WO2022065805A1

WO2022065805A1 - Recombinant polypeptide derived from mussel adhesive protein and use thereof

Info

Publication number: WO2022065805A1
Application number: PCT/KR2021/012712
Authority: WO
Inventors: 김용태; 김혜미; 주은빈; 김보영; 이준성
Original assignee: 주식회사 바이오빛
Priority date: 2020-09-28
Filing date: 2021-09-16
Publication date: 2022-03-31
Also published as: KR20230110455A; KR20220043985A

Abstract

The present invention relates to a recombinant polypeptide in which a functional peptide is fused to an EGF-like polypeptide derived from a mussel adhesive protein, a gene encoding the recombinant polypeptide, a vector comprising the gene, a transformant obtained by transforming a host cell with the vector, and a use thereof. The recombinant polypeptide of the present invention can be used not only in daily necessities, but also in cosmetics, advanced pharmaceuticals and pharmaceutical materials, and can enable the mussel adhesive protein, which has been previously used only as a biocompatible adhesive material, to be effectively used also in fields such as cell regeneration, wound healing, skin improvement, inflammation, atopy, and resolving infection problems.

Description

Recombinant polypeptides derived from mussel adhesion proteins and uses thereof

The present invention relates to a recombinant polypeptide derived from a mussel adhesive protein and uses thereof, and more particularly, to a biocompatible fragment comprising an EGF (Epidermal Growth Factor)-like domain repeat region derived from a mussel adhesive protein. Polypeptides, functional compositions comprising same, and uses thereof. The recombinant polypeptide of the present invention can be usefully used where cell and tissue regeneration properties and antibacterial and antiviral, anti-inflammatory, and anti-atopic properties are required in combination.

Recently, as tissue regeneration research is active, many studies have been made on the effect of tissue regeneration on growth factors, which are known as essential proteins for cell maintenance, growth, and differentiation. Among them, EGF, called epithelial growth factor, is a peptide-type cell growth factor discovered in 1962 by Dr. Stanley Cohen, an American biologist who won the Nobel Prize in Physiology or Medicine, from a substance that promotes proliferation in rat submandibular gland extract.

EGF is a component that induces cell division and promotes the growth of epidermal cells and the proliferation of fibroblasts that synthesize collagen. promotes creation In addition, EGF binds to EGF receptors in epithelial cells and fibroblasts and is involved in the activation of platelets, macrophages, monocytes, etc. to induce wound healing, whereby epithelial cell proliferation, differentiation and angiogenesis, and many cell lines It enhances the wound healing process by causing various biological phenomena such as DNA, RNA, and protein synthesis. This was confirmed based on various previous results. As such, EGF is widely used not only for cell growth, but also as a treatment for wounds and diabetic foot ulcers (S. Yang, et al., The international journal of lower extremity wounds 15, 120-125, 2016).

On the other hand, the adhesive secreted by mussels or barnacles is a bioadhesive composed of protein, has water resistance, and is an environmentally friendly adhesive that is biodegradable by the action of microorganisms or enzymes due to its inherent biodegradable properties. Among them, the mussel adhesive protein secreted from the mussel's foot is a bio-based material derived from living things, and it is known that it does not attack human cells or cause an immune response, so it has potential applications in medical fields such as adhesion of living tissues or adhesion of broken teeth during surgery. It has been attracting attention as a large biomaterial (Korean Patent Publication No. 10-1578522, Republic of Korea Patent Publication No. 10-1631704). In fact, in order to utilize the mussel adhesive protein as a biocompatible material, the biological properties have been confirmed. In order to confirm the effect of contact and administration of mussel adhesive protein, a study on organ toxicity and immune response was conducted through animal experiments. Necrosis or acute inflammatory reaction was not identified (J. Dove, et al., Journal of American Dental Association 112, 879, 1986).

Research on mussel adhesion proteins is being divided into the development of various mussel proteins and mass production using genetic recombination technology, mainly Mytilus edulis and Mytilus galloprovincialis. And Mytilus coruscus (Mytilus coruscus) is known for the mussel adhesive protein. In order to elucidate the mechanism of the mussel adhesion protein, the types of mussel proteins and their amino acid sequences have been studied for a long time, and it was found that they consist of about 12 or more proteins.

Among various mussel adhesion proteins, a protein named MGFP-2 (Mytilus galloprovincilalis foot protein-2) specifically has a large number of EGF-like domains. EGF-like domains are predominantly expressed in various proteins of animal origin, and are frequently observed repeatedly. EGF-like domains typically contain six cysteine residues that form disulfide bonds, and the subdomain lengths between cysteines are broad. Some EGF-like domains have the ability to bind calcium, forming a harder, protease resistant structure upon binding to calcium. Some EGF-like domains can also bind EGF receptors.

Proteins containing EGF-like domains have been shown to function in various biological processes such as blood coagulation and complement activation, many of which require calcium for biological functions. In addition, it is found in a number of extracellular proteins involved in wound healing, such as cell matrix formation and cell adhesion, as well as several growth factors (Korean Patent Publication No. 10-1196799, TJ Deming, et al., Curremt Opinion in Chemical) Biology 3, 100-105, 1999, M Selander-Sunnerhagen, et al., J Biol Chem. 25, 19642-9, 1992).

However, mussel adhesive protein is mainly known only as a strong natural adhesive compared to chemically synthesized adhesives, so it has been mainly applied to the development of coatings containing adhesive proteins as an active ingredient. It is not recognized as a biocompatible adhesive material.

On the other hand, as a member of the natural immune system, antibacterial peptides are the safest antibacterial substances with excellent biocompatibility, and are known to regulate the host's defense function as well as direct sterilization. By acting with a mechanism different from that of existing antibiotics, it can exhibit broad and strong killing activity ranging from antibiotic-resistant bacteria as well as fungi, and it is known that the action time for controlling pathogenic microorganisms is also very fast (Registration of Korean Patent Publication No. 10-1652263).

Accordingly, the present inventors have developed a recombinant polypeptide in which an EGF-like domain derived from mussel adhesion protein and various types of antibacterial peptides are fused, and revealed that the recombinant polypeptide can more effectively exhibit cell regeneration and antibacterial effects. Thus, the present invention was completed.

The present invention is to solve the problems of the prior art as described above, and an object of the present invention is to provide a recombinant polypeptide in which a functional peptide is fused to an EGF-like polypeptide derived from a mussel adhesive protein.

