WO2022042165A1 - Anti-tetanus toxin fully humanized neutralizing antibody and application thereof - Google Patents

Abstract

Disclosed in the present application is an anti-tetanus toxin fully humanized monoclonal antibody. The antibody has a unique CDR region, is combined with a heavy chain N-terminal structural domain TeNT-H_N of tetanus toxin, and has the affinity of 0.545 nM. The antibody can effectively neutralize tetanus toxin and can completely protect mice attacked by tetanus toxin. The antibody provided by the present invention has a unique action site which is different from the action site of an anti-tetanus toxin monoclonal antibody in the prior art, such that the antibody has the potential of forming cocktail combination therapy with other neutralizing antibodies.

Description

A fully human neutralizing antibody against tetanus toxin and its application technical field

The invention discloses a monoclonal antibody, which belongs to the technical field of immunology and microbiology.

Background technique

Tetanus is a bacterial infection caused by Clostridium tetani (C. tetani). Clostridium tetani invades the human body through skin or mucosal wounds, grows and reproduces in an oxygen-deficient environment, and produces toxins that cause muscle spasms and autonomic nervous system dysfunction. Without medical intervention, the mortality rate is extremely high. Spores of Clostridium tetani are widespread in the environment and can infect wounds, minor abrasions and, in neonatal tetanus, the umbilical cord stump of a newborn. Although tetanus is rare in developed countries, it remains a huge diagnostic and treatment challenge in many low- and middle-income countries. An estimated 34,019 deaths were caused by neonatal tetanus in 2015. Tetanus that occurs outside the neonatal period is not a reportable disease in many countries, and few countries where tetanus is common have robust reporting systems or accurate incidence data. Nonetheless, there are numerous case reports in the internationally published literature, suggesting that tetanus remains a significant problem. According to the Global Burden of Disease (GBD) survey, an estimated 56,743 people died from tetanus in 2015. In developed countries, tetanus cases are occasionally reported, most often in the elderly population (≥60 years) or in injecting drug users.

Fortunately, tetanus is a vaccine-preventable disease. In 1924, the tetanus toxoid (TT) vaccine was introduced. One dose of tetanus toxoid produces little lasting immunity, a second immunization protects about 90% of individuals within 2-4 weeks, but immunity is short-lived in many individuals, and a third immunization ensures at least 5 Years of Universal Protection. Because the vaccine is effective against tetanus, the DTP vaccine, which consists of the pertussis vaccine and diphtheria toxoid, has become part of the childhood immunization program. However, tetanus cannot be eradicated due to the widespread presence of the causative agent, Clostridium tetani, in the environment.

Tetanus toxin (TeNT) is a potent neurotoxin produced as a single-chain protein of 150kDa that is post-translationally modified to form a heavy chain HC and a light chain LC linked by disulfide bonds, the HC of which is further subdivided are the C-terminal domain H _C and the N-terminal domain H _N . Hc mediates the binding of toxins to receptors on the cell surface, which is the first step in the entry of toxins into cells; HN _mediates the translocation of light chains to the cytoplasm. The light chain is a 50kDa metalloprotease responsible for the toxin effect. Tetanus toxin binds to the presynaptic membrane at the neuromuscular junction, followed by internalization and retrograde transport within motor neurons via the endogenous microtubule axonal pathway. This toxin is transported across cells and taken up by presynaptic inhibitory neurons, where the light chain is released into the cytoplasm. The substrate of this toxin is vesicle-associated membrane protein 2 (VAMP2), a soluble NSF attachment protein receptor required for synaptic vesicle docking and neurotransmitter release receptor, SNARE) complex. Cleavage of tetanus toxin at a specific peptide bond of VAMP2 (between Gln 76 and Phe 77) prevents the formation of the SNARE complex, thereby preventing calcium-mediated exocytosis. As a result, inhibitory signals from the motor nerves are reduced, leading to the characteristic spasms in tetanus symptoms. Tetanus toxin also has binding activity to central excitatory synapses and can bind to sympathetic adrenergic neurons, which may lead to autonomic dysregulation in tetanus clinical symptoms. Therefore, anti-TeNT-H _C antibodies can block the binding of toxins to cell surface receptors, thereby preventing toxins from entering cells for neutralization; anti-TeNT-H _N antibodies can neutralize by inhibiting the translocation of light chains to the cytoplasm effect.

technical problem

Treatment of tetanus includes prevention of toxin absorption, control of muscle spasms, and supportive care. Antitoxins and antibiotics are currently the only specific treatments available. Antitoxin is an antitoxin globulin preparation prepared by immunizing humans or animals (usually horses) with tetanus toxoid, and purified by pepsin digestion, which can specifically neutralize tetanus toxin and effectively treat tetanus. However, antitoxins derived from animals (horses) are heterologous proteins to the human body, which are prone to cause allergic reactions and also have the risk of transmitting zoonotic infectious diseases. Compared with equine antitoxin, human tetanus immune globulin (TIG) obtained from immunized healthy people is less likely to cause allergic reactions, but it still has the limitations of small production scale, high cost and the risk of infectious disease transmission.

