO: 13 or SEQ ID NO: 14. [0014] In some embodiments, compositions that include a viral vector provided herein further include a pharmaceutically acceptable excipient. [0015] In some embodiments, provided herein are kits that include any of the compositions that include a viral vector provided herein. In some embodiments, kits provide herein further include a pre-loaded syringe that include the composition.
  • adeno-associated viral (AAV) vectors wherein the AAV includes a coding sequence that encodes a peptide that include the amino acid sequence: AVVWGVTAV (SEQ ID NO: 1) or AVVTGVTAV (SEQ ID NO: 2).
  • the AAV includes a coding sequence that encodes a peptide that include the amino acid sequence: GAVVWGVTAVKK (SEQ ID NO: 3) or RAVVTGVTAVAE (SEQ ID NO: 4).
  • the AAV includes a coding sequence that encodes a peptide that include the amino acid sequence: GAVVWGVTAVKKGRKKRRQRRRPQ (SEQ ID NO: 6) or YGRKKRRQRRRAVVTGVTAVAE (SEQ ID NO: 7).
  • the peptide is from 9 to 45 amino acids in length.
  • the peptide is from 30 to 40 amino acids in length.
  • the peptide is 34 amino acids in length.
  • the peptide is 36 amino acids in length.
  • AAVs provided herein include a coding sequence that encodes a peptide that inhibits ⁇ -synuclein (SEQ ID NO: 8) aggregation by binding to residues 68-78 of ⁇ - synuclein.
  • AAVs provided herein are an AAV serotype 1 vector (AAV1), an AAV serotype 2 vector (AAV2), an AAV serotype 1 and 2 hybrid vector (AAV1/2), an AAV serotype 3 vector (AAV3), an AAV serotype 4 vector (AAV4), an AAV serotype 5 vector (AAV5), an AAV serotype 6 vector (AAV6), an AAV serotype 7 vector (AAV7), an AAV serotype 8 vector (AAV8), or an AAV serotype 9 vector (AAV9).
  • AAVs provided herein are an AAV1 vector, an AAV2 vector, an AAV1/2 vector, an AAV4 vector, an AAV5 vector, an AAV8 vector, or an AAV9 vector.
  • the AAV vector is an AAV1/2 vector.
  • AAVs provided herein include a coding sequence that encodes a heterologous peptide tag.
  • the heterologous peptide tag is coupled to the peptide.
  • the heterologous peptide tag is a human influenza hemagglutinin (HA) tag.
  • the AAV vector includes a regulatory sequence.
  • the regulatory sequence includes a promoter.
  • the promoter is an inducible promoter, a constitutive promoter, or a tissue-specific promoter.
  • the promoter is the JC polymovirus promoter, the platelet-derived growth factor B-chain (PDGF-beta) promoter, the chicken ⁇ -actin (CBA) promoter, or the cytomegalovirus (CMV) promoter.
  • the regulatory sequence is the SV40 early enhancer/promoter element, the hybrid CMV enhancer/PDGF-beta promoter element, or the hybrid CMV enhancer/CBA promoter element. In some embodiments, the regulatory sequence is the hybrid CMV enhancer/CBA promoter.
  • the hybrid CMV enhancer/CBA promoter includes a nucleic acid sequence of SEQ ID NO: 9.
  • the AAV vector includes a post-transcriptional regulatory element.
  • the post-transcriptional regulatory element is a Woodchuck post-transcriptional regulatory element.
  • the Woodchuck post-transcriptional regulatory element includes a nucleic acid sequence of SEQ ID NO: 10.
  • the AAV vector includes a scaffold attachment region sequence.
  • the scaffold attachment region sequence includes a nucleic acid sequence of SEQ ID NO: 12.
  • the AAV vector includes a polyadenylation sequence.
  • the polyadenylation sequence is a bovine growth hormone (BGH) polyadenylation sequence.
  • the bovine growth hormone (BGH) polyadenylation sequence includes a nucleic acid sequence of SEQ ID NO: 11.
  • the AAV vector includes a nucleic acid sequence of SEQ ID NO: 13 or SEQ ID NO: 14.
  • provided herein are methods for treating a neurodegenerative disease in a subject, the method that include administering to the subject an effective amount of any of the compositions or any of the AAV vectors provided herein.
  • the neurodegenerative disease is Alzheimer’s disease or a synucleinopathy.
  • the synucleinopathy is selected from the group consisting of: a Lewy body disorder, Parkinson’s disease (PD), PD with dementia (PDD), pure autonomic failure (PAF), and multiple system atrophy (MSA).
  • PD Parkinson’s disease
  • PPD PD with dementia
  • PAF pure autonomic failure
  • MSA multiple system atrophy
  • provided herein are methods for reducing ⁇ -synuclein (SEQ ID NO: 8) aggregation in a subject in need thereof, the method that include administering to the subject an effective amount of any of the compositions or any of the AAV vectors provided herein.
  • the neurodegenerative disease is Alzheimer’s disease or a synucleinopathy.
  • the synucleinopathy is selected from the group consisting of: a Lewy body disorder, Parkinson’s disease (PD), PD with dementia (PDD), pure autonomic failure (PAF), and multiple system atrophy (MSA).
  • PD Parkinson’s disease
  • PPD PD with dementia
  • PAF pure autonomic failure
  • MSA multiple system atrophy
  • the composition or the AAV vector is administered parenterally.
  • the composition or the AAV vector is administered to the central nervous system of the subject.
  • the composition or the AAV vector is administered intracranially.
  • the composition or the AAV vector is administered to the substantia nigra of the subject.
  • kits that include any of the compositions or any of the AAV vectors provided herein, and instructions for performing any of the methods provided herein.
  • amino acid refers to any amino acid, including naturally occurring amino acids (e.g., alpha-amino acids), unnatural amino acids, and modified amino acids.
  • amino acid includes both D- and L-amino acids.
  • unnatural amino acids include beta-amino acids, homo-amino acids, proline and pyruvic acid derivatives, 3-substituted alanine derivatives, glycine derivatives, ring substituted phenylalanine and tyrosine derivatives, linear core amino acids, and N-methyl amino acids.
  • a modified amino acid can be an amino acid resulting from a reaction at an amino group, carboxy group, side-chain functional group, or from the replacement of any hydrogen by a heteroatom.
  • Amino acids are referred to herein by their full name and/or by their IUPAC one-letter abbreviation.
  • Reference to the term "about” has its usual meaning in the context of compositions to allow for reasonable variations in amounts that can achieve the same effect and also refers herein to a value of plus or minus 10% of the provided value. For example, "about 20" means or includes amounts from 18 to and including 22.
  • singular terms shall include pluralities and plural terms shall include the singular.
  • This disclosure provides viral vectors that encode one or more peptides that inhibit ⁇ -synuclein aggregation. Also provided herein are methods of inhibiting ⁇ - synuclein aggregation in a subject using viral vectors that encode one or more peptides that inhibit ⁇ -synuclein aggregation.
  • the ⁇ -synuclein protein a 140 amino acid protein (SEQ ID NO: 8) that has been found in amyloid deposits in neuronal cells in disease conditions, plays a fundamental role in the pathogenesis of synucleinopathies such as Parkinson’s disease, dementia with Lewy bodies, and multiple system atrophy (see, e.g., Visanji et al. Transl Neurodegener.2019; 8:28). Abnormal deposition of ⁇ -synuclein is also observed in a variety of other diseases including Alzheimer's disease, pure autonomic failure, and REM sleep behavior disorder (Brás et al. J Neurochem.2020; 153(4):433-454).
  • a “peptide that inhibits ⁇ -synuclein aggregation” or a “peptide inhibitor of ⁇ - synuclein aggregation” is any peptide exhibiting one or more of the following activities: decreasing the rate of ⁇ -synuclein aggregation, decreasing the amount of ⁇ -synuclein aggregation, decreasing the spread of ⁇ -synuclein aggregation, preventing ⁇ -synuclein aggregation, stopping ⁇ -synuclein aggregation, eliminating ⁇ -synuclein aggregation reducing and/or eliminating the toxicity of ⁇ -synuclein aggregates, and reducing and/or eliminating the spread of ⁇ -synuclein aggregates.
  • Seeding the sequential transfer of pathologic protein aggregates along connected tissues, and/or prion-like spread of ⁇ -synuclein aggregates can contribute to the progression and severity of neurodegenerative diseases.
  • Braak staging has shown that pathology gradually spreads over time through connected brain regions, and cell culture and animal models show that small amounts of a-syn aggregates can act as seeds and induce aggregation of the native protein (see, e.g. Braak H, et al. (2003) Neurobiol Aging 24(2): 197-211; Braak et al. (2009) Adv Anat Embryol Cell Biol 201 : 1-119; Masuda-Suzukake M, et al.
  • a peptide expressed by a viral vector provided herein inhibits aggregation of a-synuclein.
  • a peptide that inhibits aggregation of ⁇ -synuclein can inhibit ⁇ -synuclein aggregation by about 10%, by about 20%, by about 30%, by about 40%, by about 50%, by about 60%, by about 70%, by about 80%, by about 90%, by about 95%, by about 96%, by about 97%, by about 98%, by about 99%, or more as compared to the ⁇ -synuclein aggregation that would be observed in the absence of the peptide.
  • a peptide that inhibits ⁇ - synuclein aggregation "caps" growing aggregates of a-synuclein, preventing the spread of ⁇ -synuclein aggregates.
