WO2022065867A1 - 변형된 cas12a 단백질 및 이의 용도 - Google Patents

변형된 cas12a 단백질 및 이의 용도 Download PDF

Info

Publication number
WO2022065867A1
WO2022065867A1 PCT/KR2021/012936 KR2021012936W WO2022065867A1 WO 2022065867 A1 WO2022065867 A1 WO 2022065867A1 KR 2021012936 W KR2021012936 W KR 2021012936W WO 2022065867 A1 WO2022065867 A1 WO 2022065867A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
modified
seq
cas12a
cas12a protein
Prior art date
Application number
PCT/KR2021/012936
Other languages
English (en)
French (fr)
Inventor
박종진
이정혁
Original Assignee
(주)지플러스생명과학
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020200121989A external-priority patent/KR102497690B1/ko
Priority claimed from KR1020200121990A external-priority patent/KR20220039189A/ko
Application filed by (주)지플러스생명과학 filed Critical (주)지플러스생명과학
Priority to US18/027,598 priority Critical patent/US20230374478A1/en
Publication of WO2022065867A1 publication Critical patent/WO2022065867A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • the present invention relates to modified Cas12a proteins and uses thereof.
  • the present invention relates to a composition for genome editing comprising the modified Cas12a protein and an enhancer, a genome editing method using the same, and a transformant production method using the same.
  • Genome editing refers to a technology that freely edits the genetic information of living things. Advances in the field of life sciences and advances in genome sequencing technology have enabled us to broadly understand a variety of genetic information. For example, understanding of genes for reproduction of plants and animals, disease and growth, genetic mutations that cause various human genetic diseases, and the production of biofuels have already been secured, but they can be directly used to improve life and prevent human diseases. In order to reach the level of treatment, further technological advances are essential.
  • Genome editing technology can dramatically expand the range of applications by changing the genetic information of animals, plants, and microorganisms, including humans.
  • Genetic scissors are molecular tools designed and made to precisely cut desired genetic information and are playing a key role in genome editing technology.
  • gene scissors are becoming a key technology that expands the speed and scope of the utilization of genetic information and creates a new industrial field.
  • the gene scissors developed so far can be divided into three generations according to their order.
  • the first-generation gene scissors are ZFN (Zinc Finger Nuclease)
  • the second-generation gene scissors are TALEN (Transcription Activator-Like Effector Nuclease)
  • CRISPR Clustered regularly interspaced short palindromic repeat
  • CRISPR-associated9 3rd generation gene scissors.
  • CRISPRs are loci containing several short direct repeats found in the genome of approximately 40% of genetically sequenced bacteria and 90% of genetically sequenced archaea.
  • the Cas protein forms an active endonuclease when complexed with two RNAs termed CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), they do so externally from invasion of the phage or plasmid. Protects host cells by ignoring genetic elements.
  • the crRNA is transcribed from the CRISPR element of the host genome that has been occupied by a foreign invader for delivery.
  • RNA-guided nuclease derived from the CRISPR-Cas system provides a means to edit the genome.
  • studies related to a technology capable of editing the genome of cells and organs using single guide RNA (sgRNA) and Cas protein have been actively conducted.
  • the Cpf1 (Cas12a) protein (derived from Prevotella and Francisella 1) was reported as another nuclease protein of the CRISPR-Cas system (B Zetsche, et al, 2015), thus broadening the choice in genome editing. lost.
  • the CRISPR-Cas system based on the Cpf1 protein also still presents the off-target problem of the conventional Cas9 protein based gene scissors.
  • Off-target DNA cleavage by off-target effects may cause mutations in unwanted genes such as proto-oncogenes and tumor suppressor genes, and may cause translocation, deletion, and Since it is possible to increase genomic recombination such as inversion, it becomes a serious problem in the use of gene scissors in research fields and medical fields. Therefore, recent studies have been conducted to develop gene scissors with excellent indel efficiency in order to reduce off-targeting of gene scissors. has not been reported yet.
  • the present inventors have completed the present invention by deriving a novel CRISPR-associated protein that can be effectively applied to gene scissors, and conducting research to develop a gene scissors system with excellent indel efficiency based on this.
  • Cas12a protein In order to achieve the above object, one aspect of the present invention, Cas12a protein; And it provides a modified Cas12a protein linked to myc-NLS (nuclear localization sequences) comprising the amino acid sequence of SEQ ID NO: 4 to the C-terminus of the protein.
  • myc-NLS nuclear localization sequences
  • the modified Cas12a protein or a polynucleotide encoding the same; and a guide RNA comprising a nucleotide sequence hybridizable to a target nucleotide sequence or a polynucleotide encoding the same; provides a composition for genome editing comprising.
  • Another aspect of the present invention is a Cas12a protein, a modified Cas12a protein or a polynucleotide encoding the same; a guide RNA comprising a nucleotide sequence capable of hybridizing with a target nucleotide sequence or a polynucleotide encoding the same; And enhancer (enhancer); provides a composition for genome editing comprising.
  • Another aspect of the present invention provides a genome editing method comprising introducing the composition for genome editing into an isolated cell or organism.
  • Another aspect of the present invention provides a method for producing a transformant comprising introducing the composition for genome editing into isolated cells or organisms other than humans.
  • the modified Cas12a protein has significantly superior endonuclease activity for recognizing and cutting intracellular nucleic acid sequences bound to guide RNAs compared to the conventional AsCpf1 protein, it is effectively used as a nuclease with excellent indel efficiency in the CRISPR-Cas system. can be utilized.
  • the indel efficiency is excellent compared to the existing CRISPR-Cas system, and thus can be effectively utilized for gene editing.
  • FIG. 1 is a diagram showing the structure of a pET28a-His-opmgCas12a-1-6XNLS-His recombinant expression vector.
  • FIG. 3 is a graph showing the results of FPLC chromatography (Fast Protein Liquid Chromatography) confirming opmgCas12a-1-6XNLS using a His column.
  • FIG. 4 is a graph showing the results of FPLC chromatography confirming opmgCas12a-1-6XNLS using a desalting column.
  • 5 is a photograph showing the Coomassie staining result of SDS-PAGE for the opmgCas12a-1-6XNLS fraction.
  • Figure 6a is a photograph comparing the knockout efficiency of AsCas12a, mgCas12a1, opmgCas12a-1-6XNLS and mgCas12a1-GFP for the HPRT1 gene in HEK293T.
  • Figure 6b is a photograph comparing the knockout efficiency of AsCas12a, mgCas12a1, opmgCas12a-1-6XNLS and mgCas12a1-GFP according to the presence or absence of an enhancer for the HPRT1 gene in HEK293T.
  • Figure 7a is a graph comparing the knockout efficiency of AsCas12a, mgCas12a1, opmgCas12a-1-6XNLS and mgCas12a1-GFP for the HPRT1 gene in HEK293T.
  • Figure 7b is a graph comparing the knockout efficiency of AsCas12a, mgCas12a1, opmgCas12a-1-6XNLS and mgCas12a1-GFP according to the presence or absence of an enhancer for the HPRT1 gene in HEK293T.
  • FIG. 8 is a schematic diagram of mgCas12a-1 and mgCas12a-1-6XNLS according to the present invention.
  • BPNLS bipartite nuclear localization sequences
  • FIG. 9 is a graph comparing the knockout efficiency of AsCas12a, mgCas12a-1 and opmgCas12a-1-6XNLS according to the presence or absence of an enhancer for the HPRT1 gene in HEK293T over time (24 hours and 48 hours).
  • Cas12a protein provides a modified Cas12a protein linked to myc-NLS (nuclear localization sequences) comprising the amino acid sequence of SEQ ID NO: 4 to the C-terminus of the protein.
  • the Cas12a protein may be composed of the amino acid sequence of SEQ ID NO: 1.
  • the myc-NLS may be composed of the amino acid sequence of SEQ ID NO: 4.
  • Cas12a is a CRISPR-associated protein, which is a type V CRISPR system protein, which may also be referred to as Cpf1.
  • Cas12a is a single protein and is similar to Cas9, a type II CRISPR system protein, in that it binds to crRNA and cuts a target gene, but there is a difference in its operation method. Since Cas12a protein works as a single crRNA, there is no need to use crRNA and trans-activating crRNA (tracrRNA) at the same time as in Cas9 or to artificially create a single guide RNA (sgRNA) that combines tracrRNA and crRNA.
  • tracrRNA trans-activating crRNA
  • the PAM exists at the 5' position of the target sequence.
  • the length of the guide RNA (gRNA) that determines the target is also shorter than that of Cas9.
  • gRNA guide RNA
  • mgCas12a had lower indel efficiency compared to AsCpf1 and LbCpf1, making it difficult to apply to the CRISPR-Cas system.
  • remarkably excellent indel efficiency was confirmed in mgCas12a-1-6XNLS, in which myc-NLS, a nuclear localization signal, was repeatedly linked to the C-terminus of mgCas12a-1, to improve the gene editing efficiency of the conventional CRISPR-Cas system. It was confirmed that mgCas12a-1-6XNLS can be usefully utilized for this purpose.
  • the mgCas12a-1 protein may have the amino acid sequence of SEQ ID NO: 1.
  • mgCas12a-1 and myc-NLS may be directly bound.
  • mgCas12a-1 and myc-NLS may be linked through a linker.
  • the linker may be 1 to 10 amino acids as a peptide linker.
  • the linker may be a peptide consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids.
  • the amino acid may be selected from 20 amino acids.
  • the peptide linker may be composed of amino acids selected from the group consisting of Gly and Ser.
  • One embodiment of the peptide linker may be Gly-Gly-Ser.
  • the myc-NLS may be linked to the C-terminus of mgCas12a-1 by a Gly-Gly-Ser amino acid sequence.
  • modified Cas12a protein may further include 1 to 10 myc-NLS.
  • modified Cas12a protein may include 6 myc-NLS.
  • the myc-NLS may be six repeats.
  • the myc-NLS may be linked through a peptide linker, respectively.
  • the peptide linker may be Gly-Gly-Ser.
  • a plurality of myc-NLS linked to the C-terminus of mgCas12a-1 may be repeatedly linked, preferably 2 to 10 may be repetitively linked, and most preferably 6 are repeat linked.
  • myc-NLS the gene editing efficiency of mgCas12a-1 can be remarkably improved by linking a plurality of mgCas12a-1 C-terminal repeats.
  • myc-NLS may be linked to each other by Gly-Gly-Ser amino acid sequences.
  • the myc-NLS may include the amino acid sequence of SEQ ID NO: 4.
  • the myc-NLS may be encoded by the nucleotide sequence of SEQ ID NO: 3.
  • lysine (Lys) at position 169 in the amino acid sequence of SEQ ID NO: 1 may be substituted with arginine (Arg).
  • aspartic acid (Asp) at position 529 in the amino acid sequence of SEQ ID NO: 1 may be substituted with arginine (Arg).
  • lysine (Lys) at position 169 is substituted with arginine (Arg) and aspartic acid (Asp) at position 529 is optimized by substitution with arginine (Arg)
  • the protein was designated opmgCas12a-1-6XNLS.
  • gene editing efficiency by opmgCas12a-1-6XNLS was significantly increased compared to mgCas12a-1-6XNLS.
  • the modified Cas12a protein may include the amino acid sequence of SEQ ID NO: 22 or SEQ ID NO: 19.
  • composition for genome editing comprising modified Cas12a protein
  • the modified Cas12a protein or a polynucleotide encoding the same; and a guide RNA comprising a polynucleotide sequence capable of hybridizing with a target nucleotide sequence or a polynucleotide encoding the same; provides a composition for genome editing comprising.
  • the modified Cas12a protein is as described above.
  • guide RNA is an RNA comprising a nucleotide sequence capable of complementary binding to a target DNA, and gRNA can form a complex with the mgCas12a-1-6XNLS protein, and mgCas12a- 1-6XNLS refers to single-stranded RNA that can bring protein to target DNA.
  • the guide RNA may be prepared to be specific for any target to be cut.
  • the modified Cas12a protein of the present invention may be in a form that is easy to be introduced into a cell.
  • the modified Cas12a protein may be linked to a cell penetrating peptide or a protein transduction domain.
  • the protein transduction domain may be poly-arginine or HIV-derived TAT protein, but is not limited thereto.
  • the length of the sequence capable of forming a base pair with the complementary strand of the target DNA sequence of the guide RNA is 17 to 23 bp, 18 to 23 bp, 19 to 23 bp, more specifically 20 to 23 bp, even more specifically, 21 to 23 bp days
  • the present invention is not limited thereto.
  • the DNA sequence targeted by the guide RNA includes a protospacer adjacent motif (PAM) sequence that is 3 to 4 additional nucleotides upstream of the 5'-end region, specifically, the PAM sequence is 5'-TTTG-3' or 5' -TTTA-3' is preferable.
  • PAM protospacer adjacent motif
  • the modified Cas12a protein may be linked with a tag advantageous for isolation and/or purification.
  • a tag advantageous for isolation and/or purification.