Neutralizing antibodies can play an effective protective effect as an active ingredient of antitoxin. With the development of genetic engineering, fully human monoclonal antibodies show more and more advantages, and their safety, efficacy and relevance in human diseases have been significantly improved compared with traditional polyclonal antibodies or murine monoclonal antibodies . It has been reported in the literature that monoclonal antibodies against bacterial toxins such as Bacillus anthracis protective antigen and botulinum toxin can provide complete protection against corresponding pathogens in animals. The purpose of the present invention is to provide a fully human monoclonal neutralizing antibody against tetanus toxin, and then provide its application in the preparation of tetanus preventive and/or therapeutic drugs.

technical solutions

Based on the above purpose, the present invention first provides a humanized monoclonal antibody against tetanus toxin, the amino acid sequences of the heavy chain variable region CDR1, CDR2 and CDR3 regions of the antibody are as shown in SEQ ID NO: 1, 26-33, 51-58, 97-108 positions; the antibody light chain variable region CDR1, CDR2 and CDR3 regions amino acid sequences are respectively shown in the 27-37, 55-57, 94-102 position sequences of SEQ ID NO:5 Show.

In a preferred embodiment, the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO:1, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO:5. The monoclonal antibody having the heavy chain variable region and light chain variable region is designated "T3" in this application.

In a more preferred embodiment, the amino acid sequence of the antibody heavy chain constant region is shown in SEQ ID NO: 3, and the amino acid sequence of the antibody light chain constant region is shown in SEQ ID NO: 7 or SEQ ID NO: 9 shown.

Secondly, the present invention also provides a polynucleotide encoding the above-mentioned monoclonal antibody heavy chain and/or light chain, the polynucleotide sequence encoding the heavy chain variable region of the antibody is shown in SEQ ID NO: 2, The polynucleotide sequence encoding the light chain variable region of the antibody is shown in SEQ ID NO:6.

In a preferred embodiment, the sequence of the polynucleotide encoding the constant region of the heavy chain of the antibody is shown in SEQ ID NO: 4, and the sequence of the polynucleotide encoding the constant region of the light chain of the antibody is shown in SEQ ID NO: 8 or SEQ ID NO:10.

Third, the present invention also provides a functional element for expressing the above-mentioned polynucleotide encoding the heavy chain and/or light chain of the monoclonal antibody.

In a preferred embodiment, the functional element is a linear expression cassette.

In another preferred embodiment, the functional element is a mammalian expression vector.

Fourth, the present invention also provides a host cell containing the above functional elements.

In a preferred embodiment, the cells are Expi 293F cells.

In another preferred embodiment, the cells are CHO-S cells. In the present invention, CHO-S cells can be used to construct stable transgenic cell lines to realize industrial production.

Fifth, the present invention provides a composition containing the above monoclonal antibody.

In a preferred embodiment, the composition further comprises an antibody against the C-terminal domain of the heavy chain of tetanus toxin.

Finally, the present invention provides the application of the above monoclonal antibody in the preparation of tetanus preventive and/or therapeutic drugs.

technical effect

The antibody provided by the present invention has a unique CDR region and binds to the heavy chain N-terminal domain of tetanus toxin with an affinity of 0.545nM. The antibody can effectively neutralize tetanus toxin and can completely protect mice challenged with tetanus toxin. The antibody provided by the present invention has a unique action site, which is different from the action site of the anti-tetanus toxin monoclonal antibody in the prior art, suggesting that it has a unique action site with other non-binding heavy chain N-terminal domains of tetanus toxin. Neutralizing antibodies, especially those that specifically bind to the C-terminal domain of the heavy chain of tetanus toxin, constitute the potential for cocktail combination therapy.

Description of drawings

Figure 1. Flow cytometry sorting flow chart;

Figure 2. Amplified antibody variable region gene nucleic acid electropherogram;

Figure 3. Schematic diagram of linear expression box;

Figure 4. Binding activity of antibody expression supernatant to TT;

Figure 5. Binding curves of T3 to TT and TeNT _- HC;

Figure 6. The curve diagram of the protection rate of T3 to the challenge mice as a function of time;

Figure 7. The results of the antibody competition binding TT experiment;

Figure 8. The binding kinetics curve of T3 and TT;

Figure 9. Western Blot plot of T3 binding to TT and TeNT _- HC.

detailed description

The present invention will be further described below with reference to specific embodiments, and the advantages and characteristics of the present invention will become clearer with the description. However, these embodiments are only exemplary, and do not constitute any limitation to the protection scope defined by the claims of the present invention.