Another object of the present invention is to provide a gene encoding the recombinant polypeptide, a vector including the gene, and a transformant transformed with the vector.

It is also an object of the present invention to provide a pharmaceutical or cosmetic composition for cell regeneration or anti-inflammatory use comprising a recombinant polypeptide.

In order to solve the above problems, the present invention provides a recombinant polypeptide in which a functional peptide is fused to an EGF-like polypeptide derived from a mussel adhesion protein.

In one embodiment, the mussel may be Mytilus edulis, Mytilus galloprovincialis, or Mytilus coruscus, but is not limited thereto.

In one embodiment, the functional peptide may be an extracellular matrix protein, a growth factor, or an antibacterial peptide, but is not limited thereto.

In a preferred embodiment, the extracellular matrix protein may be collagen, fibronectin, laminin, or vitronectin, and the growth factor is epidermal growth factor (EGF). , Fibroblast Growth Factor (FGF), or Vascular Endothelial Growth Factor (VEGF), but is not limited thereto. In addition, the antimicrobial peptide is KLWKKWAKKWLKLWKA (SEQ ID NO: 12), AKRHHGYKRKFH (SEQ ID NO: 13), ILRWPWWPWRRK (SEQ ID NO: 14), LKKLAKLALAF (SEQ ID NO: 15), KLLLKLLKKLLKLLKKK (SEQ ID NO: 16), GWLKK (SEQ ID NO: 17), THRPPMWSPVKK (SEQ ID NO: 17), THRPPMWSPVWP SEQ ID NO: 18), ILPWKWPWWPWRR (SEQ ID NO: 19), RRWWCRC (SEQ ID NO: 20), or KLAKLAKKLAKLAK (SEQ ID NO: 21).

In one embodiment, the functional peptide may be fused to the C-terminus, the N-terminus, or both ends of the mussel adhesion protein, but is not limited thereto.

In one embodiment, the mussel adhesion protein is FP-1, FP-2, FP-3, FP-4, FP-5, FP-6, and fragments thereof, preferably FP-2 or FP-2 It may be a fragment of, and more preferably, a fragment of MGFP-2 or MGFP-2, but is not limited thereto.

In a preferred embodiment, the fragment of FP-2 may include an amino acid sequence selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 6, but is not limited thereto.

In a preferred embodiment, the recombinant polypeptide of the present invention may include, but is not limited to, the amino acid sequence of SEQ ID NO: 9.

In addition, the present invention provides a gene encoding the recombinant polypeptide, a vector comprising the gene, and a transformant obtained by transforming the vector into a host cell.

In one embodiment, the gene may include, but is not limited to, the nucleotide sequence of SEQ ID NO: 11.

In a preferred embodiment, the host cell may be a prokaryotic cell or a eukaryotic cell, preferably an E. coli cell, but is not limited thereto.

Also, the present invention

(a) preparing a vector comprising a gene encoding the recombinant polypeptide; (b) preparing a transformant transformed with the vector into a host cell; And (c) culturing the transformant; provides a method for producing a recombinant polypeptide comprising a.

In one embodiment, the method for preparing the recombinant polypeptide may further include, but is not limited to, (d) isolating and purifying the recombinant polypeptide.

In addition, the present invention provides a pharmaceutical or cosmetic composition for cell regeneration or anti-inflammatory use comprising the recombinant polypeptide.

The recombinant polypeptide in which a functional peptide is fused to an EGF-like polypeptide derived from the mussel adhesive protein of the present invention is safe for the human body, has excellent cell regeneration ability, has easy processability to be applied to various products, and is biodegradable under certain conditions, Because it provides excellent eco-friendliness that does not use additional solvents for coating or bonding, it can be used not only as daily necessities, but also as cosmetics, and even as pharmaceuticals and pharmaceutical materials. , wound healing, skin improvement, inflammation, atopic dermatitis, and solving infection problems.

The above-described and further features and advantages of the present invention will become apparent when considered in conjunction with the drawings and the following embodiments, which are provided for illustrative purposes.

1 shows a vector diagram for expression of a gene encoding a recombinant polypeptide of the present invention.

2A to 2C show the results of nucleotide sequence analysis of genes encoding three recombinant polypeptides of the present invention, and show the first, fourth, and fifth models of Example 1, respectively.

3 shows a production process diagram of a recombinant polypeptide of the present invention.

4 is a photograph showing the results of the separation and purification process of the recombinant polypeptide of the present invention confirmed by SDS-PAGE, and shows the polypeptide before and after expression of the polypeptide and after the final separation and purification.

5 shows a photograph of lyophilization after isolation and purification of the recombinant polypeptide of the present invention.

6 is a graph showing the cell regeneration properties of the recombinant polypeptide of the present invention.

7 is a photograph showing the antibacterial properties of the recombinant polypeptide of the present invention.

Hereinafter, the present invention will be described in detail.

The present invention provides a recombinant polypeptide in which a functional peptide is fused to an EGF-like polypeptide derived from a mussel adhesion protein.

In one embodiment, the mussel may be selected from the group consisting of Mytilus edulis, Mytilus galloprovincialis, and Mytilus coruscus, preferably Mytilus galloprovincialis. It may be early, but is not limited thereto.

In one embodiment, the functional peptide may be derived from the group consisting of an extracellular matrix, a growth factor, and an antibacterial peptide, preferably derived from an antibacterial peptide, but is not limited thereto.

In one embodiment, the extracellular matrix protein may be selected from the group consisting of collagen, fibronectin, laminin, and vitronectin, wherein the growth factor consists of epidermal growth factor, fibroblast growth factor, and vascular endothelial growth factor It may be selected from the group, but is not limited thereto.

In one embodiment, the EGF-like polypeptide derived from the mussel adhesion protein and the functional peptide may be directly linked or linked via a linker. The linker may be a peptidic linker or a non-peptidic linker.

When the linker is a peptidic linker, it may include one or more amino acids, for example, 1 to 10, preferably 2 to 6, such as 2 amino acids, but is not limited thereto. In a preferred embodiment, the linker may be a dipeptide of KL.

When the linker is a non-peptidic linker, a biocompatible polymer having two or more repeating units bonded thereto may be used. The repeating units are linked to each other via any covalent bond other than a peptide bond. The non-peptidic linker may be selected from the group consisting of fatty acids, polysaccharides, high molecular polymers, low molecular weight compounds, nucleotides, and combinations thereof, but is not limited thereto.