  • a small peptide tag such as a His tag, a Flag tag, an S tag, or a Glutathione S-transferase (GST) tag, a Maltose binding protein (MBP) tag, etc. may be used depending on the purpose, but is not limited thereto.
  • GST Glutathione S-transferase
  • MBP Maltose binding protein
  • the tag may be bound to the N-terminus or C-terminus of the Cas12a protein or the modified Cas12a protein.
  • the CRISPR/mgCas12a-1-6XNLS system of the present invention comprises a polynucleotide encoding a guide RNA; and as an isolated polynucleotide such as a polynucleotide encoding a Cas protein. It can also be used in the form of a recombinant expression vector comprising an expression cassette for expressing guide RNA, or/and Cas protein.
  • recombinant expression vector refers to a recombinant DNA molecule comprising a desired coding sequence and an appropriate nucleic acid sequence essential for expressing a coding sequence operably linked to a specific host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotes are known.
  • operably linked refers to a functional linkage between a gene expression control sequence and another nucleotide sequence.
  • the gene expression control sequence may be at least one selected from the group consisting of an origin of replication, a promoter, and a terminator.
  • the transcription termination sequence may be a polyadenylation sequence (pA)
  • the origin of replication may be an f1 origin of replication, an SV40 origin of replication, a pMB1 origin of replication, an adeno origin of replication, an AAV origin of replication, or a BBV origin of replication, but is not limited thereto. .
  • promoter refers to a region upstream of DNA from a structural gene, and refers to a DNA molecule to which RNA polymerase binds to initiate transcription.
  • the promoter is one of the transcription control sequences that regulate the transcription initiation of a specific gene, and may be a polynucleotide fragment of about 100 bp to about 2500 bp in length.
  • the promoter can be used without limitation, as long as it can regulate transcription initiation in a cell, for example, a eukaryotic cell (eg, a plant cell, or an animal cell (eg, a mammalian cell such as a human, a mouse, etc.)).
  • the promoter may be a CMV promoter (cytomegalovirus promoter (eg human or mouse CMV immediate-early promoter), U6 promoter, elongation factor 1-a (EF1-alpha) promoter, EF1-alpha short (EFS) promoter, SV40 promoter, adenovirus promoter (major late promoter), pL ⁇ promoter, trp promoter, lac promoter, tac promoter, T7 promoter, vaccinia virus 7.5K promoter, HSV tk promoter, SV40E1 promoter, respiratory syncytial virus; RSV promoter, metallotionin promoter, ⁇ -actin promoter, ubiquitin C promoter, human interleukin-2 (IL-2) gene promoter, human lymphotoxin gene promoter, and human GM -CSF (human granulocyte-macrophage colony stimulating factor) may be selected from the group consisting of gene promoters, but is not limited thereto.
  • the recombinant expression vector according to an embodiment of the present invention may be selected from the group consisting of viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors.
  • viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors.
  • Vectors that can be used as recombinant expression vectors include plasmids used in the art (eg, pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1).
  • phage eg, ⁇ gt4 ⁇ B, ⁇ -Charon, ⁇ z1, M13, etc.
  • viral vectors eg, adeno-associated virus (AAV) vectors, etc. It may be manufactured based on, but is not limited thereto.
  • the recombinant expression vector of the present invention may further include one or more selectable markers.
  • the marker is a nucleic acid sequence having characteristics that can be selected by conventional chemical methods, and includes all genes capable of distinguishing a transfected cell from a non-transfected cell.
  • herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, ampicillin, kanamycin, G418, Bleomycin , hygromycin (hygromycin), may be an antibiotic resistance gene such as chloramphenicol (chloramphenicol), but is not limited thereto.
  • the production of the recombinant expression vector of the present invention can be prepared using a genetic recombination technique well known in the art, and site-specific DNA cleavage and ligation can be performed using enzymes generally known in the art. there is.
  • composition for genome editing is not limited thereto, but may further include an enhancer.
  • the term “enhancer” is a part that promotes transcription more actively by inducing a structural change of a DNA template while in a gene. There is a characteristic that can exert its function no matter where it exists.
  • the enhancer is not limited thereto, but may be a Cpfl enhancer.
  • Cpf1 does not require tracrRNA to function, only one short crRNA is required.
  • Cpf1 recognizes a T-rich protospacer adjacent motif (PAM), unlike the G-rich PAM of Cas9, allowing novel targeting possibilities in the genome.
  • PAM protospacer adjacent motif
  • Cpf1 is known to bind to the PAM sequence, 5'-TTN, 5'-TTTN or 5'-TTTV, depending on the species of origin. It has been reported that the PAM sequence must be double-stranded for the Cpf1 PAM binding domain to recognize and bind to the PAM site.
  • the nucleotide of 9 has a hairpin length of 16 base pairs and is 46.1% editable, SEQ ID NO.
  • the 25 oligonucleotides have a hairpin length of 16 base pairs and are characterized by 44.8% editability.
  • composition for genome editing comprising Cas12a protein and enhancer
  • Another aspect of the present invention is a Cas12a protein or a polynucleotide encoding the same; a guide RNA comprising a nucleotide sequence capable of hybridizing with a target nucleotide sequence or a polynucleotide encoding the same; And enhancer (enhancer); provides a composition for genome editing comprising.
  • Cas12a protein As used herein, the terms “Cas12a protein”, “guide RNA” and “enhancer” are the same as described above.
  • the Cas12a protein may have the amino acid of SEQ ID NO: 1.
  • the Cas12a protein may be in a form in which at least one amino acid is substituted in SEQ ID NO: 1.
  • the substituted form is as described above.
  • the Cas12a protein may be a modified Cas12a protein.
  • the modified Cas12a protein may be in the form of a protein including the amino acid sequence of SEQ ID NO: 1 and myc-NLS.
  • a plurality of myc-NLS linked to the C-terminus of mgCas12a-1 may be repeat-linked, preferably 2 to 10 repeat-linked ones, and most preferably 6 repeat-linked ones.
  • myc-NLS gene editing efficiency of mgCas12a-1 can be remarkably improved by a plurality of mgCas12a-1 C-terminal repeats, and myc-NLS can be linked to each other by a Gly-Gly-Ser amino acid sequence.
  • the myc-NLS may include the nucleotide sequence of SEQ ID NO: 3.
  • the myc-NLS may include the amino acid sequence of SEQ ID NO: 4.
  • lysine (Lys) at position 169 is substituted with arginine (Arg) and aspartic acid (Asp) at position 529 is optimized by substitution with arginine (Arg)
  • Cys arginine
  • Asp aspartic acid
  • Arg Efficient gene editing can be achieved by opmgCas12a-1-6XNLS.
  • the Cas12a protein may include the amino acid sequence of SEQ ID NO: 22 or SEQ ID NO: 19.
  • composition for genome editing comprising Cas12a protein and/or enhancer
  • Another aspect of the present invention provides a genome editing method comprising introducing the composition for genome editing into an isolated cell or organism.
  • Another aspect of the present invention provides a method for producing a transformant comprising introducing a composition for genome editing into isolated cells or organisms other than humans.
  • composition for genome editing of the present invention may be introduced into a cell or organism by a method known in the art for introducing a nucleic acid molecule into an organism, cell, tissue or organ, and as is known in the art, it may be suitable depending on the host cell. This can be done by selecting standard techniques. Such methods include, for example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic The liposome method and the lithium acetate-DMSO method may be included, but are not limited thereto.
  • Example 1 Construction of mgCas12a-1 mutant recombinant vector with increased gene editing efficiency
  • Example 1.1 pET28a-His-mgCas12a-1-6XNLS-His recombinant vector
  • the core region (130bp) of Table 2 was ordered in the form of a primer and annealed, and then PCR amplified using the extension primer of Table 3 to prepare an insert.
  • primer primer sequence (5' ⁇ 3') SEQ ID NO: extension primer forward ttgacttcattcaaaataagcggtatctgggcggctcccctgctgctaaacgtgttaagcttgatgggggtagcccggcagccaagagagtcaaactcg SEQ ID NO: 6 reverse agccggatctcagtggtggtggtggtggtggtggctgccgctagcatccaatttgacgcgctttgcagccggtgacccaccgtctaatttgactcgcttagcc SEQ ID NO: 7
  • the mgCas12a-1-6XNLS protein has the amino acid sequence of SEQ ID NO: 8 encoded by the nucleotide sequence of SEQ ID NO: 9.
  • Example 1.2 pET28a-His-opmgCas12a-1-6XNLS-His recombinant vector
  • Example 1.1 In the mgCas12a-1-6XNLS recombinant vector of Example 1.1, a codon-optimized opmgCas12a-1-6XNLS recombinant vector was prepared by point mutation.
  • the pET28a-His-mgCas12a-1-6XNLS-His vector of Example 1.1 was double cleaved using EcoI and BsaI to prepare a vector. Thereafter, by performing Gibson assembly and cloning the insert into the vector, a pET28a-His-opmgCas12a-1-6XNLS-His recombinant vector in which opmgCas12a-1 was cloned was constructed.
  • the opmgCas12a-1-6XNLS-His protein has the amino acid sequence of SEQ ID NO: 19 encoded by the nucleotide sequence of SEQ ID NO: 20.
  • the recombinant vector expressing opmgCas12a-1-6XNLS prepared in Example 1.2. was transformed into competent cells, Rosetta(DE3) or Rosetta2(DE3)pLysS, respectively.
  • Example 1.2 1 ⁇ l of the recombinant vector of Example 1.2 was added to 100 ⁇ l of Rosetta (DE3) or Rosetta2 (DE3) pLysS, and then reacted on ice for 30 minutes. Thereafter, heat shock was applied at 42° C. for 45 seconds, and then quickly transferred to ice and reacted for 2 minutes. After adding 1 ml of LB medium, shaking incubation at 37° C. for 1 hour, centrifugation at 13,000 rpm for 3 minutes to precipitate cells, and resuspension after leaving 100 ⁇ l of the supernatant, After spreading on an LB plate containing kanamycin, it was transformed by culturing at 37° C. overnight.
  • Rosetta Rosetta
  • DE3 pLysS Rosetta2
  • Rosetta (DE3) or Rosetta2 (DE3) pLysS transformed in Example 2.1 was cultured overnight, and after inoculation of 5 ml in 500 ml of liquid TB medium to which 100 mg/ml of kanamycin antibiotic was added. , in an incubator at 37 °C until 0.6 OD 600 was incubated.
  • lysis buffer (20 mM HEPES pH7.5, 100 mM KCl, 20 mM imidazole, 10% glycerol and EDTA-free protease inhibitor cocktail), followed by sonication. Cells were disrupted. The pulverized product was centrifuged at 6,000 rpm for 20 minutes three times and then filtered through a 0.22 micron filter. After washing and eluting using a nickel column (HisTrap FF 5 ml) and 300 mM imidazole buffer, SDS-PAGE electrophoresis and coomassie staning were performed to confirm the opmgCas12a-1-6XNLS protein. .
  • the opmgCas12a-1-6XNLS protein washed and eluted by the method of Example 2 was purified by chromatography.
  • the opmgCas12a-1-6XNLS protein was purified by FPLC chromatography using a His column or a desalting column. OpmgCas12a-1-6XNLS by dialysis overnight in dialysis buffer (20 mM HEPES pH 7.5, 100 mM KCl, 1 mM DTT, 10% glycerol), followed by selective filtration and concentration according to protein size (Amicon Ultra Centrifugal Filter 100,000 MWCO) The protein was purified.
  • the purified opmgCas12a-1-6XNLS protein was The concentration was measured by the Bradford quantitative method, and was stored at -80°C before use.
  • Example 4.1 Construction of RNPs with opmgCas12a-1-6XNLS for HPRT1 gene editing
  • HEK 293T cells were cultured in DMEM (Dulbecco Modified Eagle Medium) containing 10% fetal bovine serum FBS and penicillin-streptomycin (P/S) at 37° C. in a 5% CO 2 incubator.
  • Ribonucleic acid protein (RNP) was prepared by incubating 126 pmol of opmgCas12a-1-6XNLS protein 5 ⁇ M and 160 pmol of crRNA targeting HPRT1 (Table 4) 6.4 ⁇ M at room temperature for 20 minutes.
  • the crRNA sequence of HPRT1 used was synthesized from Integrated DNA Technologies (IDT).
  • 2 ⁇ 10 5 HEK293T cells were mixed with 20 ⁇ l of nucleofection reagent, mixed with 10 ⁇ l of RNP, or 10 ⁇ l of RNP and enhancer (final concentration 3 ⁇ M), followed by a 4D-Nucleofector device ( Lonza) was used to introduce RNP into the cells by an electroporation method.
  • the enhancer was used by purchasing 'Cpf1 electroporation enhancer, 10 nmol (cat no. 1076301)' from IDT. 48 hours after transformation, genomic DNA was extracted from the cells using the PureLink TM Genomic DNA Mini Kit (invitrogen).
  • Example 4.1 The genomic DNA extracted in Example 4.1 was purified and a sequencing library was prepared according to Illumina's protocol, and deep sequencing analysis of the target site was performed using MiniSeq equipment.
  • RNP including opmgCas12a-1-6XNLS (FIG. 8) for HPRT1 gene editing was prepared in the same manner as in Example 4.1., and the nucleotide sequence for the target site was analyzed in the same manner as in Example 4.2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 변형된 CRISPR 연관 단백질 및 이의 용도에 관한 것이다. 보다 상세하게는, 상기 변형된 CRISPR 연관 단백질 및 인핸서를 포함하는 유전체 편집용 조성물 및 이를 이용한 유전체 편집 방법과 형질 전환체 제조 방법에 관한 것이다. 본 발명에 따른 변형된 CRISPR 연관 단백질은 CRISPR-Cas 시스템에서 인델 효율이 우수한 뉴클레아제로서 활용 가능하며, 기존의 CRISPR-Cas 시스템 대비 인델 효율이 우수하므로, 유전자 편집에 효과적으로 활용될 수 있다.

