WO2022056378A1 - Method for treating cancer with kidney protection - Google Patents
Method for treating cancer with kidney protection Download PDFInfo
- Publication number
- WO2022056378A1 WO2022056378A1 PCT/US2021/050064 US2021050064W WO2022056378A1 WO 2022056378 A1 WO2022056378 A1 WO 2022056378A1 US 2021050064 W US2021050064 W US 2021050064W WO 2022056378 A1 WO2022056378 A1 WO 2022056378A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- iron
- content
- protoporphyrin
- hepcidin
- amount
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
- A61K31/409—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil having four such rings, e.g. porphine derivatives, bilirubin, biliverdine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/555—Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/66—Phosphorus compounds
- A61K31/675—Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/24—Heavy metals; Compounds thereof
- A61K33/243—Platinum; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/24—Heavy metals; Compounds thereof
- A61K33/26—Iron; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/21—Interferons [IFN]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/06—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations
- A61K49/08—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by the carrier
- A61K49/10—Organic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/06—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations
- A61K49/08—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by the carrier
- A61K49/10—Organic compounds
- A61K49/101—Organic compounds the carrier being a complex-forming compound able to form MRI-active complexes with paramagnetic metals
- A61K49/106—Organic compounds the carrier being a complex-forming compound able to form MRI-active complexes with paramagnetic metals the complex-forming compound being cyclic, e.g. DOTA
- A61K49/108—Organic compounds the carrier being a complex-forming compound able to form MRI-active complexes with paramagnetic metals the complex-forming compound being cyclic, e.g. DOTA the metal complex being Gd-DOTA
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
Definitions
- Cisplatin is a commonly used chemotherapy agent since the discovery of its anti-cancer activity more than 50 years ago.
- cis-diammine dichloroplatinum II cisplatin
- cisplatin is being widely used clinically as an anticancer agent for testicular cancer, ovarian cancer, head and neck cancer, bladder cancer, and non-small-cell lung cancer.
- cisplatin cis-diammine dichloroplatinum II
- use of cisplatin has been limited.
- Kidney protection has previously been confirmed through administration of FeS and SnPP. See U.S. Pat. No. 9,844,563 to Zager et al.
- the ability to effectively protect against renal damage during chemotherapy requires selective protection whereby a protective agent does not undermine the efficacy of the chemotherapy agent on tumor cells. Additional work is needed to develop effective protective agents for use during chemotherapy.
- Fig. 1 shows that RBT-3 (360 mg) induces rapid and marked increases in plasma hepcidin levels in human subjects.
- Fig. 2 shows that RBT-3 (240 mg) induces rapid and marked increases in plasma hepcidin levels.
- Fig. 3 shows that RBT-3 (120 mg) induces plasma hepcidin increases in both healthy volunteers (HV) and CKD subjects.
- Fig. 4 shows that increases in plasma hepcidin levels over baseline values.
- Fig. 5 shows that the Nrf2 pathway is activated by RBT-3 injection in CD-I mice.
- Fig. 6A - Fig. 6B show that RBT-3 induces prominent increases in heme oxygenase 1 (HO- 1) expression in mouse proximal tubules, as assessed by immunohistochemistry.
- the present invention relates to the use of renal protective agents that selectively protect the kidney and/or liver relative to cancer cells, and methods of treating cancer using a chemotherapy agent, or screening for cancer using a radiocontrast agent using such renal protective agents.
- the renal protective agent is an iron composition such as iron sucrose (FeS).
- the renal protective agent is a protoporphyrin (e.g., tin protoporphyrin, SnPP).
- the invention involves administering a combination of iron composition and protoporphyrin during cancer chemotherapy or radiocontrast imaging. For example, administering iron sucrose and tin protoporphyrin along with a chemotherapy agent.
- the present invention utilizes iron compositions such as iron sucrose such as RBT-3 is described in U.S. Pat. App. No. 16/805,223, entitled “NOVEL IRON COMPOSITIONS AND METHODS OF MAKING AND USING THE SAME" filed February 20, 2020, and claiming priority to U.S. provisional application 62/812,028 filed February 20, 2019, the disclosure of which is incorporated herein in its entirety.
- the protoporphyrin includes metal porphyrins, such as tin protoporphyrin (SnPP).