  • Cell-based assays can be used to test the efficiency with which peptides can prevent seeding and/or cap growing aggregates of ⁇ -synuclein. For example, endogenous protein aggregation or puncta formation can be measured after transfection of nanomolar amounts of ⁇ -synuclein seeds in cell, e.g., HEK293 cells, and administration of a peptide that inhibits ⁇ -synuclein aggregation.
  • the cell can express fluorescently-labeled (e.g., YFP-labeled) ⁇ -synuclein and aggregation can be monitored by fluorescent imaging (see, e.g., Sanders DW, et al. (2014) Neuron 82(6): 1271-1288 and U.S. Application No.2019/0241613).
  • fluorescent imaging see, e.g., Sanders DW, et al. (2014) Neuron 82(6): 1271-1288 and U.S. Application No.2019/0241613
  • In vitro aggregation assays can also be used to test the efficacy of a peptide that inhibit ⁇ -synuclein aggregation.
  • recombinantly purified ⁇ -synuclein can be aggregated in the presence of a peptide, and the aggregation can be monitored by measuring fluorescence of Thioflavin T, an amyloid binding dye.
  • insoluble protein aggregates extracted from tissue samples e.g., tissue samples from PD patients
  • the peptide that inhibits ⁇ -synuclein aggregation includes an amino acid sequence of AVVWGVTAV (SEQ ID NO: 1).
  • the peptide that inhibits ⁇ -synuclein aggregation is AVVWGVTAV (SEQ ID NO: 1). In some embodiments, the peptide that inhibits ⁇ -synuclein aggregation includes an amino acid sequence of AVVTGVTAV (SEQ ID NO: 2). In some embodiments, the peptide that inhibits ⁇ -synuclein aggregation is AVVTGVTAV (SEQ ID NO: 2). Peptides that are or include an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 have been shown to prevent formation of seeding competent aggregates as well as cap fibril seeds and prevent their elongation (see, e.g., U.S. Application No.
  • the peptide that inhibits ⁇ -synuclein aggregation binds to the NACore (residues 68-78) of ⁇ -synuclein.
  • the NACore is within the 35-residue NAC (non-amyloid 3 component) domain found in amyloid deposits (Rodriguez J A, et al. (2015) Nature 525(7570):486-490).
  • the NACore aggregates readily, and the aggregates display properties such as diffraction pattern and cytotoxicity similar to full- length ⁇ -syn (see, e.g., U.S. Application No.2019/0241613).
  • the peptide encoded by a viral vector described herein inhibits ⁇ -synuclein aggregation by binding to residues 68-78 of ⁇ -synuclein. Residues 47-56 of ⁇ -synuclein are referred to as “PreNAC” and may also lead to the formation of aggregates. [0039] In some embodiments, a peptide that inhibits ⁇ -synuclein aggregation is from about 9 to about 45 amino acids in length.
  • a peptide that inhibits ⁇ - synuclein aggregation can be from about 9 to about 15, about 9 to about 20, about 9 to about 25, about 9 to about 30, about 9 to about 35, about 9 to about 40, about 40 to about 45, about 35 to about 45, about 30 to about 45, about 25 to about 45, about 20 to about 45, or about 15 to about 45 amino acids in length.
  • the peptide is from about 25 to about 35, about 30 to about 40, or about 35 to about 45 amino acids in length.
  • a peptide that inhibits ⁇ -synuclein aggregation can be 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids in length.
  • the peptide that inhibits ⁇ -synuclein aggregation is 34 amino acids in length. In some embodiments, the peptide that inhibits ⁇ -synuclein aggregation is 36 amino acids in length. [0040] In some embodiments, a peptide that inhibits ⁇ -synuclein aggregation includes a heterologous peptide tag. In some embodiments, can help prevent self-aggregation of the peptide, increase solubility of the peptide, facilitate monitoring of the peptide, or a combination thereof.
  • heterologous peptide tags include a TAT tag, a human influenza hemagglutinin (HA) tag, a polyLys tag, a GST tag, a GFP tag, a polyHis tag, a V5 tag, a Myc tag, and a FLAG tag. See the exemplary sequences of exemplary heterologous peptide tags in Table 1.
  • the heterologous peptide tag is an HA tag. Table 1.
  • the heterologous peptide tag is at the N-terminus of the peptide that inhibits ⁇ -synuclein aggregation.
  • the heterologous peptide tag is at the C-terminus of the peptide that inhibits ⁇ -synuclein aggregation.
  • a peptide that inhibits ⁇ -synuclein aggregation includes the amino acid sequence: AVVWGVTAV (SEQ ID NO: 1) or GAVVWGVTAVKK (SEQ ID NO: 3).
  • a peptide that inhibits ⁇ - synuclein aggregation is AVVWGVTAV (SEQ ID NO: 1) or GAVVWGVTAVKK (SEQ ID NO: 3).
  • a peptide that inhibits ⁇ -synuclein aggregation includes the amino acid sequence: AVVTGVTAV (SEQ ID NO: 2) or RAVVTGVTAVAE (SEQ ID NO: 4).
  • a peptide that inhibits ⁇ - synuclein aggregation is AVVTGVTAV (SEQ ID NO: 2) or RAVVTGVTAVAE (SEQ ID NO: 4).
  • the peptide that inhibits ⁇ -synuclein aggregation includes one or more heterologous peptide tags (e.g., any of the heterologous peptide tags in Table 1) at either N-terminal to or C-terminal to the peptide that inhibits ⁇ -synuclein aggregation.
  • the peptide that inhibits ⁇ -synuclein aggregation includes a polyLys tag.
  • the peptide that inhibits ⁇ - synuclein aggregation includes the amino acid sequence: GAVVWGVTAVKKKKK (SEQ ID NO: 5).
  • the peptide that inhibits ⁇ -synuclein aggregation is GAVVWGVTAVKKKKK (SEQ ID NO: 5). In some embodiments, the peptide that inhibits ⁇ -synuclein aggregation has a TAT tag.
  • the peptide that inhibits ⁇ -synuclein aggregation includes the amino acid sequence: GAVVWGVTAVKKGRKKRRQRRRPQ (SEQ ID NO: 6). In some embodiments, the peptide that inhibits ⁇ -synuclein aggregation is GAVVWGVTAVKKGRKKRRQRRRPQ (SEQ ID NO: 6).
  • the peptide that inhibits ⁇ -synuclein aggregation includes the amino acid sequence: YGRKKRRQRRRAVVTGVTAVAE (SEQ ID NO: 7). In some embodiments, the peptide that inhibits ⁇ -synuclein aggregation is YGRKKRRQRRRAVVTGVTAVAE (SEQ ID NO: 7). [0043] In some embodiments, a peptide that inhibits ⁇ -synuclein aggregation includes two or more monomers separated by peptide linkers. For example, a peptide that inhibits ⁇ -synuclein aggregation can include two, three, four, or more monomers separated by peptide linkers.
  • a peptide that inhibits ⁇ -synuclein aggregation includes four monomers separated by peptide linkers. In some embodiments, a peptide that inhibits ⁇ -synuclein aggregation includes two or more monomers separated by peptide linkers wherein the peptide monomers include the sequence AVVWGVTAV (SEQ ID NO: 1). In some embodiments, a peptide that inhibits ⁇ -synuclein aggregation includes two or more monomers separated by peptide linkers wherein the peptide monomers include the sequence GAVVWGVTAVKK (SEQ ID NO: 3).
  • a peptide that inhibits ⁇ -synuclein aggregation includes two or more monomers separated by peptide linkers wherein the peptide monomers include the sequence GAVVWGVTAVKKKKK (SEQ ID NO: 5). In some embodiments, a peptide that inhibits ⁇ -synuclein aggregation includes two or more monomers separated by peptide linkers wherein the peptide monomers include the sequence GAVVWGVTAVKKGRKKRRQRRRPQ (SEQ ID NO: 6).
  • a peptide that inhibits ⁇ -synuclein aggregation includes four identical monomers selected from the group consisting of: AVVWGVTAV (SEQ ID NO: 1), GAVVWGVTAVKK (SEQ ID NO: 3), GAVVWGVTAVKKKKK (SEQ ID NO: 5), and GAVVWGVTAVKKGRKKRRQRRRPQ (SEQ ID NO: 6).
  • a peptide that inhibits ⁇ -synuclein aggregation includes four monomers separated by peptide linkers wherein the peptide monomers are individually selected from monomers that include the sequence AVVWGVTAV (SEQ ID NO: 1), GAVVWGVTAVKK (SEQ ID NO: 3), GAVVWGVTAVKKKKK (SEQ ID NO: 5), or GAVVWGVTAVKKGRKKRRQRRRPQ (SEQ ID NO: 6).
  • a peptide that inhibits ⁇ -synuclein aggregation includes two or more monomers separated by peptide linkers, wherein the linkers are encoded by nucleic acids having sequences selected from the following group: gggggaggtggctctggtggagggtca (SEQ ID NO: 22), ggaggcggtgggagcggtgggggaggtagt (SEQ ID NO: 23), ggtggggggggggaagtggagggggtggctct (SEQ ID NO: 24), ggtggtggaggatctgggggcggtggttct (SEQ ID NO: 25), and combinations thereof.
  • a peptide that inhibits ⁇ -synuclein aggregation includes two or more monomers separated by peptide linkers, wherein the peptide linkers are all identical. In some embodiments, a peptide that inhibits ⁇ -synuclein aggregation includes two or more monomers separated by peptide linkers, wherein two, three, or four of the peptide linkers are identical. In some embodiments, a peptide that inhibits ⁇ -synuclein aggregation includes two or more monomers separated by peptide linkers, wherein the peptide linkers are not all identical.
  • viral vectors that encode one or more peptides that inhibit ⁇ -synuclein aggregation (e.g., any of the peptides described herein).
  • the term "viral vector” as referred to herein includes any viral genetic element that is capable of replication when associated with the proper control elements and that can transfer gene sequences between cells.
  • useful vectors are contemplated to be those vectors in which the nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter.
  • a viral vector can include, for example, sufficient cis-acting elements for expression; other elements for expression can be supplied by the host mammalian cell or in an in vitro expression system.
  • Viral vectors include all those known in the art, such as, without limitation, adeno-associated viral (AAV) vectors, retroviral vectors, Herpes simplex vectors, alphavirus vectors, flavivirus vectors, rhabdovirus-based vectors, and chimeric viral vectors.
