WO2022047237A1 - Engineered immune cells with priming receptors - Google Patents

Engineered immune cells with priming receptors Download PDF

Info

Publication number
WO2022047237A1
WO2022047237A1 PCT/US2021/048066 US2021048066W WO2022047237A1 WO 2022047237 A1 WO2022047237 A1 WO 2022047237A1 US 2021048066 W US2021048066 W US 2021048066W WO 2022047237 A1 WO2022047237 A1 WO 2022047237A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
dna template
receptor
priming
domain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/048066
Other languages
English (en)
French (fr)
Inventor
Aaron Cooper
Michelle NGUYEN
Anzhi YAO
Stephen Santoro
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Arsenal Biosciences Inc
Original Assignee
Arsenal Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN202180073716.2A priority Critical patent/CN116529364A/zh
Priority to JP2023514105A priority patent/JP2023543137A/ja
Priority to EP21862873.3A priority patent/EP4204575A4/en
Priority to MX2023002455A priority patent/MX2023002455A/es
Priority to AU2021334366A priority patent/AU2021334366A1/en
Priority to CA3191148A priority patent/CA3191148A1/en
Application filed by Arsenal Biosciences Inc filed Critical Arsenal Biosciences Inc
Priority to IL300994A priority patent/IL300994A/en
Priority to KR1020237010538A priority patent/KR20230083275A/ko
Publication of WO2022047237A1 publication Critical patent/WO2022047237A1/en
Priority to US18/114,981 priority patent/US20230340409A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • A61K40/4211CD19 or B4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4254Adhesion molecules, e.g. NRCAM, EpCAM or cadherins
    • A61K40/4255Mesothelin [MSLN]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/48Blood cells, e.g. leukemia or lymphoma
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/50Fusion polypeptide containing protease site
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/23Interleukins [IL]
    • C12N2501/2307Interleukin-7 (IL-7)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/23Interleukins [IL]
    • C12N2501/2315Interleukin-15 (IL-15)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/48Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE

Definitions

  • Cancer is a disease characterized by uncontrollable growth of cells. Many approaches to treating cancer have been tried, including drugs and radiation therapies. Recent cancer treatments have sought to use the body’s own immune cells to attack cancer cells.
  • One promising approach uses T cells that are taken from a patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give the T cells a new ability to target a specific protein.
  • the receptors are chimeric because they combine antigenbinding and T-cell activating functions into a single receptor.
  • CAR-T cells are introduced into patients to attack tumor cells.
  • CAR-T cells can be either derived from T cells in a patient's own blood (autologous) or derived from the T cells of another healthy donor (allogeneic).
  • CAR-T cells Once CAR-T cells are infused into a patient, they come in contact with their targeted antigen on a cell. The CAR-T cells bind to the antigen and become activated. Upon antigen engagement, CAR T cells can proliferate exponentially, initiate antitumor cytokine production, and target tumor cell killing. However, there remain some concerns and limitations to CAR T cell-based immunotherapy. Some CAR T cells may engage with normal cells expressing low levels of target antigens, leading to off target toxicity.
  • primary immune cells comprising at least one DNA template non-virally inserted into a target region of the genome of the cell, wherein the size of the DNA template is greater than or equal to about 5 kilobase pairs (kb).
  • the primary immune cell does not comprise a viral vector for introducing the DNA template into the primary immune cell.
  • the size of the DNA template is greater than or equal to about 5.0 kb, 5.1 kb, 5.2 kb, 5.3 kb, 5.4 kb, 5.5 kb, 5.6 kb, 5.7 kb, 5.8 kb, 5.9 kb, 6.0 kb, 6.1 kb, 6.2 kb, 6.3 kb, 6.4 kb, 6.5 kb, 6.6 kb, 6.7 kb, 6.8 kb, 6.9 kb, 7.0 kb, 7.1 kb, 7.2 kb, 7.3 kb, 7.4 kb,
  • the size of the DNA template is about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about kb 6 to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, or about 9 kb to about 10 kb.
  • the DNA template is a double-stranded DNA template or a single-stranded DNA template.
  • the DNA template is a linear DNA template or a circular DNA template, optionally wherein the circular DNA template is a plasmid.
  • the 5’ and 3’ ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the primary cell.
  • the target region of the genome of the cell is a T Cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH).
  • T Cell Receptor Alpha Constant (TRAC) locus
  • GSH genomic safe harbor
  • the DNA template comprises a heterologous sequence.
  • the DNA template comprises a gene.
  • the DNA template comprises a priming receptor comprising a transcription factor.
  • the DNA template comprises a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • the DNA template comprises a chimeric antigen receptor (CAR) and a priming receptor comprising a transcription factor.
  • CAR chimeric antigen receptor
  • the DNA template comprises an inducible promoter operably linked to the chimeric antigen receptor.
  • the DNA template further comprises a constitutive promoter operably linked to the priming receptor.
  • the DNA template further comprises an inducible promoter operably linked to the chimeric antigen receptor and a constitutive promoter operably linked to the priming receptor.
  • the DNA template comprises, in a 5’ to 3’ direction: the inducible promoter; the chimeric antigen receptor, the constitutive promoter; and the priming receptor.
  • the DNA template comprises, in a 5’ to 3’ direction: the constitutive promoter; the priming receptor, the inducible promoter; and the chimeric antigen receptor.
  • the DNA template further comprises a self-excising 2A peptide (P2A).
  • P2A self-excising 2A peptide
  • the P2A nucleic acid is at the 3’ end of the DNA template.
  • the DNA template further comprises a woodchuck hepatitis virus post-translational regulatory element (WPRE).
  • WPRE woodchuck hepatitis virus post-translational regulatory element
  • the WPRE is at the 3’ end of the nucleic acid encoding the CAR and at the 5’ end of the nucleic acid encoding the priming receptor or wherein the WPRE is at the 3’ end of the nucleic acid encoding the priming receptor and at the 5’ end of the nucleic acid encoding the CAR.
  • the priming receptor comprises, in an N terminus to C terminus direction: an extracellular antigen-binding domain having a binding affinity for an antigen; a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and an intracellular domain comprising a human or humanized transcriptional effector, wherein binding of an antigen to the extracellular antigen-binding domain results in cleavage at the ligand-inducible proteolytic cleavage site thereby releasing the intracellular domain.
  • the priming receptor further comprises a juxtamembrane domain (JMD) positioned between the transmembrane domain and the intracellular domain.
  • JMD juxtamembrane domain
  • the transcription factor binds to the inducible promoter and induces expression of the CAR.
  • the CAR comprises, from N-terminus to C-terminus, an extracellular antigen-binding domain having a binding affinity for an antigen; a transmembrane domain; an intracellular co-stimulatory domain; and an intracellular activation domain.
  • the priming receptor and the CAR bind different antigens. [0035] In some embodiments, the priming receptor and the CAR bind the same antigen. [0036] In some embodiments, the immune cell is a primary human immune cell.
  • the primary immune cell is an autologous immune cell.
  • the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor.
  • NK natural killer
  • the primary immune cell is a primary T cell.
  • the primary immune cell is a primary human T cell.
  • the primary immune cell is virus-free.
  • populations of cells comprising a plurality of the primary immune cell disclosed herein.
  • primary immune cells comprising at least one DNA template inserted into a target region of the genome of the primary immune cell, wherein the size of the DNA template is greater than or equal to 5 kilobase pairs, and wherein the primary immune cell does not comprise a viral vector for introducing the DNA template into the primary immune cell.
  • primary immune cells comprising at least one DNA template comprising a chimeric antigen receptor (CAR) and a priming receptor comprising a transcription factor inserted into a target region of the genome of the primary immune cell, wherein the size of the DNA template is greater than or equal to 5 kilobase pairs, and wherein the primary immune cell does not comprise a viral vector for introducing the DNA template into the primary immune cell.
  • CAR chimeric antigen receptor
  • viable, virus-free, primary cells comprising a ribonucleoprotein complex (RNP)-DNA template complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the size of the DNA template is greater than or equal to 5 kilobase nucleotides in size, and wherein the 5’ and 3’ ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the primary cell.
  • RNP ribonucleoprotein complex
  • viable, virus-free, primary cells comprising a ribonucleoprotein complex (RNP)-DNA template complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the size of the DNA template is greater than or equal to 5 kilobase nucleotides in size, wherein the DNA template comprises a chimeric antigen receptor (CAR) and a priming receptor comprising a transcription factor, and wherein the 5’ and 3’ ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the primary cell.
  • RNP ribonucleoprotein complex
  • kits for treating a disease in a subject comprising administering the primary immune cell to the subject.
  • the disease is cancer.
  • non-viral vectors comprising a DNA template, wherein the DNA template is greater than or equal to 5 kilobase nucleotides in size, and wherein the 5’ and 3’ ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in a genome of a primary cell.
  • the size of the DNA template is greater than or equal to about 5.0 kb, 5.1 kb, 5.2 kb, 5.3 kb, 5.4 kb, 5.5 kb, 5.6 kb, 5.7 kb, 5.8 kb, 5.9 kb, 6.0 kb, 6.1 kb, 6.2 kb, 6.3 kb, 6.4 kb, 6.5 kb, 6.6 kb, 6.7 kb, 6.8 kb, 6.9 kb, 7.0 kb, 7.1 kb, 7.2 kb, 7.3 kb, 7.4 kb,
  • the size of the DNA template is about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about kb 6 to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, or about 9 kb to about 10 kb.
  • the target region of the genome of the cell is a T Cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH).
  • the DNA template comprises a heterologous sequence.
  • the DNA template comprises a gene.
  • the DNA template comprises a priming receptor comprising a transcription factor.
  • the DNA template comprises a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • the DNA template comprises a chimeric antigen receptor (CAR) and a priming receptor comprising a transcription factor.
  • the DNA template comprises an inducible promoter operably linked to the chimeric antigen receptor.
  • the DNA template further comprises a constitutive promoter operably linked to the priming receptor.
  • the DNA template further comprises an inducible promoter operably linked to the chimeric antigen receptor and a constitutive promoter operably linked to the priming receptor.
  • the DNA template comprises, in a 5’ to 3’ direction: the inducible promoter; the chimeric antigen receptor, the constitutive promoter; and the priming receptor.
  • the DNA template comprises, in a 5’ to 3’ direction: the constitutive promoter; the priming receptor the inducible promoter; and the chimeric antigen receptor.
  • the DNA template further comprises a self-excising 2A peptide (P2A).
  • P2A self-excising 2A peptide
  • the P2A is at the 3’ end of the DNA template.
  • the DNA template further comprises a woodchuck hepatitis virus post-translational regulatory element (WPRE).
  • WPRE woodchuck hepatitis virus post-translational regulatory element
  • the priming receptor comprises, in an N terminus to C terminus direction: an extracellular antigen-binding domain having a binding affinity for an antigen; a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and an intracellular domain comprising a human or humanized transcriptional effector, wherein binding of an antigen to the extracellular antigen-binding domain results in cleavage at the ligand-inducible proteolytic cleavage site thereby releasing the intracellular domain.
  • the priming receptor further comprises a juxtamembrane domain (JMD) positioned between the transmembrane domain and the intracellular domain.
  • JMD juxtamembrane domain
  • the transcription factor binds to the inducible promoter and induces expression of the CAR.
  • the CAR comprises, from N-terminus to C-terminus, an extracellular antigen-binding domain having a binding affinity for an antigen; a transmembrane domain; an intracellular co-stimulatory domain; and an intracellular activation domain.
  • the priming receptor and the CAR bind different antigens.
  • the priming receptor and the CAR bind the same antigen.
  • methods of editing a primary immune cell comprising: providing a ribonucleoprotein complex (RNP)-DNA template complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the size of the DNA template is greater than or equal to 5 kilobase nucleotides in size, and wherein the 5’ and 3’ ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the primary immune cell; non-virally introducing the RNP -DNA template complex into the primary immune cell, wherein the guide RNA specifically hybridizes to a target region of the genome of the primary immune cell, and wherein the nuclease domain cleaves the target region to create the insertion site in the
  • RNP ribonucleoprotein complex
  • non-virally introducing comprises electroporation.
  • the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.
  • Cas CRISPR-associated endonuclease
  • the size of the DNA template is greater than or equal to about 5.0 kb, 5.1 kb, 5.2 kb, 5.3 kb, 5.4 kb, 5.5 kb, 5.6 kb, 5.7 kb, 5.8 kb, 5.9 kb, 6.0 kb, 6.1 kb, 6.2 kb, 6.3 kb, 6.4 kb, 6.5 kb, 6.6 kb, 6.7 kb, 6.8 kb, 6.9 kb, 7.0 kb, 7.1 kb, 7.2 kb, 7.3 kb, 7.4 kb,
  • the size of the DNA template is about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about kb 6 to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, or about 9 kb to about 10 kb.
  • the target region of the genome of the cell is a T Cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH).
  • the DNA template is a double-stranded DNA template or a single-stranded DNA template.
  • the DNA template is a linear DNA template or a circular DNA template, optionally wherein the circular DNA template is a plasmid.
  • the DNA template comprises a heterologous sequence.
  • the DNA template comprises a gene.
  • the DNA template comprises a priming receptor comprising a transcription factor.
  • the DNA template comprises a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • the DNA template comprises a chimeric antigen receptor (CAR) and a priming receptor comprising a transcription factor.
  • CAR chimeric antigen receptor
  • the DNA template comprises an inducible promoter operably linked to the chimeric antigen receptor.
  • the DNA template further comprises a constitutive promoter operably linked to the priming receptor.
  • the DNA template further comprises an inducible promoter operably linked to the chimeric antigen receptor and a constitutive promoter operably linked to the priming receptor.
  • the DNA template comprises, in a 5’ to 3’ direction: the inducible promoter; the chimeric antigen receptor, the constitutive promoter; and the priming receptor.
  • the DNA template comprises, in a 5’ to 3’ direction: the constitutive promoter; the priming receptor, the inducible promoter; and the chimeric antigen receptor.
  • the DNA template further comprises a self-excising 2A peptide (P2A).
  • P2A self-excising 2A peptide
  • the P2A nucleic acid is at the 3’ end of the DNA template.
  • the DNA template further comprises a woodchuck hepatitis virus post-translational regulatory element (WPRE).
  • WPRE woodchuck hepatitis virus post-translational regulatory element
  • the WPRE is at the 3’ end of the nucleic acid encoding the CAR and at the 5’ end of the nucleic acid encoding the priming receptor or wherein the WPRE is at the 3’ end of the nucleic acid encoding the priming receptor and at the 5’ end of the nucleic acid encoding the CAR.
  • the priming receptor comprises, in an N terminus to C terminus direction: an extracellular antigen-binding domain having a binding affinity for an antigen; a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and an intracellular domain comprising a human or humanized transcriptional effector, wherein binding of an antigen to the extracellular antigen-binding domain results in cleavage at the ligand-inducible proteolytic cleavage site thereby releasing the intracellular domain.
  • the priming receptor further comprises a juxtamembrane domain (JMD) positioned between the transmembrane domain and the intracellular domain.
  • JMD juxtamembrane domain
  • the transcription factor binds to the inducible promoter and induces expression of the CAR.
  • the CAR comprises, from N-terminus to C-terminus, an extracellular antigen-binding domain having a binding affinity for an antigen; a transmembrane domain; an intracellular co-stimulatory domain; and an intracellular activation domain.
  • the priming receptor and the CAR bind different antigens. [0099] In some embodiments, the priming receptor and the CAR bind the same antigen. [00100] In some embodiments, the immune cell is a primary human immune cell.
  • the primary immune cell is an autologous immune cell.
  • the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor.
  • NK natural killer
  • the primary immune cell is a primary T cell.
  • the primary immune cell is a primary human T cell.
  • the primary immune cell is virus-free.
  • the method further comprises obtaining the immune cell from a patient and introducing the plasmid in vitro.
  • RNA ribonucleoprotein complex
  • the RNP comprises a nuclease domain and a guide RNA
  • the size of the DNA template is greater than or equal to 5 kilobase nucleotides in size
  • the DNA template comprises a chimeric antigen receptor (CAR) and a priming receptor comprising a transcription factor and wherein the 5’ and 3’ ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the primary immune cell
  • the guide RNA specifically hybridizes to a target region of the genome of the primary immune cell, and wherein the nuclease domain cleaves the target region to create the insertion site in the genome of the primary immune cell
  • FIG. 1 shows an exemplary plasmid of the invention.
  • FIG. 2 shows an exemplary method of producing engineered immune cells.
  • FIG. 3 shows a schematic of an experimental protocol.
  • FIG. 4 provides experimental results showing desired receptor expression and control.
  • FIG. 5 shows a schematic of an experimental protocol.
  • FIG. 6 provides experimental results showing low amounts of unwanted CAR expression.
  • FIG. 7 shows a schematic showing the GS94 integration site on Chromosome 11.
  • FIG. 8A includes plots showing CAR induction and primeR expression of engineered T cells after 48 hours of coculturing with K562-PrimeR cells.
  • FIG. 8B includes plots showing the cytotoxity and cytokine secretion levels for engineered T cells 48 hours of coculturing with K562-primeR/CAR cells.
  • FIG. 9A includes a schematic showing the experimental overview for evaluating the effect of integration site on cytotoxicity.
  • FIG. 9B includes plots showing the measured cytotoxicity for engineered T cells cocultured for 48 hours with the K562-primeR/CAR or K562-CAR cells.
  • FIG. 10A includes a schematic showing the experimental overview for evaluating the effect of integration site on cytokine secretion.
  • FIG. 10B includes plots showing the measured cytokine levels for engineered T cells cocultured for 48 hours with K562- primeR/CAR cells.
  • FIG. 11 includes a schematic showing the in vitro experiment conducted to determine the effect of integration site on primeR-independent CAR expression.
  • Flow refers to flow cytometry and “restim” refers to repetitive CD3/CD28 stimulation of the engineered T cells.
  • EP refers to electroporation.
  • FIGS. 12A and 12B include plots showing the stability of PrimeR expression over time when using the indicated integration sites.
  • Flow refers to flow cytometry and “restim” refers to repetitive CD3/CD28 stimulation of the engineered T cells.
  • EP refers to electroporation.
  • FIG. 12B the PrimeR expression is normalized to the expression from using the TRAC integration site.
  • FIG. 13A includes a schematic showing the iGuide-Seq assay technique.
  • FIG. 13B includes a plot showing the on-target efficiency, using iGuide Seq assay, for the indicated integration sites.
  • FIG. 13C includes schematics from the iGuide-Seq analysis showing that GS94 had no reproducible putatitve off-targets across two donors.
  • FIG. 14 includes a schematic showing the iGuide-Seq workflow and data.
  • FIG. 15 includes a plot showing rhAmp-seq analysis of putative off-target sites identified by iGUIDE-seq and Elevation prediction.
  • FIG. 16 includes plots showing RNA-seq analysis of cells with GS94, GS102 and TRAC knock-in of primeR/CAR circuits. Scatterplot of gene expression in cells with integration at the GS94 locus (y-axis) vs cells with integration at either the TRAC or the GS102 locus (x-axis) in two donors.
  • the light gray dots correspond to ETS1 and FLU.
  • In dark gray are the genes that were found to be differentially expressed using edgeR (foldchange > 0, FDR-corrected p-value ⁇ 0.01, average counts-per-million across compared conditions at least 2).
  • FIG. 17 includes plots showing the absence of cytokine-independent growth in cells with a primeR/CAR circuit knock-in at GS94.
  • FIG. 18 shows the expression of a 8.3 kb transgene circuit comprising a primeR and CAR in K562 cells.
  • FIG. 19A shows a diagram of a 4.6 kb cassette that was inserted into the GS94 safe harbor locus.
  • FIG. 19B shows a diagram of a 8.3 kb cassette that was inserted into the GS94 safe harbor locus.
  • the present invention provides novel engineered immune cells and methods for making and using such cells.
  • the engineered immune cells include a transgene inserted into the immune cells’ genome, which encodes genes for an engineered priming receptor and a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • the engineered immune cells express the priming receptor encoded by the plasmid on the cells’ surface, but do not express the CAR.
  • the priming receptors include a cleavable transcription factor.
  • an immune cell of the invention encounters a target cell, the priming receptor binds to a cognate ligand on the target cell. This causes the priming receptor to release the cleavable transcription factor.
  • the engineered immune cell When expressed on the surface of the immune cell, the CAR is available to bind to a cognate ligand on a target cell. Binding of the CAR to its target ligand triggers a cytotoxic response by the engineered immune cell, which kills the target cell.
  • the engineered immune cells of the present invention have several advantages over prior engineered immune cells.
  • the embodiment described below demonstrates that a synthetic circuit can be delivered into the T cell genome using targeted non-viral delivery, and that circuit fidelity can be maintained after genomic integration. This enhances the safety profile and broadens the therapeutic window of the cells, as targeted integration into the TRAC promoter reduces the risk of off-target gene insertion into the genome, as occurs via lentivirus gene delivery.
  • the circuit provides additional safety features. For example, the cytotoxic CAR is not available for activation, because it is not expressed, until it encounters a target cell with the priming receptor’s cognate ligand. Moreover, because the CAR is not initially expressed, the cells are less likely to exhibit exhaustion, differentiation, tonic signaling, and activation-induced immune cell death, while concurrently exhibiting high proliferation and persistence potential.
  • the term “gene” refers to the basic unit of heredity, consisting of a segment of DNA arranged along a chromosome, which codes for a specific protein or segment of protein.
  • a gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns, and a 3' untranslated region.
  • the gene may further comprise a terminator, enhancers and/or silencers.
  • locus refers to a specific, fixed physical location on a chromosome where a gene or genetic marker is located.
  • safe harbor locus refers to a locus at which genes or genetic elements can be incorporated without disruption to expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS).
  • SHS safe harbor sites
  • a safe harbor locus refers to an “integration site” or “knock-in site” at which a sequence encoding a transgene, as defined herein, can be inserted. In some embodiments the insertion occurs with replacement of a sequence that is located at the integration site. In some embodiments, the insertion occurs without replacement of a sequence at the integration site. Examples of integration sites contemplated are provided in Table 1.
  • the term “insert” refers to a nucleotide sequence that is integrated (inserted) at a target locus or safe harbor site.
  • the insert can be used to refer to the genes or genetic elements that are incorporated at the target locus or safe harbor site using, for example, homology-directed repair (HDR) CRISPR/Cas9 genome-editing or other methods for inserting nucleotide sequences into a genomic region known to those of ordinary skill in the art.
  • HDR homology-directed repair
  • CRISPR/Cas refers to a widespread class of bacterial systems for defense against foreign nucleic acid.
  • CRISPR/Cas systems are found in a wide range of eubacterial and archaeal organisms.
  • CRISPR/Cas systems include type I, II, and III subtypes. Wild-type type II CRISPR/Cas systems utilize an RNA-mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid.
  • Guide RNAs having the activity of both a guide RNA and an activating RNA are also known in the art. In some cases, such dual activity guide RNAs are referred to as a small guide RNA (sgRNA).
  • sgRNA small guide RNA
  • Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes- Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae.
  • An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g., Chylinksi, et al., RNA Biol.
  • the Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in the host cell.
  • RNA-mediated nuclease e.g., of bacterial or archeal orgin, or derived therefrom.