Description

변형된 CAS12A 단백질 및 이의 용도
본 발명은 변형된 Cas12a 단백질 및 이의 용도에 관한 것이다. 또한, 상기 변형된 Cas12a 단백질 및 인핸서를 포함하는 유전체 편집용 조성물 및 이를 이용한 유전체 편집 방법과 형질 전환체 제조 방법에 관한 것이다.
유전체 편집(Genome Editing)이란 생명체의 유전정보를 자유롭게 교정하는 기술을 말한다. 생명과학분야의 진보와 유전체 서열 분석 기술의 발전을 통해 우리는 다양한 유전정보에 대해 폭넓게 이해할 수 있게 되었다. 예를 들어 동식물의 번식, 질병과 성장, 다양한 인간 유전질병을 일으키는 유전자 변이, 바이오연료의 생산 등을 위한 유전자에 대한 이해는 이미 확보된 상황이지만 이를 직접적으로 활용하여 생명체를 개선하고, 인간 질병을 치료하는 수준에까지 이르기 위해서는 그 이상의 기술 진보가 필수적이다.
유전체 편집 기술은 인간을 포함하여 동물, 식물, 미생물의 유전정보를 변화시켜 그 활용범위를 획기적으로 확장시킬 수 있다. 유전자 가위는 원하는 유전정보를 정확히 자를 수 있도록 설계되어 만들어지는 분자 도구로 유전체 편집 기술에서 핵심역할을 하고 있다. 유전자 서열분석 분야를 한 차원 발전시켰던 차세대시퀀싱(Next generation sequencing) 기술과 같이, 유전자 가위는 유전정보 활용의 속도와 그 범위를 확장시키고 새로운 산업 분야를 창출해 내는 핵심 기술이 되고 있다.
지금까지 개발된 유전자 가위는 그 순서에 따라 3세대로 나눌 수 있다. 1세대 유전자 가위는 ZFN(Zinc Finger Nuclease), 2세대 유전자 가위는 TALEN(Transcription Activator-Like Effector Nuclease), 가장 최근에 연구된 CRISPR(Clustered regularly interspaced short palindromic repeat)-Cas(CRISPR-associated)9은 3세대 유전자 가위다.
CRISPRs는 유전자 서열이 밝혀진 박테리아의 대략 40% 및 유전자 서열이 밝혀진 고세균의 90%의 유전체에서 발견되는 여러 짧은 직접 반복을 포함하는 좌위이다. Cas 단백질은 CRISPR RNA(crRNA) 및 trans-activating crRNA(tracrRNA)로 명명된 두 개의 RNA와 복합체를 형성했을 때, 활성 엔도뉴클레아제(endonuclease)를 형성하고, 그렇게 함으로써 파지 또는 플라스미드의 침입에서 외부 유전적 요소를 묵살하여 숙주 세포를 보호한다. crRNA는 전달에 외부 침입자로부터 점유되었던 숙주 유전체의 CRISPR 요소로부터 전사된다.
이러한 CRISPR-Cas 시스템 유래의 RNA-가이드 뉴클레아제(RNA-guided nuclease)는 유전체를 편집할 수 있는 수단을 제공해준다. 특히, 단일 가이드 RNA(sgRNA)와 Cas 단백질을 이용하여 세포 및 기관의 유전체를 편집할 수 있는 기술과 관련된 연구들이 활발히 진행되어왔다. 최근, Cpf1(Cas12a) 단백질(Prevotella 및 Francisella 1 유래)이 CRISPR-Cas 시스템의 또 다른 뉴클레아제 단백질로서 보고되었고(B Zetsche, et al, 2015), 이에 따라 유전체 편집에 있어서 선택의 폭이 넓어졌다.
다만, Cpf1 단백질 기반의 CRISPR-Cas 시스템 역시 종래 Cas9 단백질 기반 유전자 가위의 표적이탈(off-target) 문제를 여전히 나타낸다. 표적이탈 효과에 의한 비표적 DNA 절단은 전암유전자(proto-oncogene) 및 암억제유전자(tumor suppressor gene)와 같이 원치 않는 유전자에서 돌연변이를 야기할 수 있고, 전위(translocation), 결실(deletion), 및 역위(inversion)와 같은 유전체 재조합을 증가시킬 수 있어, 연구 분야 및 의학 분야 등에서 유전자 가위를 이용하는데 심각한 문제가 된다. 따라서, 최근 유전자 가위의 표적이탈을 감소시키기 위하여, 인델(indel) 효율이 우수한 유전자 가위를 개발하기 위한 연구가 수행되고 있으나, 전체 유전체 수준에서 표적이탈 효과 없이 표적 위치에만 특이적으로 작동하는 유전자 가위는 아직까지 보고된 바 없다.
이에, 본 발명자들은 유전자 가위에 효과적으로 적용될 수 있는 신규 CRISPR 연관 단백질을 도출하고, 이를 기반으로 인델 효율이 우수한 유전자 가위 시스템을 개발하기 위한 연구를 수행하여 본 발명을 완성하였다.
상기 목적 달성을 위해, 본 발명의 일 측면은, Cas12a 단백질; 및 상기 단백질의 C-말단에 서열번호 4의 아미노산 서열을 포함하는 myc-NLS(nuclear localization sequences)가 연결된 변형된 Cas12a 단백질을 제공한다.
본 발명의 다른 측면은, 상기 변형된 Cas12a 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및 표적 뉴클레오티드(target nucleotide) 서열과 혼성화 가능한 뉴클레오티드 서열을 포함하는 가이드 RNA 또는 이를 암호화하는 폴리뉴클레오티드;를 포함하는 유전체 편집용 조성물을 제공한다.
본 발명의 또 다른 측면은, Cas12a 단백질, 변형된 Cas12a 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 표적 뉴클레오티드(target nucleotide) 서열과 혼성화 가능한 뉴클레오티드 서열을 포함하는 가이드 RNA 또는 이를 암호화하는 폴리뉴클레오티드; 및 인핸서(enhancer);를 포함하는 유전체 편집용 조성물을 제공한다.
본 발명의 또 다른 측면은, 상기 유전체 편집용 조성물을 분리된 세포 또는 유기체에 도입하는 단계를 포함하는 유전체 편집 방법을 제공한다.
본 발명의 또 다른 측면은, 상기 유전체 편집용 조성물을 분리된 세포 또는 인간을 제외한 유기체에 도입하는 단계를 포함하는 형질 전환체의 제조 방법을 제공한다.
본원 변형된 Cas12a 단백질은 가이드 RNA와 결합된 세포 내 핵산 서열을 인식하여 절단하는 엔도뉴클레아제 활성이 종래 사용되는 AsCpf1 단백질보다도 현저히 우수하므로, CRISPR-Cas 시스템에서 인델 효율이 우수한 뉴클레아제로써 효과적으로 활용될 수 있다. 또한, Cas12a 단백질 및 인핸서를 포함하는 유전체 편집용 조성물, 및 이의 용도에 따르면, 기존의 CRISPR-Cas 시스템 대비 인델 효율이 우수하므로, 유전자 편집에 효과적으로 활용될 수 있다.
도 1은 pET28a-His-opmgCas12a-1-6XNLS-His 재조합 발현 벡터의 구조를 나타낸 그림이다.
도 2는 SDS-PAGE에 의하여 opmgCas12a-1-6XNLS 단백질의 최적 발현 조건이 확인된 사진이다.
도 3은 His 컬럼을 사용하여 opmgCas12a-1-6XNLS를 확인한 FPLC 크로마토그래피(Fast Protein Liquid Chromatography) 결과를 나타낸 그래프이다.
도 4는 탈염(desalting) 컬럼을 사용하여 opmgCas12a-1-6XNLS를 확인한 FPLC 크로마토그래피 결과를 나타낸 그래프이다.
도 5는 opmgCas12a-1-6XNLS 분획에 대한 SDS-PAGE의 쿠마시 염색 결과를 나타낸 사진이다.
도 6a는 HEK293T에서 HPRT1 유전자에 대한 AsCas12a, mgCas12a1, opmgCas12a-1-6XNLS 및 mgCas12a1-GFP의 녹아웃(knockout) 효율을 비교한 사진이다.
도 6b는 HEK293T에서 HPRT1 유전자에 대한 인핸서 유무에 따른 AsCas12a, mgCas12a1, opmgCas12a-1-6XNLS 및 mgCas12a1-GFP의 녹아웃(knockout) 효율을 비교한 사진이다.
도 7a는 HEK293T에서 HPRT1 유전자에 대한 AsCas12a, mgCas12a1, opmgCas12a-1-6XNLS 및 mgCas12a1-GFP의 녹아웃(knockout) 효율을 비교한 그래프이다.
도 7b는 HEK293T에서 HPRT1 유전자에 대한 인핸서 유무에 따른 AsCas12a, mgCas12a1, opmgCas12a-1-6XNLS 및 mgCas12a1-GFP의 녹아웃(knockout) 효율을 비교한 그래프이다.
도 8은 본 발명에 따른 mgCas12a-1 및 mgCas12a-1-6XNLS의 모식도이다. 여기에서, BPNLS에서는 bipartite NLS(nuclear localization sequences)를 의미한다.
도 9는 HEK293T에서 HPRT1 유전자에 대한 인핸서 유무에 따른 AsCas12a, mgCas12a-1 및 opmgCas12a-1-6XNLS의 녹아웃(knockout) 효율을 시간별(24시간 및 48시간)로 비교한 그래프이다.
변형된 CRISPR 연관 Cas12a 단백질
본 발명의 일 측면은, Cas12a 단백질; 및 상기 단백질의 C-말단에 서열번호 4의 아미노산 서열을 포함하는 myc-NLS(nuclear localization sequences)가 연결된 변형된 Cas12a 단백질을 제공한다.
바람직하게는 상기 Cas12a 단백질은 서열번호 1의 아미노산 서열로 구성된 것일 수 있다. 또한, 상기 myc-NLS는 서열번호 4의 아미노산 서열로 구성된 것일 수 있다.
본 명세서에서 사용한 용어 "Cas12a"는 CRISPR 연관 단백질로써, Cpf1로도 지칭될 수 있는 type V CRISPR 시스템 단백질이다. Cas12a는 단일 단백질로써, crRNA과 결합하여 표적 유전자를 절단한다는 점은 type Ⅱ CRISPR 시스템 단백질인 Cas9와 유사하나, 그 작동 방식에서 차이가 있다. Cas12a 단백질은 하나의 crRNA로 작동하므로, Cas9의 경우와 같이 crRNA와 trans-activating crRNA(tracrRNA)를 동시에 사용하거나, 인위적으로 tracrRNA와 crRNA를 합친 single guide RNA(sgRNA)를 제작할 필요가 없다.