- SnPP tin protoporphyrin
- a number of synthetic analogs of iron protoporphyrin IX are known. These compounds are commercially available and/or can be readily synthesized by known methods.
- Me-protoporphyrin or MePP
- Me stands for metal, and specifically by utilizing the chemical symbol for the metal such as Cr-protoporphyrin (CrPP), Sn- protoporphyrin (SnPP), Zn-protoporphyrin (ZnPP) for the chromium, tin, and zinc protoporphyrin compounds respectively.
- Chemotherapy agents that can be used in connection with the present invention include compounds within the class of platinum analogs, including cisplatin, as well as carboplatin, eloxatin, or oxaliplatin.
- Hepcidin is a well-recognized iron regulatory protein that is produced predominantly in hepatocytes in response to macrophage iron levels and pro-inflammatory states.
- Coffey R Ganz T. Iron homeostasis: An anthropocentric perspective. J Biol Chem. 2017;292:12727-12734. While it was initially considered to have antimicrobial properties Michels K, Nemeth E, Ganz T, Mehrad B. Hepcidin and host defense against infectious diseases, PLoS Pathog. 2015;ll(8):el004998, in recent years it has been demonstrated to have acute kidney protective effects. Van Swelm RP, Wetzels J F, Verweij VG, et al.
- hepcidin deficient mice are highly susceptible to ischemic renal damage (6).
- the mechanism by which hepcidin exerts its protective actions remains speculative.
- most interest has focused on the following potential pathway (6,7): i) due to its small size (25 kDa), hepcidin undergoes rapid glomerular filtration, followed by proximal tubule endocytic uptake; ii) hepcidin binds to the iron exporter, ferroportin, causing its cellular redistribution and subsequent proteolytic destruction; iii) ferroportin loss may increase intracellular catalytic iron levels; and iv) a rise in cytosolic iron can stimulate the synthesis of ferritin which confers its well-known cytoprotective/antioxidant effects.
- synergistic interactions between the hepcidin and the cytoprotective Nrf2 pathways may exist (10-13).; Lim PJ, Duarte TL, Arezes J, et al. Nrf2 controls iron homeostasis in haemochromatosis and thalassaemia via Bmp6 and hepcidin. Nat Metab. 2019;1:519-531; Bayele HK, Balesaria S, Srai SK. Phytoestrogens modulate hepcidin expression by Nrf2: Implications for dietary control of iron absorption. Free Radic Biol Med. 2015;89:1192-1202; Tanaka Y, Ikeda T, Yamamoto K, Ogawa H, Kamisako T.
- Nrf 2-nul I mice Dysregulated expression of fatty acid oxidation enzymes and iron-regulatory genes in livers of Nrf 2-nul I mice. J Gastroenterol Hepatol. 2012;27:1711-1717; Harada N, Kanayama M, Maruyama A, et al. Nrf2 regulates ferroportin 1-mediated iron efflux and counteracts lipopolysaccharide-induced ferroportin 1 mRNA suppression in macrophages. Arch Biochem Biophys. 2011;508:101-109.
- RBT-3 novel IV iron sucrose formulation
- the iron composition is preferably an iron sucrose composition.
- the iron sucrose composition is preferably an iron sucrose composition comprising bicarbonate. In one example, the iron sucrose composition is RBT-3.
- the iron composition may have one or more of the following characteristics, including an Fe2+/Fe3+ ratio of approximately 1-10%, 2-5%, 3-4% or about 3.4%, a total iron content of 5-19 mg/ml, 8-18 mg/ml, 10-15 mg/ml, or about 12 mg/ml, and organic carbon content of 4-11%, 6- 9% or about 7.7%, an osmolality of 1100-1600 mOsM/Kg, 1400-1580 mOsm/Kg, or about 1540 mOsm/Kg and iron core size of about l-3nm, 2-2.8 nm, or about 2.39 nm, a Na content of between 0.8%-3%, l%-2%, or about 1.26%, and an average molecular weight of 10,000-30,000 daltons, 20,000 - 25,000 daltons, or about 23,881 daltons.