Example 1. Screening and preparation of monoclonal antibodies

1. Collection of blood samples

After obtaining informed consent, collect recombinant tetanus vaccine (the main component is recombinant tetanus toxin heavy chain _C -terminal domain TeNT-HC, GenBank: AF154828) clinical trial subjects 28 days after the second immunization blood sample 10mL, with in subsequent experiments.

2. FITC-labeled tetanus toxoid (TT)

Specific memory B cells need to be sorted by fluorescently labeled antigen. The method of FITC-labeled tetanus toxoid (TT) is as follows:

1) Fluorescein Isothiocyanate_FITC (SIGMA, F4274) was dissolved in DMSO at a concentration of 20 mg/mL.

2) Take 100 μL of 3.3 mg/mL TT solution, add pH 9.6 carbonate buffer to 400 μL.

3) Add 8 μL of FITC to the TT solution, and incubate at 4°C for 3h in the dark.

4) Use a 50kDa ultrafiltration tube to change the solution with PBS until the filtrate is transparent and colorless. Wrap the labeled protein in tin foil and store at 4°C until use.

3. Flow Sorting of Memory B Cells

The collected blood samples were separated from PBMC by Ficoll density gradient centrifugation. The process is as follows:

1) Take fresh anticoagulated whole blood, EDTA anticoagulation, and dilute the whole blood with an equal volume of PBS.

2) Add a certain volume of separation liquid to the centrifuge tube, and spread the diluted blood sample above the liquid surface of the separation liquid to keep the interface between the two liquid surfaces clear; separation liquid, anticoagulated undiluted whole blood, PBS (or normal saline) ) volume is 1:1:1.

3) Balanced, room temperature, horizontal rotor 800g, acceleration 3acc, centrifugation for 30 minutes.

4) After the centrifugation, the bottom of the tube is red blood cells, the middle layer is the separation liquid, the top layer is the plasma/tissue homogenate layer, and a thin and dense buffy coat is between the plasma layer and the separation liquid layer, that is: a single nucleus Layer of cells (including lymphocytes and monocytes); carefully pipette the buffy coat into another centrifuge tube.

5) Dilute to a certain volume with PBS, invert and mix; at room temperature, with a horizontal rotor at 300 g, centrifuge for 10 minutes, discard the supernatant; repeat washing twice.

6) Resuspend lymphocytes with PBS for use.

7) Count the cells used for sorting, take 1×10 ⁶ cells in a volume of 100 μL, add 5 kinds of fluorescent dyes in the amount recommended in Table 1, and incubate at 4°C for 1 h in the dark.

Table 1. Flow sorting of fluorescent antibodies/antigens

mark	fluorescence	Company/Item No.	Volume (per 1×10 6 cells)
TT	FITC	SIGMA, F4274	2μL
IgG	PE	BD, 555787	40μL
CD19	Alexa Fluor 700	Beckman, IM2470	10μL
CD3	PerCP	BD, 552851	20μL
CD27	PE-Cy7	Beckman, A54823	10μL

8) Repeat washing 2-3 times with PBS containing 2% FBS, resuspend in 400 μL of FPBS, remove cell clusters with a 40 μm cell sieve, and store at 4°C in the dark for sorting.

9) TT-specific single memory B cells were sorted using a cell sorter (SONY, SH800S). The sorting strategy is: CD3 ⁻ /CD19 ⁺ /IgG ⁺ /CD27 ⁺ /TT ⁺ , as shown in Figure 1, the lymphocytes are circled in A, CD3 ⁻ /CD19 ⁺ B cells are circled in B, and the B cells are circled in C IgG ⁺ /CD27 ⁺ memory B cells, TT ⁺ memory B cells are circled in D. A single memory B cell was directly sorted into a 96-well plate, each well containing 5U RNase inhibitor and 19.8 μL RNase-free water, and stored at -80°C.

4. Single-cell PCR amplification of fully human mAbs

1) Reverse transcription PCR

180 TT-specific memory B cells were obtained by sorting, and all the following specific primers for each subtype of heavy chain (H), κ light chain and λ light chain were added to each reaction system at the same time (see Table 2 for primer sequences) .

Primers:

H: 5'L-VH 1, 5'L-VH 3, 5'L-VH 4/6, 5'L-VH 5, HuIgG-const-anti, 3'Cm CH1.

κ: 5′L Vκ1/2, 5′L Vκ3, 5′L Vκ4, 3′Cκ543–566.

λ: 5'L Vλ1, 5'L Vλ2, 5'L Vλ3, 5'L Vλ4/5, 5'L Vλ6, 5'L Vλ7, 5'L Vλ8, 3'Cλ.