As the antibacterial peptide used in the recombinant polypeptide of the present invention, any peptide derived from nature or artificially synthesized may be used without limitation. The antibacterial peptide can exert an antibacterial effect through a mechanism of destroying the cell membrane of microorganisms or penetrating the cell membrane to inhibit the metabolic function, and any antibacterial peptide that exerts an antibacterial effect through the mechanism of destroying the cell membrane of the microorganism can be used in the invention. Preferably, the antibacterial peptide to be fused to the adhesion protein can be optionally selected from antibacterial peptides effective against Gram-positive as well as Gram-negative bacteria.

In a preferred embodiment, the antimicrobial peptide is KLWKKWAKKWLKLWKA (SEQ ID NO: 12), AKRHHGYKRKFH (SEQ ID NO: 13), ILRWPWWPWRRK (SEQ ID NO: 14), LKKLAKLALAF (SEQ ID NO: 15), KLLLKLLKKLLKLLKKKK (SEQ ID NO: 16), THRPPMWSPV (SEQ ID NO: 16), THRPPM , GWLKKIGKWKIFKK (SEQ ID NO: 18), ILPWKWPWWPWRR (SEQ ID NO: 19), RRWWCRC (SEQ ID NO: 20), and KLAKLAKKLAKLAK (SEQ ID NO: 21). In another embodiment, the antimicrobial peptide can be selected from FALALKALKKL (SEQ ID NO: 22), KWKLFKKIGAVLKVL (SEQ ID NO: 23), LVKLVAGIKKKFLKWK (SEQ ID NO: 24), IWSILAPLGTTLVKLVAGIGQQKRK (SEQ ID NO: 25), GTNNWWQSPSIQN (SEQ ID NO: 26), but limited thereto. it is not going to be In another embodiment, the antimicrobial peptide is an α-helical 23 amino acid peptide isolated from the skin of the African frog Xenopus laevis, Magainin, Dermaseptin, or human defensin. ), casericidin (cathelicidin) LL-37, histatin (Histatin), etc. may be used, but is not limited thereto.

In one embodiment, the functional peptide may be fused to the C-terminus, the N-terminus, or both termini of the mussel adhesion protein.

In the present invention, the mussel adhesive protein is a mussel-derived adhesive protein, and preferably a recombinant mussel adhesive protein or a mutant (Mutnat) of the mussel adhesive protein, but is not limited thereto. Preferably, International Publication No. WO2006/107183A1 or any mussel adhesion protein described in WO2005/092920. The mutants of the mussel adhesive protein preferably contain additional sequences at the carboxyl terminus (C-terminus) or amino terminus (N-terminus) of the mussel adhesive protein, provided that the adhesion of the mussel adhesive protein is maintained, or Some amino acids may be substituted with other amino acids. More preferably, a physiologically functional peptide, for example, a polypeptide consisting of 3 to 25 amino acids including RGD is linked to the carboxyl terminus or amino terminus of the mussel adhesive protein, or the total number of tyrosine residues constituting the mussel adhesive protein is 1 to 100%, preferably 5 to 100%, more preferably 50 to 100% may be substituted with 3,4-dihydroxyphenyl-L-alanine (DOPA).

In one embodiment, the mussel adhesion protein may be selected from the group consisting of FP-1, FP-2, FP-3, FP-4, FP-5, FP-6, and fragments thereof, preferably FP It may be a fragment of -2 or FP-2, and more preferably, the fragment of FP-2 may be selected from the group consisting of SEQ ID NOs: 2 to 6, but is not limited thereto.

In a preferred embodiment of the present invention, the recombinant polypeptide of the present invention may include, but is not limited to, the amino acid sequence of SEQ ID NO: 9.

Among the amino acids constituting the recombinant polypeptide of the present invention, a tyrosine residue can be changed to DOPA and further to DOPA quinone through chemical modification, and the modified DOPA and DOPA quinone can play a very important role in adhesion to the surface. . In one embodiment, chemical modification of the recombinant polypeptide can be performed using, for example, a mushroom-derived Tyrosinase enzyme capable of mediating such chemical modification. Recombinant polypeptides subjected to chemical modification can be attached to various materials such as metal, plastic, and glass.

The present invention also provides a gene encoding the recombinant polypeptide of the present invention, a vector comprising the gene, and a transformant obtained by transforming the vector into a host cell.

The mussel adhesive protein in the present invention is preferably inserted so that it can be expressed in a conventional vector prepared for the purpose of expressing a foreign gene, and can be mass-produced by a genetic engineering method, but is not limited thereto. The vector may be appropriately selected or newly constructed according to the type and characteristics of a host cell for producing the protein. A method of transforming the vector into a host cell and a method of producing a recombinant protein from a transformant can be easily carried out by a conventional method. Methods such as selection, construction, transformation, and recombinant protein expression of the vector described above can be easily carried out by those skilled in the art to which the present invention pertains, and some modifications in conventional methods are also included in the present invention. do.

In one embodiment, the host cell may be a prokaryotic cell or a eukaryotic cell, preferably an E. coli cell, but is not limited thereto.

In the present invention, the term "gene" is used to include, without limitation, a nucleic acid (eg, DNA) sequence including a coding sequence necessary for producing a polypeptide, precursor, or RNA (eg, rRNA, tRNA). In the present invention, the term "gene" includes both cDNA and genomic form of a gene. A genomic form or clone of a gene contains a coding region that is interrupted by a non-coding sequence called an “intron” or “insertion region” or “insert sequence”. A polypeptide may be encoded by the full-length coding sequence or by a portion of the full-length or fragment coding sequence so long as the desired activity or functional properties (eg, enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) are maintained. can be coded. The term also includes the coding region of a structural gene and sequences positioned adjacent to the coding region at the 5' and 3' ends by a distance of at least about 1 kb from the terminus such that the gene corresponds to the length of a full-length mRNA. .

In the present invention, the vector is preferably an expression vector for efficient expression of a gene encoding a recombinant polypeptide of the present invention. In the present invention, "expression vector" refers to a recombinant vector capable of expressing a target peptide in an appropriate host cell, and refers to a gene construct including essential regulatory elements operably linked to express a gene insert. The expression vector of the present invention may include expression control elements such as a promoter, an operator, and an initiation codon as elements generally possessed by a suitable expression vector. The start codon and stop codon are generally considered part of the nucleotide sequence encoding the polypeptide, and must be functional in the subject when the genetic construct is administered and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.