- an Fe2+/Fe3+ ratio of approximately 1-10%, 2-5%, 3-4% or about 3.4%
- Hepicidin is a key regulator of systemic and intracellular iron homeostasis, and has recently been noted to possess renal tubular cytoprotective effects. As previously discussed, following recombinant hepcidin administration, renal filtration, proximal tubular uptake, and subsequent degradation of ferroportin result. Since ferroportin is the only known cellular exporter of iron, its degradation is believed to increase proximal tubular iron content which then stimulates ferritin production. Given that ferritin is a potent anti-oxidant, it may be a key arbiter of hepcidin's cytoprotective effects.
- FeS driven ferritin increases that FeS might stimulate hepatic hepcidin synthesis which then evokes renal ferritin production by the above noted pathway.
- FeS can evoke rapid and sustained hepcidin production (i.e., within a 24 hr period), such as would be required for it to contribute to our previously noted FeS- induced preconditioning state.
- RBT-3 novel FeS
- Hepatic hepicidin production in response to iron loading is thought to exclusively result from increased gene transcription, initiated by holotransferrin binding to its hepatic receptors (Tfrl, Trf2). Subsequent BMP-SMAD pathway activation then up-regulates HAMP1 gene transcription. To confirm that this pathway was activated by RBT-3 injection, we measured HAMP1 mRNA in both mouse liver and kidney at 24 hrs post RBT-3 administration. Surprisingly, whereas marked HAMP1 mRNA increases were observed in both organs, a 10 fold greater response was observed in kidney. To our knowledge, preferential renal vs hepatic HAMP1 induction in response to Fe has not previously been reported.
- RBT-3 could be administered ⁇ 18-24 hrs prior to cisplatin infusion, thereby allowing the necessary time for the full development of an FeS- mediated cytoresistant state.
- RBT-3 was administered to mice 18 hrs prior to cisplatin injection, marked renal protection was observed, as evidenced by steep reductions in BUN, plasma creatinine, and plasma NAG concentrations (Table 3).
- a fourth, and completely unexpected, protective action evoked by RBT-3 preconditioning was a dramatic suppression in renal cisplatin uptake. Because cisplatin nephrotoxicity is highly dependent on proximal tubule cell uptake, the observed 40% reduction in renal cortical cisplatin levels must have played a dominant role in RBT-3's protective action. Proximal tubule cell cisplatin uptake is mediated via organic cation transporters (e.g. OCT2, MATE1), located in the basolateral membrane.
- OCT2, MATE1 organic cation transporters
- CLINICAL STUDY [0030]
- HVs healthy volunteers
- 9 patients with stage 3-4 CKD (15-59 ml/min/1.73 m2) were recruited for this investigation.
- the subjects that formed the basis for the current study were also the foundation of a previous study which evaluated differential effects of FeS on heavy and light chain ferritin expression (8).
- the study received IRB approval from Advarra IRB, Columbia, MD, and informed consent was obtained from each subject.
- the HV and CKD groups were each divided into 3 equal cohorts (n, 3 each), with each cohort receiving either 120, 240, or 360 mg of RBT-3 (12 mg/ml stock solution).
- the RBT-3 dose (10, 20, or 30 ml of stock solution) was infused IV with 100 ml of saline over 2 hr.
- the subjects remained overnight at the study site (Riverside Clinical Research, Edgewater, FL) to screen for potential adverse events.
- Timed heparinized plasma samples were collected at baseline (0) and at 4, 12, 24, and 72 hrs. 'Spot' urine samples were obtained at baseline and 24 hrs following RBT-3 infusion.
- mice were used for all animal studies which were approved by the institution's IACUC. Mice were injected via the tail vein with either 1 mg of RBT-3 or vehicle (n, 5 each). Eighteen hrs later, they were deeply anesthetized with pentobarbital (40-50 mg/Kg), the abdominal cavities were opened, a blood sample was obtained from the vena cava, and then the kidneys and livers were quickly resected, iced, and total RNA and protein were extracted (14).
- pentobarbital 40-50 mg/Kg
- Renal cortical and hepatic hepcidin (HAMP1) mRNA levels were measured by competitive RT-PCR using the following primer pair: left: cagcagaacagaaggcatga; right: agatgcagatggggaagttg.
- the mRNA values were factored by simultaneously determined GAPDH product (14).
- Plasma, hepatic, and renal cortical hepcidin levels were also determined by ELISA (14).
- Nrf2 effects on mouse kidney Nrf2 expression.
- 5 control and 5 RBT-3 treated mice had kidney samples collected 4 hrs following injections.