또한, Cas12a 시스템은 Cas9와 달리 PAM이 표적 서열의 5' 위치에 존재한다. 또한, Cas12a 시스템은 표적을 결정하는 guide RNA(gRNA)의 길이도 Cas9에 비해 짧다. 또한, Cas12a는 표적 DNA가 절단된 위치에 blunt-end가 아닌 5' overhang(sticky end)을 발생시키므로, 보다 정확하고 다양한 유전자 편집이 가능하다는 장점을 갖는다.
mgCas12a는 AsCpf1 및 LbCpf1 대비 인델 효율이 낮아, CRISPR-Cas 시스템에 적용되기 어려웠다. 다만, 본 발명에서는 mgCas12a-1의 C-말단에 핵위치 신호인 myc-NLS를 반복연결한 mgCas12a-1-6XNLS에서 현저히 우수한 인델 효율이 확인되어, 종래 CRISPR-Cas 시스템의 유전자 편집 효율을 개선하기 위해 mgCas12a-1-6XNLS이 유용하게 활용될 수 있음이 확인되었다. 이때, 상기 mgCas12a-1 단백질은 서열번호 1의 아미노산 서열을 가질 수 있다.
본 발명의 일 구체예에 따르면, mgCas12a-1 및 myc-NLS은 직접 결합될 수 있다. 또한, mgCas12a-1 및 myc-NLS은 링커를 통해 결합될 수 있다. 상기 링커는 펩타이드 링커로서 1개 내지 10개의 아미노산 일 수 있다. 또한, 상기 링커는 1, 2, 3, 4, 5, 6, 7, 8, 9 또는 10개의 아미노산으로 이루어진 펩타이드일 수 있다. 아미노산을 20개의 아미노산에서 선택될 수 있다. 바람직하게, 상기 펩타이드 링커는 Gly 및 Ser으로 구성된 군에서 선택되는 아미노산으로 이루어진 것일 수 있다. 상기 펩타이드 링커의 일 구체예는 Gly-Gly-Ser 일 수 있다.
상기 myc-NLS는 Gly-Gly-Ser 아미노산 서열에 의해 mgCas12a-1의 C-말단에 연결될 수 있다.
또한, 상기 변형된 Cas12a 단백질은 추가적으로 myc-NLS를 1 내지 10개를 더 포함할 수 있다. 또한, 상기 변형된 Cas12a 단백질은 myc-NLS를 6개를 포함할 수 있다. 본 발명의 일 구체예에 따르면, 상기 myc-NLS는 6개가 반복연결된 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 myc-NLS는 각각 펩타이드 링커를 통해 연결될 수 있다. 이때, 펩타이드 링커는 Gly-Gly-Ser 일 수 있다.
일 실시예에 따르면, mgCas12a-1의 C-말단에 연결되는 myc-NLS는 복수개가 반복연결된 것일 수 있고, 바람직하게는 2 내지 10개가 반복연결된 것일 수 있으며, 가장 바람직하게는 6개가 반복연결된 것일 수 있다. myc-NLS는 복수개의 mgCas12a-1 C-말단 반복연결에 의하여, mgCas12a-1의 유전자 편집 효율이 현저히 개선될 수 있다. 또한, myc-NLS는 Gly-Gly-Ser 아미노산 서열에 의해 서로 연결될 수 있다.
본 발명의 일 구체예에 따르면, 상기 myc-NLS는 서열번호 4의 아미노산 서열을 포함하는 것일 수 있다. 또한, 상기 myc-NLS는 서열번호 3의 염기서열에 의해 코딩될 수 있다.
본 발명의 일 구체예에 따르면, 상기 서열번호 1의 아미노산 서열 중 169번째 위치의 라이신(Lys)이 아르기닌(Arg)으로 치환된 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 서열번호 1의 아미노산 서열 중 529번째 위치의 아스파르트산(Asp)이 아르기닌(Arg)으로 치환된 것일 수 있다.
특히, 본 발명의 mgCas12a-1-6XNLS의 아미노산 서열 중 169번째 위치의 라이신(Lys)이 아르기닌(Arg)으로 치환 및 529번째 위치의 아스파르트산(Asp)이 아르기닌(Arg)으로 치환에 의해 최적화된 단백질을 opmgCas12a-1-6XNLS로 지칭하였다. 이때, opmgCas12a-1-6XNLS에 의한 유전자 편집 효율은 mgCas12a-1-6XNLS에 비해 현저히 증가하였다.
본 발명의 일 구체예에 따르면, 상기 변형된 Cas12a 단백질은 서열번호 22 또는 서열번호 19의 아미노산 서열을 포함하는 것일 수 있다.
변형된 Cas12a 단백질을 포함하는 유전체 편집용 조성물
본 발명의 다른 측면은, 상기 변형된 Cas12a 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및 표적 뉴클레오티드(target nucleotide) 서열과 혼성화 가능한 폴리뉴클레오티드 서열을 포함하는 가이드 RNA 또는 이를 암호화하는 폴리뉴클레오티드;를 포함하는 유전체 편집용 조성물을 제공한다.
상기 변형된 Cas12a 단백질은 상술한 바와 같다.
본 명세서에서 사용한 용어, "가이드 RNA(gRNA)"는 표적 DNA에 상보적으로 결합할 수 있는 염기서열을 포함하는 RNA로, gRNA는 mgCas12a-1-6XNLS 단백질과 복합체를 형성할 수 있고, mgCas12a-1-6XNLS 단백질을 표적 DNA에 가져올 수 있는 단일 사슬 RNA를 말한다. 본 발명에서 가이드 RNA는 절단하고자 하는 어떠한 표적에 특이적이 되도록 제조될 수 있다.
본 발명의 변형된 Cas12a 단백질은 세포 내로 도입되기에 용이한 형태일 수 있다. 예를 들면, 변형된 Cas12a 단백질은 세포 투과 펩타이드 또는 단백질 전달 도메인(protein transduction domain)과 연결된 것일 수 있다. 상기 단백질 전달 도메인은 폴리-아르기닌 또는 HIV 유래의 TAT 단백질일 수 있으나, 이에 한정되는 것은 아니다.
가이드 RNA의 표적 DNA 서열의 상보적 사슬과 염기 쌍을 형성할 수 있는 서열의 길이는 17 내지 23bp, 18 내지 23bp, 19 내지 23bp, 보다 구체적으로 20 내지 23bp, 보다 더 구체적으로, 21 내지 23bp 일 수 있으나, 이에 한정되는 것은 아니다.
가이드 RNA에 의해 표적화되는 DNA 서열은 5'-말단 부위 상류에 3 내지 4개의 추가적인 뉴클레오티드인 PAM(protospacer adjacent motif) 서열을 포함하며, 구체적으로 상기 PAM 서열은 5'-TTTG-3' 또는 5'-TTTA-3'인 것이 바람직하다.
변형된 Cas12a 단백질, 구체적으로 mgCas12a-1-6XNLS 단백질은 분리 및/또는 정제에 유리한 태그와 연결될 수 있다. 예를 들어, His 태그, Flag 태그, S 태그 등과 같은 작은 펩타이드 태그, 또는 GST(Glutathione S-transferase) 태그, MBP(Maltose binding protein) 태그 등이 목적에 따라 사용될 수 있으나, 이에 한정되는 것은 아니다. 상기 태그는 Cas12a 단백질 또는 변형된 Cas12a 단백질의 N 말단 또는 C 말단에 결합될 수 있다.
본 발명의 CRISPR/mgCas12a-1-6XNLS 시스템은 가이드 RNA를 코딩하는 폴리뉴클레오티드; 및 Cas 단백질을 코딩하는 폴리뉴클레오티드와 같이 분리된 폴리뉴클레오티드로 이용될 수 있다. 또한 가이드 RNA, 또는/및 Cas 단백질을 발현하기 위한 발현 카세트를 포함하는 재조합 발현 벡터 형태로도 사용될 수 있다.
본 명세서에서 사용한 용어, "재조합 발현벡터"는 목적한 코딩 서열과, 특정 숙주 생물에서 작동가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다. 진핵세포에서 이용 가능한 프로모터, 인핸서, 종결신호 및 폴리아데닐레이션 신호는 공지되어 있다.
본 명세서에서 사용한 용어, "작동가능하게 연결된"은 유전자 발현 조절 서열과 다른 뉴클레오티드 서열사이의 기능적인 결합을 의미한다. 상기 유전자 발현 조절 서열은 복제원점(replication origin), 프로모터 및 전사 종결 서열(terminator) 등으로 이루어진 군으로부터 선택되는 1종 이상일 수 있다. 전사 종결 서열은 폴리아데닐화 서열(pA)일 수 있으며, 복제 원점은 f1 복제원점, SV40 복제원점, pMB1 복제원점, 아데노 복제원점, AAV 복제원점 또는 BBV 복제원점 등일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 사용한 용어, "프로모터"는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며, 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다.