In addition, the vector of the present invention may include a signal sequence for the release of the fusion polypeptide in order to facilitate the separation of the recombinant polypeptide of the present invention from the cell culture medium. A specific initiation signal may also be required for efficient translation of the inserted nucleic acid sequence. These signals include the ATG initiation codon and adjacent sequences. In some cases, an exogenous translational control signal, which may include an ATG initiation codon, must be provided. These exogenous translational control signals and initiation codons can be from a variety of natural and synthetic sources. Expression efficiency can be increased by introduction of appropriate transcriptional or translational enhancing factors.

The vector of the present invention can be used without limitation, any conventional expression vector. For example, plasmid DNA, phage DNA, and the like can be used. Specific examples of the plasmid DNA include commercial plasmids such as pUC18 and pIDTSAMRT-AMP. Other examples of the plasmid that can be used in the present invention include E. coli-derived plasmids (pET-22b(+), pYG601BR322, pBR325, pUC118 and pUC119), Bacillus subtilis-derived plasmids (pUB110 and pTP5) and yeast- derived plasmids (YEp13, YEp24 and YCp50). Specific examples of phage DNA include λ-phages (Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11 and λZAP). In addition, animal viruses such as retroviruses, adenoviruses or vaccinia viruses, and insect viruses such as baculoviruses can be used. Since these expression vectors show different protein expression levels and modifications depending on the host cell, it is sufficient to select and use the most suitable host cell for the purpose.

In a preferred embodiment, the pET22b(+) vector may be used as the vector of the present invention. The pET22b(+) vector is a vector for protein expression, a recombinant MGFP-2 mutant is inserted at the Nde I/Hind III restriction site of the pET22b(+) vector, and Hind III/Xho I restriction of the pET22b(+) vector An antibacterial peptide is inserted at the site of the enzyme. Since the pET22b(+) vector includes a T7 promoter, expression can be induced using Isopropylthio-β-D-galactoside (IPTG), and an affinity ligand for protein separation and purification using affinity chromatography (eg, hexahisitidine) ) gene sequence after the Xho I restriction site.

The transformant of the present invention can be obtained by introducing the vector of the present invention into a suitable host cell. The types of hosts include Escherichia genus (Genus), Pseudomonas genus, Ralstonia genus, Alcaligenes genus, Comamonas genus, Burkholderia genus. ), Agrobacterium, Flabobacterium, Vibrio, Enterobacter, Rhizobium, Gluconobacter, Acineto Genus Acinetobacter, genus Moraxella, genus Nitrosomonas, genus Aeromonas, genus Paracoccus, genus Bacillus, genus Clostridium , Lactobacillus genus, Corynebacterium genus, Arthrobacter genus, Achromobacter genus, Micrococcus genus, Mycobacterium genus, Streptococcus Various bacteria, such as the genus Streptococcus, the genus Streptomyces, the genus Actinomyces, the genus Nocardia, and the genus Methylobacterium, are mentioned. In addition to the above bacteria, yeasts such as Saccharomyces genus and Candida genus, and various molds may be mentioned as hosts, but are not limited thereto.

For example, when a bacterium such as Escherichia coli is used as a host, the recombinant vector of the present invention is capable of autonomous replication in the host itself, and at the same time, a promoter, DNA containing a gene encoding a recombinant polypeptide, and a transcription termination sequence It is preferable to have a structure necessary for expression of etc. As a method for introducing the recombinant DNA into bacteria, a calcium chloride method, an electroporation method, a spheroplast method, a lithium acetate method, etc. can be used, but are not limited thereto.

In addition, the present invention comprises the steps of (a) preparing a vector comprising a gene encoding a recombinant polypeptide of the present invention; (b) preparing a transformant transformed with the vector into a host cell; And (c) culturing the transformant; provides a method for producing a recombinant polypeptide comprising a.

In one embodiment, the method may further comprise (d) isolating and purifying the recombinant polypeptide.

As a method for culturing the transformant of the present invention, a conventional method used for culturing a host may be used. In addition, as a culture method, arbitrary methods used for the culture|cultivation of normal microorganisms, such as a batch type, a flow-batch type, continuous culture, and a reactor type, can be used. As a medium for a transformant obtained by using a bacterium such as Escherichia coli as a host, a complete medium or a synthetic medium, for example, LB medium, M9 medium, and the like can be given. In addition, the culturing temperature can accumulate and recover the recombinant polypeptide of the present invention in cells by culturing within the above-mentioned suitable temperature range.

The carbon source is necessary for the growth of microorganisms, for example, sugars such as glucose, fructose, sucrose, maltose, galactose, starch; lower alcohols such as ethanol, propanol and butanol; polyhydric alcohols such as glycerol; organic acids such as acetic acid, citric acid, succinic acid, tartaric acid, lactic acid, and gluconic acid; Fatty acids, such as propionic acid, butanoic acid, pentanoic acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, dodecanoic acid, etc. can be used.

Examples of the nitrogen source include ammonium salts such as ammonia, ammonium chloride, ammonium sulfate and ammonium phosphate, and those derived from natural products such as peptone, meat juice, yeast extract, malt extract, casein decomposition product, and corn steep liquor. Moreover, as an inorganic substance, potassium phosphate, secondary potassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride etc. are mentioned, for example. An antibiotic such as kanamycin, ampicillin, tetracycline, chloramphenicol, or streptomycin may be added to the culture medium.

In addition, when culturing a microorganism transformed using an expression vector inducing promoters, an inducer suitable for the type of promoter may be added to the medium. For example, isopropyl-β-D-thiogalactopyranoside (IPTG), tetracycline, indole acrylic acid (IAA), etc. are mentioned as an inducer. For the acquisition and purification of the recombinant polypeptide of the present invention, centrifugal recovery of cells or supernatant from the obtained culture, cell disruption, extraction, affinity chromatography, cation or anion exchange chromatography, gel filtration, etc. alone or in an appropriate combination It can be done by doing, but is not limited thereto.

In one embodiment, the transformant of the present invention may be cultured in a conventional LB medium, and IPTG may be added to induce expression of the recombinant polypeptide of the present invention. A preferred method for expressing the recombinant polypeptide is culturing the transformant of the present invention in LB (5 g/liter yeast extract, 10 g/liter tryptone, 10 g/liter NaCl) medium, and the absorbance of the culture medium is 0.6 to 600 nm at 600 nm. At 0.8, 0.5 mM to 4 mM of IPTG may be added and cultured for 3 hours, but is not limited thereto. The recombinant polypeptide expressed by the above method is produced in the form of an inclusion body, and the recombinant polypeptide of the present invention can be isolated and purified by solubilizing the inclusion body.