  • RNA-mediated nuclases include the foregoing Cas9 proteins and homologs thereof, and include but are not limited to, CPF1 (See, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015).
  • the term “Cas9 ribonucleoprotein” complex and the like refers to a complex between the Cas9 protein, and a crRNA (e.g., guide RNA or small guide RNA), the Cas9 protein and a trans-activating crRNA (tracrRNA), the Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex containing the Cas9 protein, a tracrRNA, and a crRNA guide RNA).
  • a crRNA e.g., guide RNA or small guide RNA
  • tracrRNA trans-activating crRNA
  • the Cas9 protein and a small guide RNA or a combination thereof (e.g., a complex containing the Cas9 protein, a tracrRNA, and a crRNA guide RNA).
  • T lymphocyte and “T cell” are used interchangeably and refer to cells that have completed maturation in the thymus, and identify certain foreign antigens in the body.
  • the terms also refer to the major leukocyte types that have various roles in the immune system, including activation and deactivation of other immune cells.
  • the T cell can be any T cell such as a cultured T cell, e.g., a primary T cell, or a T cell derived from a cultured T cell line, e.g., a Jurkat, SupTl, etc., or a T cell obtained from a mammal.
  • T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., uncultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or sub-populations thereof.
  • the T cell can be a CD3 + cell.
  • T cells can be CD4 + , CD8 + , or CD4 + and CD8 + .
  • the T cell can be any type of T cell, CD4 + / CD8 + double positive T cells, CD4 + helper T cells (e.g. Thl and Th2 cells), CD8 + T cells (e.g. cytotoxic T cells), peripheral Including but not limited to blood mononuclear cells (PBMC), peripheral blood leukocytes (PBL), tumor infiltrating lymphocytes (TIL), memory T cells, naive T cells, regulatory T cells, y6 T cells, etc. It can be any T cell at any stage of development.
  • PBMC blood mononuclear cells
  • PBL peripheral blood leukocytes
  • TIL tumor infiltrating lymphocytes
  • memory T cells naive T cells
  • regulatory T cells regulatory T cells
  • y6 T cells etc. It can be any T cell at any stage of development.
  • helper T cells include Th3 (Treg) cells, Thl7 cells, Th9 cells, or Tfh cells.
  • Additional types of memory T cells include cells such as central memory T cells (Tcm cells), effector memory T cells (Tern cells and TEMRA cells).
  • T cell can also refer to a genetically modified T cell, such as a T cell that has been modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T cells can also be differentiated from stem cells or progenitor cells.
  • TCR T cell receptor
  • CAR chimeric antigen receptor
  • CD4 + T cells refers to a subset of T cells that express CD4 on their surface and are associated with a cellular immune response.
  • CD4 + T cells are characterized by a poststimulation secretion profile that can include secretion of cytokines such as IFN-y, TNF-a, IL-2, IL-4 and IL-10.
  • CD4 is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but was also found on other cells including monocytes / macrophages.
  • the CD4 antigen is a member of the immunoglobulin superfamily and has been implicated as an associative recognition element in MHC (major histocompatibility complex) class II restricted immune responses.
  • MHC major histocompatibility complex
  • CD8 + T cells refers to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells.
  • the “CD8” molecule is a differentiation antigen present on thymocytes, as well as on cytotoxic and suppressor T lymphocytes.
  • the CD8 antigen is a member of the immunoglobulin superfamily and is an associative recognition element in major histocompatibility complex class I restriction interactions.
  • hematopoietic stem cell refers to a type of stem cell that can give rise to a blood cell. Hematopoietic stem cells can give rise to cells of the myeloid or lymphoid lineages, or a combination thereof. Hematopoietic stem cells are predominantly found in the bone marrow, although they can be isolated from peripheral blood, or a fraction thereof. Various cell surface markers can be used to identify, sort, or purify hematopoietic stem cells. In some cases, hematopoietic stem cells are identified as c- kit + and lin".
  • human hematopoietic stem cells are identified as CD34 + , CD59 + , Thyl/CD90 + , CD38 lo/ ", C-kit/CDl 17 + , lin”. In some cases, human hematopoietic stem cells are identified as CD34", CD59 + , Thyl/CD90 + , CD38 lo/ ", C-kit/CDl 17 + , lin”. In some cases, human hematopoietic stem cells are identified as CD133 + , CD59 + , Thyl/CD90 + , CD38 lo/ ", C- kit/CDl 17 + , lin".
  • mouse hematopoietic stem cells are identified as CD34 lo/ ", SCA-1 + , Thyl +/1 °, CD38 + , C-kit + , lin”. In some cases, the hematopoietic stem cells are CD150 + CD48'CD244‘.
  • hematopoietic cell refers to a cell derived from a hematopoietic stem cell.
  • the hematopoietic cell may be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood, or a fraction thereof).
  • an hematopoietic stem cell can be isolated and the hematopoietic cell obtained or provided by differentiating the stem cell.
  • Hematopoietic cells include cells with limited potential to differentiate into further cell types.
  • hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells.
  • Hematopoietic cells include cells of the lymphoid and myeloid lineages, such as lymphocytes, erythrocytes, granulocytes, monocytes, and thrombocytes.
  • the phrase “immune cell” is inclusive of all cell types that give rise to immune cells, including hematopoietic cells, pluripotent stem cells, and induced pluripotent stem cells (iPSCs).
  • the immune cell is a B cell, macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell progenitor or dendritic cell.
  • the cell is an innate immune cell.
  • primary cell or primary stem cell refers to a cell that has not been transformed or immortalized.
  • Such primary cells can be cultured, sub-cultured, or passaged a limited number of times (e.g., cultured 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times).
  • the primary cells are adapted to in vitro culture conditions.
  • the primary cells are isolated from an organism, system, organ, or tissue, optionally sorted, and utilized, e.g., directly without culturing or sub-culturing.
  • the primary cells are stimulated, activated, or differentiated.
  • primary T cells can be activated by contact with (e.g., culturing in the presence of) CD3, CD28 agonists, IL-2, IFN-y, or a combination thereof.
  • ex vivo generally includes experiments or measurements made in or on living tissue, preferably in an artificial environment outside the organism, preferably with minimal differences from natural conditions.
  • construct refers to a complex of molecules, including macromolecules or polynucleotides.
  • the term “integration” refers to the process of stably inserting one or more nucleotides of a construct into the cell genome, i.e., covalently linking to a nucleic acid sequence in the chromosomal DNA of the cell. It may also refer to nucleotide deletions at a site of integration. Where there is a deletion at the insertion site, “integration” may further include substitution of the endogenous sequence or nucleotide deleted with one or more inserted nucleotides.
  • the term “exogenous” refers to a molecule or activity that has been introduced into a host cell and is not native to that cell.
  • the molecule can be introduced, for example, by introduction of the encoding nucleic acid into host genetic material, such as by integration into a host chromosome, or as non-chromosomal genetic material, such as a plasmid.
  • the term, when used in connection with expression of an encoding nucleic acid refers to the introduction of the encoding nucleic acid into a cell in an expressible form.
  • the term “endogenous” refers to a molecule or activity that is present in a host cell under natural, unedited conditions.
  • the term, when used in connection with expression of the encoding nucleic acid refers to expression of the encoding nucleic acid that is contained within the cell and not introduced exogenously.
  • heterologous refers to a nucleic acid or polypeptide sequence or domain which is not native to a flanking sequence, e.g., wherein the heterologous sequence is not found in nature coupled to the nucleic acid or polypeptide sequences occurring at one or both ends.
  • polynucleotide donor construct refers to a nucleotide sequence (e.g. DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide.
  • the polynucleotide donor construct can include prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences.
  • the polynucleotide donor construct can be a miRNA, shRNA, natural polypeptide (i.e., a naturally occurring polypeptide) or fragment thereof or a variant polypeptide (e.g. a natural polypeptide having less than 100% sequence identity with the natural polypeptide) or fragments thereof.
  • the term “complementary” or “complementarity” refers to specific base pairing between nucleotides or nucleic acids.
  • Complementary nucleotides are, generally, A and T (or A and U), and G and C.
  • the guide RNAs described herein can comprise sequences, for example, DNA targeting sequence that are perfectly complementary or substantially complementary (e.g., having 1-4 mismatches) to a genomic sequence in a cell.
  • the term “transgene” refers to a polynucleotide that has been transferred naturally, or by any of a number of genetic engineering techniques from one organism to another. It is optionally translated into a polypeptide.
  • a “recombinant protein” is a protein encoded by a gene — recombinant DNA — that has been cloned in a system that supports expression of the gene and translation of messenger RNA (see expression system).
  • the recombinant protein can be a therapeutic agent, e.g. a protein that treats a disease or disorder disclosed herein.
  • transgene can refer to a polynucleotide that encodes a polypeptide.
  • a transgene can also refer to a non-encoding sequence, such as, but not limited to shRNAs, miRNAs, and miRs.
  • operably linked refers to the binding of a nucleic acid sequence to a single nucleic acid fragment such that one function is affected by the other.
  • a promoter is capable of affecting the expression of a coding sequence or functional RNA (i.e., the coding sequence or functional RNA is under transcriptional control by the promoter)
  • the promoter is operably linked thereto.
  • Coding sequences can be operably linked to control sequences in both sense and antisense orientation.
  • developmental cell states refers to, for example, states when the cell is inactive, actively expressing, differentiating, senescent, etc.
  • developmental cell state may also refer to a cell in a precursor state (e.g., a T cell precursor).
  • the term “encoding” refers to a sequence of nucleic acids which codes for a protein or polypeptide of interest.
  • the nucleic acid sequence may be either a molecule of DNA or RNA.
  • the molecule is a DNA molecule.
  • the molecule is a RNA molecule.
  • When present as a RNA molecule it will comprise sequences which direct the ribosomes of the host cell to start translation (e.g., a start codon, ATG) and direct the ribosomes to end translation (e.g., a stop codon). Between the start codon and stop codon is an open reading frame (ORF).
  • ORF open reading frame
  • the term “inserting” refers to a manipulation of a nucleotide sequence to introduce a non-native sequence. This is done, for example, via the use of restriction enzymes and ligases whereby the DNA sequence of interest, usually encoding the gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with appropriate restriction enzymes in order to create compatible overlaps and then using a ligase to join the molecules together.
  • restriction enzymes and ligases whereby the DNA sequence of interest, usually encoding the gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with appropriate restriction enzymes in order to create compatible overlaps and then using a ligase to join the molecules together.
  • the term “subject” refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs and sheep. In certain embodiments, the subject is a human. In some embodiments the subject has a disease or condition that can be treated with an engineered cell provided herein or population thereof. In some aspects, the disease or condition is a cancer.
  • promoter refers to a nucleotide sequence (e.g. DNA sequence) capable of controlling the expression of a coding sequence or functional RNA.
  • the promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
  • a promoter can be derived from natural genes in its entirety, can be composed of different elements from different promoters found in nature, and/or may comprise synthetic DNA segments.
  • a promoter, as contemplated herein, can be endogenous to the cell of interest or exogenous to the cell of interest. It is appreciated by those skilled in the art that different promoters can induce gene expression in different tissue or cell types, or at different developmental stages, or in response to different environmental conditions.
  • a promoter can be selected according to the strength of the promoter and/or the conditions under which the promoter is active, e.g., constitutive promoter, strong promoter, weak promoter, inducible/repressible promoter, tissue specific Or developmentally regulated promoters, cell cycle-dependent promoters, and the like.
  • a promoter can be an inducible promoter (e.g., a heat shock promoter, tetracycline- regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor- regulated promoter, etc.).
  • the promoter can be a constitutive promoter (e.g., CMV promoter, UBC promoter).
  • the promoter can be a spatially restricted and/or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.). See for example US Publication 20180127786, the disclosure of which is herein incorporated by reference in its entirety.
  • Gene editing may involve a gene (or nucleotide sequence) knock-in or knock-out.
  • knock-in refers to an addition of a DNA sequence, or fragment thereof into a genome.
  • DNA sequences to be knocked-in may include an entire gene or genes, may include regulatory sequences associated with a gene or any portion or fragment of the foregoing.
  • a polynucleotide donor construct encoding a recombinant protein may be inserted into the genome of a cell carrying a mutant gene.
  • a knock-in strategy involves substitution of an existing sequence with the provided sequence, e.g., substitution of a mutant allele with a wild-type copy.
  • the term “knock-out” refers to the elimination of a gene or the expression of a gene.
  • a gene can be knocked out by either a deletion or an addition of a nucleotide sequence that leads to a disruption of the reading frame.
  • a gene may be knocked out by replacing a part of the gene with an irrelevant (.e.g., non-coding) sequence.
  • non-homologous end joining refers to a cellular process in which cut or nicked ends of a DNA strand are directly ligated without the need for a homologous template nucleic acid. NHEJ can lead to the addition, the deletion, substitution, or a combination thereof, of one or more nucleotides at the repair site.
  • the term “homology directed repair” or HDR refers to a cellular process in which cut or nicked ends of a DNA strand are repaired by polymerization from a homologous template nucleic acid.
  • the homologous template nucleic acid can be provided by homologous sequences elsewhere in the genome (sister chromatids, homologous chromosomes, or repeated regions on the same or different chromosomes).
  • an exogenous template nucleic acid can be introduced to obtain a specific HDR-induced change of the sequence at the target site. In this way, specific mutations can be introduced at the cut site.
  • a single-stranded DNA template or a double-stranded DNA template refers to a DNA oligonucleotide that can be used by a cell as a template for HDR.
  • the single-stranded DNA template or a double-stranded DNA template has at least one region of homology to a target site.
  • the single-stranded DNA template or doublestranded DNA template has two homologous regions flanking a region that contains a heterologous sequence to be inserted at a target cut site.
  • vectors can be linear or circular. Vectors can integrate into a target genome of a host cell or replicate independently in a host cell. Vectors can comprise, for example, an origin of replication, a multicloning site, and/or a selectable marker.
  • An expression vector typically comprises an expression cassette.
  • Vectors and plasmids include, but are not limited to, integrating vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.
  • introducing in the context of introducing a nucleic acid or a complex comprising a nucleic acid, for example, an RNP-DNA template complex, refers to the translocation of the nucleic acid sequence or the RNP-DNA template complex from outside a cell to inside the cell.
  • introducing refers to translocation of the nucleic acid or the complex from outside the cell to inside the nucleus of the cell.
  • Various methods of such translocation are contemplated, including but not limited to, electroporation, contact with nanowires or nanotubes, receptor mediated internalization, translocation via cell penetrating peptides, liposome mediated translocation, and the like.
  • expression cassette is a polynucleotide construct, generated recombinantly or synthetically, comprising regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell.
  • the regulatory sequences can facilitate transcription of the selected polynucleotide in a host cell, or transcription and translation of the selected polynucleotide in a host cell.
  • An expression cassette can, for example, be integrated in the genome of a host cell or be present in an expression vector.
  • chemotherapeutic agent refers to a chemical compound useful in the treatment of cancer.
  • Chemotherapeutic agents include “anti-hormonal agents” or “endocrine therapeutics” which act to regulate, reduce, block, or inhibit the effects of hormones that can promote the growth of cancer.
  • composition refers to a mixture that contains, e.g., an engineered cell or protein contemplated herein.
  • the composition may contain additional components, such as adjuvants, stabilizers, excipients, and the like.
  • composition or “pharmaceutical composition” refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective in treating a subject, and which contains no additional components which are unacceptably toxic to the subject in the amounts provided in the pharmaceutical composition.
  • ameliorating refers to any therapeutically beneficial result in the treatment of a disease state, e.g., a cancer disease state, including prophylaxis, lessening in the severity or progression, remission, or cure thereof.
  • in situ refers to processes that occur in a living cell growing separate from a living organism, e.g., growing in tissue culture.
  • in vivo refers to processes that occur in a living organism.
  • mammal as used herein includes both humans and non-humans and include but is not limited to humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.
  • percent “identity,” in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection.
  • sequence comparison algorithms e.g., BLASTP and BLASTN or other algorithms available to persons of skill
  • the percent “identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.
  • sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol.
  • the term “sufficient amount” means an amount sufficient to produce a desired effect, e.g., an amount sufficient to modulate protein aggregation in a cell.
  • terapéuticaally effective amount is an amount that is effective to ameliorate a symptom of a disease.
  • a therapeutically effective amount can be a “prophylactically effective amount” as prophylaxis can be considered therapy.
  • the term “effective amount” refers to the amount of a compound e.g., a compositions described herein, cells described herein) sufficient to effect beneficial or desired results.
  • An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.
  • the term “treating” includes any effect, e.g., lessening, reducing, modulating, ameliorating or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof.
  • modulate and “modulation” refer to reducing or inhibiting or, alternatively, activating or increasing, a recited variable.
  • increase and activate refer to an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater in a recited variable.
  • the present disclosure contemplates recombinant nucleic acid inserts that comprise one or more transgenes.
  • the transgene can encode a therapeutic protein, an antibody, a peptide, a suicide gene, an apoptosis gene or any other gene of interest.
  • the transgene encodes a priming receptor.
  • the transgene encodes a chimeric antigen receptor.
  • the insert comprises a priming receptor transgene and a chimeric antigen receptor transgene.
  • the insert can also comprise a self-cleaving peptide.
  • self-cleaving peptides include, but are not limited to, self-cleaving viral 2A peptides, for example, a porcine teschovirus-1 (P2A) peptide, a Thosea asigna virus (T2A) peptide, an equine rhinitis A virus (E2A) peptide, or a foot-and-mouth disease virus (F2A) peptide.
  • Self-cleaving 2A peptides allow expression of multiple gene products from a single construct. (See, for example, Chang et al. “Cleavage efficient 2 A peptides for high level monoclonal antibody expression in CHO cells,” MAbs 7(2): 403-412 (2015)).
  • the insert can also comprise a WPRE element.
  • WPRE elements are generally described in Higashimoto, T., et al. Gene Ther 14, 1298-1304 (2007); and Zufferey, R., et al. J Virol. 1999 Apr;73(4):2886-92., both of which are hereby incorporated by reference.
  • the priming receptor is a synthetic circuit receptor based on the Notch protein. Binding of a natural Notch receptor to a cognate ligand, such as those from the Delta family of proteins, causes intramembrane proteolysis that cleaves an intracellular fragment of the Notch protein. This intracellular fragment is a transcriptional regulator that only functions when cleaved from Notch. Cleavage may occur by sequential proteolysis by ADAM metalloprotease and the gamma-secretase complex. This intracellular fragment enters the nucleus of a cell and activates cell-cell signaling genes. In contrast to a natural Notch protein, a synNotch priming receptor replaces the natural Notch intracellular fragment with one that causes the gene encoding the CAR to activate upon release from the priming receptor.
  • Notch receptors have a modular domain organization.
  • the ectodomains of Notch receptors consist of a series of N-terminal epidermal growth factor (EGF)-like repeats that are responsible for ligand binding.
  • EGF epidermal growth factor
  • the Notch ligand-binding domain is replaced with a ligand binding domain that binds a selected target ligand or antigen.
  • the EGF repeats are followed by three LIN -12/Notch repeat (LNR) modules, which are unique to Notch receptors, and are widely reported to participate in preventing premature receptor activation.
  • LNR LIN -12/Notch repeat
  • the heterodimerization (HD) domain of Notchl is divided by furin cleavage, so that its N-terminal part terminates the extracellular subunit, and its C -terminal half constitutes the beginning of the transmembrane subunit. Following the extracellular region, the receptor has a transmembrane segment and an intracellular domain (ICD), which includes a transcriptional regulator.
  • ICD intracellular domain
  • priming receptors can be used in the methods, cells, and nucleic acids as described herein.
  • One type of priming receptor contemplated for use in the methods and cells herein comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor including the NRR, a TMD, and an ICD.
  • “Fn Notch” receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Robo receptor (such as a mammalian Robol, Robo2, Robo3, or Robo4), followed by 1, 2, or 3 fibronectin repeats (“Fn”), a TMD, and an ICD.
  • a Robo receptor such as a mammalian Robol, Robo2, Robo3, or Robo4
  • Mini Notch receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor (lacking the NRR), a TMD, and an ICD.
  • “Minimal Tinker Notch” receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide lacking substantial sequence identity with a Notch receptor (e.g., a synthetic (GGS)n polypeptide sequence), a TMD, and an ICD.
  • “Hinge Notch” receptors comprise a heterologous extracellular ligand binding domain, a hinge sequence comprising an oligomerization domain (i.e., a domain that promotes dimerization, trimerization, or higher order multimerization with a synthetic receptor and/or an existing host receptor), a TMD, and an ICD. All of these receptor classes are synthetic, recombinant, and do not occur in nature.