Table 2. Reverse Transcription PCR Primers

The PCR reaction system includes: 6 μL of 5× buffer, 1.2 μL of dNTP, 1.2 μL of reverse transcriptase, the primers are as above, the template is single cell, and the water is supplemented to 30 μL.

The PCR reaction conditions were: reverse transcription at 50°C for 30 minutes, pre-denaturation at 95°C for 15 minutes, followed by 40 cycles of 95°C for 40 seconds, 55°C for 30 seconds, 72°C for 1 minute, and a final extension at 72°C for 10 minutes.

2) Nested PCR

Using the reverse transcription product as a template, three nested PCR reactions were performed to amplify H, κ, and λ. The specific process is as follows:

Primers:

H: VH3a-sense, VH3b-sense, MuD, PW-Cgamma.

κ: 5'Pan Vκ, 3'Cκ494–516.

λ: 5'AgeI Vλ1, 5'AgeI Vλ2, 5'AgeI Vλ3, 5'AgeI Vλ4/5, 5'AgeI Vλ6, 5'AgeI Vλ7/8, 3'XhoI Cλ.

Table 3. Nested PCR primers

The PCR reaction system includes: 2.5 μL of 10× buffer, 0.5 μL of 10 mM dNTP, 0.25 μL of DNA polymerase, the primers are as above, the template is 1 μL of reverse transcription product, and the water is filled to 25 μL.

PCR reaction conditions were: 94°C for 4 minutes of pre-denaturation, followed by 40 cycles of 94°C for 30 seconds, 57°C for 30 seconds, 72°C for 45 seconds, and a final extension at 72°C for 10 minutes.

3) Agarose gel electrophoresis

A clone in which both the heavy chain and light chain genes were successfully amplified in a single cell was considered to be a paired clone. After 5 μL of nested PCR amplification products were subjected to 1% agarose gel electrophoresis, the paired positive clones were sequenced. The sequence of the antibody variable region obtained by sequencing was analyzed with Vector NTI software and IMGT website, and the antibody protein expression and analysis were carried out. Functional Verification. Figure 2 is the identification map of agarose gel electrophoresis after nested PCR amplification of H, κ and λ genes. Only when the heavy chain and light chain variable region genes were amplified from the same memory B cells, they were considered to be naturally paired antibody genes, and the corresponding nested PCR products were sequenced for further study.

5. Linear Expression Cassettes to Express Antibodies

Through the above reverse transcription reaction, 25 paired antibody sequences were obtained from single-cell clones. If the traditional cloning and expression method is time-consuming and laborious, the antibody can be rapidly expressed by constructing a linear expression cassette. The basic principle of this method is that the promoter sequence (GenBank No.: X03922.1), the coding sequence of the antibody leader peptide, the antibody variable region (obtained from a single cell), the antibody constant region (produced by Biosynthesis, the heavy chain constant region sequence is shown by SEQ ID NO:3, the DNA coding sequence is shown by SEQ ID NO:4, the kappa chain constant region sequence is shown by SEQ ID NO:7, the DNA coding sequence is shown by SEQ ID NO:7 NO: 8, the λ light chain constant region sequence is shown by SEQ ID NO: 9, the DNA coding sequence is connected by SEQ ID NO: 10), poly A tail (GenBank No.: X03896.1), the linear The form of DNA is transfected into cells for antibody expression.

The specific process is as follows:

1) Using pSec Tag2 (Invitrogen) as a template, amplify the promoter-leader sequence fragment and the poly A tail fragment.

The PCR reaction system for amplifying the promoter-leader sequence fragment includes: template plasmid pSec Tag2 (Invitrogen) 1 ng, 10× buffer 5 μL, 10 mM dNTP 1 μL, DNA polymerase 0.5 μL, primer 5'CMV-FORWARD (CGATGTAGGGCCAGATATACGCGTTG), Primer 3'leader-sequence (GTCACCAGTGGAACCTGGAACCCA), supplemented with water to 50 μL.

The PCR reaction system for amplifying the poly-A tail fragment includes: template plasmid pSec Tag2 (Invitrogen) 1ng, 10× buffer 5μL, 10mM dNTP 1μL, DNA polymerase 0.5μL, primer 5'POLY(A) (GCCTCGACTGTGCCTTCTAGTTGC), Primer 3'POLY(A)(TCCC CAGCATGCCTGCTATTGTCT), make up to 50μL with water.

The PCR reaction conditions were: pre-denaturation at 94°C for 4 minutes, followed by 30 cycles of 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 1 minute, and a final extension at 72°C for 10 minutes.

2) Amplify the constant region of the antibody.