- Total mRNA was extracted and assayed for 4 Nrf2 activated genes: 1) heme oxygenase 1 (HO-1); 2) NAD(P)H quinone dehydrogenase 1 (NQ.O1); 3) sulfiredoxin-1 (SRXN1); and 4) glutamate-cysteine-ligase-catalytic subunit (GCLC) by RT-PCR, as previously described (15).
- Nrf2 nuclear translocation was assessed by extracting nuclear protein and assaying for Nrf2 by ELISA, as previously performed by this laboratory (15).
- the slides were then dewaxed and stained on a Leica BOND Rx Stainer (Leica, Buffalo Grove, IL) using Leica Bond reagents for dewaxing (Dewax Solution), antigen retrieval (Epitope Retrieval Solution 2), and rinsing after each step (Bond Wash Solution).
- Antigen retrieval was performed for 20 minutes at 100°C with all other steps at ambient temperature. Endogenous peroxidase was blocked with 3% H2O2 for 5 minutes followed by protein blocking with TCT buffer (0.05M Tris, 0.15M NaCI, 0.25% Casein, 0.1% Tween 20, 0.05% ProClinSOO pH 7.6) for 10 minutes.
- HO-1 Abeam abl89491
- the primary antibody, HO-1 was applied for 60 minutes followed by the Leica anti-rabbit HRP polymer for 10 minutes and the application of the tertiary TSA- amplification reagent (PerkinElmer OPAL 650 at 1:100) for 10 minutes.
- Slides were removed from the stainer and stained with DAPI for 5 minutes, rinsed, and cover slipped with Prolong Gold Antifade reagent (Invitrogen/Life Technologies, Grand Island, NY).
- NAG N-acetyl glucosamidase
- Table 1 Overview of healthy subjects and subjects with Stage 3-4 CKD (from Ref. 8).
- the CKD subjects were significantly older than the HVs, and there were fewer CKD males compared to the HV group.
- Mean eGFR for the CKD group was 38 ⁇ 8 ml/min/1.73 m 2 ( ⁇ half that of the HV group which was >70 ml/min.1.73 m 2 ).
- the lower eGFRs for the CKD subjects were manifested by elevated baseline and plasma creatinine concentrations, vs. those seen in the HVs.
- Baseline mouse hepatic HAMP1 mRNA expression (Table 2) was approximately 25x greater than that observed in renal cortex, consistent with the liver being the dominant site of hepcidin production (1). While both liver and kidney each responded to RBT-3 injection with HAMP1 mRNA increases, the degree of the HAMP1 mRNA increase was dramatically greater in kidney vs. the liver (by a factor of lOx). However, baseline and post RBT-3 hepcidin protein levels were comparable for the two organs ( ⁇ 5x elevations over baseline values; see Table 2). These increases corresponded with an approximate 3 fold RBT-3 induced increase in plasma hepcidin levels (Table 2).
- Table 2 Hepcidin expression in mouse liver, kidney, and plasma under control conditions and 18 hrs following RBT-3 administration.
- the HAMP1 mRNAs are factored by GAPDH.
- the values are means ⁇ 1 SEM.
- P values were derived by unpaired Student's test.
- HO-1 immunofluorescence Focal proximal tubule HO-1 staining was observed in control kidney tissue (Fig. 6). The extent and intensity of HO-1 staining was greatly increased 18 hrs following RBT-3 injection. The increase appeared to be largely confined to proximal tubule cells, which manifested intense cytoplasmic staining. No apparent increase in glomerular or medullary HO-1 staining was observed in response to RBT-3 injection.
- RBT-3 effects on cisplatin nephrotoxicity By 3 days post cisplatin injection, severe renal injury was apparent in control mice, as denoted by marked BUN and plasma creatinine elevations (Table 3). RBT-3 preconditioning caused an approximate 50% reduction in cisplatin- induced injury, as assessed by BUN and creatinine levels. That this protection reflected decreased proximal tubule injury was denoted by an almost complete blockade of NAG release into the systemic circulation (Table 3). Of interest, the RBT-3 mediated protection was associated with (and likely due, at least in part) to a 40% reduction in renal cortical cisplatin concentrations (Table 3).
- HV healthy volunteers
- CKD chronic kidney disease
- FIG. 1 Figure 2.