  • the non-naturally occurring receptors disclosed herein bind a target cell-surface displayed ligand, which triggers proteolytic cleavage of the receptors and release of a transcriptional regulator that modulates a custom transcriptional program in the cell.
  • the priming receptor does not include a LIN-12-Notch repeat (LNR) and/or a heterodimerization domain (HD) of a Notch receptor.
  • LNR LIN-12-Notch repeat
  • HD heterodimerization domain
  • the priming receptor comprises an extracellular domain.
  • the extracellular domain includes the ligand-binding portion of a receptor.
  • the extracellular domain includes an antigen-binding moiety that binds to one or more target antigens.
  • the antigen-binding moiety includes one or more antigenbinding determinants of an antibody or a functional antigen-binding fragment thereof.
  • the antigen-binding moiety is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, or a minibody, a F(ab')2 fragment, a Fab fragment, a single chain variable fragment (scFv), and a single domain antibody (sdAb), or a functional fragment thereof.
  • the antigen-binding moiety comprises an scFv.
  • the antigen-binding moiety can include naturally-occurring amino acid sequences or can be engineered, designed, or modified so as to provide desired and/or improved properties, e.g., increased binding affinity.
  • an antibody that “selectively binds” an antigen is an antigenbinding moiety that binds the antigen with high affinity and does not significantly bind other unrelated antigens.
  • the extracellular antigen-binding domain binds to Alkaline phosphatase, germ cell type (ALPG). Additional antigens are described in WO20 1061872.
  • the chimeric polypeptides of the disclosure include a TMD comprising one or more ligand-inducible proteolytic cleavage sites.
  • the TMD suitable for the chimeric receptors disclosed herein can be any transmembrane domain of a Type 1 transmembrane receptor including at least one gamma- secretase cleavage site.
  • a Type 1 transmembrane receptor including at least one gamma- secretase cleavage site.
  • gamma- secretase complex as well as its substrate proteins, including amyloid precursor protein (APP) and Notch, can, for example, be found in a recent review by Zhang et al, Frontiers Cell Neurosci (2014).
  • Non limiting suitable TMDs from Type 1 transmembrane receptors include those from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HL A- A, and IFNAR2, wherein the TMD includes at least one gamma secretase cleavage site.
  • TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from Type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, S0RCS3, S0RCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, YASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM.
  • Type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE
  • the TMD of the chimeric polypeptides or Notch receptors of the disclosure is a TMD derived from the TMD of a member of the calsyntenin family, such as, alcadein alpha and alcadein gamma.
  • the TMD of the chimeric polypeptides or Notch receptors of the disclosure is a TMD known for Notch receptors.
  • the TMD of the chimeric polypeptides or Notch receptors of the disclosure is a TMD derived from a different Notch receptor.
  • the Notchl TMD can be substituted with a Notch2 TMD, Notch3 TMD, Notch4 TMD, or a Notch TMD from a nonhuman animal such as Danio rerio, Drosophila melanogaster, Xenopus laevis, or Gallus gallus.
  • a nonhuman animal such as Danio rerio, Drosophila melanogaster, Xenopus laevis, or Gallus gallus.
  • the priming receptor comprises a Notch cleavage site, such as S2 or S3.
  • Additional proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, a metalloproteinase cleavage site for a MMP selected from collagenase- 1, -2, and -3 (MMP-1, -8, and -13), gelatinase A and B (MMP -2 and -9), stromelysin 1, 2, and 3 (MMP-3, -10, and -11), matrilysin (MMP-7), and membrane metalloproteinases (MT 1 -MMP and MT2-MMP).
  • MMP-1, -8, and -13 gelatinase A and B
  • MMP-3, -10, and -11 stromelysin 1, 2, and 3
  • MMP-7 matrilysin
  • MT 1 -MMP and MT2-MMP membrane metalloproteinases
  • a suitable protease cleavage site is a plasminogen activator cleavage site, e.g., a urokinase plasminogen activator (uPA) or a tissue plasminogen activator (tPA) cleavage site.
  • a suitable protease cleavage site is a prolactin cleavage site.
  • Specific examples of cleavage sequences of uPA and tPA include sequences comprising Yal-Gly-Arg.
  • protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch vims (TEV) protease cleavage site, e.g., Glu-Asn-Leu-Tyr-Thr-Gln-Ser, where the protease cleaves between the glutamine and the serine.
  • TSV tobacco etch vims
  • Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, e.g., Asp-Asp- Asp-Asp- Lys, where cleavage occurs after the lysine residue.
  • protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, e.g., Leu- Vai -Pro- Arg.
  • Additional suitable linkers comprising protease cleavage sites include sequences cleavable by the following proteases: a PreScissionTM protease (a fusion protein comprising human rhinovirus 3C protease and glutathione-S-transferase), a thrombin, cathepsin B, Epstein-Barr vims proteas, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMP, matrix metalloproteinase 2 (MMP -2), cathepsin L; cathepsin D, matrix metalloproteinase 1 (MMP-1), urokinase-type plasminogen activator, membrane
  • proteases that are not native to the host cell in which the receptor is expressed can be used as a further regulatory mechanism, in which activation of the receptor is reduced until the protease is expressed or otherwise provided.
  • a protease may be tumor-associated or disease-associated (expressed to a significantly higher degree than in normal tissue), and serve as an independent regulatory mechanism.
  • some matrix metalloproteases are highly expressed in certain cancer types.
  • the amino acid substitution(s) within the TMD includes one or more substitutions within a “GV” motif of the TMD. In some embodiments, at least one of such substitution(s) comprises a substitution to alanine. Additional sequences and substitutions are described in WO2021061872, hereby incorporated by reference in its entirety.
  • the priming receptor comprises one or more intracellular domains from or derived from a transcriptional regulator.
  • Transcriptional regulators either activate or repress transcription from cognate promoters.
  • Transcriptional activators typically bind nearby to transcriptional promoters and recruit RNA polymerase to directly initiate transcription.
  • Transcriptional repressors bind to transcriptional promoters and sterically hinder transcriptional initiation by RNA polymerase.
  • Other transcriptional regulators serve as either an activator or a repressor depending on where it binds and cellular conditions.
  • a “transcriptional activation domain” refers to the domain of a transcription factor that interacts with transcriptional control elements and/or transcriptional regulatory proteins (i.e., transcription factors, RNA polymerases, etc.) to increase and/or activate transcription of one or more genes.
  • transcriptional activation domains include: a herpes simplex virus VP 16 activation domain, VP64 (which is a tetrameric derivative of VP 16), HIV TAT, a NFkB p65 activation domain, p53 activation domains 1 and 2, a CREB (cAMP response element binding protein) activation domain, an E2A activation domain, NF AT (nuclear factor of activated T-cells) activation domain, yeast Gal4, yeast GCN4, yeast HAP1, MLL, RTG3, GLN3, OAF1, PIP2, PDR1, PDR3, PHO4, LEU3 glucocorticoid receptor transcription activation domain, B-cell POU homeodomain protein Oct2, plant Ap2, or any others known to one or ordinary skill in the art.
  • the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR- VP64, ZFHD1-YP64, Gal4-KRAB, and HAP1-VP16.
  • the transcriptional regulator is Gal4-VP64.
  • a transcriptional activation domain can comprise a wild-type or naturally occurring sequence, or it can be a modified, mutant, or derivative version of the original transcriptional activation domain that has the desired ability to increase and/or activate transcription of one or more genes.
  • the transcriptional regulator can further include a nuclear localization signal.
  • a synthetic protein comprises one or more intracellular “DNA-binding domains” (or “DB domains”).
  • DNA-binding domains refer to sequence-specific DNA binding domains that bind a particular DNA sequence element.
  • a “sequence-specific DNA-binding domain” refers to a protein domain portion that has the ability to selectively bind DNA having a specific, predetermined sequence.
  • a sequence-specific DNA binding domain can comprise a wild-type or naturally occurring sequence, or it can be a modified, mutant, or derivative version of the original domain that has the desired ability to bind to a desired sequence.
  • the sequence-specific DNA binding domain is engineered to bind a desired sequence.
  • Non-limiting examples of proteins having sequence-specific DNA binding domains that can be used in synthetic proteins described herein include HNF la, Gal4, GCN4, reverse tetracycline receptor, THY1, SYN1, NSE/RU5', AGRP, CALB2, CAMK2A, CCK, CHAT, DLX6A, EMX1, zinc finger proteins or domains thereof, CRISPR/Cas proteins, such as Cas9, Cas3, Cas4, Cas5, Cas5e (or CasD), Cash, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, CaslO, CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Cs
  • the CRISPR/Cas-like protein can be a wild type CRISPR/Cas protein, a modified CRISPR/Cas protein, or a fragment of a wild type or modified CRISPR/Cas protein.
  • the CRISPR/Cas-like protein can be modified to increase nucleic acid binding affinity and/or specificity, alter an enzymatic activity, and/or change another property of the protein.
  • nuclease i.e., DNase, RNase
  • nuclease domains of the CRISPR/Cas-like protein can be modified, deleted, or inactivated.
  • the CRISPR/Cas-like protein can be truncated to remove domains that are not essential for the functions of the systems described herein.
  • a CRISPR enzyme that is used as a DNA binding protein or domain thereof can be mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR or domain thereof lacks the ability to cleave a nucleic acid sequence containing a DNA binding domain target site.
  • a D10A mutation can be combined with one or more of H840A, N854A, or N863 A mutations to produce a Cas9 enzyme substantially lacking all DNA cleavage activity.
  • the ECD and the TMD, or the TMD and the ICD can be linked to each other with a linking polypeptide, such as a juxtamembrane domain.
  • a linking polypeptide such as a juxtamembrane domain.
  • “SynNotch” receptors comprise a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD (including the NRR), a TMD, and an ICD.
  • “Fn Notch” receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Robo receptor (such as a mammalian Robol, Robo2, Robo3, or Robo4), followed by 1, 2, or 3 fibronectin repeats (“Fn”), a TMD, and an ICD.
  • “Mini Notch” receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor IMD but lacking the NRR (the LIN-12-Notch repeat (LNR) modules, and the heterodimerization domain), a TMD, and an ICD.
  • “Minimal Linker Notch” receptors comprise a heterologous extracellular ligand-binding domain, a linking polypeptide lacking substantial sequence identity with a Notch receptor (for example, without limitation, having a synthetic (GGS)n polypeptide sequence), a TMD, and an ICD.
  • “Hinge Notch” receptors comprise a heterologous extracellular ligand-binding domain, a hinge sequence comprising an oligomerization domain (i.e., a domain that promotes dimerization, trimerization, or higher order multimerization with a synthetic receptor and/or an existing host receptor), a TMD, and an ICD.
  • the priming receptor comprises a juxtamembrane domain (IMD) peptide in between the extracellular domain and the transmembrane domain. In some embodiments, the priming receptor comprises a juxtamembrane domain (IMD) peptide in between the transmembrane domain and the intracellular domain. In some embodiments, the IMD peptide comprises an LWF motif. The use of LWF motifs in receptor constructs is described in US Patent N. 10,858,443, hereby incorporated by reference in its entirety. In some embodiments, the IMD peptide has substantial sequence identity to the IMD of Notchl, Notch2, Notch3, and/or Notch4.
  • the JMD peptide has substantial sequence identity to the Notchl, Notch2, Notch3, and/or Notch4 JMD, but does not include a LIN-12-Notch repeat (LNR) and/or a heterodimerization domain (HD) of a Notch receptor. In some embodiments, the JMD peptide does not have substantial sequence identity to the Notchl, Notch2, Notch3, and/or Notch4 JMD. In some embodiments, the JMD peptide includes an oligimerization domain which promotes formation of dimers, trimers, or higher order assemblages of the receptor. Such JMD peptides are described in WO2021061872, hereby incorporated by reference in its entirety.
  • the linking polypeptide is derived from a Notch JMD sequence after deletion of the NRR and HD domain.
  • the Notch JMD sequence may be the sequence from Notchl, Notch2, Notch3, or Notch4, and can be derived from a non-human homolog, such as those from Drosophila, Gallus, Danio, and the like. Four to 50 amino acid residues of the remaining Notch sequence can be used as a polypeptide linker.
  • the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and/or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric polypeptide, such as the signal transduction level when ligand induced or in the absence of ligand.
  • the linking polypeptide does not have substantial sequence identity to a Notch JMD sequence, including the Notch JMD sequence from Notchl, Notch2, Notch3, or Notch4, or a non-human homolog thereof.
  • a polypeptide linker can be used as a polypeptide linker.
  • the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and/or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric polypeptide of the disclosure.
  • the Minimal Linker sequence can be designed to include or omit a protease cleavage site, and can include or omit a glycosylation site or sites for other types of post-translational modification. In some embodiments, the Minimal Linker linker does not comprise a protease cleavage site or a glysosylation site.
  • the priming receptor further comprises a hinge.
  • Hinge linkers that can be used in the priming receptor can include an oligomerization domain (e.g., a hinge domain) containing one or more polypeptide motifs that promote oligomer formation of the chimeric polypeptides via intermolecular disulfide bonding.
  • the hinge domain generally includes a flexible polypeptide connector region disposed between the ECD and the TMD.
  • the hinge domain provides flexibility between the ECD and TMD and also provides sites for intermolecular disulfide bonding between two or more chimeric polypeptide monomers to form an oligomeric complex.
  • the hinge domain includes motifs that promote dimer formation of the chimeric polypeptides disclosed herein. In some embodiments, the hinge domain includes motifs that promote trimer formation of the chimeric polypeptides disclosed herein (e.g., a hinge domain derived from 0X40).
  • Hinge polypeptide sequences suitable for the compositions and methods of the disclosure can be naturally-occurring hinge polypeptide sequences (e.g., those from naturally-occurring immunoglobulins) or can be engineered, designed, or modified so as to provide desired and/or improved properties, e.g., modulating transcription.
  • Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgGl hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain, or a functional variant thereof.
  • the hinge polypeptide sequence contains one or more CXXC motifs.
  • the hinge polypeptide sequence contains one or more CPPC motifs.
  • Hinge polypeptide sequences can also be derived from a CD8a hinge domain, a CD28 hinge domain, a CD 152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an 0X40 hinge domain, and functional variants thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from a CD8 a hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from a CD28 hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from an 0X40 hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof.
  • the Fn Notch linking polypeptide is derived from the Robol JMD, which contains a fibronectin repeat (Fn) domain, with a short polypeptide sequence between the Fn repeats and the TMD.
  • the Fn Notch linking polypeptide does not contain a Notch negative regulatory region (NRR), or the Notch HD domain.
  • the Fn linking polypeptide can contain 1, 2, 3, 4, or 5 Fn repeats.
  • the chimeric receptor comprises a Fn linking polypeptide having about 1 to about 5 Fn repeats, about 1 to about 3 Fn repeats, or about 2 to about 3 Fn repeats.
  • the short polypeptide sequence between the Fn repeats and the TMD can be from about 2 to about 30 amino acid residues.
  • the short polypeptide sequence can be between about 5 and about 20 amino acids, of any sequence. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 naturally- occurring amino acids, of any sequence. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids, of any sequence but having no more than one proline. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids, and about 50% or more of the amino acids are glycine. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids, where the amino acids are selected from glycine, serine, threonine, and alanine. In some embodiments, the length and amino acid composition of the Fn linking polypeptide sequence can be varied to alter the orientation and/or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric polypeptide of the disclosure.
  • the priming receptor further comprises a stop-transfer sequence (STS) in between the transmembrane domain and the intracellular domains.
  • STS comprises a charged, lipophobic sequence.
  • the STS serves as a membrane anchor, and is believed to prevent passage of the intracellular domain into the plasma membrane.
  • the use of STS domains in priming receptors is described in WO202 1061872, hereby incorporated by reference in its entirety.
  • Non-limiting exemplary STS sequences include APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNE1, KCNE2, CHL1, LRP1, LRP2, LRP18, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKTFD1, NECTIN1, KL, IL6R, EFNB1, CD44, CLSTN1, LRP8, PCDHGC3, NRG1, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK,
  • the STS is heterologous to the transmembrane domain. In some embodiments, the STS is homologous to the transmembrane domain. STS sequences are described in WO2021061872, hereby incorporated by reference in its entirety.
  • the recombinant CAR may be a human CAR, comprising fully human sequences, e.g., natural human sequences.
  • the recombinant receptor such as a CAR, such as the antibody portion thereof, further includes a spacer, which may be or include at least a portion of an immunoglobulin constant region or variant or modified version thereof, such as a hinge region, e.g., an IgG4 hinge region, and/or a CH1/CL and/or Fc region.
  • the constant region or portion is of a human IgG, such as IgG4 or IgGl.
  • the portion of the constant region serves as a spacer region between the antigen-recognition component, e.g., scFv, and transmembrane domain.
  • the spacer can be of a length that provides for increased responsiveness of the cell following antigen binding, as compared to in the absence of the spacer. In some examples, the spacer is at or about 12 amino acids in length or is no more than 12 amino acids in length.
  • Exemplary spacers include those having at least about 10 to 229 amino acids, about 10 to 200 amino acids, about 10 to 175 amino acids, about 10 to 150 amino acids, about 10 to 125 amino acids, about 10 to 100 amino acids, about 10 to 75 amino acids, about 10 to 50 amino acids, about 10 to 40 amino acids, about 10 to 30 amino acids, about 10 to 20 amino acids, or about 10 to 15 amino acids, and including any integer between the endpoints of any of the listed ranges.
  • a spacer region has about 12 amino acids or less, about 119 amino acids or less, or about 229 amino acids or less.
  • Exemplary spacers include IgG4 hinge alone, IgG4 hinge linked to CH2 and CH3 domains, or IgG4 hinge linked to the CH3 domain.
  • Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153 or international patent application publication number W02014031687.
  • the constant region or portion is of IgD.
  • the antigen recognition domain of a receptor such as a CAR can be linked to one or more intracellular signaling components, such as signaling components that mimic activation through an antigen receptor complex, such as a TCR complex, in the case of a CAR, and/or signal via another cell surface receptor.
  • the extracellular binding component e.g., ligand-binding or antigen-binding domain
  • the transmembrane domain is fused to the extracellular domain.
  • a transmembrane domain that naturally is associated with one of the domains in the receptor e.g., CAR, is used.
  • the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
  • the transmembrane domain in some embodiments is derived either from a natural or from a synthetic source. Where the source is natural, the domain in some aspects is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (i.e.
  • the transmembrane domain in some embodiments is synthetic.
  • the synthetic transmembrane domain comprises predominantly hydrophobic residues such as leucine and valine.
  • a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
  • the linkage is by linkers, spacers, and/or transmembrane domain(s).
  • intracellular signaling domains are those that mimic or approximate a signal through a natural antigen receptor, a signal through such a receptor in combination with a costimulatory receptor, and/or a signal through a costimulatory receptor alone.
  • a short oligo- or polypeptide linker for example, a linker of between 2 and 10 amino acids in length, such as one containing glycines and serines, e.g., glycine-serine doublet, is present and forms a linkage between the transmembrane domain and the cytoplasmic signaling domain of the receptor.
  • the receptor e.g., the CAR
  • the receptor includes an intracellular component of a TCR complex, such as a TCR CD3 chain that mediates T-cell activation and cytotoxicity, e.g., CD3 zeta chain.
  • the extracellular domain is linked to one or more cell signaling modules.
  • cell signaling modules include CD3 transmembrane domain, CD3 intracellular signaling domains, and/or other CD transmembrane domains.
  • the receptor e.g., CAR
  • the receptor further includes a portion of one or more additional molecules such as Fc receptor-gamma, CD8, CD4, CD25, or CD 16.
  • the CAR includes a chimeric molecule between CD3-zeta or Fc receptor-gamma and CD8, CD4, CD25 or CD 16.
  • the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one of the normal effector functions or responses of the immune cell, e.g., T cell engineered to express the receptor.
  • the receptor induces a function of a T cell such as cytolytic activity or T-helper activity, such as secretion of cytokines or other factors.
  • a truncated portion of an intracellular signaling domain of an antigen receptor component or costimulatory molecule is used in place of an intact immunostimulatory chain, for example, if it transduces the effector function signal.
  • the intracellular signaling domain or domains include the cytoplasmic sequences of the T cell receptor (TCR), and in some aspects also those of co-receptors that in the natural context act in concert with such receptor to initiate signal transduction following antigen receptor engagement, and/or any derivative or variant of such molecules, and/or any synthetic sequence that has the same functional capability.
  • TCR T cell receptor
  • full activation In the context of a natural TCR, full activation generally requires not only signaling through the TCR, but also a costimulatory signal.
  • a component for generating secondary or co-stimulatory signal is also included in the receptor.
  • the receptor does not include a component for generating a costimulatory signal.
  • an additional receptor is expressed in the same cell and provides the component for generating the secondary or costimulatory signal.
  • T cell activation is in some aspects described as being mediated by two classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation through the TCR (primary cytoplasmic signaling sequences), and those that act in an antigenindependent manner to provide a secondary or co-stimulatory signal (secondary cytoplasmic signaling sequences).
  • primary cytoplasmic signaling sequences those that initiate antigen-dependent primary activation through the TCR