In addition, the present invention provides a pharmaceutical composition for cell regeneration or anti-inflammation comprising the recombinant polypeptide of the present invention.

The pharmaceutical composition of the present invention comprises 0.001 to 10% by weight, or 0.01 to 5% by weight, or 0.01 to 3% by weight, or 0.1 to 2% by weight, or 0.5 to 10% by weight of the recombinant polypeptide of the present invention based on the total weight of the pharmaceutical composition. It may include 1.5 wt%, but is not limited thereto.

In addition to the recombinant polypeptide, the pharmaceutical composition of the present invention may further contain other components, etc. that can preferably give a synergistic effect to the effect of the recombinant polypeptide within a range that does not impair the effect of the present invention. there is. For example, it may contain conventional adjuvants such as antioxidants, stabilizers, solubilizers, vitamins, pigments and fragrances, or carriers.

The route of administration of the pharmaceutical composition includes oral, intravenous, intramuscular, intraarterial, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal, for example, topical application by application. method can be applied. The parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intralesional injection or infusion techniques.

The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level includes the subject type and severity, age, sex, type of disease, The activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of excretion, the duration of treatment, factors including concurrent drugs, and other factors well known in the medical field can be determined according to factors. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, and can be easily determined by a person skilled in the art.

The pharmaceutical composition of the present invention is not particularly limited as long as it is an individual for the purpose of cell regeneration or anti-inflammatory action, and any composition is applicable. For example, the pharmaceutical composition of the present invention can be used for not only humans, but also non-human animals such as monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cattle, sheep, pigs, goats, etc., birds and fish. Do.

The pharmaceutical composition may contain one or more active ingredients exhibiting the same or similar functions in addition to the recombinant polypeptide of the present invention. The composition may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, and syrups, external preparations, suppositories, and sterile injection solutions according to conventional methods, respectively.

Preparations for parenteral administration include powders, granules, tablets, capsules, sterilized aqueous solutions, solutions, non-aqueous solutions, suspensions, emulsions, syrups, suppositories, aerosols, etc. It can be formulated and used in the form, and preferably cream, gel, patch, spray, ointment, warning agent, lotion, liniment agent, pasta agent, or cataplasma pharmaceutical composition for external application to the skin can be prepared and used. However, the present invention is not limited thereto. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.

The pharmaceutical composition may further contain adjuvants such as preservatives, stabilizers, wetting agents or emulsification accelerators, salts and/or buffers for regulating osmotic pressure, and other therapeutically useful substances, and mixing, granulation, which is a conventional method It can be formulated according to the method of formulation or coating.

The dosage of the pharmaceutical composition may vary according to various factors including the age, weight, general health, sex, administration time, administration route, excretion rate, drug formulation, and severity of a specific disease of the individual.

In addition, the pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers. In addition, the pharmaceutical composition may be administered at a dosage within the range of 1 to 20,000 mg/kg, such as 1 to 10,000 mg/kg, 1 to 1,000 mg/kg, or 1 to 200 mg/kg, based on an adult, and the pharmaceutical composition When the red composition is for external use, it is preferable to apply it once to 5 times a day in an amount of (1.0 to 3.0 ml) based on an adult and continue it for at least 1 month, but the dosage does not limit the scope of the present invention. The pharmaceutical composition composition may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

In addition, the present invention provides a cosmetic composition for cell regeneration or anti-inflammatory comprising the recombinant polypeptide of the present invention.

The cosmetic composition of the present invention may be prepared in liquid or solid form using bases, adjuvants and additives commonly used in the cosmetic field. Cosmetics in liquid or solid form, for example, but not limited thereto, may include a form of lotion, cream, lotion, and the like.

The cosmetic composition of the present invention may include commonly used components, for example, antioxidants, preservatives, stabilizers, solubilizers, conventional adjuvants such as vitamins, pigments and fragrances, and carriers.

In addition, the cosmetic composition of the present invention may further include a wrinkle-improving cosmetic, a cosmetic for whitening, a sunscreen, a light scattering agent, and the like to add or enhance functionality, but is not limited thereto.

The cosmetic composition of the present invention may be prepared in any formulation conventionally prepared in the art, for example, a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing , oil, powder foundation, emulsion foundation, wax foundation, spray, etc., but is not limited thereto. More specifically, it may be prepared in the form of a flexible lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. can

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylene glycol oil, glycerol fatty ester, polyethylene glycol or fatty acid ester of sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals Adult cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.

When the formulation of the present invention is a surfactant-containing cleansing agent, as carrier components, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide ether sulfate, alkyl amidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester may be used.

The cosmetic composition of the present invention may be used alone or in overlapping application, or may be used in overlapping application with other cosmetic compositions other than the present invention. In addition, the cosmetic composition for cell regeneration or anti-inflammatory according to the present invention can be used according to a conventional method of use, and the number of times of use can be changed according to the skin condition or taste of the user.

Hereinafter, the present invention will be described in more detail by way of Examples.

However, the following examples are provided to illustrate preferred embodiments of the present invention, and the present invention is not limited in scope by the following specific embodiments provided for purposes of illustration only. It is apparent that functionally equivalent products, compositions and methods as disclosed herein are included within the scope of the present invention.

Example 1. Cloning of recombinant MGFP-2 gene

Analyze the amino acid sequence of MGFP-2 protein with the InterPro database (http://www.ebi.ac.uk/interpro/) and UniProt, a program that classifies protein sequences into families and predicts the existence of functionally important domains and regions. As a result, signal peptide (1-17), DOPA (18-44), EGF-like domains (45-81, 82-117, 118-154, 155-191, 192 among a total of 473 amino acids set forth in SEQ ID NO: 1) -228, 229-265, 266-301, 302-340, 342-378, 383-420, 425-461), laminin (34-82, 84-120, 121-157, 158-194, 195-231, 232-267, 268-304, 305-344, 345-380, 381-423, 424-462). Based on this, the MGFP-2 recombinant polypeptide model was composed of the following five amino acid sequences, and the recombinant MGFP-2 gene was cloned by selecting three of the five models (No. 1, 4, and 5) (see FIG. 2).