본 발명의 일 구체예에 따른 프로모터는 특정 유전자의 전사 개시를 조절하는 전사 조절 서열 중 하나로, 약 100bp 내지 약 2500bp 길이의 폴리뉴클레오티드 단편일 수 있다. 프로모터는 세포, 예를 들어, 진핵 세포(예컨대, 식물 세포, 또는 동물 세포(예를 들어, 인간, 마우스 등의 포유류 세포 등) 등)에서 전사 개시를 조절할 수 있으면, 제한 없이 사용 가능하다. 예를 들어, 프로모터는 CMV 프로모터(cytomegalovirus promoter(예를 들어, 인간 또는 마우스 CMV immediate-early 프로모터), U6 프로모터, EF1-alpha(elongation factor 1-a) 프로모터, EF1-alpha short(EFS) 프로모터, SV40 프로모터, 아데노바이러스 프로모터(major late promoter), pL λ 프로모터, trp 프로모터, lac 프로모터, tac 프로모터, T7 프로모터, 백시니아 바이러스 7.5K 프로모터, HSV의 tk 프로모터, SV40E1 프로모터, 호흡기 세포융합 바이러스(Respiratory syncytial virus; RSV) 프로모터, 메탈로티오닌 프로모터(metallothionin promoter), β-액틴 프로모터, 유비퀴틴 C 프로모터, 인간 IL-2(human interleukin-2) 유전자 프로모터, 인간 림포톡신(human lymphotoxin) 유전자 프로모터 및 인간 GM-CSF(human granulocyte-macrophage colony stimulating factor) 유전자 프로모터로 이루어진 군으로부터 선택되는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따른 재조합 발현벡터는 플라스미드 벡터, 코즈미드 벡터 및 박테리오파아지 벡터, 아데노바이러스 벡터, 레트로바이러스 벡터 및 아데노-연관 바이러스 벡터와 같은 바이러스 벡터로 이루어진 군으로부터 선택되는 것일 수 있다. 재조합 발현벡터로 사용될 수 있는 벡터는 당업계에서 사용되는 플라스미드(예를 들어, pcDNA 시리즈, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX 시리즈, pET 시리즈, pUC19 등), 파지(예를 들어, λgt4λB, λ-Charon, λΔz1, M13 등) 또는 바이러스 벡터(예를 들어, 아데노-연관 바이러스(AAV) 벡터 등) 등을 기본으로 하여 제작될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 재조합 발현벡터는 하나 이상의 선택성 마커를 더 포함할 수 있다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질주입된 세포를 비형질주입 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 예를 들어, 글리포세이트(glyphosate), 글루포시네이트암모늄(glufosinate ammonium) 또는 포스피노트리신(phosphinothricin)과 같은 제초제 저항성 유전자, 암피실린(ampicillin), 카나마이신(kanamycin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 재조합 발현벡터의 제작은 당해 기술 분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용하여 수행될 수 있다.
상기 유전체 편집용 조성물은 이에 제한되지는 않으나, 인핸서(enhancer)를 더 포함하는 것일 수 있다.
본 명세서에서 사용한 용어, "인핸서(enhancer)"는 유전자 속에 있으면서 DNA 주형의 구조적 변화를 유발하여 전사가 더욱 활발하게 일어나도록 촉진 작용을 하는 부분으로, 유전자마다 특유한 염기 배열로 구성되어 있고, 유전자 속에 어떤 위치에 존재하더라도 그 기능을 발휘할 수 있는 특성이 있다.
상기 인핸서는 이에 제한되지는 않으나, Cpfl 인핸서일 수 있다. Cpf1은 기능을 하기 위해 tracrRNA가 필요하지 않으며, 하나의 짧은 crRNA만 있으면 된다. 또한, Cpf1은 Cas9의 G가 풍부한 PAM과 달리 T가 풍부한 PAM(protospacer adjacent motif)을 인식하여 게놈에서 새로운 표적화 가능성을 허용한다. Cpf1은 기원 종에 따라 PAM 서열, 5'-TTN, 5'-TTTN 또는 5'-TTTV에 결합하는 것으로 알려져 있다. Cpf1 PAM 결합 도메인이 PAM 부위를 인식하고 결합하려면 PAM 서열이 이중 가닥이어어야 함이 보고된 바 있다. 구체적으로 Cpf1 인핸서의 일 구체예로는 미국공개특허 제2018-0273938호에 개시된 SEQ ID NO. 9(TGGATAATAATGAACGCATTAGATAGATTTGAATGCCGGAACTTTGGATTTAGATCACCCATTGACTTGGTCAACGGAAACATGTTCGCTATTAATATAGCGAACATGTTTC; 서열번호 24) 또는 SEQ ID NO. 25(TGGATAATAATGAACGCATTAGATAGATTTGAATGCCGGAACTTTGGATTTAGATCACCCATTGACTTGGTCAACGGAAACATGTTCGCTATTAATATAGCGAACATGTTTC; 서열번호 25)의 올리고뉴클레오티드일 수 있다. 미국공개특허 제2018-0273938호에 개시된 SEQ ID NO. 9의 뉴클레오티드는 16개 염기쌍의 헤어핀 길이를 가지며 46.1% 편집(editing)이 가능하고, SEQ ID NO. 25의 올리고뉴클레오티드는 16개 염기쌍의 헤어핀 길이를 가지며 44.8% 편집이 가능한 것을 특징으로 한다.
Cas12a 단백질 및 인핸서를 포함하는 유전체 편집용 조성물
본 발명의 또 다른 측면은, Cas12a 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 표적 뉴클레오티드(target nucleotide) 서열과 혼성화 가능한 뉴클레오티드 서열을 포함하는 가이드 RNA 또는 이를 암호화하는 폴리뉴클레오티드; 및 인핸서(enhancer);를 포함하는 유전체 편집용 조성물을 제공한다.
본 명세서에서 사용한 용어 "Cas12a 단백질", "가이드 RNA" 및 "인핸서(enhancer)"는 전술한 바와 같다.
본 발명에서는 인핸서를 포함하는 type V CRISPR 시스템의 우수한 인델 효율이 확인되었다. 또한, 종래 AsCpf1 및 LbCpf1 대비 인델 효율이 낮아, type V CRISPR 시스템에 적용되기 어려운 것으로 알려진 mgCas12a-1의 C-말단에, 핵위치 신호인 myc-NLS를 반복연결한 mgCas12a-1-6XNLS를 인핸서와 함께 사용한 type V CRISPR 시스템의 현저히 우수한 인델 효율이 확인되었다. 따라서, 종래 type V CRISPR 시스템의 유전자 편집 효율을 개선하기 위해 엔도뉴클레아제로써, mgCas12a-1-6XNLS 및 인핸서가 유용하게 활용될 수 있음이 확인되었다.
상기 Cas12a 단백질은 서열번호 1의 아미노산을 가질 수 있다. 또한, 상기 Cas12a 단백질은 서열번호 1에서 적어도 하나의 아미노산이 치환된 형태일 수 있다. 상기 치환된 형태는 상술한 바와 같다. 또한, 상기 Cas12a 단백질은 변형된 Cas12a 단백질 일 수 있다. 구체적으로 상술한 바와 같이, 변형된 Cas12a 단백질은 서열번호 1의 아미노산 서열을 포함하는 단백질 및 myc-NLS를 포함한 형태일 수 있다.
또한, 포함된 myc-NLS의 수, 결합 방법, 링커 등은 상술한 바와 같다.
mgCas12a-1의 C-말단에 연결되는 myc-NLS는 복수개가 반복연결된 것일 수 있고, 바람직하게는 2 내지 10개가 반복연결된 것일 수 있으며, 가장 바람직하게는 6개가 반복연결된 것일 수 있다. myc-NLS는 복수개의 mgCas12a-1 C-말단 반복연결에 의하여, mgCas12a-1의 유전자 편집 효율이 현저히 개선될 수 있으며, myc-NLS는 Gly-Gly-Ser 아미노산 서열에 의해 서로 연결될 수 있다.
본 발명의 일 구체예에 따르면, 상기 myc-NLS는 서열번호 3의 염기서열을 포함하는 것일 수 있다. 또한, 상기 myc-NLS는 서열번호 4의 아미노산 서열을 포함하는 것일 수 있다.
특히, 본 발명의 mgCas12a-1-6XNLS의 아미노산 서열 중 169번째 위치의 라이신(Lys)이 아르기닌(Arg)으로 치환 및 529번째 위치의 아스파르트산(Asp)이 아르기닌(Arg)으로 치환에 의해 최적화된 opmgCas12a-1-6XNLS에 의하여 효과적인 유전자 편집이 이루어질 수 있다.
본 발명의 일 구체예에 따르면, 상기 Cas12a 단백질은 서열번호 22 또는 서열번호 19의 아미노산 서열을 포함하는 것일 수 있다.
Cas12a 단백질 및/또는 인핸서를 포함하는 유전체 편집용 조성물의 용도
본 발명의 또 다른 측면은, 상기 유전체 편집용 조성물을 분리된 세포 또는 유기체에 도입하는 단계를 포함하는 유전체 편집 방법을 제공한다.
본 발명의 또 다른 측면은, 유전체 편집용 조성물을 분리된 세포 또는 인간을 제외한 유기체에 도입하는 단계를 포함하는 형질 전환체의 제조 방법을 제공한다.
본 발명의 유전체 편집용 조성물은 핵산 분자를 유기체, 세포, 조직 또는 기관에 도입하는 당 분야에서 공지된 방법에 의해 세포 또는 유기체에 도입될 수 있으며, 당 분야에서 공지된 바와 같이 숙주 세포에 따라 적합한 표준 기술을 선택하여 수행할 수 있다. 이런 방법에는 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온성 리포좀법, 및 초산 리튬-DMSO법 등이 포함될 수 있으나, 이에 한정되는 것은 아니다.
이하 본 발명을 하나 이상의 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 유전자 편집 효율이 증가된 mgCas12a-1 변이체 재조합 벡터 제작
실시예 1.1. pET28a-His-mgCas12a-1-6XNLS-His 재조합 벡터
서열번호 2의 염기서열에 의해 암호화되는 서열번호 1의 아미노산 서열을 갖는 단백질(mgCas12a-1)의 유전자 편집 효율을 증가시키기 위하여, mgCas12a-1의 C-말단에 표 1의 myc-NLS(nuclear localization sequences)를 6번 반복하여 추가한 단백질 변이체(mgCas12a-1-6XNLS) 재조합 벡터를 제작하였다.
명칭 구분 서열 서열번호
myc-NLS 염기서열(5'→3') ccggcagccaagagagtcaaactcgac 서열번호 3
아미노산서열(N→C) PAAKRVKLD 서열번호 4
구체적으로, 표 2의 Core region(130bp)을 프라이머 형태로 주문하여 어닐링(annealing)한 후, 표 3의 신장(extension) 프라이머를 사용하여 PCR 증폭함으로써, 인서트(Insert)를 준비하였다.
명칭 염기서열(5'→3') 서열번호
Core region agccaagagagtcaaactcgacggcggctccccagcggcaaaaagggtgaaactagacgggggtagccccgccgcgaagcgtgtaaagctggatggaggatcgcctgcggctaagcgagtcaaattagac 서열번호 5
프라이머 프라이머 염기서열(5'→3') 서열번호