  • secondary cytoplasmic signaling sequences those that act in an antigenindependent manner to provide a secondary or co-stimulatory signal.
  • the receptor includes one or both of such signaling components.
  • the receptor includes a primary cytoplasmic signaling sequence that regulates primary activation of the TCR complex.
  • Primary cytoplasmic signaling sequences that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs.
  • ITAMs immunoreceptor tyrosine-based activation motifs
  • TEAM containing primary cytoplasmic signaling sequences include those derived from TCR or CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, and CD66d.
  • cytoplasmic signaling molecule(s) in the CAR contain(s) a cytoplasmic signaling domain, portion thereof, or sequence derived from CD3 zeta.
  • the receptor includes a signaling domain and/or transmembrane portion of a costimulatory receptor, such as CD28, 4-1BB, 0X40, DAP10, and ICOS.
  • a costimulatory receptor such as CD28, 4-1BB, 0X40, DAP10, and ICOS.
  • the same receptor includes both the activating and costimulatory components.
  • the intracellular signaling domain comprises a CD28 transmembrane and signaling domain linked to a CD3 (e.g., CD3-zeta) intracellular domain.
  • the intracellular signaling domain comprises a chimeric CD28 and CD137 (4- IBB, TNFRSF9) co-stimulatory domains, linked to a CD3 zeta intracellular domain.
  • the receptor encompasses one or more, e.g., two or more, costimulatory domains and an activation domain, e.g., primary activation domain, in the cytoplasmic portion.
  • exemplary receptors include intracellular components of CD3-zeta, CD28, and 4- IBB.
  • the CAR or other antigen receptor further includes a marker, such as a cell surface marker, which may be used to confirm transduction or engineering of the cell to express the receptor, such as a truncated version of a cell surface receptor, such as truncated EGFR (tEGFR).
  • the marker includes all or part (e.g., truncated form) of CD34, a nerve growth factor receptor (NGFR), or epidermal growth factor receptor (e.g., tEGFR).
  • the nucleic acid encoding the marker is operably linked to a polynucleotide encoding for a linker sequence, such as a cleavable linker sequence or a ribosomal skip sequence, e.g., T2A. See W02014031687.
  • introduction of a construct encoding the CAR and EGFRt separated by a T2A ribosome switch can express two proteins from the same construct, such that the EGFRt can be used as a marker to detect cells expressing such construct.
  • a marker, and optionally a linker sequence can be any as disclosed in published patent application No. WO2014031687.
  • the marker can be a truncated EGFR (tEGFR) that is, optionally, linked to a linker sequence, such as a T2A ribosomal skip sequence.
  • the marker is a molecule, e.g., cell surface protein, not naturally found on T cells or not naturally found on the surface of T cells, or a portion thereof.
  • the molecule is a non-self molecule, e.g., non-self protein, i.e., one that is not recognized as "self 1 by the immune system of the host into which the cells will be adoptively transferred.
  • the marker serves no therapeutic function and/or produces no effect other than to be used as a marker for genetic engineering, e.g., for selecting cells successfully engineered.
  • the marker may be a therapeutic molecule or molecule otherwise exerting some desired effect, such as a ligand for a cell to be encountered in vivo, such as a costimulatory or immune checkpoint molecule to enhance and/or dampen responses of the cells upon adoptive transfer and encounter with ligand.
  • the CAR may comprise one or modified synthetic amino acids in place of one or more naturally-occurring amino acids.
  • modified amino acids include, but are not limited to, aminocyclohexane carboxylic acid, norleucine, a-amino n-decanoic acid, homoserine, S- acetylaminom ethylcysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4- nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, (3 -phenylserine (3- hydroxyphenylalanine, phenylglycine, a-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, l,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid
  • CARs are referred to as first, second, and/or third generation CARs.
  • a first generation CAR is one that solely provides a CD3-chain induced signal upon antigen binding;
  • a second-generation CAR is one that provides such a signal and costimulatory signal, such as one including an intracellular signaling domain from a costimulatory receptor such as CD28 or CD 137;
  • a third generation CAR in some aspects is one that includes multiple costimulatory domains of different costimulatory receptors.
  • the chimeric antigen receptor includes an extracellular portion containing an antibody or fragment described herein. In some aspects, the chimeric antigen receptor includes an extracellular portion containing an antibody or fragment described herein and an intracellular signaling domain. In some embodiments, an antibody or fragment includes an scFv or a single-domain VH antibody and the intracellular domain contains an ITAM. In some aspects, the intracellular signaling domain includes a signaling domain of a zeta chain of a CD3- zeta (CD3) chain. In some embodiments, the chimeric antigen receptor includes a transmembrane domain linking the extracellular domain and the intracellular signaling domain.
  • the transmembrane domain contains a transmembrane portion of CD28.
  • the extracellular domain and transmembrane can be linked directly or indirectly.
  • the extracellular domain and transmembrane are linked by a spacer, such as any described herein.
  • the chimeric antigen receptor contains an intracellular domain of a T cell costimulatory molecule, such as between the transmembrane domain and intracellular signaling domain.
  • the T cell costimulatory molecule is CD28 or 41BB.
  • the CAR contains an antibody, e.g., an antibody fragment, a transmembrane domain that is or contains a transmembrane portion of CD28 or a functional variant thereof, and an intracellular signaling domain containing a signaling portion of CD28 or functional variant thereof and a signaling portion of CD3 zeta or functional variant thereof.
  • the CAR contains an antibody, e.g., antibody fragment, a transmembrane domain that is or contains a transmembrane portion of CD28 or a functional variant thereof, and an intracellular signaling domain containing a signaling portion of a 4- IBB or functional variant thereof and a signaling portion of CD3 zeta or functional variant thereof.
  • the receptor further includes a spacer containing a portion of an Ig molecule, such as a human Ig molecule, such as an Ig hinge, e.g. an IgG4 hinge, such as a hinge-only spacer.
  • the transmembrane domain of the receptor e.g., the CAR
  • the transmembrane domain of human CD28 or variant thereof e.g., a 27-amino acid transmembrane domain of a human CD28 (Accession No.: P10747.1).
  • the chimeric antigen receptor contains an intracellular domain of a T cell costimulatory molecule.
  • the T cell costimulatory molecule is CD28 or 4-1BB.
  • the intracellular signaling domain comprises an intracellular costimulatory signaling domain of human CD28 or functional variant or portion thereof, such as a 41 amino acid domain thereof and/or such a domain with an LL to GG substitution at positions 186-187 of a native CD28 protein.
  • the intracellular domain comprises an intracellular costimulatory signaling domain of 4 IBB or functional variant or portion thereof, such as a 42-amino acid cytoplasmic domain of a human 4-1BB (Accession No. Q07011.1) or functional variant or portion thereof.
  • the intracellular signaling domain comprises a human CD3 zeta stimulatory signaling domain or functional variant thereof, such as a 112 AA cytoplasmic domain of isoform 3 of human CD3.zeta. (Accession No.: P20963.2) or a CD3 zeta signaling domain as described in U.S. Pat. No. 7,446,190 or U.S. Pat. No. 8,911,993.
  • a human CD3 zeta stimulatory signaling domain or functional variant thereof such as a 112 AA cytoplasmic domain of isoform 3 of human CD3.zeta. (Accession No.: P20963.2) or a CD3 zeta signaling domain as described in U.S. Pat. No. 7,446,190 or U.S. Pat. No. 8,911,993.
  • the spacer contains only a hinge region of an IgG, such as only a hinge of IgG4 or IgGl.
  • the spacer is an Ig hinge, e.g., and IgG4 hinge, linked to a CH2 and/or CH3 domains.
  • the spacer is an Ig hinge, e.g., an IgG4 hinge, linked to CH2 and CH3 domains.
  • the spacer is an Ig hinge, e.g., an IgG4 hinge, linked to a CH3 domain only.
  • the spacer is or comprises a glycine-serine rich sequence or other flexible linker such as known flexible linkers.
  • the CAR includes an antibody or fragment thereof, including single chain antibodies (sdAbs, e.g. containing only the VH region) and scFvs, described herein, a spacer such as any of the Ig-hinge containing spacers, a CD28 transmembrane domain, a CD28 intracellular signaling domain, and a CD3 zeta signaling domain.
  • sdAbs single chain antibodies
  • scFvs described herein
  • spacer such as any of the Ig-hinge containing spacers
  • CD28 transmembrane domain e.g. containing only the VH region
  • CD28 intracellular signaling domain e.g. zeta signaling domain
  • CD3 zeta signaling domain e.g. zeta signaling domain
  • the CAR includes an antibody or fragment, including sdAbs and scFvs described herein, a spacer such as any of the Ig-hinge containing spacers, a CD28 transmembrane domain, a CD28 intracellular signaling domain, and a CD3 zeta signaling domain.
  • Chimeric antigen receptor (CAR) T cells are T cells that have been genetically engineered to produce an artificial T-cell receptor for use in immunotherapy.
  • Chimeric antigen receptors are receptor proteins that have been engineered to confer T cells with the ability to target a specific protein.
  • the genetic modification of lymphocytes (e.g. T cells) by incorporation of, for example, CARs, and administration of the engineered cells to a subject is an example of “adoptive cell therapy”.
  • the term “adoptive cell therapy” refers to cell-based immunotherapy for transfusion of autologous or allogeneic lymphocytes, referred to as T cells or B cells. In this CAR therapy approach, cells are expanded and cultured ex vivo and genetically modified, prior to transfusion.
  • T-cells are harvested from a subject — they can be autologous T-cells from the subject own blood or from a donor that will not be receiving the CAR therapy. Once isolated, the T-cells are genetically modified with a CAR, expanded ex vivo, and administered to the subject (i.e. patient) by, e.g. infusion.
  • the CARs may be introduced into the T-cells using, for example, a site-specific technique.
  • site specific integration of the transgenes e.g. CARs
  • the transgenes may be targeted to a safe harbor locus or TRAC.
  • site-specific techniques for integration into the safe harbor loci include, without limitation, homology-dependent engineering using nucleases and homology independent targeted insertion using Cas9.
  • the engineered CAR T cells have applications to immune-oncology.
  • the CAR for example, can be selected to target a specific tumor antigen.
  • cancers that can be effectively targeted using CAR T cells are blood cancers.
  • CAR T cell therapy can be used to treat solid tumors.
  • a recombinant primary immune cell comprising at least one DNA template non-virally inserted into a target region of the genome of the cell, wherein the size of the DNA template is greater than or equal to about 4.5 or 5 kilobase pairs (kb).
  • a cell comprising an insert at a target locus or safe harbor site as described in the present disclosure can be referred to as an engineered cell.
  • the immune cell is any cell that can give rise to a pluripotent immune cell.
  • the immune cell can be an induced pluripotent stem cell (iPSC) or a human pluripotent stem cell (HSPC).
  • the immune cell comprises primary hematopoietic cells or primary hematopoietic stem cells.
  • that engineered cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a natural killer (NK) cell, a T cell, a CD8+ cell, a CD4+ cell, or a T cell progenitor.
  • the immune cells are T cells.
  • the T cells are regulatory T cells, effector T cells, or naive T cells.
  • the T cells are CD8 + T cells.
  • the T cells are CD4 + T cells.
  • the T cells are CD4 + CD8 + T cells.
  • the engineered cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a T cell or a T cell progenitor.
  • immune cells include T cell, B cell, natural killer (NK) cell, NKT/iNKT cell, macrophage, myeloid cell, and dendritic cells.
  • Non-limiting examples of stem cells include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo-derived embryonic stem cells obtained by nuclear transfer (ntES; nuclear transfer ES), male germline stem cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem/progenitor stem cells (HSPCs), somatic stem cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells and stem cells of other cells (including osteocyte, chondrocyte, myocyte, cardiac myocyte, neuron, tendon cell, adipocyte, pancreocyte, hepatocyte, nephrocyte and follicle cells and so on).
  • PSCs pluripotent stem cells
  • ESCs embryonic stem cells
  • iPSCs induced pluripotent stem cells
  • embryo-derived embryonic stem cells obtained by nuclear transfer (ntES; nuclear transfer ES), male germline stem cells (
  • the engineered cells is a T cell, NK cells, iPSC, and HSPC.
  • the engineered cells used in the present disclosure are human cell lines grown in vitro (e.g. deliberately immortalized cell lines, cancer cell lines, etc.).
  • populations of cells comprising a plurality of the primary immune cell.
  • the genome of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or greater of the cells comprises a targeted insertion of a heterologous DNA template, wherein the DNA template is at least about 5 kb in size.
  • gene editing refers to a type of genetic manipulation in which DNA is inserted, replaced, or removed from the genome using artificially manipulated nucleases or “molecular scissors”. It is a useful tool for elucidating the function and effect of sequence-specific genes or proteins or altering cell behavior (e.g. for therapeutic purposes).
  • TALENs transcription activator-like effector nucleases
  • safe harbor loci e.g. the adeno-associated virus integration site 1 (AAVS1) safe harbor locus.
  • AAVS1 adeno-associated virus integration site 1
  • DICE dual integrase cassette exchange
  • phiC31 integrase and Bxbl integrase phiC31 integrase
  • Bxbl integrase a tool for target integration.
  • CRISPR/Cas9 clustered regularly interspaced short palindromic repeat/Cas9
  • Site specific gene editing approaches can include homology dependent mechanisms or homology independent mechanisms.
  • nucleotide sequences greater than about 5 kilobases in length into the genome of a cell, in the absence of a viral vector.
  • nucleotide sequence greater than about 5 kilobase in length can be inserted into the genome of a primary immune cell, in the absence of a viral vector
  • Integration of large nucleic acids for example nucleic acids greater than 5 kilobase in size, into cells, can be limited by low efficiency of integration, off-target effects and/or loss of cell viability.
  • Described herein are methods and compositions for achieving integration of a nucleotide sequence, for example, a nucleotide sequence greater than about 5 kilobases in size, into the genome of a cell. In some methods the efficiency of integration is increased, off-target effects are reduced and/or loss of cell viability is reduced.
  • FIG. 1 shows an exemplary plasmid that encodes the priming receptor and the CAR, and a schematic for its incorporation into the genome of an immune cell.
  • the plasmid is introduced into an immune cell with a nuclease, such as a CRISPR-associated system (Cas).
  • the nuclease can be introduced in a ribonucleoprotein format with a guide RNA (gRNA) that targets a specific site on the genome of the immune cell.
  • gRNA guide RNA
  • the nuclease cuts the genomic DNA at this specific site.
  • the specific site may be a portion of the genome that encodes an endogenous immune cell receptor. Thus, cutting the genome at this site will cause the immune cell to no longer express an endogenous immune cell receptor.
  • the plasmid may include 5’ and 3’ homology-directed repair arms complementary to sequences at a specific site on the genome of the immune cell.
  • the complementary sequences are on either side of the site cut by the nuclease, which allows the plasmid to be incorporated at a specified insertion site on the immune cell’s genome.
  • the cell will express the priming receptor.
  • the design of the transgene cassette ensures that non-virally delivered circuit receptors do not express CAR until the priming receptor binds to its cognate ligand and releases the cleavable transcription factor.
  • a T cell is activated.
  • the T cell may be obtained from a patient.
  • the present disclosure provides methods in which immune cells, such as T cells, are harvested from a patient.
  • the plasmid that encodes the CAR and priming receptor are introduced into a T cell.
  • the plasmids of the present disclosure can be introduced using electroporation.
  • the nuclease may also be introduced.
  • electroporation methods of the present disclosure avoid the use of viral vectors for introducing transgenes, which is a known bottleneck in immune cell engineering.
  • the T cells are then expanded and co-cultured to create a sufficient quantity of engineered immune cells to be used as a therapeutic treatment.
  • Methods for editing the genome of a cell can include a) providing a Cas9 ribonucleoprotein complex (RNP)-DNA template complex comprising: (i) the RNP, wherein the RNP comprises a Cas9 nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell, and wherein the Cas9 nuclease domain cleaves the target region to create an insertion site in the genome of the cell; and (ii) a double-stranded or single-stranded DNA template, wherein the size of the DNA template is greater than about 200 nucleotides, wherein the 5’ and 3’ ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences flanking the insertion site, and wherein the molar ratio of RNP to DNA template in the complex is from about 3: 1 to about 100: 1; and b) introducing the RNP -DNA template complex into the cell.
  • RNP Ca
  • the methods described herein provide an efficiency of delivery of the RNP -DNA template complex of at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or higher.
  • the efficiency is determined with respect to cells that are viable after introducing the RNP -DNA template into the cell.
  • the efficiency is determined with respect to the total number of cells (viable or non-viable) in which the RNP -DNA template is introduced into the cell.
  • the efficiency of delivery can be determined by quantifying the number of genome edited cells in a population of cells (as compared to total cells or total viable cells obtained after the introducing step).
  • Various methods for quantifying genome editing can be utilized. These methods include, but are not limited to, the use of a mismatchspecific nuclease, such as T7 endonuclease I; sequencing of one or more target loci (e.g., by sanger sequencing of cloned target locus amplification fragments); and high-throughput deep sequencing.
  • loss of cell viability is reduced as compared to loss of cell viability after introduction of naked DNA into a cell or introduction of DNA into a cell using a viral vector.
  • the reduction can be a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percentage in between these percentages.
  • off-target effects of integration are reduced as compared to off-target integration after introduction of naked DNA into a cell or introduction of DNA into a cell using a viral vector.
  • the reduction can be a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percentage in between these percentages.
  • the methods described herein provide for high cell viability of cells to which the RNP-DNA template has been introduced.
  • the viability of the cells to which the RNP-DNA template has been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or higher.
  • the viability of the cells to which the RNP-DNA template has been introduced is from about 20% to about 99%, from about 30% to about 90%, from about 35% to about 85% or 90% or higher, from about 40% to about 85% or 90% or higher, from about 50% to about 85% or 90% or higher, from about 50% to about 85% or 90% or higher, from about 60% to about 85% or 90% or higher, or from about 70% to about 85% or 90% or higher.
  • the molar ratio of RNP to DNA template can be from about 3: 1 to about 100: 1.
  • the molar ratio can be from about 5: 1 to 10: 1, from about 5 : 1 to about 15 : 1 , 5 : 1 to about 20 : 1 ; 5 : 1 to about 25: 1; from about 8 : 1 to about 12: 1; from about 8: 1 to about 15: 1, from about 8: 1 to about 20: 1, or from about 8: 1 to about 25: 1.
  • the DNA template is at a concentration of about 2.5 pM to about 25 pM.
  • concentration of DNA template can be about 2.5, 3, 3.5, 4,
  • the size or length of the DNA template is greater than about
  • the size of the DNA template can be about 4.5 kb to about 10 kb, about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about kb 6 to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, or about 9 kb to about 10 kb.
  • the amount of DNA template is about 1 pg to about 10 pg.
  • the amount of DNA template can be about 1 pg to about 2 pg, about 1 pg to about 3 pg, about 1 pg to about 4 pg, about 1 pg to about 5 pg, about 1 pg to about 6 pg, about 1 pg to about 7 pg, about 1 pg to about 8 pg, about 1 pg to about 9 pg, about 1 pg to about 10 pg.
  • the amount of DNA template is about 2 pg to about 3 pg, about 2 pg to about 4 pg, about 2 pg to about 5 pg, about 2 pg to about 6 pg, about 2 pg to about 7 pg, about 2 pg to about 8 pg, about 2 pg to about 9 pg, or 2 pg to about 10 pg.
  • the amount of DNA template is about 3 pg to about 4 pg, about 3 pg to about 5 pg, about 3 pg to about 6 pg, about 3 pg to about 7 pg, about 3 pg to about 8 pg, about 3 pg to about 9 pg, or about 3 pg to about 10 pg. In some embodiments, the amount of DNA template is about 4 pg to about 5 pg, about 4 pg to about 6 pg, about 4 pg to about 7 pg, about 4 pg to about 8 pg, about 4 pg to about 9 pg, or about 4 pg to about 10 pg.
  • the amount of DNA template is about 5 pg to about 6 pg, about 5 pg to about 7 pg, about 5 pg to about 8 pg, about 5 pg to about 9 pg, or about 5 pg to about 10 pg. In some embodiments, the amount of DNA template is about 6 pg to about 7 pg, about 6 pg to about 8 pg, about 6 pg to about 9 pg, or about 6 pg to about 10 pg. In some embodiments, the amount of DNA template is about 7 pg to about 8 pg, about 7 pg to about 9 pg, or about 7 pg to about 10 pg. In some embodiments, the amount of DNA template is about 8 pg to about 9 pg, or about 8 pg to about 10 pg. In some embodiments, the amount of DNA template is about 9 pg to about 10 pg.
  • the size of the DNA template is large enough and in sufficient quantity to be lethal as naked DNA.
  • the DNA template encodes a heterologous protein or a fragment thereof.
  • the DNA template encodes at least one gene.
  • the DNA template encodes at least two genes.
  • the DNA template encodes one, two, three, four, five, six, seven, eight, nine, ten, or more genes.
  • the DNA template includes regulatory sequences, for example, a promoter sequence and/or an enhancer sequence to regulate expression of the heterologous protein or fragment thereof after insertion into the genome of a cell.
  • the DNA template is a linear DNA template.
  • the DNA template is a single-stranded DNA template.
  • the single-stranded DNA template is a pure single-stranded DNA template.
  • pure single-stranded DNA is meant single-stranded DNA that substantially lacks the other or opposite strand of DNA.
  • substantially lacks is meant that the pure single-stranded DNA lacks at least 100- fold more of one strand than another strand of DNA.
  • the RNP-DNA template complex is formed by incubating the RNP with the DNA template for less than about one minute to about thirty minutes, at a temperature of about 20° C to about 25° C.
  • the RNP can be incubated with the DNA template for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes or 30 minutes or any amount of time in between these times, at a temperature of about 20° C, 21° C, 22° C, 23° C, 24° C, or 25° C.
  • the RNP can be incubated with the DNA template for less than about one minute to about one minute, for less than about one minute to about 5 minutes, for less than about 1 minute to about 10 minutes, for about 5 minutes to 10 minutes, for about 5 minutes to 15 minutes, for about 10 to about 15 minutes, for about 10 minutes to about 20 minutes, or for about 10 minutes to about 30 minutes, at a temperature of about 20° C to about 25° C.