1. Amino acids 1-117 (SEQ ID NO: 2)

MLFSFFLLLT CTQLCLGTNR PDYNDDEEDD YKPPVYKPSP SKYRPVNPCL

KKPCKYNGVC KPRGGSYKCF CKGGYYGYNC NLKNACKPNQ CKNKSRCVPV

GKTFKCVCRN GNFGRLC

2. 18-117 (SEQ ID NO: 3)

TNR PDYNDDEEDD YKPPVYKPSP SKYRPVNPCL

KKPCKYNGVC KPRGGSYKCF CKGGYYGYNC NLKNACKPNQ CKNKSRCVPV

GKTFKCVCRN GNFGRLC

3. 18-154 (SEQ ID NO: 4)

TNR PDYNDDEEDD YKPPVYKPSP SKYRPVNPCL

KKPCKYNGVC KPRGGSYKCF CKGGYYGYNC NLKNACKPNQ CKNKSRCVPV

GKTFKCVCRN GNFGRLCEKN VCSPNPCKNN GKCSPLGKTG YKCTCSGGYT

GPRC

4. 18-191 (SEQ ID NO: 5)

TNR PDYNDDEEDD YKPPVYKPSP SKYRPVNPCL

KKPCKYNGVC KPRGGSYKCF CKGGYYGYNC NLKNACKPNQ CKNKSRCVPV

GKTFKCVCRN GNFGRLCEKN VCSPNPCKNN GKCSPLGKTG YKCTCSGGYT

GPRCEVHACK PNPCKNKGRC FPDGKTGYKC RCVDGYSGPT C

5. 18-44, 45-117, 18-44 (SEQ ID NO: 6)

TNR PDYNDDEEDD YKPPVYKPSP SKYRPVNPCL

KKPCKYNGVC KPRGGSYKCF CKGGYYGYNC NLKNACKPNQ CKNKSRCVPV

GKTFKCVCRN GNFGRLCTNR PDYNDDEEDD YKPPVYKPSP SKYR

Example 2. Cloning of a gene encoding a recombinant polypeptide in which a recombinant MGFP-2 polypeptide and an antibacterial peptide are combined

After synthesizing template DNA (Cosmogenetec, Korea), PCR using a forward primer (aggagatata catatg ACCAATCGGCCCGATTAC, SEQ ID NO: 7) and a reverse primer (ggtggtggtgctcgag ATGGAACTTTCTCTTGTATCCATG, SEQ ID NO: 8) After amplifying the gene of the fourth model among the three recombinant mgfp-2 genes, it was inserted into the final pET22b(+) vector (Cat. No. 69744-3, Novagen). The inserted vector is a pET22b(+) vector in which the MGFP-2/histatin gene is inserted. The pET22b(+) vector is a vector for protein expression, in which the synthesized recombinant mgfp-2 gene is inserted at the Nde I/Hind III restriction site of the pET22b(+) vector, and Hind III/ of the pET22b(+) vector The hisstatin gene is inserted at the site of the Xho I restriction enzyme (FIG. 1). The pET22b(+) vector contains a T7 promoter, and thus expression can be induced using IPTG. The recombinant polypeptide of the present invention includes the amino acid sequence of SEQ ID NO: 9, and the gene encoding it includes the nucleotide sequence of SEQ ID NO: 11.

Example 3. Preparation and culture of transformants producing recombinant polypeptides in which MGFP-2 derived polypeptides and antibacterial peptides are combined

E. coli for cloning ( E. coli ) DH5α cells and E. coli BL21 (DE3) used for protein expression were used in CaCl ₂ buffer to make competent cells, and then heat shock (left at 42 ° C. for 1 minute) method. was transformed into the pET22b(+) Mgfp2/histatin vector prepared above. Selection of transformed colonies was performed using ampicillin (ampcillin, Gold bio) to obtain E. coli Dh5α pET22b(+) MGFP-2/histatin and E. coli BL21(DE3) mgfp2/histatin transformants.

Example 4: Production of Recombinant Polypeptide Conjugated with MGFP-2 Derived Polypeptide and Antibacterial Peptide

(1) Expression of a recombinant polypeptide in which a polypeptide derived from MGFP-2 and an antibacterial peptide are bound from E. coli BL21/pET22b(+)

E. coli BL21/pET22b(+) was cultured in LB (5 g/liter yeast extract, 10 g/liter tryptone, 10 g/liter NaCl) medium, and IPTG was added when the absorbance of the culture solution reached about 0.7 at 600 nm. Thus, the expression of the antimicrobial recombinant polypeptide in which the recombinant MGFP-2 polypeptide and the antibacterial peptide were combined was induced. At this time, 10 ml of LB medium was put into a 50 ml sterilized tube (500 μg of ampicillin was added), and the culture solution grown for 12 hours was inoculated into a 500 ml flask containing 100 ml of LB medium.

(2) Measurement of expression patterns of recombinant polypeptides in which MGFP-2 derived polypeptides and antibacterial peptides are bound

In order to analyze the expression of the recombinant polypeptide to which the MGFP-2 derived polypeptide and the antibacterial peptide were combined, the culture medium was collected over time after the addition of IPTG, and then SDS-PAGE was performed thereon.

To this end, 1 ml of a sample obtained from the culture medium every hour was centrifuged at 4°C and 10,000 rpm for 10 minutes, and then the whole cell sample from which the supernatant was removed was stored at -80°C and used for analysis. Whole cell samples were diluted in 100 μl of buffer for SDS-PAGE (0.5 M TrisHCl, pH 6.8, 10% glycerol, 5% SDS, 5% β-mercaptoethanol, 0.25% bromophenol blue), and 5 at 100 ° C. Boiled for minutes and denatured. In the case of SDS-PAGE, the sample was electrophoresed on a 12% SDS-polyacrylamide gel, and protein bands were detected using Coomasie blue staining.

Figure 4 is an electrophoresis picture showing the expression pattern over time after inducing the expression of the recombinant polypeptide to which the MGFP-2 derived polypeptide and the antibacterial peptide are combined. The recombinant polypeptide to which the MGFP-2 derived polypeptide and the antibacterial peptide were combined was expressed as a dark band with a size of about 23 kDa compared to other proteins in E. coli. Recombinant polypeptide to which MGFP-2-derived polypeptide and antibacterial peptide were combined increased expression after induction of expression, showed a maximum at about 3 hours, and then was degraded by proteolytic enzyme and decreased after about 6 hours. became

(3) Analysis of expression patterns of recombinant polypeptides in which MGFP-2 derived polypeptides and antibacterial peptides are bound

In order to confirm the expression form of the recombinant polypeptide to which the MGFP-2-derived polypeptide and the antibacterial peptide are bound, the cells of the whole cell sample were lysed (using the ultrasonic method) and then divided into a cell lysate and a supernatant, respectively, and SDS-PAGE was performed.