- RBT-3 (240 mg) induces rapid and marked increases in plasma hepcidin levels. As was the case with the 360 mg dose, hepcidin increases were observed at 4 hrs and peaked at the 24 hr time point. No significant differences were observed between the CKD and healthy volunteer (HV) groups. The 95% confidence intervals ( ⁇ ) for the healthy volunteers (HV) and CKD groups are given in the table at the bottom of the figure. P value derived from ANOVA for repeated measures.
- FIG. 3 RBT-3 (120 mg) induces plasma hepcidin increases in both healthy volunteers (HV) and CKD subjects.
- HV healthy volunteers
- CKD subjects had higher plasma hepcidin levels throughout the 72 hr period, compared to the HVs. This presumably reflects the higher baseline (starting) hepcidin levels in the CKD group (see text). This was true throughout the 360 mg, 240 mg and the 120 mg RBT-3 treatment groups (see text and right hand panel of figure 4).
- Figure 4 Increases in plasma hepcidin levels over baseline values. Because baseline plasma hepcidin levels were elevated in the CKD cohort, compared to healthy volunteers (HVs; , see right hand panel), the RBT-3- induced increases over these baseline values were calculated (24 hr peak values - baseline values). This allowed comparison between the CKD and healthy volunteer hepcidin responses. As is apparent, the HVs and CKD groups manifested highly comparable hepcidin increases with each iron dose. Values are means ⁇ 95% confidence intervals. The 240 mg and 360 mg RBT-3 dose induced comparable hepcidin increases, both of which were greater than those observed in the 120 mg RBT-3 dose groups.
- Nrf2 pathway is activated by RBT-3 injection in CD-I mice. At 4 hrs following RBT-3 injection into mice, significant increases in each of the 4 tested Nrf2 responsive gene mRNAs were observed (compared to simultaneously studied control mice). Further evidence of Nrf2 pathway activation was the finding of increased nuclear Nrf2 protein binding in nuclear protein extracts. Heme oxygenase 1 (HO-1); NAD(P)H quinone dehydrogenase 1 (NQO1); sulfiredoxin-1 (SRXN1); and glutamate-cysteine-ligase-catalytic subunit (GCLC).
- HO-1 Heme oxygenase 1
- NQO1 NAD(P)H quinone dehydrogenase 1
- SRXN1 sulfiredoxin-1
- GCLC glutamate-cysteine-ligase-catalytic subunit
- FIG. 6 RBT-3 induces prominent increases in heme oxygenase 1 (HO-1) expression in mouse proximal tubules, as assessed by immunohistochemistry.
- the control kidney shown in the left hand panel, demonstrates variable cytoplasmic staining of proximal tubule segments.
- the kidney harvested 18 hrs post FeS injection showed a prominent, near confluent proximal tubule HO-1 increase.
- no increased HO-1 staining was apparent in glomeruli, depicted by the asterisks.
- SnPP (1 umole) or vehicle (V) was given on day zero, 15 mg/kg of cisplatin was given on day 1, and BUN, creatinine, renal cortical LDH, and the mRNAs for NGAL , MCP-1, IL-6, HO-1 , and p21 were measured 3 days post cisplatin injection. SnPP conferred statistically significant protection in all cisplatin treated mice, compared to cisplatin alone P ⁇ 0.01).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Inorganic Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- General Chemical & Material Sciences (AREA)
- Radiology & Medical Imaging (AREA)
- Organic Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Urology & Nephrology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Endocrinology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2023002929A MX2023002929A (es) | 2020-09-11 | 2021-09-13 | Método para tratamiento del cáncer con protección renal. |
| KR1020237011800A KR20230112608A (ko) | 2020-09-11 | 2021-09-13 | 신장 보호와 함께 암을 치료하는 방법 |
| BR112023004583-5A BR112023004583B1 (pt) | 2020-09-11 | 2021-09-13 | Uso de uma composição farmacêutica com uma quantidade de composição de sacarose de ferro para proteger o rim durante a quimioterapia do câncer e durante imageamento de radiocontraste |