  • the viral vector is an AAV vector (see, e.g., Asokan et al., Mol. Ther.20: 699-7080, 2012).
  • "Recombinant AAV vectors" or “rAAVs” are typically composed of, at a minimum, a transgene or a portion thereof and a regulatory sequence, and optionally 5' and 3' AAV inverted terminal repeats (ITRs).
  • Such a recombinant AAV vector can be packaged into a capsid and delivered to a selected target cell (e.g., a neuronal or neuroglial cell).
  • the AAV sequences of the vector typically comprise the cis-acting 5' and 3' inverted terminal repeat sequences (See, e.g., B. J. Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp.155168 (1990)).
  • the ITR sequences are about 145 to about 210 nucleotides in length. In some embodiments, substantially the entire sequences encoding the ITRs are used in the molecule, although some degree of minor modification of these sequences is permissible.
  • the ability to modify these ITR sequences is within the skill of the art. (See, e.g., texts such as Sambrook et al. "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520532 (1996)).
  • An example of such a molecule employed in the present invention is a "cis-acting" plasmid containing the transgene, in which the selected transgene sequence and associated regulatory elements are flanked by the 5' and 3' AAV ITR sequences.
  • the AAV ITR sequences may be obtained from any known AAV, including presently identified mammalian AAV types.
  • an AAV vector include an AAV serotype 1 vector (AAV1), an AAV serotype 2 vector (AAV2), an AAV serotype 1 and 2 hybrid vector (AAV1/2), an AAV serotype 3 vector (AAV3), an AAV serotype 4 vector (AAV4), an AAV serotype 5 vector (AAV5), an AAV serotype 6 vector (AAV6), an AAV serotype 7 vector (AAV7), an AAV serotype 8 vector (AAV8), or an AAV serotype 9 vector (AAV9).
  • the AAV vector is an AAV1 vector, an AAV2 vector, an AAV1/2 vector, an AAV4 vector, an AAV5 vector, an AAV8 vector, or an AAV9 vector.
  • the AAV vector is an AAV1/2 vector.
  • the viral vector e.g., AAV vector
  • the viral vector has a total number of nucleotides in the range of about 1 kb to about 2 kb, 1 kb to about 3 kb, about 1 kb to about 4 kb, about 1 kb to about 5 kb, about 1 kb to about 6 kb, about 1 kb to about 7 kb, about 1 kb to about 8 kb, about 1 kb to about 9 kb, about 1 kb to about 10 kb, about 2 kb to about 3 kb, about 2 kb to about 4 kb, about 2 kb to about 5 kb, about 2 kb to about 6 kb, about 2 kb to about 7 kb, about 2 kb to about 8 kb, about 2 kb to about 9 kb, about 2 kb to about 10 kb, about 3 kb to about 4 kb, about 3 kb to about 5 kb, about 1 kb to about 6
  • a viral vector e.g., AAV vector
  • the viral vector also includes one or more regulatory sequences that are operably linked to the transgene (e.g., a nucleic acid encoding a peptide that inhibits ⁇ -synuclein aggregation, e.g., any of the peptides described herein) in a manner which permits its transcription, translation, and/or expression in a cell transfected with the viral vector or infected with a virus containing the viral vector.
  • the transgene e.g., a nucleic acid encoding a peptide that inhibits ⁇ -synuclein aggregation, e.g., any of the peptides described herein
  • regulatory sequence refers to a nucleic acid sequence that regulates expression of a gene product operably linked to the regulatory sequence.
  • the precise nature of the regulatory sequences needed for gene expression in host cells may vary between species, tissues or cell types, but shall in general include, as necessary, 5' non-transcribed and 5' non-translated sequences involved with the initiation of transcription and translation respectively, such as a TATA box, capping sequence, CAAT sequence, enhancer elements, and the like.
  • 5' non-transcribed regulatory sequences can include a promoter region that includes a promoter sequence for transcriptional control of the operably joined gene.
  • the viral vectors described herein can also include regulatory sequences such as enhancer sequences, hybrid enhancer/promoter sequences, and upstream activator sequences as desired. See, e.g., Powell et al. Discov Med.2015; 19(102): 49–57 and Hagedorn et al. Hum Gene Ther.2017; 28(12):1169- 1179.
  • the viral vectors described herein can optionally include 5' leader or signal sequences. The choice and design of an appropriate vector is within the ability and discretion of one of ordinary skill in the art.
  • nucleic acid sequence e.g., coding sequence
  • regulatory sequence e.g., a promoter
  • a nucleic acid sequence and a regulatory sequence are said to be "operably” linked when they are covalently linked in such a way as to place the expression or transcription of the nucleic acid sequence under the influence or control of the regulatory sequences.
  • nucleic acid sequence be translated into a functional protein or peptide
  • two DNA sequences are said to be operably linked if induction of a promoter in the 5' regulatory sequences results in the transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the coding sequences, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein.
  • a promoter region would be operably linked to a nucleic acid sequence if the promoter region were capable of effecting transcription of that DNA sequence such that the resulting transcript might be translated into the desired protein or polypeptide.
  • promoter refers to a nucleic acid sequence that is operably linked to a nucleic acid sequence encoding a polypeptide (e.g., a peptide described herein, e.g., a peptide that inhibits ⁇ -synuclein aggregation) that can increase the transcription of the nucleic acid sequence encoding the polypeptide.
  • a polypeptide e.g., a peptide described herein, e.g., a peptide that inhibits ⁇ -synuclein aggregation
  • a promoter is constitutive.
  • constitutive promoters include the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) (see, e.g., Boshart et al.
  • a promoter is inducible. Inducible promoters allow regulation of gene expression and can be regulated by a variety of conditions including, but not limited to, exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only.
  • inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art.
  • inducible promoters regulated by exogenously supplied compounds include the zinc- inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088); the ecdysone insect promoter (No et al. Proc. Natl. Acad. Sci.
  • tissue-specific regulatory sequence imparts tissue-specific gene expression capabilities.
  • tissue-specific regulatory sequences e.g., promoters, enhancers, etc.
  • the tissue-specific regulatory sequence is a tissue-specific promoter.
  • tissue-specific promoter refers to a nucleotide sequence which, when operably linked to a polynucleotide that encodes a gene product, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
  • a tissue-specific promoter binds a tissue-specific transcription factor that induces transcription in a tissue-specific manner.
  • tissue-specific promoters include: a liver-specific thyroxin binding globulin (TBG) promoter, an insulin promoter, a glucagon promoter, a somatostatin promoter, a pancreatic polypeptide (PPY) promoter, a synapsin-1 (Syn) promoter, a creatine kinase (MCK) promoter, a mammalian desmin (DES) promoter, a ⁇ -myosin heavy chain ( ⁇ -MHC) promoter, or a cardiac Troponin T (cTnT) promoter.
  • TSG liver-specific thyroxin binding globulin
  • PY pancreatic polypeptide
  • PPY pancreatic polypeptide
  • Syn synapsin-1
  • MCK creatine kinase
  • DES mammalian desmin
  • ⁇ -MHC ⁇ -myosin heavy chain
  • cTnT cardiac Troponin T
  • GUSB GUSB minimal promoter
  • MECP2 methyl CpG-Binding Protein-2
  • DES human desmin
  • TBG thyroxine binding globulin
  • MCK muscle creatine kinase
  • hAAT human alpha(1) antitrypsin
  • human EFla human cytomegalovirus
  • CMV human cytomegalovirus
  • UBC human ubiquitin C
  • human T-cell leukemia virus HTLV human T-cell leukemia virus HTLV
  • AAV ITR promoter interleukin-2 promoter, collagenase promoter, platelet-derived growth factor promoter, adenovirus 5 E2 promoter, stromelysin, murine MX gene promoter, glucose regulated proteins (GRP78 and GRP94) promoter, ⁇ -2-macroglobulin promoter, vimentin promoter, MHC class I gene ⁇ -2 ⁇ b promoter, HSP70 promoter, proliferin, tumor necrosis factor promoter, thyroid stimulating hormone a gene promoter, immunoglobulin light chain promoter, T-cell receptor promoter, HLA DQa and DQP promoters, interleukin-2 receptor promoter, MHC class II promoter, MHC class II HLA-DRa promoter, muscle creatine kinase promoter, prealbumin (transthyretin) promoter, elastase I promoter, albumin gene promoter,
  • promoters include the JC polymovirus promoter, the platelet-derived growth factor B-chain (PDGF-beta) promoter, the chicken ⁇ -actin (CBA) promoter, or the cytomegalovirus (CMV) promoter (see, e.g., Doll et al. Gene Ther.1996; 3(5):437-47). Additional examples of promoters are known in the art.
  • PDGF-beta platelet-derived growth factor B-chain
  • CBA chicken ⁇ -actin
  • CMV cytomegalovirus