As a result of SDS-PAGE of the cell supernatant and cell lysate isolated from the E. coli BL21/pET22b culture, only one of the three models of the recombinant polypeptide in which the MGFP-2 derived polypeptide and the antibacterial peptide were combined was expressed, and the rest were expressed. It didn't happen. In the case of the expressed model No. 4, the band of the recombinant polypeptide bound to the MGFP-2 derived polypeptide and the antibacterial peptide was strongly detected in the cell lysate, whereas only a very insignificant amount was detected in the cell supernatant. It was found that the peptide-conjugated recombinant polypeptide was expressed as an insoluble inclusion body in E. coli.

Example 5. Isolation and Purification of Recombinant Polypeptide Conjugated with MGFP-2 Derived Polypeptide and Antibacterial Peptide

In order to isolate and purify the recombinant polypeptide bound to the MGFP-2 derived polypeptide and the antibacterial peptide expressed in an insoluble form in E. coli BL21/pET22b, the inclusion body was dissolved.

To this end, after culturing E. coli BL21/pET22b in the same manner as in Example 3, expression of a recombinant polypeptide in which an MGFP-2 derived polypeptide and an antibacterial peptide were combined was induced, and the cultured E. coli cells were centrifuged, followed by disruption buffer (50 mM Tris-HCl, 300 mM NaCl, pH8.0) and concentrated about 50 times, after which 1 mg/ml lysozyme (lysozyme, Bio Basic Inc., Canada) was added, and 20 minutes at 4°C reacted.

Then, using a sonicator, crushed for 2 seconds on ice at 200 W, and the process of cooling for 2 seconds was repeated 30 times to complete cell disruption. In order to increase the yield of inclusion bodies, since the pI value of the MGFP-2 polypeptide is 9.4, NaOH corresponding thereto was added to insolubilize the recombinant polypeptide to which the MGFP-2 derived polypeptide and the antibacterial peptide were combined in the supernatant for 5 minutes. Thereafter, the sample was centrifuged at 14,000 rpm for about 2 to 30 minutes to remove the cell supernatant, and only the inclusion body was separated and used as a sample for separation and purification.

In order to isolate and purify the inclusion body, an extraction solution was prepared so as to have a volume 2 to 4 times the weight of the inclusion body. 25% acetic acid, 15% n-propyl alcohol were added, and the remainder was filled with 60% distilled water. After stirring for about 30 minutes to dissolve the inclusion body, centrifugation at 14,000 rpm for about 2 to 30 minutes to remove the undissolved inclusion body, and the cell supernatant was used as a sample for the acetone precipitation method.

The acetone precipitation method is a method of removing impurities other than proteins. First, acetone in 2-3 times the volume of the supernatant is added, and then stirred for about 30 minutes to aggregate the recombinant polypeptide to which the MGFP-2 derived polypeptide and the antibacterial peptide are bound. . Thereafter, the supernatant was removed by centrifugation at 14,000 rpm for about 2 to 30 minutes, the pellet was dissolved in distilled water, the pH was adjusted to a weak acid state to dissolve the MGFP-2 mutant, and the undissolved protein was removed to remove the MGFP A recombinant polypeptide in which the -2 derived polypeptide and an antibacterial peptide were combined was obtained.

Example 6. Amino acid sequence analysis of MGFP-2 derived polypeptide and recombinant polypeptide bound to antibacterial peptide

The amino acid sequence of the recombinant polypeptide in which the MGFP-2 derived polypeptide and the antibacterial peptide were combined was analyzed using an amino acid analyzer (Hewlette Packard, USA). To this end, the recombinant polypeptide to which the MGFP-2-derived polypeptide and the antibacterial peptide are combined was treated with hydrochloric acid (HCl) and high temperature to obtain a sample decomposed into each amino acid. After obtaining the residual time and quantification standard of each amino acid from the spectrum of the reference amino acid mixture, the amino acid sequence was obtained through the spectrum of amino acids sequentially separated from the end of the recombinant polypeptide to which the MGFP-2 derived polypeptide and the antibacterial peptide were bound. analyzed. The analysis results are shown in Table 1 below.

Predicted and experimental composition of amino acids (±30%)

아미노산amino acid	예측 조성(개)Prediction composition (pcs)	실험 조성(%)Experimental composition (%)
Ala (A)Ala (A)	33	1.6%1.6%
Arg (R)Arg (R)	1111	5.9%5.9%
Asn (N)Asn (N)	1717	9.0%9.0%
Asp (D)Asp (D)	77	3.7%3.7%
Cys (C)Cys (C)	2424	12.8%12.8%
Gln (Q)Gln (Q)	1One	0.5%0.5%
Glu (E)Glu (E)	44	2.1%2.1%
Gly (G)Gly (G)	2121	11.2%11.2%
His (H)His (H)	44	2.1%2.1%
Ile (I)Ile (I)	00	0.0%0.0%
Leu (L)Leu (L)	55	2.7%2.7%
Lys (K)Lys (K)	2929	15.4%15.4%
Met (M)Met (M)	00	0.0%0.0%
Phe (F)Phe (F)	55	2.7%2.7%
Pro (P)Pro (P)	1919	10.1%10.1%
Ser (S)Ser (S)	88	4.3%4.3%
Thr (T)Thr (T)	77	3.7%3.7%
Trp (W)Trp (W)	00	0.0%0.0%
Tyr (Y)Tyr (Y)	1414	7.4%7.4%
Val (V)Val (V)	99	4.8%4.8%
Pyl (O)Pyl (O)	00	0.0%0.0%
Sec (U)Sec (U)	00	0.0%0.0%

In general, in the case of amino acid composition analysis, it is known that an error of about 30% occurs due to the loss of amino acids during proteolysis. The results were almost identical to the composition and ratio of amino acid residues calculated by encoding from the nucleotide sequence of the recombinant polypeptide gene to which the peptide was bound. From this, it was confirmed that the protein expressed and isolated from E. coli BL21/pET22b was a recombinant polypeptide in which an MGFP-2 derived polypeptide and an antibacterial peptide were combined.

Example 7. Measurement of cell regeneration ability of recombinant polypeptide conjugated with MGFP-2 derived polypeptide and antibacterial peptide

In order to measure the cell regeneration ability of the recombinant polypeptide to which the MGFP-2 derived polypeptide of the present invention and the antibacterial peptide are combined, the cell regeneration ability of keratinocytes was evaluated.