| CN202180070528.4A CN116348107A (zh) | 2020-09-11 | 2021-09-13 | 通过肾脏保护来治疗癌症的方法 |
| EP21867758.1A EP4210691A4 (en) | 2020-09-11 | 2021-09-13 | METHODS OF TREATING CANCER WITH KIDNEY PROTECTION |
| IL301305A IL301305A (en) | 2020-09-11 | 2021-09-13 | Method for treating cancer with kidney protection |
| AU2021342291A AU2021342291A1 (en) | 2020-09-11 | 2021-09-13 | Method for treating cancer with kidney protection |
| CA3192411A CA3192411A1 (en) | 2020-09-11 | 2021-09-13 | Method for treating cancer with kidney protection |
| JP2023516137A JP2023541606A (ja) | 2020-09-11 | 2021-09-13 | 腎臓を保護しながらがんを治療するための方法 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202062706829P | 2020-09-11 | 2020-09-11 | |
| US62/706,829 | 2020-09-11 | ||
| US202163158803P | 2021-03-09 | 2021-03-09 | |
| US63/158,803 | 2021-03-09 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022056378A1 true WO2022056378A1 (en) | 2022-03-17 |
Family
ID=80626052
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/050064 Ceased WO2022056378A1 (en) | 2020-09-11 | 2021-09-13 | Method for treating cancer with kidney protection |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20220079984A1 (https=) |
| EP (1) | EP4210691A4 (https=) |
| JP (1) | JP2023541606A (https=) |
| KR (1) | KR20230112608A (https=) |
| CN (1) | CN116348107A (https=) |
| AU (1) | AU2021342291A1 (https=) |
| CA (1) | CA3192411A1 (https=) |
| IL (1) | IL301305A (https=) |
| MX (1) | MX2023002929A (https=) |
| WO (1) | WO2022056378A1 (https=) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN118103047A (zh) | 2021-08-27 | 2024-05-28 | 美国瑞根特有限公司 | 铁组合物及其制备和使用方法 |
| JPWO2024253189A1 (https=) * | 2023-06-09 | 2024-12-12 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090221514A1 (en) * | 2008-02-26 | 2009-09-03 | Szeto Hazel H | Methods for prevention and treatment of acute renal injury |
| WO2017100700A2 (en) * | 2015-12-11 | 2017-06-15 | Fred Hutchinson Cancer Research Center | Peptides for renal therapy |
| US20190091255A1 (en) * | 2014-09-29 | 2019-03-28 | Fred Hutchinson Cancer Research Center | Compositions, kits, and methods to induce acquired cytoresistance using stress protein inducers |
| US20200277325A1 (en) * | 2019-02-28 | 2020-09-03 | Renibus Therapeutics, Inc. | Novel iron compositions and methods of making and using the same |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU651758B2 (en) * | 1992-02-07 | 1994-07-28 | Tsumura & Co. | Side-effect alleviant |
| AU6010696A (en) * | 1995-06-10 | 1997-01-09 | Vitra Pharmaceuticals Ltd | Iron compounds, compositions, methods of making the same and uses thereof |
| WO2005094202A2 (en) * | 2004-03-16 | 2005-10-13 | Navinta, Llc | Iron sucrose complexes and method of manufacture thereof |
-
2021
- 2021-09-13 WO PCT/US2021/050064 patent/WO2022056378A1/en not_active Ceased
- 2021-09-13 US US17/472,954 patent/US20220079984A1/en not_active Abandoned
- 2021-09-13 JP JP2023516137A patent/JP2023541606A/ja active Pending
- 2021-09-13 AU AU2021342291A patent/AU2021342291A1/en not_active Abandoned
- 2021-09-13 CA CA3192411A patent/CA3192411A1/en active Pending
- 2021-09-13 CN CN202180070528.4A patent/CN116348107A/zh active Pending
- 2021-09-13 IL IL301305A patent/IL301305A/en unknown
- 2021-09-13 MX MX2023002929A patent/MX2023002929A/es unknown
- 2021-09-13 EP EP21867758.1A patent/EP4210691A4/en not_active Withdrawn
- 2021-09-13 KR KR1020237011800A patent/KR20230112608A/ko active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090221514A1 (en) * | 2008-02-26 | 2009-09-03 | Szeto Hazel H | Methods for prevention and treatment of acute renal injury |
| US20190091255A1 (en) * | 2014-09-29 | 2019-03-28 | Fred Hutchinson Cancer Research Center | Compositions, kits, and methods to induce acquired cytoresistance using stress protein inducers |
| WO2017100700A2 (en) * | 2015-12-11 | 2017-06-15 | Fred Hutchinson Cancer Research Center | Peptides for renal therapy |