extension primer forward ttgacttcattcaaaataagcggtatctgggcggctcccctgctgctaaacgtgttaagcttgatgggggtagcccggcagccaagagagtcaaactcg 서열번호 6
reverse agccggatctcagtggtggtggtggtggtggctgccgctagcatccaatttgacgcgctttgcagccggtgacccaccgtctaatttgactcgcttagcc 서열번호 7
한편, 종래 사용되고 있는 pET28a-6XHis-mgCas12a-1 플라스미드를 NotI 및 SalI으로 이중 절단(double cut)하여 벡터를 준비하였다. 이후, 깁슨 어셈블리(Gibson assembly)를 수행하여, 벡터에 인서트를 클로닝한 결과, 3개의 콜로니(colony)에서 pET28a-His-mgCas12a-1-6XNLS-His 구조(construction)가 제작된 것으로 확인되었다. mgCas12a-1-6XNLS 단백질은 서열번호 9의 염기서열로 코딩되는 서열번호 8의 아미노산 서열을 갖는다.
실시예 1.2. pET28a-His-opmgCas12a-1-6XNLS-His 재조합 벡터
실시예 1.1.의 mgCas12a-1-6XNLS의 재조합 벡터에서, 점돌연변이(point mutation)에 의해 코돈 최적화된 opmgCas12a-1-6XNLS 재조합 벡터를 제작하였다.
구체적으로, 인서트간의 상동성 재조합(homologous recombination, HR) 부위에 점돌연변이(K169R 및 D529R)가 생성되도록 디자인하였다(도 1). 그 후, PCR 증폭한 후, DpnI 처리 및 PCR 산물을 수득하여 3가지의 인서트를 각각 준비하였다.
Figure PCTKR2021012936-appb-T000001
한편, 실시예 1.1.의 pET28a-His-mgCas12a-1-6XNLS-His 벡터를 EcorI과 BsaI을 사용하여 이중 절단하여 벡터를 준비하였다. 이후, 깁슨 어셈블리를 수행하여 벡터에 인서트를 클로닝함으로써, opmgCas12a-1이 클로닝된 pET28a-His-opmgCas12a-1-6XNLS-His 재조합 벡터를 제작하였다. opmgCas12a-1-6XNLS-His 단백질은 서열번호 20의 염기서열로 코딩되는 서열번호 19의 아미노산 서열을 갖는다.
실시예 2. opmgCas12a-1-6XNLS 단백질 발현 최적조건 확인
실시예 2.1. 형질전환
실시예 1.2.에서 제작한 opmgCas12a-1-6XNLS 발현 재조합 벡터를 컴피턴트 세포(competent cell)인 Rosetta(DE3) 또는 Rosetta2(DE3)pLysS에 각각에 각각 형질전환하였다.
구체적으로, Rosetta(DE3) 또는 Rosetta2(DE3)pLysS 100㎕에 실시예 1.2.의 재조합 벡터 1㎕를 넣은 후 얼음상에서 30분 동안 반응시켰다. 그 후, 42℃에서 45초간 열 충격(heat shock)을 가한 후 재빨리 얼음으로 옮겨 2분 동안 반응시켰다. LB 배지 1㎖을 넣은 후, 37℃에서 1시간 동안 진탕배양(shaking incubation)한 다음, 13,000 rpm에서 3분간 원심분리하여 세포를 침전시키고, 상층액 100 ㎕를 남긴 후 재현탁(resuspension)하여, 카나마이신이 함유된 LB 플레이트에 스프레딩(spreading)한 다음, 37℃에서 밤새 배양하여 형질전환하였다.
실시예 2.2. 단백질 발현량 확인
opmgCas12a-1-6XNLS 단백질 발현량을 확인하기 위하여, 실시예 2.1.에서 형질전환된 Rosetta(DE3) 및 Rosetta2(DE3)pLysS의 발현 최적조건을 분석하였다.
구체적으로, 실시예 2.1.에서 형질전환된 Rosetta(DE3) 또는 Rosetta2(DE3)pLysS를 하룻밤 동안 배양하고, 100 ㎎/㎖의 카나마이신 항생제가 추가된 500 ㎖의 액체 TB 배지에 5 ㎖를 접종한 후, 37℃ 배양기에서 0.6 OD600이 될 때까지 배양하였다. 0.5 mM의 IPTG(Isopropyl β-D-1-thiogalactopyranoside)를 처리하여 opmgCas12a-1-6XNLS 단백질 발현을 유도한 후, 18℃ 또는 28℃에서 18시간 동안 배양하였다. 원심분리 후 수득한 세포를 10 ㎖의 용해 버퍼(20 mM HEPES pH7.5, 100 mM KCl, 20 mM 이미다졸, 10% 글리세롤 및 EDTA-프리 프로테아제 인히비터 칵테일)와 혼합한 후, 초음파를 처리하여 세포를 분쇄하였다. 분쇄물을 6,000 rpm에서 20분간 3회 원심분리한 후 0.22 마이크론 필터로 여과하였다. 이후, 니켈 컬럼(HisTrap FF 5 ㎖) 및 300 mM 이미다졸 버퍼를 이용하여 세척 및 용출한 다음, SDS-PAGE 전기영동 및 쿠마시 염색(coomassie staning)을 수행하여 opmgCas12a-1-6XNLS 단백질을 확인하였다.
그 결과, Rosetta2(DE3)pLysS를 사용한 18℃의 18시간 배양 조건이 opmgCas12a-1-6XNLS 단백질의 발현에 최적 조건인 것으로 확인되었다(도 2).
실시예 3. opmgCas12a-1-6XNLS 단백질 정제
실시예 2의 방법으로 세척 및 용출한 opmgCas12a-1-6XNLS 단백질을 크로마토그래피 방법으로 정제하였다.
구체적으로, opmgCas12a-1-6XNLS 단백질을 His 컬럼(column) 또는 탈염(desalting) 칼럼을 사용한 FPLC 크로마토그래피 방법으로 정제하였다. 투석 버퍼(20 mM HEPES pH 7.5, 100 mM KCl, 1 mM DTT, 10% 글리세롤)로 하룻밤 동안 투석하고, 단백질 크기에 맞춰 선택적으로 여과 및 농축(Amicon Ultra Centrifugal Filter 100,000 MWCO)하여 opmgCas12a-1-6XNLS 단백질을 정제하였다.
SDS-PAGE 전기영동 및 쿠마시 염색을 수행하여 opmgCas12a-1-6XNLS 단백질의 정제 수율을 확인한 결과, 단백질 농도는 35.54 ㎎/㎖ 및 단백질 부피는 1.6 ㎖로써, 56.9 ㎎/ℓ의 opmgCas12a-1-6XNLS 단백질 정제 수율이 확인되었다(도 3 내지 도 5).
이후, 정제된 opmgCas12a-1-6XNLS 단백질은 브래드포드 정량법으로 농도를 측정하고, -80℃에서 보관하며 사용하였다.
실시예 4. opmgCas12a-1-6XNLS의 향상된 유전자 편집 효율 확인
실시예 4.1. HPRT1 유전자 편집을 위한 opmgCas12a-1-6XNLS를 포함한 RNP 제작
HEK 293T 세포를 10% 태아 소혈청인 FBS와 P/S(penicillin-streptomycin)가 함유된 DMEM(Dulbecco Modified Eagle Medium)에서 37℃의 온도로 5% CO2 배양기에서 배양하였다. 126 pmol의 opmgCas12a-1-6XNLS 단백질 5 μM과 HPRT1을 표적화하는 160 pmol의 crRNA(표 4) 6.4 μM를 상온에서 20분간 배양하여 리보핵산단백질(RNP)을 제작하였다. 사용된 HPRT1의 crRNA 서열은 IDT(Integrated DNA Technologies)로부터 합성되었다.
유전자 crRNA sequence(5'→3') 서열번호
HPRT1 GGTTAAAGATGGTTAAATGAT 서열번호 21
HEK293T 세포 2×105개를 20 ㎕의 뉴클레오펙션(nucleofection) 시약과 혼합하고, 10 ㎕의 RNP, 또는 10 ㎕의 RNP 및 인핸서(최종농도 3 μM)와 혼합한 다음, 4D-Nucleofector 기기(Lonza)를 사용하여 세포 내로 RNP를 전기천공(electroporation) 방법으로 도입하였다. 인핸서는 IDT사의 'Cpf1 electroporation enhancer, 10 nmol(cat no. 1076301)'을 구입하여 사용하였다. 형질전환 48시간 후, PureLinkTM Genomic DNA Mini Kit(invitrogen)를 사용하여 세포로부터 게놈 DNA를 추출하였다.
실시예 4.2. 표적 부위에 대한 염기서열 분석
실시예 4.1.에서 추출한 게놈 DNA를 일루미나(Illumina)의 프로토콜에 따라 정제 및 시퀀싱 라이브러리를 제조하였으며, MiniSeq 장비를 이용하여 표적 부위에 대한 딥시퀀싱(deep sequencing) 분석을 진행하였다.
그 결과, mgCas12a-1 대비 opmgCas12a-1-6XNLS의 HPRT1 유전자의 녹아웃 효율이 약 4배 우수한 것으로 나타났으며, 종래 일반적으로 사용되는 AsCpf1보다도 녹아웃 효율이 약 2배 우수한 것으로 나타나, opmgCas12a-1-6XNLS 단백질에 의한 우수한 유전자 편집 효율이 확인되었다(도 6a 및 도 7b). 또한, 인핸서 사용시 100%에 가까운 녹아웃 효율이 확인되었고, 이에 따라 opmgCas12a-1-6XNLS 단백질 및 인핸서에 의한 유전자 편집 효율이 우수함을 알 수 있었다(도 6b 및 도 7b).
실시예 5. opmgCas12a-1-6XNLS의 향상된 유전자 편집 효율 시간별 확인
상기 실시예 4.1.과 동일한 방법으로 HPRT1 유전자 편집을 위한 opmgCas12a-1-6XNLS(도 8)를 포함한 RNP를 제작하고, 실시예 4.2.와 동일한 방법으로 표적 부위에 대한 염기서열을 분석하였다.
시간별로 유전자 편집 효율을 확인해 본 결과, mgCas12a-1 대비 opmgCas12a-1-6XNLS의 HPRT1 유전자의 녹아웃 효율이 현저히 우수한 것으로 나타났고, 이와 마찬가지로 종래 일반적으로 사용되는 AsCpf1보다도 녹아웃 효율이 우수한 것으로 나타났다. 또한, 인핸서 사용시 24시간에도 100%에 가까운 녹아웃 효율이 확인되었으며, 이에 따라 opmgCas12a-1-6XNLS 단백질 및 인핸서에 의한 유전자 편집 효율이 우수함을 알 수 있었다(도 9).