  • Enhancer refers to a nucleotide sequence that can increase the level of transcription of a nucleic acid encoding a protein of interest (e.g., a peptide that inhibits ⁇ -synuclein aggregation). Enhancer sequences are typically 50-1500 basepairs in length, and generally increase the level of transcription by providing additional binding sites for transcription-associated proteins (e.g., transcription factors). In some embodiments, an enhancer sequence is found within an intronic sequence. Enhancer sequences can typically act at much larger distance from the transcription start site (e.g., as compared to a promoter) than can promoters.
  • enhancers include a RSV enhancer, a CMV enhancer, and a SV40 enhancer.
  • the regulatory sequence is a SV40 early enhancer/promoter, a hybrid CMV enhancer/PDGF-beta promoter, or a hybrid CMV enhancer/CBA promoter.
  • the regulatory sequence is a hybrid CMV enhancer/CBA promoter having or including a nucleic acid sequence of SEQ ID NO: 9.
  • the viral vector includes a post-transcriptional regulatory sequence.
  • Non-limiting examples of a post-transcriptional regulatory sequence include a Hepatitis B Virus post-transcriptional regulatory sequence and a Woodchuck post-transcriptional regulatory sequence.
  • the Woodchuck post- transcriptional regulatory sequence has or includes a nucleic acid sequence of SEQ ID NO: 10.
  • any of the viral vectors provided herein can include a polyadenylation (poly(A)) sequence.
  • Polyadenylation refers herein to the covalent linkage of a polyadenyl moiety, or its modified variant, to a messenger RNA molecule.
  • mRNA messenger RNA
  • the 3' poly(A) tail is a long sequence of adenine nucleotides (often several hundred) added to the pre-mRNA through the action of an enzyme, polyadenylate polymerase. In higher eukaryotes, the poly(A) tail is added onto transcripts that contain a specific sequence, the polyadenylation signal. The poly(A) tail and the protein bound to it aid in protecting mRNA from degradation by exonucleases. Polyadenylation is also important for transcription termination, export of the mRNA from the nucleus, and translation. Polyadenylation can occur in the nucleus immediately after transcription of DNA into RNA, but it can also occur later in the cytoplasm.
  • RNA chain is cleaved through the action of an endonuclease complex associated with RNA polymerase.
  • the cleavage site is usually characterized by the presence of the base sequence AAUAAA near the cleavage site.
  • adenosine residues are added to the free 3' end at the cleavage site.
  • a “polyadenylation signal sequence” or "poly(A) signal sequence” is a sequence that triggers the endonuclease cleavage of an mRNA and the addition of a series of adenosines to the 3' end of the cleaved mRNA.
  • a polyadenylation sequence generally is inserted following the transgene sequences and before the 3' AAV ITR sequence.
  • the poly(A) signal sequence is positioned 3' to the nucleic acid sequence encoding the C-terminus of the peptide that inhibit ⁇ -synuclein aggregation.
  • poly(A) signal sequences that can be used in the vectors described herein including those derived from bovine growth hormone (bgh) (Woychik et al., Proc. Natl. Acad. Sci. U.S.A.81(13):3944-3948, 1984; U.S.
  • Patent No.5,122,458 human growth hormone (hGH), mouse-p-globin, mouse-a-globin (Orkin et al., EMBO J. 4(2):453-456, 1985; Thein et al., Blood 7 ⁇ (2):3 ⁇ 3-3 ⁇ 9, 1988), human collagen, polyoma virus (Batt et al., Mol. Cell Biol.15(9):4783-4790, 1995), the Herpes simplex virus thymidine kinase gene (HSV TK), IgG heavy-chain gene polyadenylation signal (US 2006/0040354), human growth hormone (hGH) (Szymanski et al., Mol.
  • the group consisting of SV40 poly(A) signal sequence such as the SV40 late and early poly(A) signal sequence (Schek et al., Mol. Cell Biol.12(12):5386- 5393, 1992).
  • the poly(A) signal sequence is the sequence AATAAA.
  • the AATAAA sequence can be substituted with other hexanucleotide sequences with homology to AATAAA which are capable of signaling polyadenylation, including ATTAAA, AGTAAA, CATAAA, TATAAA, GATAAA, ACTAAA, AATATA, AAGAAA, AATAAT, AAAAAA, AATGAA, AATCAA, AACAAA, AATCAA, A AT A AC, AATAGA, AATTAA, or AATAAG (see, e.g., WO 06/12414).
  • the bovine growth hormone (BGH) polyadenylation sequence has or includes a nucleic acid sequence of SEQ ID NO: 11.
  • the poly(A) signal sequence can be a synthetic polyadenylation site (see, e.g., the pCl-neo expression vector of Promega which is based on Levitt el al, Genes Dev.3(7): 1019-1025, 1989).
  • the poly(A) signal sequence is the polyadenylation signal of soluble neuropilin-1 (s RP) (AAATAAAATACGAAATG) (see, e.g., WO 05/073384). Additional examples of poly(A) signal sequences are known in the art.
  • the vectors described herein can further include an upstream enhancer element (USE) that is placed upstream of a poly(A) signal sequence.
  • USEs include: human immunodeficiency virus 1 (HIV-1) USE, SV40 late 2xUSE, ground squirrel hepatitis virus (GHV) USE, Adenovirus (L3) USE, human prothrombin (hTHGB) USE, and human C2 complement gene (hC2) USE.
  • An AAV construct useful in the present disclosure can also contain an intron, e.g., located between the promoter/enhancer sequence and the transgene. See, e.g., Powell et al.
  • any of the viral vectors provided herein can include a scaffold attachment region (SAR).
  • SAR scaffold attachment region
  • a “scaffold attachment region” refers to an AT-rich DNA sequence that binds specifically to one or more components of the nuclear scaffold. See Boulikas, J. Cell. Biochem.52:14 (1993).
  • the SAR has or includes a nucleic acid sequence of SEQ ID NO: 12.
  • Another vector element that may be used is an internal ribosome entry site (IRES).
  • IRES sequence is used to produce more than one polypeptide from a single gene transcript.
  • the viral vector has or includes a nucleic acid sequence of SEQ ID NO: 13 or SEQ ID NO:14.
  • compositions including a viral vector described herein (e.g., an AAV vector that encodes one or more peptides that inhibit ⁇ -synuclein aggregation).
  • the viral vector e.g., AAV vector
  • the viral vector is capable of expressing an ⁇ -synuclein peptide inhibitor messenger RNA in a target cell of a human subject to whom the therapeutic composition is administered.
  • the viral vector e.g., an AAV vector capable of expressing an ⁇ -synuclein aggregation peptide inhibitor
  • the pharmaceutical composition can include one or a plurality of AAV vectors, as described herein, in combination with one or more pharmaceutically acceptable carriers, diluents or excipients.
  • pharmaceutically acceptable indicates that the substance or composition must be compatible chemically and/or toxicologically, with the other ingredients comprising a formulation, and/or the mammal being treated therewith.
  • carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
  • Non-limiting examples of pharmaceutically acceptable carriers that can be used in the compositions described herein include water, NaCl, normal saline solutions, lactated Ringer’s, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors and colors, liposomes, dispersion media, microcapsules, cationic lipid carriers, isotonic and absorption delaying agents, and the like.
  • the carrier may also be substances for providing the formulation with stability, sterility and isotonicity (e.g., antimicrobial preservatives, antioxidants, chelating agents and buffers), for preventing the action of microorganisms (e.g. antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid and the like) or for providing the formulation with an edible flavor etc.
  • antimicrobial preservatives, antioxidants, chelating agents and buffers for preventing the action of microorganisms (e.g. antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid and the like) or for providing the formulation with an edible flavor etc.
  • microorganisms e.g. antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid and the like
  • other pharmaceutical carriers are useful in the present disclosure.
  • a composition described herein can also include buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose, or dextrans; mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
  • any of the viral vectors described herein can be formulated using natural and/or synthetic polymers.
  • Non-limiting examples of polymers that may be included in any of the compositions described herein can include, but are not limited to, DYNAMIC POLYCONJUGATE® (Arrowhead Research Corp., Pasadena, Calif), formulations from Minis Bio (Madison, Wis.) and Roche Madison (Madison, Wis.), PhaseRX polymer formulations such as, without limitation, SMARTT POLYMER TECHNOLOGY® (PhaseRX, Seattle, Wash ), DMRI/DOPE, poloxamer, VAXFECTIN® adjuvant from Vical (San Diego, Calif), chitosan, cyclodextrin from Calando Pharmaceuticals (Pasadena, Calif), dendrimers and poly (lactic-co-glycolic acid) (PLGA) polymers, RONDELTM (RNAi/Oligonucleotide Nanoparticle Delivery) polymers (Arrowhead Research Corporation, Pasadena, Calif), and pH responsive co- block polymers, such as
  • compositions described herein can be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations can be easily administered in a variety of dosage forms such as injectable solutions, injectable gels, drug-release capsules, and the like.
  • a composition described herein is formulated for parenteral administration.
  • a composition described herein is formulated for intracranial administration.
  • a composition described herein is formulated for intravenous administration. See, e.g., Lykken et al.