| US20200277325A1 (en) * | 2019-02-28 | 2020-09-03 | Renibus Therapeutics, Inc. | Novel iron compositions and methods of making and using the same |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP4210691A4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| IL301305A (en) | 2023-05-01 |
| EP4210691A4 (en) | 2025-02-26 |
| MX2023002929A (es) | 2023-05-22 |
| BR112023004583A2 (pt) | 2023-04-11 |
| AU2021342291A1 (en) | 2023-04-20 |
| JP2023541606A (ja) | 2023-10-03 |
| EP4210691A1 (en) | 2023-07-19 |
| CN116348107A (zh) | 2023-06-27 |
| US20220079984A1 (en) | 2022-03-17 |
| KR20230112608A (ko) | 2023-07-27 |
| CA3192411A1 (en) | 2022-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5789000A (en) | Sterile aqueous parenteral formulations of cis-diammine dichloro platinum | |
| US9572834B2 (en) | Use of carbon nanomaterials with antioxidant properties to treat oxidative stress | |
| JP2017535522A (ja) | ストレスタンパク質誘導剤を使用して獲得細胞抵抗性を誘導するための組成物、キット及び方法 | |
| US20220079984A1 (en) | Method for treating cancer with kidney protection | |
| US20250011470A1 (en) | Targeting tumor cells with chemotherapeutic agents conjugated to matriptase antibodies | |
| Wu et al. | Self-assembled carbon monoxide nanogenerators managing sepsis through scavenging multiple inflammatory mediators | |
| KR102444113B1 (ko) | 안정한 글루코코르티코이드 제제 | |
| US12029792B2 (en) | Stereocomplexes for the delivery of anti-cancer agents | |
| EP2528613B1 (en) | Receptor associated protein peptide-fucosidase inhibitor conjugates and their use in the treatment of liver tumours | |
| BR112023004583B1 (pt) | Uso de uma composição farmacêutica com uma quantidade de composição de sacarose de ferro para proteger o rim durante a quimioterapia do câncer e durante imageamento de radiocontraste | |
| HK40095700A (zh) | 通过肾脏保护来治疗癌症的方法 | |
| US20180264025A1 (en) | Novel amyloid fibril formation inhibitor | |
| US8852566B2 (en) | Compositions and methods for preferential distribution of active agents to injury sites | |
| CN116801733A (zh) | 用于在慢性炎症性病症中靶向晚期糖基化终产物受体(rage)的组合物 | |
| US20210299270A1 (en) | Targeting tumor cells with chemotherapeutic agents conjugated to anti-matriptase antibodies by in vivo cleavable linking moieties | |
| WO2017165692A1 (en) | Compounds linked with a saccharide metal complex and uses thereof | |
| Ueda et al. | Mechanism of the protective effect of sodium malate on cisplatin-induced toxicity in mice | |
| US20250090629A1 (en) | Alleviating drug nephrotoxicity | |
| Bertrand et al. | Designing polymeric binders for pharmaceutical applications | |
| US20240058472A1 (en) | C60 histidine carnosine fumarates and use | |
| EA049524B1 (ru) | Композиции многоосновных лекарственных средств для снижения полиорганной токсичности у млекопитающих | |
| Zhao et al. | Drug-reinforced metal-organic framework nanozyme for combined treatment of ischemia/reperfusion acute kidney injury | |
| Riordan et al. | Poisoning in childhood | |
| Oliveira | N-Acetylcysteine (NAC): Impacts on Human Health | |
| TW201006479A (en) | Use of idrabiotaparinux for decreasing the incidence of bleedings during an antithrombotic treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21867758 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2023516137 Country of ref document: JP Kind code of ref document: A Ref document number: 3192411 Country of ref document: CA |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112023004583 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202317025910 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 112023004583 Country of ref document: BR Kind code of ref document: A2 Effective date: 20230310 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021867758 Country of ref document: EP Effective date: 20230411 |
|
| ENP | Entry into the national phase |
Ref document number: 2021342291 Country of ref document: AU Date of ref document: 20210913 Kind code of ref document: A |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2021867758 Country of ref document: EP |