Claims (15)

  1. Cas12a 단백질; 및
    상기 단백질의 C-말단에 서열번호 4의 아미노산 서열을 포함하는 myc-NLS(nuclear localization sequences)가 연결된 변형된 Cas12a 단백질.
  2. 제1항에 있어서,
    상기 Cas12a 단백질은 서열번호 1의 아미노산 서열인 것인, 변형된 Cas12a 단백질.
  3. 제1항에 있어서,
    상기 연결은 펩타이드 링커에 의한 것인, 변형된 Cas12a 단백질.
  4. 제1항에 있어서,
    상기 myc-NLS는 2 내지 10개를 더 포함하는 것인, 변형된 Cas12a 단백질.
  5. 제4항에 있어서,
    상기 myc-NLS는 6개를 포함하는 것인, 변형된 Cas12a 단백질.
  6. 제4항 또는 제5항에 있어서,
    상기 myc-NLS는 각각 Gly-Gly-Ser 아미노산 서열로 연결된 것인, 변형된 Cas12a 단백질.
  7. 제1항에 있어서,
    상기 서열번호 1의 아미노산 서열 중 169번째 위치의 라이신(Lys)이 아르기닌(Arg)으로 치환된 것인, 변형된 Cas12a 단백질.
  8. 제1항에 있어서,
    상기 서열번호 1의 아미노산 서열 중 529번째 위치의 아스파르트산(Asp)이 아르기닌(Arg)으로 치환된 것인, 변형된 Cas12a 단백질.
  9. 제1항에 있어서,
    상기 Cas12a 단백질은 서열번호 22의 아미노산 서열을 포함하는, 변형된 Cas12a 단백질.
  10. 제1항 내지 제9항 중 어느 한 항의 변형된 Cas12a 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및
    표적 뉴클레오티드(target nucleotide) 서열과 혼성화 가능한 뉴클레오티드 서열을 포함하는 가이드 RNA 또는 이를 암호화하는 폴리뉴클레오티드;
    를 포함하는 유전체 편집용 조성물.
  11. 제10항에 있어서,
    상기 유전체 편집용 조성물은 인핸서(enhancer)를 더 포함하는 것인, 유전체 편집용 조성물.
  12. Cas12a 단백질 또는 이를 암호화하는 폴리뉴클레오티드;
    표적 뉴클레오티드(target nucleotide) 서열과 혼성화 가능한 뉴클레오티드 서열을 포함하는 가이드 RNA 또는 이를 암호화하는 폴리뉴클레오티드; 및
    인핸서(enhancer);
    를 포함하는 유전체 편집용 조성물.
  13. 제12항에 있어서,
    상기 Cas12a 단백질은 서열번호 1의 아미노산 서열을 포함하는 단백질; 및
    상기 단백질의 C-말단에 서열번호 4의 아미노산 서열을 포함하는 myc-NLS(nuclear localization sequences)가 연결된 변형된 Cas12a 단백질인 것인, 유전체 편집용 조성물.
  14. 제10항 내지 제13항 중 어느 한 항의 유전체 편집용 조성물을 분리된 세포 또는 유기체에 도입하는 단계를 포함하는 유전체 편집 방법.
  15. 제10항 내지 제13항 중 어느 한 항의 유전체 편집용 조성물을 분리된 세포 또는 인간을 제외한 유기체에 도입하는 단계를 포함하는 형질 전환체의 제조 방법.
PCT/KR2021/012936 2020-09-22 2021-09-23 변형된 cas12a 단백질 및 이의 용도 WO2022065867A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US18/027,598 US20230374478A1 (en) 2020-09-22 2021-09-23 Modified cas12a protein and use thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR1020200121989A KR102497690B1 (ko) 2020-09-22 2020-09-22 신규한 crispr 연관 단백질 및 이의 용도
KR10-2020-0121990 2020-09-22
KR10-2020-0121989 2020-09-22
KR1020200121990A KR20220039189A (ko) 2020-09-22 2020-09-22 신규한 crispr 연관 단백질 및 인핸서를 포함하는 유전체 편집용 조성물, 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2022065867A1 true WO2022065867A1 (ko) 2022-03-31