The H chain constant region PCR system includes: heavy chain constant region template 10ng, 10× buffer 5μL, 10mM dNTP 1μL, DNA polymerase 0.5μL, primer 5'CH (ACCAAGGGCCCATCGGTCTTCCCC), primer 3'CH (GCAACTAGAAGGCACAGTCGAGGCTTTACCCGGAGACAGGGA), water supplement Make up to 50 μL.

The kappa chain constant region PCR system includes: kappa chain constant region template 10ng, 10× buffer 5μL, 10mM dNTP 1μL, DNA polymerase 0.5μL, primer 5'Cκ (ACTGTGGCTGCACCATCTGTCTTC), primer 3'Cκ (GCAACTAGAAGGCACAGTCGAGGCACACTCTCCCCTGTTGAAGCT), water supplement Make up to 50 μL.

The λ chain constant region PCR system includes: λ chain constant region template 10ng, 10× buffer 5μL, 10mM dNTP 1μL, DNA polymerase 0.5μL, primer 5'Cλ (GAGGAGCTTCAAGCCAACAAGGCCACA), primer 3'Cλ (GCAACTAGAAGGCACAGTCGAGGCTGAACATTCTGTAGGGGCCAC), water replenishment Make up to 50 μL.

The PCR reaction conditions were: pre-denaturation at 94°C for 4 minutes, followed by 30 cycles of 94°C for 30 seconds, 60°C for 60 seconds, 72°C for 3 minutes, and a final extension at 72°C for 10 minutes.

3) Amplify antibody variable regions.

The PCR system contains: the template is 10ng of reverse transcription PCR product, 5μL of 10× buffer, 1μL of 10mM dNTP, 0.5μL of DNA polymerase, primers as shown in Table 4 (the heavy chain and light chain primers are mixed separately and added to the system ), make up to 50 μL of water.

The PCR reaction conditions were: pre-denaturation at 94°C for 4 minutes, followed by 30 cycles of 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 3 minutes, and a final extension at 72°C for 10 minutes.

Table 4. Linear Expression Cassette Construction Amplification Variable Region PCR Primers

4) Recovery and purification of PCR products: After the above PCR products were subjected to 1% agarose gel electrophoresis, the gel was cut and recovered using a recovery kit from OMEGA.

5) Amplify the linear expression cassettes for the heavy and light chains, respectively.

A schematic diagram of the splicing sequence of the linear expression box is shown in Figure 3. In Fig. 3, A is the linear expression box of the H chain, B is the linear expression box of the κ chain, and C is the linear expression box of the λ chain.

The PCR reaction system includes:

Template: purified promoter-leader sequence fragment 10ng, heavy chain/light chain variable region fragment 10ng, heavy chain/light chain constant region fragment 10ng, poly A tail fragment 10ng, 10× buffer 2.5μL, 10mM dNTPs 0.5 μL, DNA polymerase 0.25 μL, primers 5’CMV-FORWARD (CGATGTACGGCCAGATATACGCGTTG) and 3’POLY(A) (TCCCCAGCATGCCTGCTATTGTCT), and water to make up to 25 μL.

PCR reaction conditions were: 94°C for 4 minutes of pre-denaturation, followed by 30 cycles of 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 3 minutes, and a final extension at 72°C for 10 minutes.

6) Recovery and purification of PCR product: The PCR reaction product was directly recovered with the recovery kit of OMEGA company.

7) DNA quantification: The PCR recovery products were quantified with Nano (GE Healthcare).

8) Cell seeding: 293T cells were seeded in a 24-well cell culture plate at 2×10 ⁵ /mL, and cultured overnight at 37° C. in a cell incubator containing 5% CO ₂ .

9) Cell co-transfection: On the next day, add 1 μg of the successfully constructed heavy chain and light chain linear expression cassette PCR products to 200 μL of serum-free MEM medium, mix well, and add 4 μL of transfection reagent Turbofect (Thermo Scientific, R0531), co-incubated for 15-20 minutes and added dropwise to the culture wells of 293T cells cultured overnight. In a cell incubator containing 5% CO ₂ , the cell culture supernatant was collected after culturing at 37 °C for 48 h.

6. ELISA to screen antibodies with binding activity

1) The day before the experiment, a 96-well enzyme-linked plate was coated with 1 μg/mL of tetanus toxoid TT (purchased from China Institute for Food and Drug Control), and each well was coated with 100 μL. Place the coated enzyme-linked plate in a humidified chamber at 4°C overnight.

2) On the day of the experiment, wash 5 times with a plate washer (BIO-TEK, 405_LS), add 100 μL of blocking solution to each well, and place at room temperature for 1 hour.

3) Wash the plate 5 times, add 100 μL of the transfected cell culture supernatant, and let stand for 1 hour at room temperature.