  • the pharmaceutical formulations suitable for injectable use include, without limitation, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. In many cases, the formulation is sterile and fluid to the extent that easy syringability exists. In some embodiments, the formulation is stable under the conditions of manufacture and storage and is preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • polyol e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • suitable mixtures thereof e.g., vegetable oils
  • vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • Proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and
  • isotonic agents for example, sugars or sodium chloride
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • the solution can be suitably buffered, if necessary, and the liquid diluent can be first rendered isotonic with sufficient saline or glucose.
  • a sterile aqueous medium that can be employed will be known to those of skill in the art.
  • one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage can be accommodated depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host. [0081] Sterile injectable solutions can be prepared by incorporating the active viral vector (e.g., AAV vector) in the required amount in the appropriate solvent with various of the other ingredients enumerated herein, as required, followed by filtered sterilization.
  • active viral vector e.g., AAV vector
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze- drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the compositions disclosed herein can also be formulated in a neutral or salt form.
  • Pharmaceutically-acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like.
  • Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium,
  • Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, can be used for the introduction of the compositions of the present invention into suitable host cells.
  • a viral vector described herein can be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.
  • liposomes were developed with improved serum stability and circulation half-times (U.S.
  • Liposomes have been used successfully with a number of cell types that are normally resistant to transfection by other procedures. In addition, liposomes are free of the DNA length constraints that are typical of viral-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cultured cell lines and animals.
  • kits including any of the compositions described herein.
  • a kit can include a solid composition (e.g., a lyophilized composition including a vector described herein) and a liquid for solubilizing the lyophilized composition.
  • a kit can include a pre-loaded syringe including any of the compositions described herein.
  • the kit includes a vial comprising any of the compositions described herein (e.g., formulated as an aqueous composition, e.g., an aqueous pharmaceutical composition).
  • the kits can include instructions for performing any of the methods described herein.
  • Methods Also provided herein is are methods of introducing into cell (e.g., a neuronal or neuroglial cell) of a mammal (e.g., a human) a therapeutically effective amount of any of the compositions or viral vectors described herein.
  • a cell e.g., a neuronal or neuroglial cell
  • mammal e.g., a human
  • any of the compositions or viral vectors described herein e.g., a composition or viral vector that encodes a peptide that inhibits ⁇ -synuclein aggregation
  • expression of the peptide that inhibits ⁇ -synuclein aggregation is increased in the cell, e.g., as compared to expression of the peptide that inhibits ⁇ -synuclein aggregation in a reference cell (e.g., a reference cell into which the composition or viral vector has not been introduced).
  • the reference cell does not express the peptide that inhibits ⁇ -synuclein aggregation, or does not express a detectable amount of the peptide that inhibits ⁇ - synuclein aggregation.
  • methods of treating a neurodegenerative disease in a subject that include administering a therapeutically effective amount of any of the compositions or viral vectors described herein (e.g., AAV vectors, e.g., an AAV vector that encodes a peptide that inhibits ⁇ -synuclein aggregation, e.g., any of the ⁇ -synuclein aggregation described herein) into the central nervous system of a subject.
  • AAV vectors e.g., an AAV vector that encodes a peptide that inhibits ⁇ -synuclein aggregation, e.g., any of the ⁇ -synuclein aggregation described herein
  • compositions or viral vectors e.g., AAV vectors, e.g., an AAV vector that encodes a peptide that inhibits ⁇ -synuclein aggregation, e.g., any of the ⁇ -synuclein aggregation described herein.
  • Treatment refers to any type of intervention or process performed on, or the administration of an active agent to, the subject with the objective of reversing, alleviating, ameliorating, inhibiting, or slowing down, the onset, progression, development, severity, or recurrence of a symptom, complication, condition, or biochemical indicia associated with a disease (e.g., Alzheimer’s disease or a synucleinopathy).
  • treatment includes resolution of a particular disorder, including a reduction in one or more symptoms of the disorder and/or a reduction in in the severity of one or more symptoms associated with the disorder (e.g., Alzheimer’s disease or a synucleinopathy).
  • a “subject” includes any human or non-human animal.
  • the term “non-human animal” includes, but is not limited to, vertebrates such as non-human primates, sheep, dogs, and rodents such as mice, rats, and guinea pigs.
  • the subject is a human.
  • an "effective amount” or “therapeutically effective amount” of a therapeutic agent is any amount of the agent that, when used alone or in combination with one or more additional therapies, slows down the onset of a disorder (e.g., Alzheimer’s disease or a synucleinopathy) or promotes regression of the disorder evidenced by a decrease in severity of disorder symptoms, an increase in frequency and duration of disorder symptom-free periods, or a ameliorating an impairment or disability due to the disorder affliction.
  • a disorder e.g., Alzheimer’s disease or a synucleinopathy
  • the ability of one or more additional therapies to promote disorder regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.
  • an effect amount of any of the viral vectors or compositions comprising viral vectors described herein is sufficient to cover a region of interest (e.g. substantia nigra or putamen) in a subject when the viral vector or composition is administered to the subject.
  • an effective amount of any of the viral vectors or compositions comprising viral vectors described herein is measured in genomic particles per brain (gp/brain, e.g., gp/human brain).
  • an effective amount of any of the viral vectors or compositions comprising viral vectors described herein is about 1x10 9 , about 2x10 9 , about 3x10 9 , about 4x10 9 , about 5x10 9 , about 6x10 9 , about 7x10 9 , about 8x10 9 , about 9x10 9 , about 1.0x10 10 , about 1.1x10 10 , about 1.2x10 10 , about 1.3x10 10 , about 1.4x10 10 , about 1.5x10 10 , about 1.6x10 10 , about 1.7x10 10 , about 1.8x10 10 , about 1.9x10 10 , about 2.0x10 10 , or about 3.0x10 10 gp/brain.
  • administering refers to the physical introduction of a therapeutic agent to a subject, using any of the various methods and delivery systems described herein or otherwise known to those skilled in the art.
  • Routes of administration can include, without limitation, intracranial, oral, intravenous, intranasal, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, for example by injection or infusion (e.g., intravenous infusion). Administration can also be performed, for example, once, a plurality of times, and/or over one or more extended periods.
  • a therapeutically effective amount of any of the compositions or viral vectors described herein is administered to a subject only once.
  • the neurodegenerative disease is Alzheimer’s disease or a synucleinopathy.
  • Non-limiting examples of a synucleinopathy include a Lewy body disorder, Parkinson’s disease (PD), PD with dementia (PDD), pure autonomic failure (PAF), and multiple system atrophy (MSA).
  • PD Parkinson’s disease
  • PPD PD with dementia
  • PAF pure autonomic failure
  • MSA multiple system atrophy
  • Any of the variety of methods described herein or otherwise known in the art for introducing any of the compositions described herein into a mammalian cell can be used (e.g., through the use of a viral vector, e.g., any of the viral vectors described herein).
  • the administration of the compositions or viral vectors described herein can be carried out in any convenient manner, including, without limitation, by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation.
  • compositions described herein can be administered to a subject intracranially, transarterially, subcutaneously, intradermally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, or intraperitoneally.
  • the compositions or viral vectors described herein are administered to a patient by intracranial injection.
  • the level of expression of a peptide that inhibits ⁇ -synuclein aggregation can be detected directly (e.g., detecting the peptide or detecting the mRNA that encodes the peptide).
  • Non-limiting examples of techniques that can be used to detect expression and/or activity of a peptide that inhibits ⁇ -synuclein aggregation directly include: real-time PCR, Western blotting, immunoprecipitation, immunohistochemistry, or immunofluorescence.