  • the RNP-DNA template complex and the cell are mixed prior to introducing the RNP-DNA template complex into the cell.
  • introducing the RNP-DNA template complex comprises electroporation.
  • Methods, compositions, and devices for electroporating cells to introduce a RNP-DNA template complex can include those described in the examples herein. Additional or alternative methods, compositions, and devices for electroporating cells to introduce a RNP-DNA template complex can include those described in WO/2006/001614 or Kim, J. A. et al. Biosens. Bioelectron. 23, 1353-1360 (2008). Additional or alternative methods, compositions, and devices for electroporating cells to introduce a RNP-DNA template complex can include those described in U.S. Patent Appl. Pub. Nos. 2006/0094095; 2005/0064596; or 2006/0087522.
  • Additional or alternative methods, compositions, and devices for electroporating cells to introduce a RNP-DNA template complex can include those described in Li, L.H. et al. Cancer Res. Treat. 1, 341-350 (2002); U.S. Patent Nos.: 6,773,669; 7,186,559; 7,771,984; 7,991,559; 6485961; 7029916; and U.S. Patent Appl. Pub. Nos: 2014/0017213; and 2012/0088842, all of which are hereby incorporated by reference.
  • Additional or alternative methods, compositions, and devices for electroporating cells to introduce a RNP-DNA template complex can include those described in Geng, T. et al.. J. Control Release 144, 91-100 (2010); and Wang, J., et al. Lab. Chip 10, 2057-2061 (2010), all of which are hereby incorporated by reference.
  • the Cas9 protein can be in an active endonuclease form, such that when bound to target nucleic acid as part of a complex with a guide RNA or part of a complex with a DNA template, a double strand break is introduced into the target nucleic acid.
  • the double strand break can be repaired by NHEJ to introduce random mutations, or HDR to introduce specific mutations.
  • Various Cas9 nucleases can be utilized in the methods described herein. For example, a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3’ of the region targeted by the guide RNA can be utilized.
  • PAM NGG protospacer adjacent motif
  • Cas9 nucleases can be targeted to any region of a genome that contains an NGG sequence.
  • Cas9 proteins with orthogonal PAM motif requirements can be utilized to target sequences that do not have an adjacent NGG PAM sequence.
  • Exemplary Cas9 proteins with orthogonal PAM sequence specificities include, but are not limited to, CFP1, those described in Nature Methods 10, 1116-1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015, both of which are hereby incorporated by reference.
  • the Cas9 protein is a nickase, such that when bound to target nucleic acid as part of a complex with a guide RNA, a single strand break or nick is introduced into the target nucleic acid.
  • a pair of Cas9 nickases, each bound to a structurally different guide RNA, can be targeted to two proximal sites of a target genomic region and thus introduce a pair of proximal single stranded breaks into the target genomic region.
  • nickases can provide enhanced specificity because off-target effects are likely to result in single nicks, which are generally repaired without lesion by base-excision repair mechanisms.
  • Exemplary Cas9 nickases include Cas9 nucleases having a D10A or H840A mutation.
  • the RNP comprises a Cas9 nuclease. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP-DNA template complex comprises at least two structurally different RNP complexes. In some embodiments, the at least two structurally different RNP complexes contain structurally different Cas9 nuclease domains In some embodiments, the at least two structurally different RNP complexes contain structurally different guide RNAs.
  • each of the structurally different RNP complexes comprises a Cas9 nickase, and the structurally different guide RNAs hybridize to opposite strands of the target region.
  • a plurality of RNP-DNA templates comprising structurally different ribonucleoprotein complexes is introduced into the cell.
  • a Cas9 protein can be complexed with a plurality (e.g., 2, 3, 4, 5, or more, e.g., 2-10, 5-100, 20-100) of structurally different guide RNAs to target insertion of a DNA template at a plurality of structurally different target genomic regions.
  • cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells and the like.
  • the cell is a mammalian cell, for example, a human cell.
  • the cell can be in vitro, ex vivo or in vivo.
  • the cell can also be a primary cell, a germ cell, a stem cell or a precursor cell.
  • the precursor cell can be, for example, a pluripotent stem cell, or a hematopoietic stem cell.
  • the cell is a primary hematopoietic cell or a primary hematopoietic stem cell.
  • the primary hematopoietic cell is an immune cell.
  • the immune cell is a T cell.
  • the T cell is a regulatory T cell, an effector T cell, or a naive T cell.
  • the T cell is a CD4 + T cell.
  • the T cell is a CD8 + T cell.
  • the T cell is a CD4 + CD8 + T cell.
  • the T cell is a CD4'CD8' T cell.
  • the methods further comprise expanding the population of modified cells.
  • the cells are removed from a subject, modified using any of the methods described herein and administered to the patient.
  • any of the constructs described herein is delivered to the patient in vivo. See, for example, U.S. Patent No. 9737604 and Zhang et al. “Lipid nanoparticle-mediated efficient delivery of CRISPR/Cas9 for tumor therapy,” NPG Asia Materials Volume 9, page e441 (2017), both of which are hereby incorporated by reference.
  • the RNP- DNA template complex is introduced into about 1 x 10 5 to about 2 x 10 6 cells.
  • the RNP- DNA template complex can be introduced into about 1 x 10 5 to about 5 x 10 5 cells, about 1 x 10 5 to about 1 x 10 6 , 1 x 10 5 to about 1.5 x 10 6 , l x 10 5 to about 2 x 10 6 , about 1 x 10 6 to about 1.5 x 10 6 cells or about 1 x 10 6 to about 2 x 10 6 .
  • the methods and compositions described herein can be used for generation, modification, use, or control of recombinant T cells, such as chimeric antigen receptor T cells (CAR T cells).
  • CAR T cells can be used to treat or prevent cancer, an infectious disease, or autoimmune disease in a subject.
  • one or more gene products are inserted or knocked-in to a T cell to express a heterologous protein (e.g., a chimeric antigen receptor (CAR) or a priming receptor).
  • a heterologous protein e.g., a chimeric antigen receptor (CAR) or a priming receptor.
  • Methods for editing the genome of a T cell include a method of editing the genome of a human T cell comprise inserting a nucleic acid sequence or construct into a target region in exon 1 of the TCR-a subunit (TRAC) gene in the human T cell.
  • the target region is in exon 1 of the constant domain of TRAC gene.
  • the target region is in exon 1, exon 2 or exon 3, prior to the start of the sequence encoding the TCR-a transmembrane domain.
  • Methods for editing the genome of a T cell also include a method of editing the genome of a human T cell comprise inserting a nucleic acid sequence or construct into a target region in exon 1 of a TCR-P subunit (TRBC) gene in the human T cell.
  • the target region is in exon 1 of the TRBC1 or TRBC2 gene.
  • Methods for editing the genome of a T cell include a method of editing the genome of a human T cell comprise inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).
  • GSH genomic safe harbor
  • Gene editing therapies include, for example, vector integration and site specific integration.
  • Site-specific integration is a promising alternative to random integration of viral vectors, as it mitigates the risks of insertional mutagenesis or insertional oncogenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406; Porteus et al. Nat Biotechnol. 2005 23:967-973; Paques et al. Curr Gen Ther. 2007 7:49-66).
  • site specific integration continues to face challenges such as poor knock-in efficiency, risk of insertional oncogenesis, unstable and/or anomalous expression of adjacent genes or the transgene, low accessibility (e.g. within 20 kB of adjacent genes), etc.
  • SHS safe harbor loci or safe harbor sites
  • AAVS1 site on chromosome 19q which was initially identified as a site for recurrent adenoassociated virus insertion.
  • Other potential SHS have been identified on the basis of homology, with sites first identified in other species (e.g., the human homolog of the permissive murine Rosa26 locus) or among the growing number of human genes that appear non-essential under some circumstances.
  • SHS CCR5 chemokine receptor gene
  • Rosa26 Additional potential genomic SHS have been identified in human and other cell types on the basis of viral integration site mapping or gene-trap analyses, as was the original murine Rosa26 locus.
  • the AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (e.g. DNA transgenes) with expected function. It is at position 19ql3.42. It has an open chromatin structure and is transcription-competent.
  • the canonical SHS locus for AAVS1 is chrl9: 55,625,241-55,629,351. See Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference.
  • An exemplary AAVS1 target gRNA and target sequence are provided below:
  • AAVS1 -gRNA sequence • AAVS1 -gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT
  • CCR5 which is located on chromosome 3 at position 3p21.31, encodes the major co-receptor for HIV-1. Disruption at this site in the CCR5 gene has been beneficial in HIV/AIDS therapy and prompted the development of zinc-finger nucleases that target its third exon.
  • the canonical SHS locus for CCR5 is chr3: 46,414,443-46,414,942. See Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference.
  • the mouse Rosa26 locus is particularly useful for genetic modification as it can be targeted with high efficiency and is expressed in most cell types tested.
  • Irion et al. 2007 (“Identification and targeting of the ROSA26 locus in human embryonic stem cells.” Nature biotechnology 25.12 (2007): 1477-1482, the relevant disclosure of which are herein incorporated by reference) identified the human homolog, human ROSA26, in chromosome 3 (position 3p25.3).
  • the canonical SHS locus for human Rosa26 (hRosa26) is chr3: 9,415,082- 9,414,043. See Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference.
  • safe harbor sites are provided in Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference. Examples of additional integration sites are provided in Table 1. [0007] In some embodiments, the safe harbor sites allow for high transgene expression (sufficient to allow for transgene functionality or treatment of a disease of interest) and stable expression of the transgene over several days, weeks or months. In some embodiments, knockout of the gene at the safe harbor locus confers benefit to the function of the cell, or the gene at the safe harbor locus has no known function within the cell.
  • the safe harbor locus results in stable transgene expression in vitro with or without CD3/CD28 stimulation, negligible off-target cleavage as detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage relative to other loci as detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and positioned outside of a cancer-related gene.
  • a “nearby gene” can refer to a gene that is within about lOOkB, about 125kB, about 150kB, about 175kB, about 200kB, about 225kB, about 250kB, about 275kB, about 300kB, about 325kB, about 350kB, about 375kB, about 400kB, about 425kB, about 450kB, about 475kB, about 500kB, about 525kB, about 550kB away from the safe harbor locus (integration site).
  • the present disclosure contemplates inserts that comprise one or more transgenes.
  • the transgene can encode a therapeutic protein, an antibody, a peptide, a suicide gene, an apoptosis gene or any other gene of interest.
  • the transgene integration can result in, for example, enhanced therapeutic properties.
  • enhanced therapeutic properties refer to an enhanced therapeutic property of a cell when compared to a typical immune cell of the same normal cell type.
  • an NK cell having “enhanced therapeutic properties” has an enhanced, improved, and/or increased treatment outcome when compared to a typical, unmodified and/or naturally occurring NK cell.
  • the therapeutic properties of immune cells can include, but are not limited to, cell transplantation, transport, homing, viability, self-renewal, persistence, immune response control and regulation, survival, and cytotoxicity.
  • the therapeutic properties of immune cells are also manifested by: antigen-targeted receptor expression; HLA presentation or lack thereof; tolerance to the intratumoral microenvironment; induction of bystander immune cells and immune regulation; improved target specificity with reduction; resistance to treatments such as chemotherapy.
  • the term “insert size” refers to the length of the nucleotide sequence being integrated (inserted) at the target locus or safe harbor site.
  • the insert size comprises at least about 4.5 kilobasepairs (kb) to about 10 kilobasepairs (kb).
  • the insert size comprises about 5000 nucleotides or more basepairs.
  • the insert size comprises up to 4.5, 4.8, 5, 6, 7, 8, 9,
  • the insert size is greater than 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp or the sizes in between. In some embodiments, the insert size is within the range of 4.5-15 kbp or is any number in that range. In some embodiments, the insert size is within the range of 4.8-8.3 kbp or is any number in that range. In some embodiments, the insert size is within the range of 5-8.3 kbp or is any number in that range. In some embodiments, the insert size is within the range of 5-15 kbp or is any number in that range.
  • the insert size is within the range of 4.5-20 kbp or is any number in that range. In some embodiments, the insert size is 5-10 kbp. In some embodiments, the insert size is 4.5-10, 5-10, 6-10, 7-10, 8-10, 9-10 kbp. In some embodiments, the insert size is 4.5-
  • the insert size is 4.5-12, 6-
  • the insert size is 4.5-13, 6-
  • the insert size is 4.5-
  • the insert size is 4.5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, or 14-15 kbp. In some embodiments, the insert size is 4.5-16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-
  • the insert size is 4.5-17, 6-17, 7-17, 8-17, 9-
  • the insert size is 4.5-18, 6-18, 7-18, 8-18, 9-18, 10-18, 11-18, 12-18, 13-18, 14-18, 15-18, 16-18 or 17-18 kbp. In some embodiments, the insert size is 4.5-19, 6-19, 7-19, 8-19, 9-19, 10-19, 11-19, 12-19, 13-19, 14-19, 15-19, 16-19, 17-19, or 18-19 kbp. In some embodiments, the insert size is 4.5-20, 6-20, 7-20, 8-20, 9-20, 10-20, 11-20, 12-20, 13-20, 14-20, 15-20, 16-20, 17-20, 18-20, or 19-20 kbp.
  • the inserts of the present disclosure refer to nucleic acid molecules or polynucleotide inserted at a target locus or safe harbor site.
  • the nucleotide sequence is a DNA molecule, e.g., genomic DNA, or comprises deoxy-ribonucleotides.
  • the insert comprises a smaller fragment of DNA, such as a plastid DNA, mitochondrial DNA, or DNA isolated in the form of a plasmid, a fosmid, a cosmid, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), and/or any other sub-genome segment of DNA.
  • BAC bacterial artificial chromosome
  • YAC yeast artificial chromosome
  • the insert is an RNA molecule or comprises ribonucleotides.
  • the nucleotides in the insert are contemplated as naturally occuring nucleotides, non-naturally occuring, and modified nucleotides.
  • Nucleotides may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications.
  • the polynucleotides can be in any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular conformations, and other three-dimension conformations contemplated in the art.
  • the inserts can have coding and/or non-coding regions.
  • the insert can comprises a non-coding sequence (e.g., control elements, e.g., a promoter sequence).
  • the insert encodes transcription factors.
  • the insert encodes an antigen binding receptors such as single receptors, T-cell receptors (TCRs), priming receptors, CARs, mAbs, etc.
  • the inserts are RNAi molecules, including, but not limited to, miRNAs, siRNA, shRNAs, etc.
  • the insert is a human sequence.
  • the insert is chimeric.
  • the insert is a multi-gene/multi-module therapeutic cassette.
  • a multi- gene/multi -module therapeutic cassette referst to an insert or cassette having one or more than one receptor (e.g., synthetic receptors), other exogenous protein coding sequences, noncoding RNAs, transcriptional regulatory elements, and/or insulator sequences, etc.
  • the nucleic acid sequence is inserted into the genome of the T cell via non-viral delivery.
  • the nucleic acid can be naked DNA, or in a non-viral plasmid or vector.
  • Non-viral delivery techniques can be site-specific integration techniques, as described herein or known to those of ordinary skill in the art. Examples of site-specific techniques for integration into the safe harbor loci include, without limitation, homology-dependent engineering using nucleases and homology independent targeted insertion using Cas9 or other CRISPR endonucleases.
  • the insert is integrated at a safe harbor site by introducing into the engineered cell, (a) a targeted nuclease that cleaves a target region in the safe harbor site to create the insertion site; and (b) the nucleic acid sequence (insert), wherein the insert is incorporated at the insertion site by, e.g., HDR.
  • a targeted nuclease that cleaves a target region in the safe harbor site to create the insertion site
  • the nucleic acid sequence (insert) wherein the insert is incorporated at the insertion site by, e.g., HDR.
  • CRISPR-Cas e.g. CRISPR- Cas9
  • This approach incorporates the use of a guide polynucleotide (e.g. guide ribonucleic acid or gRNA) and a cas endonuclease (e.g. Cas9 endonuclease).
  • a guide polynucleotide e.g. guide ribonucleic acid or gRNA
  • a cas endonuclease e.g. Cas9 endonuclease
  • a polypeptide referred to as a “Cas endonuclease” or having “Cas endonuclease activity” refers to a CRISPR-related (Cas) polypeptide encoded by a Cas gene, wherein a Cas polypeptide is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., US Pat. No. 8,697,359). Also included in this definition are variants of Cas endonuclease that retain guide polynucleotide-dependent endonuclease activity.
  • the Cas endonuclease used in the donor DNA insertion method detailed herein is an endonuclease that introduces double-strand breaks into DNA at the target site (e.g., within the target locus or at the safe harbor site).
  • guide polynucleotide relates to a polynucleotide sequence capable of complexing with a Cas endonuclease and allowing the Cas endonuclease to recognize and cleave a DNA target site.
  • the guide polynucleotide can be a single molecule or a double molecule.
  • the guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence).
  • a guide polynucleotide comprising only ribonucleic acid is also referred to as “guide RNA”.
  • a polynucleotide donor construct is inserted at a safe harbor locus using a guide RNA (gRNA) in combination with a cas endonuclease (e.g. Cas9 endonuclease).
  • gRNA guide RNA
  • cas endonuclease e.g. Cas9 endonuclease
  • the guide polynucleotide includes a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) that is complementary to a nucleotide sequence in the target DNA, and a second nucleotide that interacts with a Cas endonuclease polypeptide.
  • It can be a double molecule (also referred to as a double-stranded guide polynucleotide) comprising a sequence domain (referred to as a Cas endonuclease recognition domain or CER domain).
  • the CER domain of this double molecule guide polynucleotide comprises two separate molecules that hybridize along the complementary region.
  • the two separate molecules can be RNA sequences, DNA sequences and/or RNA- DNA combination sequences.
  • Genome editing using CRISPR-Cas approaches relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by the RNA-guided Cas endonuclease (e.g. Cas 9 endonuclease). Homology-directed repair (HDR) of these DSBs enables precise editing of the genome by introducing defined genomic changes, including base substitutions, sequence insertions, and deletions.
  • HDR-based CRISPR/Cas9 genome-editing involves transfecting cells with Cas9, gRNA and donor DNA containing homologous arms matching the genomic locus of interest.
  • HITI hypertension independent targeted insertion
  • NHEJ non-homologous end joining
  • gRNAs Guide RNAs
  • donor plasmids lack homology arms and DSB repair does not occur through the HDR pathway.
  • the donor polynucleotide construct can be engineered to include Cas9 cleavage site(s) flanking the gene or sequence to be inserted. This results in Cas9 cleavage at both the donor plasmid and the genomic target sequence.
  • the guide RNAs and/or mRNA (or DNA) encoding an endonuclease can be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide.
  • Non-limiting examples of such moieties include lipid moieties such as a cholesterol moiety, cholic acid, a thioether, a thiocholesterol, an aliphatic chain (e.g., dodecandiol or undecyl residues), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl- rac-glycero-3-H- phosphonate, a polyamine or a polyethylene glycol chain, adamantane acetic acid, a palmityl moiety and an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety. See for example US Patent Publication No. 20180127786, the disclosure of which is herein incorporated by reference in its entirety.
  • the engineered cells, populations thereof, or compositions thereof are administered to a subject, generally a mammal, generally a human, in an effective amount.
  • the engineered cells may be administered to a subject by infusion e.g., continuous infusion over a period of time) or other modes of administration known to those of ordinary skill in the art.
  • the engineered cells provided herein not only find use in gene therapy but also in non-pharmaceutical uses such as, e.g., production of animal models and production of recombinant cell lines expressing a protein of interest.
  • the engineered cells of the present disclosure can be any cell, generally a mammalian cell, generally a human cell that has been modified by integrating a transgene at a safe harbor locus described herein.
  • the engineered cells are immune cells.
  • the engineered cells are lymphocytes.
  • the engineered cells are T cells or T cell precursors.
  • the engineered cells, compositions and methods of the present disclosure are useful for therapeutic applications such as CAR T cell therapy and TCR T cell therapy.
  • the insertion of a sequence encoding a transgene within a safe harbor locus maintains the TCR expression relative to instances when there is no insertion and enables transgene expression while maintaining TCR function.
  • the present disclosure provides methods of treating a subject in need of treatment by administering to the subject a composition comprising any of the engineered cells described herein.
  • the terms “treat,” “treatment,” and the like refer generally to obtaining a desired pharmacological and/or physiological effect.
  • treatment encompasses any treatment of a disease in a subject (e.g., mammal, e.g., human). Treatment may also refer to the administration of the engineered cells provided herein to a subject that is susceptible to the disease but has not yet been diagnosed as suffering from it, including preventing the disease from occurring; inhibiting disease progression; or reducing the disease (i.e., causing a regression of the disease). Further, treatment may stabilize or reduce undesirable clinical symptoms in subjects (e.g., patients).
  • the cells provided herein populations thereof, or compositions thereof may be administered before, during or after the occurrence of the disease or injury.
  • the subject has a disease, condition, and/or injury that can be treated and/or ameliorated by cell therapy.
  • the subject in need of cell therapy is a subject having an injury, disease, or condition, thereby causing cell therapy (e.g., therapy in which cellular material is administered to the subject).
  • cell therapy e.g., therapy in which cellular material is administered to the subject.
  • a subject in need of cell therapy includes, but is not limited to, a bone marrow transplant or stem cell transplant candidate, a subject who has received chemotherapy or radiation therapy, a hyperproliferative disease or cancer (e.g., a hematopoietic system), a subject having or at risk of developing a hyperproliferative disease or cancer), a subject having or at risk of developing a tumor (e.g., solid tumor), viral infection or virus. It is also intended to encompass subjects suffering from or at risk of suffering from a disease associated with an infection.
  • a hyperproliferative disease or cancer e.g., a hematopoietic system