Family

ID=80845756

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/012936 WO2022065867A1 (ko) 2020-09-22 2021-09-23 변형된 cas12a 단백질 및 이의 용도

Country Status (2)

Country Link
US (1) US20230374478A1 (ko)
WO (1) WO2022065867A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024060814A1 (zh) * 2022-09-21 2024-03-28 香港中文大学（深圳） 一种Cas12a变体及其在基因编辑中的应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017015015A1 (en) * 2015-07-17 2017-01-26 Emory University Crispr-associated protein from francisella and uses related thereto
KR101896847B1 (ko) * 2017-09-22 2018-09-07 한국생명공학연구원 DNA 절단 활성이 불활성화된 Cpf1을 포함하는 유전자 발현 억제용 조성물 및 그 용도
KR20200026804A (ko) * 2017-05-18 2020-03-11 더 브로드 인스티튜트, 인코퍼레이티드 표적화된 핵산 편집을 위한 시스템, 방법 및 조성물
KR102096604B1 (ko) * 2018-08-09 2020-04-02 (주)지플러스 생명과학 신규한 crispr 연관 단백질 및 이의 용도
KR20200097760A (ko) * 2017-12-11 2020-08-19 에디타스 메디신, 인코포레이티드 유전자 편집을 위한 cpf1-관련 방법 및 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017015015A1 (en) * 2015-07-17 2017-01-26 Emory University Crispr-associated protein from francisella and uses related thereto
KR20200026804A (ko) * 2017-05-18 2020-03-11 더 브로드 인스티튜트, 인코퍼레이티드 표적화된 핵산 편집을 위한 시스템, 방법 및 조성물
KR101896847B1 (ko) * 2017-09-22 2018-09-07 한국생명공학연구원 DNA 절단 활성이 불활성화된 Cpf1을 포함하는 유전자 발현 억제용 조성물 및 그 용도
KR20200097760A (ko) * 2017-12-11 2020-08-19 에디타스 메디신, 인코포레이티드 유전자 편집을 위한 cpf1-관련 방법 및 조성물
KR102096604B1 (ko) * 2018-08-09 2020-04-02 (주)지플러스 생명과학 신규한 crispr 연관 단백질 및 이의 용도

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024060814A1 (zh) * 2022-09-21 2024-03-28 香港中文大学（深圳） 一种Cas12a变体及其在基因编辑中的应用

Also Published As

Publication number Publication date
US20230374478A1 (en) 2023-11-23

Similar Documents

Publication Publication Date Title
US12024727B2 (en) Enzymes with RuvC domains
US6004804A (en) Non-chimeric mutational vectors
KR101889589B1 (ko) 변형 캐스케이드 리보핵단백질 및 이의 용도
WO2020032711A1 (ko) 신규한 crispr 연관 단백질 및 이의 용도
WO2023098485A1 (zh) 一种基于c2c9核酸酶的新型基因组编辑系统及其应用
WO2020087631A1 (zh) 基于C2c1核酸酶的基因组编辑系统和方法
WO2022065867A1 (ko) 변형된 cas12a 단백질 및 이의 용도
KR20230054457A (ko) 카고 뉴클레오타이드 서열을 전위시키는 시스템 및 방법
WO2021226369A1 (en) Enzymes with ruvc domains
KR102497690B1 (ko) 신규한 crispr 연관 단백질 및 이의 용도
KR20220039189A (ko) 신규한 crispr 연관 단백질 및 인핸서를 포함하는 유전체 편집용 조성물, 및 이의 용도
RU2788197C1 (ru) Средство разрезания ДНК на основе Cas9 белка из бактерии Streptococcus uberis NCTC3858
RU2778156C1 (ru) Средство разрезания ДНК на основе Cas9 белка из бактерии Capnocytophaga ochracea
RU2724470C1 (ru) Применение cas9 белка из бактерии pasteurella pneumotropica для модификации геномной днк в клетках
JP7353602B1 (ja) ゲノム編集方法およびゲノム編集用組成物
RU2791447C1 (ru) Средство разрезания ДНК на основе ScCas12a белка из бактерии Sedimentisphaera cyanobacteriorum
RU2722934C1 (ru) Средство разрезания днк на основе cas9 белка из бактерии pasteurella pneumotropica
WO2023206872A1 (zh) 一种工程优化的核酸酶、向导rna、编辑系统和应用
RU2771626C1 (ru) Средство разрезания двунитевой ДНК с помощью Cas12d белка из Katanobacteria и гибридной РНК, полученной путем слияния направляющей CRISPR РНК и scout РНК
RU2712492C1 (ru) Средство разрезания днк на основе cas9 белка из defluviimonas sp.
OA20812A (en) Use of CAS9 protein from the bacterium pasteurella pneumotropica.
WO2024042165A2 (en) Novel rna-guided nucleases and nucleic acid targeting systems comprising such rna-guided nucleases
WO2024042168A1 (en) Novel rna-guided nucleases and nucleic acid targeting systems comprising such rna-guided nucleases
CN118019843A (zh) Ii类v型crispr系统
EA041935B1 (ru) СРЕДСТВО РАЗРЕЗАНИЯ ДНК НА ОСНОВЕ Cas9 БЕЛКА ИЗ БАКТЕРИИ Pasteurella Pneumotropica

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21872895

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21872895

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 21872895

Country of ref document: EP

Kind code of ref document: A1