4) Wash the plate 5 times, dilute the HPR-labeled goat anti-human IgG secondary antibody (Abeam, ab97225) at 1:10000 with diluent, add 100 μL per well to the corresponding well of the ELISA plate, and incubate at room temperature for 1 hour.

5) Wash the plate 5 times, add 100 μL of TMB single-component color developing solution to each well, develop color for 6 minutes, avoid light at room temperature, and then add 50 μL of stop solution to each well to stop the reaction.

6) Detect the OD value at 450-630nm with a microplate reader, and save and record the original data.

Results: 22 monoclonal antibodies were expressed, and the binding activity of TT was identified. The results showed that 15 mAbs could specifically bind to TT. Figure 4 shows the binding activity of 15 mAbs.

7. T3 antibody sequence description

Antibody T3 with binding activity was studied and its sequence is described below:

The amino acid sequence of the variable region of the T3 heavy chain is shown in SEQ ID NO.1, and its CDR1, CDR2 and CDR3 are shown in the sequence of positions 26-33, 51-58, and 97-108 of SEQ ID NO.1, respectively. The T3 heavy chain The variable region nucleotide sequence is shown in SEQ ID NO.2, the T3 heavy chain constant region amino acid sequence is shown in SEQ ID NO.3, and the T3 heavy chain constant region nucleotide sequence is shown in SEQ ID NO.4; The amino acid sequence of the variable region of the T3 light chain is shown in SEQ ID NO.5, and its CDR1, CDR2 and CDR3 are shown in the sequences of positions 27-37, 55-57, and 94-102 of SEQ ID NO.5, respectively. The T3 light chain The variable region nucleotide sequence is shown in SEQ ID NO.6, the T3 light chain constant region amino acid sequence is shown in SEQ ID NO.7, and the T3 light constant region nucleotide sequence is shown in SEQ ID NO.8.

8. Expression plasmid construction and antibody preparation

An expression plasmid was constructed for T3, and the monoclonal antibody was expressed. Methods as below:

1) The full-length genes of the T3H and T3K linear expression cassettes were double digested with EcoR I (NEB, R3101) and Not I (NEB, R3189), and ligated into the pcDNA3.4 expression plasmid.

2) 15 μg of each of pcDNA3.4-T3H and pcDNA3.4-T3K were taken, transfected into 30 mL of Expi293 system (Life, A14524), and cultured at 125 rpm and 5% CO ₂ for 72 h.

3) 3000×g, centrifuge for 10 minutes to collect the expression supernatant, filter through a 0.22 μm syringe filter, and use rProtein A for affinity purification.

4) The collected antibodies were exchanged with PBS, and then the antibody concentration was determined with BCA protein quantification kit (Thermo Scientific, 23225).

Example 2. ELISA detection of antibody binding activity

1. The day before the experiment, the 96-well enzyme-linked plate was coated with 1 μg/mL of tetanus toxoid TT (purchased from China Institute for Food and Drug Control) and the _C -terminal domain of tetanus toxin heavy chain (TeNT-HC, GenBank: AF154828 ), 100 μL per well for coating; put the coated enzyme-linked plate in a wet box at 4°C overnight.

2. Wash 5 times with a plate washer on the day of the experiment; add 100 μL of blocking solution to each well and place at room temperature for 1 hour.

3. Wash the plate 5 times; add 150 μL of T3 mAb with a concentration of 3.3 μg/mL to the first well, and add 100 μL of diluent to the remaining wells; aspirate 50 μL from the first well and add it to the second well, and so on, in a 1:3 gradient dilution The final volume of each well was 100 μL; let stand for 1 hour at room temperature.

4. Wash the plate 5 times; dilute the HPR-labeled goat anti-human IgG secondary antibody at 1:10000 with diluent, add 100 μL per well to the corresponding well of the ELISA plate, and leave it at room temperature for 1 hour.

5. Wash the plate 5 times; add 100 μL of TMB single-component color developing solution to each well, develop color for 6 minutes, avoid light at room temperature, and then add 50 μL of stop solution to each well to stop the reaction.

6. Use a microplate reader to detect the OD value at 450-630nm, and save and record the original data.

The binding activity curve is shown in Figure 5. The results show that: T3 can bind well to tetanus toxoid TT (EC ₅₀ is 4.178ng/mL), but cannot bind to the heavy chain _C -terminal domain of the toxin (TeNT-HC ), It is indicated that the binding epitope is located in other fragments of the toxin other than HC or only in the whole _TeNT molecule.