  • expression of a peptide that inhibits ⁇ -synuclein aggregation can be detected indirectly e.g., via tests that monitor a neurodegenerative disease such as PD.
  • Non-limiting examples of tests that monitor PD are those tests that monitor bradykinesia, tremor, rigidity, and/or postural instability.
  • a subject that has been administered an effective amount of any of the compositions or viral vectors e.g., AAV vectors, e.g., an AAV vector that encodes a peptide that inhibits ⁇ -synuclein aggregation
  • exhibits reduced PD or neurodegenerative symptoms e.g., in one or more of bradykinesia, tremor, rigidity, and/or postural instability
  • a subject that has been administered an effective amount of any of the compositions or viral vectors described herein exhibits one or more symptoms that are reduced by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more as compared to a subject that has not been administered an effective amount of any of the compositions or viral vectors described herein.
  • a subject that has been administered an effective amount of any of the compositions or viral vectors described herein exhibits no PD or neurodegenerative symptoms as compared to a subject that has not been administered an effective amount of any of the compositions or viral vectors described herein.
  • a subject that has been administered an effective amount of any of the compositions or viral vectors e.g., AAV vectors, e.g., an AAV vector that encodes a peptide that inhibits ⁇ -synuclein aggregation
  • AAV vectors e.g., an AAV vector that encodes a peptide that inhibits ⁇ -synuclein aggregation
  • exhibits reduced PD or neurodegenerative symptom(s) e.g., in one or more of bradykinesia, tremor, rigidity, and/or postural instability
  • a subject that has been administered an effective amount of any of the compositions or viral vectors described herein exhibits one or more symptom(s) that are reduced by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more as compared to the symptom(s) exhibited by the subject prior to administration of the composition or viral vector.
  • the subject that has been administered an effective amount of any of the compositions or viral vectors described herein exhibits no PD or neurodegenerative symptom(s) as compared to the symptom(s) exhibited by the subject prior to administration of the composition or viral vector.
  • EXAMPLES [0098] The disclosure is further described in the following examples, which do not limit the scope of the disclosure described in the claims.
  • EXAMPLE 1. AAV Vector Preparation and Packaging Transformation of E. coli cells and preparation of plasmid DNA [0099] SUBCLONING EFFICIENCY TM DH5 ⁇ TM Competent Cells were used for the transformation. The PURELINK TM HiPure Plasmid Maxiprep Kit was used for plasmid preparation. [00100] DH5 ⁇ TM cells were thawed on ice.
  • the cells were gently mixed with a pipette tip.50 ⁇ L of cells for each transformation were aliquoted into a separate, chilled 1.5 mL microcentrifuge tube.1 to 5 ⁇ L of plasmid were added to the cells and mixed gently. The tubes were incubated on ice for 30 minutes. The cells were heat-shocked by placing the tubes in a 37 °C water bath for 5 minutes. The tubes were then placed on ice for 2 minutes.250 ⁇ L of pre-warmed Luria Broth (LB) medium was added, and the tubes were incubated at 37 °C for 30 minutes without agitation.20 ⁇ L to 200 ⁇ L from each transformation were spread onto pre-warmed LB-ampicillin agar plates.
  • LB Luria Broth
  • the plates were incubated overnight in a 37 °C bacterial incubator.
  • One bacterial colony was selected and used to aseptically inoculate 90 mL of LB supplemented with 100 ⁇ g/mL ampicillin in a conical flask. The flask was placed in a bacterial shaker and incubated overnight at 37 °C with agitation (shaker set at 220 rpm).
  • the tubes were inverted on paper towels for a few minutes to remove residual supernatant.5 mL of Resuspension buffer (R3) with RNase A were added to each tube, and the pellet was resuspended. The cells suspensions from the two tubes were combined. [00103] 10 mL of Lysis Buffer (L7) were added to the tube and the solution mixed by gently inverting the capped tube several times. The tube was incubated at room temperature for 5 minutes.10 mL Precipitation Buffer (N3) were added and the solution mixed gently by inverting the capped tube several times until the mixture appears to be homogenous. [00104] The tubes were centrifuged at 8,000 x g for 30 minutes at 4 °C.
  • R3 Resuspension buffer
  • N3 Precipitation Buffer
  • the solution was mixed well and centrifuged at 17,000 x g for 3 min at room temperature. [00106] The supernatant was removed and discarded. The DNA pellet was washed in 0.7 mL 79% ethanol. The tube was centrifuged at 17,000 x g for 1 min at room temperature. The supernatant was removed and the pellet was air-dried for 10 minutes. The purified DNA was then resuspended in in 200-500 ⁇ L TE buffer. The plasmid was stored at -20 ⁇ C.
  • HEK293 Cell Culture [00107] Complete DMEM was warmed to 37 °C. Frozen HEK293 cells were removed from liquid nitrogen storage and immediately placed the tube into a 37 °C water bath.
  • the cells were thawed for 30-60 seconds in the 37 °C water bath.
  • the tube was transferred into a Class II Biological Safety Cabinet and the cell suspension was added to 10 mL of complete DMEM in a sterile 50 mL conical centrifuge tube.
  • the cryovial that had contained the cells was rinsed with 1 mL of complete DMEM and added to the cell suspension.
  • the cell suspension was centrifuged at 300 x g, at 20 °C for 5 min. The supernatant as discarded, and the pelleted cells were resuspended in 5 mL of complete DMEM with gentle pipetting.
  • the cell suspension was transferred into a Tl75 flask containing 35 mL of complete DMEM.
  • the cells were grown and maintained in an incubator at 37 °C in 5% CO 2 .
  • the HEK293 cells were split every 3-4 days when they grew to approximately 90% confluency. Cells may be passaged 20 times before a new batch of cells is required. Complete DMEM, 1x PBS solution, and TrypLE Express were warmed to 37 °C. The culture medium was removed from the flask and discarded.20 mL of 1x PBS was added to the flask and the flask was gently tilt back and forth to wash the cells. The PBS solution was removed and discarded. [00110] 5 mL of TrypLE Express were added to the cells. The cells were incubated at 37 °C for 5-10 minutes.
  • the flask was gently swirled to detach the cell.5mL of complete DMPEM was added to the flask.
  • the cell suspension was transferred from the flask to a sterile 50 mL conical centrifuge tube. The tube was centrifuged at 300 x g at 20 °C for 5 minutes. [00111] The supernatant was discarded, and the cell pellet was loosened by gently tapping the side of the tube.
  • the cells were resuspended in 8 mL (for a 3-day cycle) or 10 mL (for a 4-day cycle) of complete DMEM and mixed gently.1 mL of the cell suspension was transferred into a new T175 flask containing 35 mL of complete DMEM, i.e., a 1:8 subcultivation ratio for 3-day culture period or 1:10 subcultivation ratio for 4-day culture period. The cells were returned to an incubator at 37 °C in 5% CO 2 .
  • Cell plating [00112] On Day 1, HEK293 cells (human embryonic kidney cells 293) were seeded into 5 x 15 cm tissue culture dishes that were sufficient for a single 300 ⁇ L batch of rAAV.
  • the number of cells in one 90% confluent T175 flask was sufficient to seed 3.5- 4.0 x 15 cm plates (plating density of approximately 15 x 10 6 - 20 x 10 6 cells per plate) such that a confluency of 70% was achieved at the time of transfection.
  • the cells were dissociated and harvested from the T175 flasks as described above.
  • the DNA mix was prepared by pipetting the reagents in the following order into a 50 mL tube: 12 mL sterile room temperature ultrapure water, 1.65 mL 2.5M CaCl 2 , 62.5 ⁇ g pAAV expression plasmid, 125 ⁇ g pF ⁇ 6, and 62.5 ⁇ g capsid plasmid. [00117] The DNA mix was filter sterilized into a 75 cm 2 tissue culture flask using a 0.2 ⁇ m ACRODISC® syringe filter.
  • the cell supernatant was transferred into a fresh tube.
  • the iodixanol gradient was prepared in a disposable 35 mL ultracentrifuge tube. The solutions were loaded in the following order suing a spinal needle attached to a 10 mL disposable syringe: 7.5-8.0 mL of cell supernatant; 8.5 mL 15% iodixanol; 6.0 mL 25% iodixanol; 5.0 mL 40% iodixanol; and 5.0 mL 54% iodixanol. The needle was held against the side of the tube and each solution was slowly expelled so as to not disturb the layer above.
  • Lysis buffer 150 mM NaCl, 50 mM Tris, pH 8.5 was added to the cell supernatant at the top of tube to within 1-2 mm below the bottom of the tube stopper, being careful not to disturb any of the layers.
  • the tube was centrifuged in a SORVALL TM ultracentrifuge T865 rotor at 58,000 rpm for 1 hour and 45 minutes (including the 15 minute acceleration and 90 minute spin).
  • An 18 gauge needle attached to a 5 mL syringe was inserted at the 40-54% iodixanol interface.
  • a 20 gauge needle was inserted at the top of the tube to facilitate entry of air into the tube.
  • rAAV vector preparations can contain a mixture of empty capsids and genome-containing vector particles.