  • a subject having or at risk of developing a hyperproliferative disease or cancer e.g., solid tumor
  • a tumor e.g., solid tumor
  • the present disclosure provides a composition of the present disclosure along with instructions for use.
  • the instructions for use can be present in the kits as a package insert, in the labeling of the container of the kit or components thereof, or can be in digital form (e.g. on a CD-ROM, via a link on the internet).
  • a kit can include one or more of a genome-targeting nucleic acid, a polynucleotide encoding a genome-targeting nucleic acid, a site-directed polypeptide, and/or a polynucleotide encoding a site-directed polypeptide. Additional components within the kits are also contemplated, for example, buffer (such as reconstituting buffer, stabilizing buffer, diluting buffer), and/or one or more control vectors.
  • the engineered recombinant cells provided herein can be administered as part of a pharmaceutical compositions.
  • These compositions can comprise, in addition to one or more of the recombinant cells, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • the precise nature of the carrier or other material can depend on the route of administration, e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
  • the pharmaceutical composition may comprise one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used, and one of ordinary skill in the art is capable of selecting suitable pharmaceutical excipients.
  • pharmaceutical excipients provided below are intended to be illustrative, and not limiting. Additional pharmaceutical excipients include, for example, those described in the Handbook of Pharmaceutical Excipients, Rowe el al. (Eds.) 6th Ed. (2009), incorporated by reference in its entirety.
  • compositions for oral administration can be in tablet, capsule, powder or liquid form.
  • a tablet can include a solid carrier such as gelatin or an adjuvant.
  • Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol can be included.
  • the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
  • a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
  • isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection.
  • Preservatives, stabilisers, buffers, antioxidants and/or other additives can be included, as required.
  • administration is preferably in a “therapeutically effective amount” or “prophylactically effective amount’ ’(as the case can be, although prophylaxis can be considered therapy), this being sufficient to show benefit to the individual.
  • a “therapeutically effective amount” or “prophylactically effective amount’ (as the case can be, although prophylaxis can be considered therapy), this being sufficient to show benefit to the individual.
  • the actual amount administered, and rate and time-course of administration will depend on the nature and severity of protein aggregation disease being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980.
  • a composition can be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
  • Plasmids contained homology arms homologous to sequences flanking the CRISPR target sites in the genome of 1.2kb in length.
  • T-cells were enriched from peripheral blood mononuclear cells (PBMCs) obtained from normal donor Leukopaks (STEMCELL Technologies) using Lymphoprep (STEMCELL Technologies) and the EasySep Human T-Cell Isolation Kit (STEMCELL Technologies).
  • PBMCs peripheral blood mononuclear cells
  • T- cells were subsequently activated with CD3/CD28 Dynabeads at 1 : 1 bead to cell ratio (ThermoFisher, 40203D) in TexMACS medium (Miltenyi 130-197-196) supplemented with 3% human AB serum (Gemini Bio) and 12.5 ng/ml human IL-7 and IL-15 (Miltenyi premium grade) and cultured at 37°C, 5% CO2 for 48 hours before electroporation.
  • TexMACS medium Miltenyi 130-197-196
  • human IL-7 and IL-15 Miltenyi premium grade
  • CRISPR RNP were prepared by combining 120 pM sgRNA (Synthego) targeting DNA sequence GTCAGGGTTCTGGATATCTG (TRAC, SEQ ID NO: 79), 62.5 pM sNLS- SpCas9-sNLS (Aldevron) and P3 buffer (Lonza) at a volume ratio of 5: 1 :3:6, and incubated for 15 minutes at room temperature.
  • An optimized amount of plasmid DNA determined by dose titration experiments (ranging from 0.5-3 micrograms) was mixed with 3.5 pl of RNP.
  • T-cells were counted, debeaded, centrifuged at 90 X G for 10 minutes and resuspended at 10 A 6 cells/14.5 pl of P3 with supplement added (Lonza). 14.5 pl of T-cell suspension was added to the DNA/RNP mixture, transferred to Lonza 16-well cuvette strip, and pulsed in a Lonza 4D Nucleofector System with code EH-115. Cells were allowed to rest for 15 minutes at room temperature before transfer to 96-well plates (Sarstedt) in TexMACS medium supplemented with 12.5 ng/ml human IL-7 and IL-15 (Miltenyi premium grade).
  • Transgene expression was detected by staining with anti-Myc antibody (Cell Signaling Technology clone 9B11) and anti-Flag antibody (RnD systems, clone 1042E) and analyzed on an Attune NxT Flow Cytometer.
  • Other antibodies used were live/dead Fixable Near-IR (Thermo Fisher), TCRalpha/beta antibody (BioLegend clone IP26), CD4 antibody (BioLegend clone RPA-T4), CD8 antibody (BioLegend clone SKI).
  • transgene ie. synthetic circuit
  • edited T cells were co-cultured with target cell line expressing priming antigen at 1 : 1 E:T ratio, and incubated for 24hrs. T cells were harvested and stained with anti-Myc and anti-Flag antibodies to assess for Prime Receptor and CAR expression, respectively.
  • FIG. 3 provides an overview for an experimental protocol used to show the fidelity of a synthetic circuit introduced to the TRAC locus of T cells using the tailored transgene cassette as shown in FIG. 1 and a non-viral gene editing technology.
  • the T cells include a FLAG tag that is co-expressed with the CAR and a myc-tag that is co-expressed with the priming receptor (primeR).
  • the engineered immune cells expressing the transgene insert in the TRAC locus were prepared, and initially expressed the priming receptor.
  • the engineered immune cells were then incubated for 24 hours with K562 target cells expressing the priming antigen at 1 : 1 E:T ratio. These target cells express the cognate ligand for the priming receptor.
  • T cells were harvested and stained with anti-Myc and anti-Flag antibodies to assess priming receptor and CAR expression, respectively.
  • CAR induction on edited T cells is expected in the presence of priming antigen only.
  • the engineered immune cells express the CAR.
  • FIG. 4 provides the experimental results. Analysis was readout on an Attune NxT Flow Cytometer. As shown, when the T cells were incubated alone or with the target cell K562 in the absence of the priming receptor ligand, there was very little CAR expression, but high levels of priming receptor expression. This indicates that the priming receptor is specifically expressed and activated as intended. It also indicates that, in the absence of the priming receptor ligand, very few cells express the CAR. Thus, the circuit receptor is not leaky. When the T cells were incubated with the target cells that had the priming receptor cognate protein (K562 ALPG ), many T cells show expression of the CAR. This indicates that activation of the priming receptor induces expression of the CAR.
  • K562 ALPG priming receptor cognate protein
  • FIG. 5 provides an overview for an experimental protocol used to show the fidelity of a synthetic circuit introduced to T cells using the tailored transgene cassette as shown in FIG. 1 and a non-viral gene editing technology.
  • the T cells include a FLAG tag that is coexpressed with the CAR and a myc-tag that is co-expressed with the priming receptor (primeR).
  • the engineered immune cells were prepared, and initially express the priming receptor.
  • the engineered immune cells were then incubated for 24 hours with target cells expressing the priming antigen at 1 : 1 E:T ratio. These target cells express the cognate ligand for the priming receptor.
  • T cells were harvested and stained with anti-Myc and anti-Flag antibodies to assess priming receptor and CAR expression, respectively. CAR induction on edited T cells is expected in the presence of priming antigen only. Thus, after sufficient incubation with the target cells, the engineered immune cells express the CAR.
  • FIG. 6 shows further quantitative data from two donors that show a very small percentage of T cells express the CAR in the absence of the priming receptor activation.
  • a synthetic circuit was delivered to T cells derived from 2 healthy donors using CRISPR technology.
  • the edited T cells were co-cultured with a K562 cell line expressing the cognate priming at 1: 1 E:T ratio, a negative control K562 parental cell line, or Myc beads as positive control, and incubated for 24hrs.
  • T cells were harvested and stained with anti-Myc and antiFlag antibodies to assess for Prime Receptor and CAR expression, respectively. Analysis was readout on an Attune NxT Flow Cytometer.
  • Example 2 Evaluation of large circuit expression and function following non- viral insertion
  • GS94 is a candidate integration site located on chromosome H’s distal q arm. It is within 180-350kb of the promoters for ETS1 and FLU (FIG. 7), however it is considered low-risk for integration vector gene therapy. The circuit expression and function potential of the GS94 gene was evaluated.
  • T cells underwent circuit cassette integration with PrimeR at GS79 (TRAC) integration site, GS94 integration site, and GS102 integration site.
  • sgRNA sequences for insertion are shown in Table 1. The cells were cocultured with K562 cells for 48 hours and then the PrimeR induced CAR MFI was compared to the PrimeR MFI.
  • CD3-CD28 Dynabead-activated T cells were electroporated with sgRNA/Cas9 RNPs targeting GS94, as well as HDRTs with homology arms directing HDR-mediated integration into the indicated sites.
  • the T cells were cocultured with K562 cells expressing the primeR target (K562 single expression cells) at day 7 post-electroporation. Cells were then stained with anti-FLAG antibody 48 h post initiation of coculture and analyzed on an Attune NxT flow cytometer. The results revealed that GS94 yields superior CAR induction with high prime R expression following the 48-hour coculture with the K562 cells. See FIG. 8A.
  • GS94 resulted in prime antigen-dependent CAR expression that was approximately twofold higher than the expression in several other candidate integration sites as well as the TRAC integration site. Additionally, on average, the prime receptor surface expression level was no less than 50% of expression level when using the TRAC integration site.
  • T cells that had undergone circuit cassette integration with PrimeR at GS79 (TRAC) integration site and GS94 integration site were cocultured with K562 cells expressing the primeR target (K562 single expression cells) for 48 hours. The cells were treated at a 1 : 1 effectortarget cell ratio (1 : 1 E:T)). Briefly, T cells generated as described above were cocultured with K562 cells dual expressing the primeR target and the CAR target (K562 dual expression cells) at day 7 post-electroporation. 48h post initiation of coculture, supernatants were collected and analyzed via Luminex for cytokine levels.
  • the cytokines measure were IL-2, INFg, and TNF. Cytotoxicity was analyzed by measuring luciferase activity of remaining target cells after 48h. Each of the data points in FIG. 8B represent two replicates and the lines represent the range of cytotoxicity for the replicates. As shown in FIG. 8B, the GS94 integration sites resulted in superior cytotoxic ability and cytokine secretion following the 48-hour coculture with K562 dual expression cells.
  • T cells that had undergone circuit cassette integration with PrimeR at GS79 (TRAC) integration site and GS94 integration site were cocultured with K562 dual expression cells (“K562 primeR/CAR) or K562 cells only expressing the CAR target (K562 CAR) at day 7 post-electroporation for 48 hours. 0.3, 1.0, and 3.0 E:T cell ratios were tested. See FIG. 9A and FIG. 9B.
  • cytotoxicity was analyzed by measuring luciferase activity of remaining target cells
  • the GS94 integration site resulted in equivalent cytotoxic potential to the TRAC integration site and there was no prime-independent cytotoxicity.
  • a group that had target cells only (E:T 0; Targets only) was compared to a group with an E:T cell ratio of 1.
  • supernatant was collected and analyzed via Luminex for cytokine levels to measure secretion of IL-2, INFg and TNF cytokines. See FIG. 10A and FIG. 10B.
  • the GS94 integration site resulted in equivalent cytokine secretion to the TRAC integration site and there was no prime-independent secretion of IL-2, INFg or TNF.
  • T cells that had undergone circuit cassette integration with PrimeR at GS79 (TRAC) integration site, and GS94 integration site, and GS102 integration site were cultured in vitro for 32 days.
  • the cells were treated with repetitive CD3/CD28 stimulation at days 5, 12, 19 and 28 of the experiment.
  • the cells were evaluated for CAR expression using a flow cytometry assay.
  • T cell activation through TCR did not result in primeR-independent CAR expression from circuit cassette integration at the candidate integration sites.
  • T cells generated as described above were cultured in 96-well plates, with T cell growth medium being exchanged every 2 days. At days 5, 12, 19 and 28, T cells were stimulated with 1 : 1 CD3/CD28 Dynabeads. Cells were analyzed for PrimeR expression by myc epitope tag staining, and for CAR expression by FLAG epitope tag staining at the indicated time points. Flow analysis was performed on an Attune NxT flow cytometer. Example 3: Evaluating stability of prime receptor expression from a large insert over several weeks
  • T cells that had undergone circuit cassette integration with PrimeR at the integration sites indicated in FIG. 12A were cultured in vitro for 32 days. Briefly, T cells generated as described above were cultured in 96-well plates, with T cell growth medium being exchanged every 2 days. At days 5, 12, 19 and 28, T cells were stimulated with 1 : 1 CD3/CD28 Dynabeads repetitive stimulation. Flow cytometry assays were run on days 16 and 32 using an Attune NxT flow cytometer. The cells were analyzed for PrimeR expression by myc epitope tag staining. As shown in FIGS. 12A and 12B, the GS94 integration site resulted in stable PrimeR expression over at least a 4-week period.
  • Example 4 Evaluation of on-target editing efficiency using non-viral insertion
  • iGUIDE-Seq assay was used.
  • the methods used for conducting the iGUIDE-Seq assay are illustrated in FIG. 13A and provided in Nobles et al., Genome Biology (2019), which is hereby incorporated by reference in its entitrety.
  • FIG. 13B the GS94 integration site had the highest on-target editing efficiency of the evaluated candidate integration sites.
  • FIG. 13C GS94 resulted in no putative off-target editing as observed with two donors.
  • Elevation prediction Computational predictions of potential off-target sites from (gs94) were performed using Elevation-search (algorithm described in Listberg et al. 2018. Prediction of off-target activities for the end-to-end design of CRISPR guide RNAs. Nat Biomed Engr 2, 37-48; software obtained from https://github.com/Microsoft/Elevation). All sites identified by Elevation- search were subjected to analysis using rhAmp-seq.
  • rhAmpSeq 49 candidate off-target sites for GS94 identified by iGUIDE or the Elevation prediction algorithm and the GS94 target site were characterized by rhAmpSeq (Integrated DNA Technologies, Inc.). This targeted amplification enables NGS-based quantification of the editing occurring at numerous sites simultaneously. Genomic DNA from T cells from at least 2 donors that had been treated singly with each of the following 7 guides: GS84, GS94, GS95, GS96, GS102, GS108, and GS138 (Table 1) was isolated with the GenFind V3 DNA purification system (Beckman Coulter).
  • rhAmpSeq amplification pools Two separate rhAmpSeq amplification pools were used to cover the 50 loci, the procedure was performed as recommended by Integrated DNA Technologies for each of the samples.
  • the rhAmpSeq libraries were sequenced on a MiniSeq with a Mid Output Kit (300-cycles) (Illumina).
  • the CRISPResso2 algorithm https://github.com/pinellolab/CRISPResso2 was used to determine the percentage of insertions and deletions at each of the amplified loci.
  • Statistical significance FDR-adjusted p-value ⁇ 0.001 using a chi-squared test was only observed at the GS94 site.
  • RNA-seq To evaluate changes induced by GS94 integration at the transcriptional level, a primeR/CAR circuit was integrated at the GS79 (TRAC), GS94, and GS102 integration sites. On day 6 post-integration, le6 edited cells were sorted using a BD FACSAria based on transgene expression. RNA was isolated from sorted T cells with the RNeasy kit (Qiagen). Purified RNA was converted into an NGS library using the TruSeq RNA Library Prep Kit v2 (Illumina). Libraries were sequenced on either the NovaSeq 6000 or NextSeq 550 instruments (Illumina). The STAR 2.7.3a aligner (Dobin A. et al. Bioinformatics.
  • Cytokine-independent growth assay To evaluate the safety of the primary T cells with GS94 locus KI, cytokine-independent growth assay was performed to evaluate the potential for oncogenic transformation. Briefly, primary human T cells that had undergone primeR/CAR circuit cassette integration at GS94 locus were thawed and recovered overnight. IxlO 6 cells were then seeded in one well of a 24 well-GRex plate, culturing for 5 days in the medium with or without cytokines. Cell number and viability were recorded at days 0, 3 and 5. As a positive control, IxlO 6 Jurkat cells were cultured in the medium without cytokines in parallel. As shown in FIG.
  • CRISPR reagents e.g. SpCas9 complexed with sgRNA
  • GS94-targeting CRISPR RNP showed the highest percentage of iGUIDE-seq oligo cassette trapping events of all candidates evaluated, and the control sgRNA sequences from the iGUIDE-seq paper showed similar specificities to what was reported in the original publication, suggesting that the assay performed as expected.
  • Putative off-target sites were taken from the iGUIDE-seq output, which already suggested that the putative sites were spurious. Additional target sites were predicted by a computational approach (Elevation software package). rhAmp-seq was used to prepare high- throughput sequencing libraries for each of the putative off-target sites, and the method was applied to DNA samples from T cells electroporated with CRISPR RNPs targeting the candidate target sites. The resulting NGS data were processed with CRISPResso2 software, and the frequency of insertions and deletions (indels) was taken as indication of CRISPR cleavage activity, as is common in the field.
  • indels frequency of insertions and deletions
  • T cells electroporated with GS94-targeting CRISPR RNP showed no greater frequency of indels at the set of putative off-target sites than T cells treated with CRISPR RNP targeting other sites, consistent with the GS94-targeting CRISPR RNP having no consequential or detectable off-target activity, and therefore being the most specific out of the set evaluated (FIG. 15).
  • RNA-seq libraries were prepared and sequenced, and analysis of the resulting Illumina sequencing data revealed no biologically or statistically significant differences in expression of any genes within 300kb of the GS94 site in cells with integrations at GS94 compared to cells with integration at TRAC or the GS102 sites (FIG. 16). Furthermore, other gene expression differences that reached statistical significance were minimal in number and in effect size, consistent with them being noise in the comparison.
  • Plasmids contained homology arms homologous to sequences flanking the CRISPR target sites in the genome of 1.2kb or 450 bp in length.
  • T-cells were enriched from peripheral blood mononuclear cells (PBMCs) obtained from normal donor Leukopaks (STEMCELL Technologies) using Lymphoprep (STEMCELL Technologies) and the EasySep Human T-Cell Isolation Kit (STEMCELL Technologies).
  • PBMCs peripheral blood mononuclear cells
  • T- cells were subsequently activated with CD3/CD28 Dynabeads at 1 : 1 bead to cell ratio (ThermoFisher, 40203D) in TexMACS medium (Miltenyi 130-197-196) supplemented with 3% human AB serum (Gemini Bio) and 12.5 ng/ml human IL-7 and IL-15 (Miltenyi premium grade) and cultured at 37°C, 5% CO2 for 48 hours before electroporation.
  • TexMACS medium Miltenyi 130-197-196
  • human IL-7 and IL-15 Miltenyi premium grade
  • CRISPR RNP were prepared by combining 120 pM sgRNA (Synthego) targeting DNA sequence GAGCCATGCTTGGCTTACGA (GS94, SEQ ID NO: 94), 62.5 pM sNLS- SpCas9-sNLS (Aldevron) and P3 buffer (Lonza) at a volume ratio of 5: 1 :3:6, and incubated for 15 minutes at room temperature.
  • An optimized amount of plasmid DNA determined by dose titration experiments (ranging from 0.5-3 micrograms) was mixed with 3.5 pl of RNP.
  • T-cells were counted, debeaded, centrifuged at 90 X G for 10 minutes and resuspended at 10 A 6 cells/14.5 pl of P3 with supplement added (Lonza). 14.5 pl of T-cell suspension was added to the DNA/RNP mixture, transferred to Lonza 384-well nucleocuvette plate, and pulsed in a Lonza HT Nucleofector System with code EH-115. Cells were allowed to rest for 15 minutes at room temperature before transfer to 96-well plates (Sarstedt) in TexMACS medium supplemented with 12.5 ng/ml human IL-7 and IL-15 (Miltenyi premium grade).
  • Transgene expression was detected by staining with anti-Myc antibody (Cell Signaling Technology clone 9B11) and anti-Flag antibody (RnD systems, clone 1042E) and analyzed on an Attune NxT Flow Cytometer.
  • Other antibodies used were live/dead Fixable Near-IR (Thermo Fisher), TCRalpha/beta antibody (BioLegend clone IP26), CD4 antibody (BioLegend clone RPA-T4), CD8 antibody (BioLegend clone SKI).
  • transgene ie. synthetic circuit
  • edited T cells were co-cultured with target cell line expressing priming antigen at 1 : 1 E:T ratio, and incubated for 24hrs. T cells were harvested and stained with anti-Myc and anti-Flag antibodies to assess for Prime Receptor and CAR expression, respectively.
  • Example 7 In vivo use of T cells comprising a CAR expressing cassette
  • T cells with a transgene cassette expressing a CAR recognizing a tumor antigen, or a CAR recognizing a tumor antigen under control of a priming receptor recognizing an antigen in the anatomical vicinity of the tumor, is assessed against human tumor cells such as K562 engineered to express the CAR antigen or to express antigens recognized by both the priming receptor and the CAR.
  • Tumor cells e.g. Ie6
  • Tumor growth is assessed by dimensional measurement by calipers every 2-4 days.
  • mice are intravenously injected with 5e6 T cells with a CAR or primeR-CAR circuit cassette integrated at a specific site by CRISPR-mediated insertion, or with T cells engineered with CRISPR RNP alone, or with PBS alone as a sham injection.
  • mice are euthanized when tumor volume reaches 2000 cubic mm.
  • Peripheral blood is bled from mice through a retro-orbital procedure, and flow cytometry and/or ddPCR is used to observe engineered T cell expansion over time.
  • spleen, blood, tumor and/or other tissue is analyzed via flow cytometry, ddPCR, and/or immunohistochemistry for the presence of engineered T cells.
  • the results demonstrate that T cells engineered with cassette integration at one of the defined genomic loci lead to tumor regression and clearance in injected mice as compared to T cells without cassette integration, and that engineered T cells are detectable in the peripheral blood and tissues of injected mice.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2021/048066 2020-08-28 2021-08-27 Engineered immune cells with priming receptors Ceased WO2022047237A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
JP2023514105A JP2023543137A (ja) 2020-08-28 2021-08-27 プライミング受容体で操作された免疫細胞
EP21862873.3A EP4204575A4 (en) 2020-08-28 2021-08-27 IMMUNE CELLS MODIFIED WITH PRIMING RECEPTORS
MX2023002455A MX2023002455A (es) 2020-08-28 2021-08-27 Células inmunitarias modificadas con receptores cebadores.
AU2021334366A AU2021334366A1 (en) 2020-08-28 2021-08-27 Engineered immune cells with priming receptors
CA3191148A CA3191148A1 (en) 2020-08-28 2021-08-27 Engineered immune cells with priming receptors
CN202180073716.2A CN116529364A (zh) 2020-08-28 2021-08-27 具有启动受体的工程化免疫细胞
IL300994A IL300994A (en) 2020-08-28 2021-08-27 Transgenic immune cells with priming receptors
KR1020237010538A KR20230083275A (ko) 2020-08-28 2021-08-27 프라이밍 수용체를 갖는 조작된 면역 세포
US18/114,981 US20230340409A1 (en) 2020-08-28 2023-02-27 Engineered immune cells with priming receptors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063072080P 2020-08-28 2020-08-28
US63/072,080 2020-08-28