Example 3. Mice challenge protection experiment

The neutralizing toxin effect of T3 was evaluated in mice, and the evaluation method was as follows:

1. Mice: BALB/c, 10 mice per group, half male and half male, 6-8 weeks old.

2. Sample preparation: boric acid buffer: NaCl 8.5g, boric acid 4.5g, sodium tetraborate decahydrate 0.5g, add water to 1L, 0.22μm filter sterilization, pH 7.4; Tetanus toxin is diluted with boric acid buffer, in The _LD50 in mice was 15.8 ng/kg.

3. Experimental grouping: T3 administration group: 10μg antibody (diluted in 50μL PBS)+2LD ₅₀ tetanus toxin (total system 0.5mL); control group: 50μL PBS+2LD ₅₀ tetanus toxin (total system 0.5mL), 37℃ Incubate for 1 hour.

4. Mice were injected intraperitoneally with the toxin/antibody mixture, 0.5 mL per mouse.

5. Observe for 10 days.

Results: The mice in the control group all died within 2 days, while the T3 administration group could achieve 100% protection in mice challenged with 2LD ₅₀ tetanus toxin (see Figure 6 for the time-dependent survival curve).

Example 4. Antibody epitope competition experiment

Competitive binding ELISA was used to analyze whether the T3 antibody had the same epitope as other tetanus antibodies prepared in our laboratory. Whether the binding epitopes of these antibodies overlap is reflected by examining whether the binding of the detection antibody to TT will be blocked by the competing antibody incubated with it. Methods as below:

1. Weigh 4 mg of biotin (Thermo Scientific, 21335) and dissolve it in 2 mL of ultrapure water to a concentration of 2 mg/mL.

2. Take 200μg of each antibody, and the volume should be controlled at about 200μL. Antibodies were labeled at a molar ratio of biotin to antibody of 20:1. The antibody and biotin were mixed, incubated at room temperature for 1 hour, and the medium was changed with a 50 kDa 0.5 mL centrifugal ultrafiltration tube, about 400 μL of PBS was changed each time, and the medium was changed more than 3 times.

3. The remaining liquid in the ultrafiltration tube was uniformly filled to about 100 μL with PBS for the last time, and the antibody concentration was determined.

4. The 96-well enzyme-linked plate was coated with TT at a concentration of 1 μg/mL, overnight at 4°C.

5. Wash the plate 5 times with a plate washer, add 100 μL of blocking solution to each well, and incubate at 37°C for 1 hour.

6. In the experiment, the detection antibody is a biotin-labeled antibody, and the competing antibody is a non-biotin-labeled antibody. The diluent dilutes the competing antibody to 100 μg/mL; the diluent dilutes the detection antibody to 1 μg/mL.

7. Wash the plate 5 times, add 50 μL of detection antibody and 50 μL of competing antibody to each well, and the final volume of each well is 100 μL.

8. Wash the plate 5 times, dilute HRP-labeled streptavidin (Thermo Scientific, 21126) at 1:1000, add 100 μL to each well, and incubate at 37°C for 1 hour.

9. Wash the plate 5 times, add 100 μL of TMB single-component color development solution to each well, and protect from light for 6 minutes, then add 50 μL of stop solution. Read the OD value at 450-630nm.

Results: The competition binding value is less than 30, which means strong competition; more than 30 and less than 60 means weak competition; more than 60 means no competition. Each antibody competes well among itself for binding, and T3 does not compete with T7, T9-6, and T18, suggesting that T3 has the potential to form a cocktail combination therapy with other neutralizing antibodies (see Figure 7).

Example 5. Western Blot identification

1. Take 0.5 μg of tetanus toxoid TT (purchased from China Institute of Food and Drug Control) and TeNT-HC (GenBank: _AF154828 ) for SDS-PAGE, and then transfer the protein to nitrocellulose membrane.

2. Block the membrane with 5% nonfat dry milk (in TBST) and incubate for 1 hour at room temperature.

3. Dilute T3 antibody to 1 μg/mL with 5% nonfat dry milk and incubate with membrane for 1 hour at room temperature.

4. Wash the membrane with TBST, 5 minutes each time, 4 times.

5. HRP-labeled anti-human IgG antibody (Abeam, 97225) was diluted 1:5000 with 5% nonfat dry milk and incubated with the membrane for 1 hour at room temperature.

6. Wash the membrane with TBST, 5 minutes each time, 4 times.

7. Use a chemiluminescent substrate (Merck Millipore) for color development and exposure.

Results: T3 could bind the 150kDa TT whole molecule and the 100kDa heavy chain HC, but could not bind the 48kDa heavy chain _C -terminal domain TeNT-HC, indicating that the epitope bound by T3 was not located in the C-terminal domain of the toxin heavy chain, but is located in the N-terminal domain of the heavy chain, H _N , and T3 is likely to play a neutralizing role by inhibiting the translocation of the light chain to the cytoplasm (see Figure 9).