For this purpose, the cells used in the experiment were the human keratinocyte cell line, HaCaT cell line (ATCC), and as a growth medium for the HaCaT cell line, 10% fetal bovine serum (FBS), Gibco) and 1% penicillin/ DMEM medium (Dulbecco's modified Eagle's medium, Gibco) with streptomycin (penicillin/streptomycin) added was used, and all cell lines were cultured at 37° C. in a 5% CO ₂ incubator. In order to evaluate the HaCaT cell regenerative ability of the recombinant polypeptide conjugated with the MGFP-2 derived polypeptide and the antibacterial peptide, 10 to 0.002 mg/m ㎖ was coated, the portion coated with the recombinant polypeptide to which the MGFP-2 derived polypeptide and the antibacterial peptide were bound was defined as the sample, and the uncoated portion was defined as the control. After dispensing HaCaT cells in an amount of 2×10 ⁴ cells per well in the sample and control portion of the 6-well plate for cell culture, the cells were cultured for 72 hours to compare cell regeneration ability. At this time, the cell viability of the HaCaT cell line was measured using a trypan blue exclusion assay.

As a result, it was confirmed that cell regeneration capacity increased by about 150% in the sample coated with the recombinant polypeptide in which the MGFP-2 derived polypeptide of the present invention and the antibacterial peptide were combined compared to the control after 72 hours of culture.

Example 8. Measurement of antibacterial activity of recombinant polypeptides in which MGFP-2 derived polypeptides and antibacterial peptides are bound

First, a recombinant polypeptide to which an MGFP-2 derived polypeptide and an antibacterial peptide were bound was prepared for each concentration. The concentration for the antibacterial activity test was prepared using a phosphate buffered saline (PBS) buffer solution at 10-0.002 mg/ml. As the antibacterial activity test strain, representative gram-negative bacteria, E. coli and representative gram-positive bacteria ( S. aureus ) were used, and each test bacteria was cultured with shaking in LB medium at 37° C. and 150 rpm until absorbance of 1.0. After diluting the test culture solution with PBS to 10 ⁴ CFU/ml at absorbance 1.0, and mixing the recombinant polypeptide to which the MGFP-2 derived polypeptide and the antibacterial peptide are prepared in a 9:1 ratio in a sterilized tube, Incubated for 1 hour at 37 °C in a constant temperature and humidifier. After 1 hour, 100 μl of the test bacterial solution was aliquoted from each tube, spread on an agar medium, and then cultured under the same conditions for 24 hours.

As a result, the recombinant polypeptide to which the MGFP-2 derived polypeptide of the present invention and the antibacterial peptide are combined has an antibacterial effect of 99.9% in both the representative gram-negative bacteria E. coli and the representative gram-positive bacteria ( S. aureus ) as compared to the control group. It was shown to have a (FIG. 7).

This study is supported by the technology development project [S2766512] of the Ministry of SMEs and Startups of the Republic of Korea and the innovation field startup package [B0080827000433].

Claims

A recombinant polypeptide in which a functional peptide is fused to an EGF-like polypeptide derived from mussel adhesion protein.
The method according to claim 1,

The mussel is a recombinant polypeptide selected from the group consisting of Mytilus edulis, Mytilus galloprovincialis, and Mytilus coruscus.
The method according to claim 1,

The functional peptide is a recombinant polypeptide derived from the group consisting of an extracellular matrix protein, a growth factor, and an antibacterial peptide.
4. The method according to claim 3,

The extracellular matrix protein is a recombinant polypeptide selected from the group consisting of collagen, fibronectin, laminin, and vitronectin.
4. The method according to claim 3,

The growth factor is a recombinant polypeptide selected from the group consisting of epidermal growth factor (EGF), fibroblast growth factor (FGF), and vascular endothelial growth factor (VEGF).
4. The method according to claim 3,

The antimicrobial peptide is KLWKKWAKKWLKLWKA (SEQ ID NO: 12), AKRHHGYKRKFH (SEQ ID NO: 13), ILRWPWWPWRRK (SEQ ID NO: 14), KLAKLALAF (SEQ ID NO: 15), KLLLKLLKKLLKLLKKK (SEQ ID NO: 16), THRPPMWSKKK (SEQ ID NO: 17), THRPPMWSKWP (SEQ ID NO: 17), SEQ ID NO: 17 18), a recombinant polypeptide selected from the group consisting of ILPWKWPWWPWRR (SEQ ID NO: 19), RRWWCRC (SEQ ID NO: 20), and KLAKLAKKLAKLAK (SEQ ID NO: 21).
The method according to claim 1,

wherein the functional peptide is fused to the C-terminus, the N-terminus, or both termini of the mussel adhesive protein.
The method according to claim 1,

The mussel adhesion protein is a recombinant polypeptide selected from the group consisting of FP-1, FP-2, FP-3, FP-4, FP-5, FP-6, and fragments thereof.
9. The method of claim 8,

wherein the mussel adhesion protein is FP-2 or a fragment of FP-2.
10. The method of claim 9,

The fragment of FP-2 is a recombinant polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 6.
11. The method of claim 10,

The fragment of FP-2 is a recombinant polypeptide having the amino acid sequence of SEQ ID NO: 5.
The method according to claim 1,

A recombinant polypeptide having the amino acid sequence of SEQ ID NO: 9.
13. A gene encoding the recombinant polypeptide of any one of claims 1 to 12.
14. The method of claim 13,

The gene is a gene having the nucleotide sequence of SEQ ID NO: 11.
A vector comprising the gene of claim 13 .
A transformant obtained by transforming the vector of claim 15 into a host cell.
17. The method of claim 16,

The transformant wherein the host cell is a prokaryotic cell or a eukaryotic cell.
18. The method of claim 17,

The transformant wherein the host cell is an E. coli cell.
(a) preparing a vector comprising a gene encoding the recombinant polypeptide of any one of claims 1 to 12;

(b) preparing a transformant transformed with the vector into a host cell; and

(c) culturing the transformant; method for producing a recombinant polypeptide comprising a.
20. The method of claim 19,

(d) a method for producing a recombinant polypeptide further comprising the step of isolating and purifying the recombinant polypeptide.
13. A pharmaceutical composition for regeneration or anti-inflammatory cells comprising the recombinant polypeptide of any one of claims 1 to 12.
A cosmetic composition for cell regeneration or anti-inflammatory use comprising the recombinant polypeptide of any one of claims 1 to 12.