  • genomic titers of viral vector stocks can be determined by SYBR Green-based qPCR using the standard curve method.
  • Vector DNA extracted from the intact rAAV particles was measured against a standard curve generated using a reference plasmid of known molarity that has been serially diluted over a range of 10 3 to 10 7 plasmid copies per ⁇ L.
  • An NTC of PCR grade water was also included and each reaction was performed in triplicate.
  • rAAV vector stock of known titer can also be included in each run to allow standardization of titers between runs. However, if direct comparisons are to be made between vectors, titers should be determined in the same qPCR experiment [00132]
  • Sufficient DNase I master mix was prepared for triplicate DNA extractions for each unknown rAAV sample and rAAV reference standard (if included) and one NTC reaction. The reactions were set up in 0.2 mL PCR tubes by combining 48 ⁇ L of DNase I master mix and 2 ⁇ L of unknown rAAV or rAAV reference standard.2 ⁇ L of ultrapure water or PCR grade water were added to the NTC reaction instead of rAAV.
  • the contents of the tubes was mixed, and the tubes were briefly spun. [00133] The tubes were incubated for 15 min at 25 °C to remove any contaminating DNA not packaged within rAAV virions. All incubation steps were carried out in a thermocycler with a 0.2 mL block.1 ⁇ L of 50 mM EDTA was added to each tube, the contents of the tubes were mixed, and the tubes were briefly spun.
  • the DNase I was heat-inactivated at 70 °C for 10 min.
  • the viral capsids were digested by addition of 49 ⁇ L of proteinase K master mix to each 51 ⁇ L DNase I digest. The samples were briefly vortexed and centrifuged.
  • plasmid standards a dilution series of 1 x 10 3 to 1 x 10 7 copies/ ⁇ L of a plasmid of known size containing the amplifiable sequence was generated.
  • the plasmid was diluted to 25-100 ng/ ⁇ L using sterile TE buffer or PCR grade water and the concentration was determined using a high accuracy spectrophotometer. The mass of the plasmid was also determined as well as the concentration in copies/ ⁇ L of the plasmid stock.
  • the plasmid was diluted in TE buffer or PCR-grade water to generate a 1 x 10 9 copies/ ⁇ L stock.
  • a 10-fold serial dilution of the stock in TE buffer or PCR-grade buffer was also made to generate plasmid standards of 1 x 10 3 , 1 x 10 4 , 1 x 10 5 , 1 x 10 6 and 1 x 10 7 copies/ ⁇ L. These were stored as 100 ⁇ L aliquots at -80 °C.
  • a new set of standards was thawed for each qPCR run. [00135]
  • 100 ⁇ L of ultrapure or PCR-grade water were added to the 100 ⁇ L of rAAV DNA samples from above.
  • the plate was centrifuged for 2 min at 20 °C at 1700 x g and transferred to a real-time thermal cycler (Applied Biosystem 7900HT real-time PCR system) and real- time PCR was run using the following cycling conditions: [00138] The data were analyzed using the instrument software. Adjustment of the baseline and threshold settings were manually adjusted as needed. The amplification curves of each set of three replicates were checked and any wells that showed amplification variation were omitted. The standard curve of Ct versus log input copies of standard plasmid were evaluated. The slope of the standard curve was close to 3.2 and the correlation coefficient (R 2 value) was 0.99 otherwise the run was repeated with a new set of standards.
  • AAV1/2 vectors encoding S62 and S71 will be completed.
  • animals On day -14 (D-14), animals will receive a stereotaxic injection of AAV1/2- EV (Groups 1 and 2), AAV1/2-S6224MER (SEQ ID NO: 6, Group 3) or AAV1/2-S71 22MER (SEQ ID NO: 7, Group 4) into the right substantia nigra (SN). Injection volume will be 2 ⁇ l per site at a final vector titer to be decided.
  • mMC mouse sequence monomer control
  • mPFF Type-1 StressMarq, 8 ⁇ g/ml
  • the Study will use a total of 48 female Sprague-Dawley rats (Charles River, 275-300 g at time of first surgery). Animals will be housed 2 per cage and acclimatised for at least one week prior to start of any procedures. Animals will be housed at standard temperature (21 ⁇ 2 °C) in a light controlled environment (lights on 7:00 am to 7:00 pm) with access to food (Teklad 7912, Harlan, Madison, WI) and water ad libitum. Animals will be weighed on the first day of acclimatization and then on a weekly basis thereafter.
  • Animals will receive a series of stereotaxic injections, first into the substantia nigra (D-14) and PFFs into the striatum on D1.
  • Day -14 AAV1/2-S62 or AAV1/2-S71
  • animals will receive a unilateral intranigral administration at a single site of either empty vector (AAV1/2-EV; Groups 1 and 2), AAV1/2-S62 (SEQ ID NO: 6, Group 3) or AAV1/2-S71 (SEQ ID NO: 7, Group 4) according to stereotaxic techniques.
  • Injection volume will be 2 ⁇ l per site at a concentration of 3.0 x 10 12 gp/ml. All vectors will be diluted (if required) in PBS.
  • the injection site will be -5.2 mm AP, and -2 mm ML relative to Bregma (according to the atlas of Paxinos and Watson, 1986) with the needle lowered -7.5 mm below the skull.
  • Day 1 (mPFF) [00156] On D1, two weeks following administration of vectors encoding each of the two peptides, a second stereotaxic surgery will be conducted.
  • rats Under isoflurane anesthesia (2% with 2 L/min oxygen flow rate, isoflurane USP 99.9%) and after confirmation of loss of tail-pinch and corneal reflexes, rats will be placed in a Kopf small animal stereotaxic frame with the incisor bar set 3.3 mm below the ear bars (interaural line). The animal's head will be shaved and the skin cleaned thoroughly using disinfectant soap, isopropyl alcohol 70% USP and iodine surgical scrub (7.5% povidone iodine). An incision ( ⁇ 2 cm) will be made with a sterile scalpel blade in an anteroposterior direction along the midline.
  • Treatment groups [00158] The study will incorporate 4 groups of rats. Animals will be assigned to each group randomly at the beginning of the Study. Treatments will be as shown in Table 2. Table 2.
  • AAV1/2-scr AAV1/2-scrambled S62 with HA-tag, 3.0 x 10 12 gp/ml
  • AAV1/2-S62 AAV1/2-S6224mer with HA-tag, 3.0 x 10 12 gp/ml
  • mPFF mouse sequence aSyn pre-formed fibrils
  • Antigen retrieval will be performed by incubating the sections in a sodium citrate buffer for 1 hr at 37 °C followed by 3 rinses in PBS. Background staining inhibited in a 5% normal donkey serum / 2% bovine serum albumin solution. Tissue will be then incubated overnight with anti pSer129 aSyn (1:5000; Abcam, ab51253) After three washes in PBS, sections will be sequentially incubated in biotinylated antibodies IgG (donkey anti-rabbit, 1:500; Jackson, West Grove, PA) and the Elite avidin-biotin complex (ABC Kits; Vector, Burlingame, CA) for 1 h separated by three washes in PBS.
  • biotinylated antibodies IgG donor anti-rabbit, 1:500; Jackson, West Grove, PA
  • ABS Elite avidin-biotin complex
  • pSer129 aSyn immunostaining will be visualized following a reaction using 3,3-diaminobenzidine (ABC Elite, Vector Laboratories, Cat. # PK-6100). Sections will be then mounted on glass slides, allowed to dry, dipped into dH 2 O, dehydrated through graded alcohols (70%, 95%, 100%) and cleared in histo-clear prior to being coverslipped with Vecta-mount mounting medium. [00161] Expression of pSer129 aSyn will be qualitatively assessed in the forebrain for extent of pathological aSyn spread. In addition, a quantitative assessment of pSer129- aSyn positive neurons in the SN will be performed by stereology (see below).
  • Brains will be sectioned frozen in the coronal plane at a thickness of 40 ⁇ m on a freezing sliding microtome (Leica Microsystems Inc., Richmond Hill, ON) and 6 series of sections will be stored in cryoprotectant (30% glycerol, 30% ethoxyethanol, 40% PBS). A single series of sections will be processed for visualization of tyrosine hydroxylase (TH) via the biotin-labelled antibody procedure.
  • cryoprotectant (30% glycerol, 30% ethoxyethanol, 40% PBS.
  • TH +ve neuronal number and/or pSer129 +ve neuronal number within the substantia nigra pars compacta (SNc) will be performed using Stereo Investigator software (MBF Bioscience, Williston, VT) according to stereologic principles.
  • hemagglutinin immunofluorescence [00165] Using a single series of midbrain and caudal striatal sections, double label immunofluorescence will be performed to reveal hemagglutinin (HA)-tagged human aSyn and tyrosine hydroxylase (TH).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
PCT/US2021/051758 2020-09-23 2021-09-23 Compositions and methods for inhibiting alpha-synuclein aggregation Ceased WO2022066911A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CA3192936A CA3192936A1 (en) 2020-09-23 2021-09-23 Compositions and methods for inhibiting alpha-synuclein aggregation
EP21873431.7A EP4216978A4 (en) 2020-09-23 2021-09-23 Compositions and methods for inhibiting alpha-synuclein aggregation
US18/027,250 US20240025953A1 (en) 2020-09-23 2021-09-23 Compositions and methods for inhibiting alpha-synuclein aggregation
CN202180070652.0A CN116457466A (zh) 2020-09-23 2021-09-23 用于抑制α-突触核蛋白聚集的组合物和方法
AU2021349261A AU2021349261A1 (en) 2020-09-23 2021-09-23 Compositions and methods for inhibiting alpha-synuclein aggregation
JP2023518378A JP2023542950A (ja) 2020-09-23 2021-09-23 α-シヌクレインの凝集を阻害するための組成物及び方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063082208P 2020-09-23 2020-09-23
US63/082,208 2020-09-23