Example 6. Antibody Affinity Assay (BLI):

1. Antibody T3 was diluted to 5 μg/mL with PBST (PBS+0.5% Tween-20).

2. Use the ForteBio Octet instrument to coat the AHC sensor.

3. Baseline calibration of the coated sensor in PBST.

4. Immerse the sensor in serially diluted TT for 300 seconds.

5. Immerse the sensor in PBST for dissociation for 600 seconds.

6. Fit the data to obtain the equilibrium dissociation constant (K _D ).

Results: The equilibrium dissociation constant between T3 and TT was 0.545 nM, indicating that the neutralizing antibody had a good affinity for TT, making it possible to develop it into an antibody for tetanus prevention or treatment (see Figure 8).

Only one monoclonal antibody as a therapeutic drug faces the possibility of pathogen mutation, causing the monoclonal antibody to lose its neutralization effect on the mutant. The combination of multiple monoclonal antibodies targeting different epitopes (cocktail therapy) can avoid this problem. Therefore, the use of the anti-tetanus toxin heavy chain N-terminal domain antibody T3 provided by the present invention and other non-specifically binding tetanus toxin heavy chain N-terminal domain antibody compositions for tetanus prevention or treatment can become this Specific technical solutions for cocktail therapy. In the further verification of the present invention, the epitope bound by the antibody T9-6 is located in the heavy chain _{C -} terminal domain TeNT-HC of tetanus toxin, and HC is the receptor binding region of the toxin, suggesting that the T9-6 mAb can inhibit the The toxin binds to the receptor for neutralization. There is no competition between T3 and T9-6, indicating that these two antibodies target different epitopes of the antigen, and they can be used as candidate antibodies for cocktail therapy in combination with other monoclonal antibodies against different epitopes to exert better protective effect. T3 and T9-6 have high affinity and high neutralizing activity to tetanus toxin, and can play an important role in the prevention, treatment and diagnosis of tetanus disease. Therefore, use antibody T3 and anti-tetanus toxin heavy chain _C -terminal domain TeNT-HC antibody to form an antibody composition for cocktail therapy, only as an example, such as antibody T3 and antibody T9-6 as a specific implementation This antibody combination regimen can become a very potential tetanus prevention or treatment.

Industrial Applicability

The present invention provides a fully human monoclonal antibody against tetanus toxin and its application in the preparation of medicine. The monoclonal antibody is easy for industrial production and has industrial practicability.

Sequence Listing Free Content

Claims (12)

1. A humanized monoclonal antibody against tetanus toxin, characterized in that the antibody heavy chain variable region CDR1, CDR2 and CDR3 region amino acid sequences are respectively as SEQ ID NO:1 Nos. 26-33, 51-58, 97 -108 position sequence; the antibody light chain variable region CDR1, CDR2 and CDR3 region amino acid sequences are respectively shown in SEQ ID NO: 5 Nos. 27-37, 55-57, 94-102 sequences.
2. The monoclonal antibody according to claim 1, wherein the amino acid sequence of the variable region of the antibody heavy chain is as shown in SEQ ID NO: 1, and the amino acid sequence of the variable region of the antibody light chain is as shown in SEQ ID NO: :5 shown.
3. The monoclonal antibody according to claim 2, wherein the amino acid sequence of the antibody heavy chain constant region is as shown in SEQ ID NO:3, and the amino acid sequence of the antibody light chain constant region is as shown in SEQ ID NO:7 or as shown in SEQ ID NO:9.
4. A polynucleotide encoding the monoclonal antibody heavy chain and/or light chain of any one of claims 1-3, wherein the polynucleotide sequence encoding the variable region of the heavy chain of the antibody is as SEQ ID NO. As shown in SEQ ID NO: 2, the polynucleotide sequence encoding the light chain variable region of the antibody is shown in SEQ ID NO: 6.
5. The polynucleotide according to claim 4, wherein the sequence of the polynucleotide encoding the antibody heavy chain constant region is shown in SEQ ID NO: 4, and the polynucleotide encoding the antibody light chain constant region The sequence of SEQ ID NO: 8 or SEQ ID NO: 10 is shown.
6. A functional element expressing the polynucleotide of claim 5 encoding the heavy chain and/or light chain of a monoclonal antibody.
7. The functional element according to claim 6, wherein the functional element is a linear expression cassette or a mammalian expression vector.
8. A host cell containing the functional element of claim 7.
9. The host cell according to claim 8, wherein the cell is an Expi 293F cell or a CHO-S cell.
10. A composition comprising the monoclonal antibody of any one of claims 1-3.
11. The composition of claim 10, further comprising an antibody against the C-terminal domain of the heavy chain of tetanus toxin.
12. Application of the monoclonal antibody of any one of claims 1-3 in the preparation of a tetanus preventive and/or therapeutic drug.

Images