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/114,981 Continuation US20230340409A1 (en) 2020-08-28 2023-02-27 Engineered immune cells with priming receptors

Publications (1)

Publication Number Publication Date
WO2022047237A1 true WO2022047237A1 (en) 2022-03-03

Family

ID=80352430

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/048066 Ceased WO2022047237A1 (en) 2020-08-28 2021-08-27 Engineered immune cells with priming receptors

Country Status (10)

Country Link
US (1) US20230340409A1 (cg-RX-API-DMAC7.html)
EP (1) EP4204575A4 (cg-RX-API-DMAC7.html)
JP (1) JP2023543137A (cg-RX-API-DMAC7.html)
KR (1) KR20230083275A (cg-RX-API-DMAC7.html)
CN (1) CN116529364A (cg-RX-API-DMAC7.html)
AU (1) AU2021334366A1 (cg-RX-API-DMAC7.html)
CA (1) CA3191148A1 (cg-RX-API-DMAC7.html)
IL (1) IL300994A (cg-RX-API-DMAC7.html)
MX (1) MX2023002455A (cg-RX-API-DMAC7.html)
WO (1) WO2022047237A1 (cg-RX-API-DMAC7.html)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023205724A3 (en) * 2022-04-20 2023-11-30 Arsenal Biosciences, Inc. Cells comprising a suppressor of gene expression and/or a synthetic pathway activator and/or an inducible payload
WO2023225059A3 (en) * 2022-05-17 2024-01-04 Arsenal Biosciences, Inc. Systems of engineered receptors targeting psma and ca9
WO2024192100A1 (en) * 2023-03-13 2024-09-19 Arsenal Biosciences, Inc. Synthetic pathway activators
US12257304B2 (en) 2023-03-03 2025-03-25 Arsenal Biosciences, Inc. Systems targeting PSMA and CA9
EP4232049A4 (en) * 2020-10-26 2025-06-18 Arsenal Biosciences, Inc. Safe harbor loci

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN121674486A (zh) * 2026-02-10 2026-03-17 潍坊吉涛医学科技有限公司 基于慢病毒载体的羊膜细胞永生化建系方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200149070A1 (en) * 2018-04-24 2020-05-14 Ligandal, Inc. Methods and compositions for genome editing

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018175636A2 (en) * 2017-03-22 2018-09-27 Novartis Ag Compositions and methods for immunooncology
SG11202004026QA (en) * 2017-10-30 2020-05-28 Pact Pharma Inc Primary cell gene editing
CN110184301B (zh) * 2018-04-28 2023-02-24 辉大(上海)生物科技有限公司 通过Tild-CRISPR实现高效精确的靶向整合
EP4034640A4 (en) * 2019-09-23 2023-10-25 Regents Of The University Of Minnesota GENETICALLY EDITED IMMUNE CELLS AND THERAPY METHODS
MX2023004822A (es) * 2020-10-26 2023-05-10 Arsenal Biosciences Inc Loci de puerto seguro.
JP2024512608A (ja) * 2021-03-24 2024-03-19 ジェネンテック, インコーポレイテッド Tリンパ球における効率的なtcr遺伝子編集
US20240352487A1 (en) * 2021-08-11 2024-10-24 UNIVERSITé LAVAL Mtor -targeted modification and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200149070A1 (en) * 2018-04-24 2020-05-14 Ligandal, Inc. Methods and compositions for genome editing

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ROYBAL ET AL.: "Precision Tumor Recognition by T Cells With Combinatorial Antigen-Sensing Circuits", CELL, vol. 164, no. 4, 11 February 2016 (2016-02-11), pages 770 - 779, XP029416808, DOI: 10.1016/j.cell.2016.01.011 *
See also references of EP4204575A4 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4232049A4 (en) * 2020-10-26 2025-06-18 Arsenal Biosciences, Inc. Safe harbor loci
WO2023205724A3 (en) * 2022-04-20 2023-11-30 Arsenal Biosciences, Inc. Cells comprising a suppressor of gene expression and/or a synthetic pathway activator and/or an inducible payload
WO2023225059A3 (en) * 2022-05-17 2024-01-04 Arsenal Biosciences, Inc. Systems of engineered receptors targeting psma and ca9
US12257304B2 (en) 2023-03-03 2025-03-25 Arsenal Biosciences, Inc. Systems targeting PSMA and CA9
WO2024192100A1 (en) * 2023-03-13 2024-09-19 Arsenal Biosciences, Inc. Synthetic pathway activators

Also Published As

Publication number Publication date
EP4204575A1 (en) 2023-07-05
EP4204575A4 (en) 2025-07-09
AU2021334366A1 (en) 2023-05-11
IL300994A (en) 2023-04-01
AU2021334366A9 (en) 2024-06-13
CA3191148A1 (en) 2022-03-03
MX2023002455A (es) 2023-05-16
KR20230083275A (ko) 2023-06-09
JP2023543137A (ja) 2023-10-13
US20230340409A1 (en) 2023-10-26
CN116529364A (zh) 2023-08-01

Similar Documents

Publication Publication Date Title
US20230340409A1 (en) Engineered immune cells with priming receptors
US12037407B2 (en) Immune cells having co-expressed shRNAS and logic gate systems
US20220235380A1 (en) Immune cells having co-expressed shrnas and logic gate systems
US20250049854A1 (en) Cells comprising a suppressor of gene expression and/or a syntheticpathway activator and/or an inducible payload
US20250082682A1 (en) Systems of engineered receptors targeting psma and ca9
US20250270288A1 (en) Synthetic pathway activators
HK40098586A (zh) 具有启动受体的工程化免疫细胞
EP4701654A2 (en) Novel receptors for transcription regulation
WO2024259376A2 (en) Non-viral cell engineering
HK40120803A (zh) 靶向psma和ca9的工程化受体的系统

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21862873

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2023514105

Country of ref document: JP

Kind code of ref document: A

Ref document number: 3191148

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 300994

Country of ref document: IL

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023003775

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 202347020999

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021862873

Country of ref document: EP

Effective date: 20230328

WWE Wipo information: entry into national phase

Ref document number: 202180073716.2

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2021334366

Country of ref document: AU

Date of ref document: 20210827

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112023003775

Country of ref document: BR

Free format text: APRESENTE, NO PRAZO DE 60 (SESSENTA) DIAS, NOVAS FOLHAS DE REIVINDICACOES DE ACORDO COM A INSTRUCAO NORMATIVA NO 31/2013, UMA VEZ QUE A PETICAO 870230038397 ESTA FORA DO FORMATO PADRAO.APRESENTE, NO PRAZO DE 60 (SESSENTA) DIAS, NOVA FOLHA DE RESUMO CONTENDO O TITULO MODIFICADO DA PETICAO 870230038370 EM DESTAQUE DE ACORDO COM O ART. 22 DA INSTRUCAO NORMATIVA NO 31/2013.COM BASE NA PORTARIA 405 DE 21/12/2020, SOLICITA-SE QUE SEJA APRESENTADO, EM ATE 60 (SESSENTA) DIAS, NOVO CONTEUDO DE LISTAGEM DE SEQUENCIA POIS O CONTEUDO APRESENTADO NA PETICAO NO 870230038370 POSSUI O CAMPO 140 COM DADO DIVERGENTE E O O CAMPO 141 FORA DO FORMATO PADRAO (DIA/MES/ANO).

ENP Entry into the national phase

Ref document number: 112023003775

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230228

WWW Wipo information: withdrawn in national office

Ref document number: 2021862873

Country of ref document: EP