Publications (1)

Publication Number Publication Date
WO2022066911A1 true WO2022066911A1 (en) 2022-03-31

Family

ID=80845817

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/051758 Ceased WO2022066911A1 (en) 2020-09-23 2021-09-23 Compositions and methods for inhibiting alpha-synuclein aggregation

Country Status (7)

Country Link
US (1) US20240025953A1 (https=)
EP (1) EP4216978A4 (https=)
JP (1) JP2023542950A (https=)
CN (1) CN116457466A (https=)
AU (1) AU2021349261A1 (https=)
CA (1) CA3192936A1 (https=)
WO (1) WO2022066911A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116590342A (zh) * 2023-05-11 2023-08-15 深圳先进技术研究院 一种aav载体及其应用
WO2024229777A1 (zh) * 2023-05-11 2024-11-14 深圳先进技术研究院 一种aav载体及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005037211A2 (en) * 2003-10-14 2005-04-28 Neurologix Research, Inc. Methods and compositions for the treatment of neurological disease
WO2018005867A2 (en) * 2016-06-29 2018-01-04 The Regents Of The University Of California Structure-based peptide inhibitors of alpha-synuclein aggregation
WO2019068854A1 (en) * 2017-10-06 2019-04-11 Ospedale San Raffaele S.R.L. GENE THERAPY OF NEURODEGENERATIVE DISEASES USING VAA VECTORS

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2154969B1 (en) * 2007-05-16 2015-11-18 The Brigham and Women's Hospital, Inc. Treatment of synucleinopathies
AU2013337354A1 (en) * 2012-11-05 2015-05-21 Genzyme Corporation Compositions and methods for treating proteinopathies
US20170184612A1 (en) * 2014-04-09 2017-06-29 The Trustees Of Columbia University In The City Of New York Use of leukocytes and novel biomarkers in the diagnosis, confirmation, and treatment of a neurological disorder
KR102423442B1 (ko) * 2015-12-11 2022-07-20 캘리포니아 인스티튜트 오브 테크놀로지 아데노-관련 바이러스를 지시하기 위한 타겟팅 펩타이드
EP3668485A1 (en) * 2017-08-18 2020-06-24 The Medical College of Wisconsin, Inc. Srcp1-based therapy for diseases associated with protein aggregation
MX2020011386A (es) * 2018-04-27 2021-01-29 Spacecraft Seven Llc Terapia genica para la degeneracion del snc.
CA3118692A1 (en) * 2018-11-06 2020-05-14 Alsatech, Inc. Cell-based gene therapy for neurodegenerative diseases

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005037211A2 (en) * 2003-10-14 2005-04-28 Neurologix Research, Inc. Methods and compositions for the treatment of neurological disease
WO2018005867A2 (en) * 2016-06-29 2018-01-04 The Regents Of The University Of California Structure-based peptide inhibitors of alpha-synuclein aggregation
WO2019068854A1 (en) * 2017-10-06 2019-04-11 Ospedale San Raffaele S.R.L. GENE THERAPY OF NEURODEGENERATIVE DISEASES USING VAA VECTORS

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MICHAEL F. NASO, BRIAN TOMKOWICZ, WILLIAM L. PERRY, WILLIAM R. STROHL: "Adeno-Associated Virus (AAV) as a Vector for Gene Therapy", BIODRUGS, ADIS INTERNATIONAL LTD., NZ, vol. 31, no. 4, 1 August 2017 (2017-08-01), NZ , pages 317 - 334, XP055547503, ISSN: 1173-8804, DOI: 10.1007/s40259-017-0234-5 *
See also references of EP4216978A4 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116590342A (zh) * 2023-05-11 2023-08-15 深圳先进技术研究院 一种aav载体及其应用
WO2024229777A1 (zh) * 2023-05-11 2024-11-14 深圳先进技术研究院 一种aav载体及其应用
CN116590342B (zh) * 2023-05-11 2026-04-03 普递瑞(上海)医药有限公司 一种aav载体及其应用

Also Published As

Publication number Publication date
CA3192936A1 (en) 2022-03-31
EP4216978A4 (en) 2025-06-11
JP2023542950A (ja) 2023-10-12
AU2021349261A9 (en) 2024-07-04
AU2021349261A1 (en) 2023-06-01
US20240025953A1 (en) 2024-01-25
CN116457466A (zh) 2023-07-18
EP4216978A1 (en) 2023-08-02

Similar Documents

Publication Publication Date Title
TWI879721B (zh) 用於nt-3基因療法之方法及材料
US20250122531A1 (en) Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
US10087224B2 (en) Gene therapy for Alzheimer's and other neurodegenerative diseases and conditions
AU2020208467A1 (en) Methods and systems for producing AAV particles
KR20220107243A (ko) Apoe 유전자 요법
WO2022018171A1 (en) GENE THERAPY VECTOR FOR eEF1A2 AND USES THEREOF
WO2019227219A1 (en) Adeno-associated viral vector-mediated gene therapy for treating fragile x-associated disorders
JP2023535121A (ja) 操作されたパーキン及びその使用
WO2022066911A1 (en) Compositions and methods for inhibiting alpha-synuclein aggregation
EP3390623B1 (en) Wilson's disease gene therapy
JP7691367B2 (ja) Cln3ポリヌクレオチドのアデノ随伴ウイルス送達
CN109843913B (zh) 神经肽表达载体以及用于治疗癫痫的方法
WO2010037143A1 (en) Vectors and methods of treating brain seizures
WO2009071679A1 (en) Novel aav vector and uses thereof
JP2022522004A (ja) 依存症障害の遺伝子治療
KR20240017311A (ko) Aav 전달을 위한 조성물 및 aav 전달 효율 스크리닝 방법
HK40121244A (zh) Nt-3基因疗法的方法和材料
WO2026030377A1 (en) Nfat1-based therapeutics for joint diseases
EP4601743A1 (en) Methods and pharmaceutical composition for the treatment of alpha-synucleinopathies
Mason SRSF1-mediated gene therapy as a therapeutic approach for C9ORF72-related amyotrophic lateral sclerosis and fronto-temporal dementia (ALS-FTD)
HK40104471A (zh) 用於目的基因的表达盒及其应用
WO2026080587A2 (en) Compositions and methods for gene therapy
HK40107283A (zh) 核酸构建体、病毒载体和病毒颗粒
HK40063258B (zh) 腺相关病毒对cln6多核苷酸的递送
EA052396B1 (ru) Способы и материалы для направленной на nt-3 генной терапии

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21873431

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3192936

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2023518378

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202180070652.0

Country of ref document: CN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021873431

Country of ref document: EP

Effective date: 20230424

ENP Entry into the national phase

Ref document number: 2021349261

Country of ref document: AU

Date of ref document: 20210923

Kind code of ref document: A