WO2022031006A1 - Composition for diagnosing osteoarthritis, and method for providing information for diagnosing osteoarthritis - Google Patents

Abstract

The present invention relates to a composition for diagnosing osteoarthritis, and a method for providing information for diagnosing osteoarthritis. In the present invention, it has been confirmed that, in the process of differentiating osteoarthritis patient-derived induced pluripotent stem cells into chondrocytes, the expression of inflammatory cytokines IL-6, MMP1, and MMP10 and the expression of cell hypertrophy markers COL1A1, RUNX2, VEGFA, and ACAN, and AQP1 increase and the expression of a hyaline cartilage marker, COL2A1, decreases, and thus, it has been confirmed that diagnosis of osteoarthritis including chondrocyte hypertrophy, particularly early diagnosis of osteoarthritis, is possible. In addition, it has been confirmed that as chondrocyte differentiation progresses, the expression aspect of most biomarkers has changed, the expression of IL-6 and AQP1 has increased, and the expression of COL2A1, SOX9, and COL1A1 has decreased. Thus, the present invention can provide information on the progression stage of osteoarthritis according to a change in the expression amount of various biomarkers, and furthermore can provide information on an appropriate treatment method according to the progression stage of osteoarthritis.

Description

Composition for diagnosing osteoarthritis and method of providing information for diagnosing osteoarthritis

The present invention relates to a composition for diagnosing osteoarthritis and a method for providing information for diagnosing osteoarthritis, and more particularly, to a composition for diagnosing osteoarthritis comprising a formulation for measuring mRNA or protein levels of various markers including IL-6, and diagnosis of osteoarthritis using the same It relates to a method of providing information for

Osteoarthritis (OA) is a degenerative joint disease that occurs frequently in cartilage, and is an important disease that deteriorates the quality of life related to participation in social activities and health in the elderly. Osteoarthritis is a phenomenon in which articular cartilage cells normally remain in the intermediate stage of differentiation, but due to some cause, they differentiate and die like growth plate chondrocytes, and lose their properties. Articular cartilage cell death (apoptosis) occurs more frequently in osteoarthritis than in normal articular cartilage. As a result, the function of articular chondrocytes decreases, the synthesis of extracellular matrix type II collagen decreases, and the catabolic matrix-degrading enzymes increase, leading to degeneration of articular cartilage characterized by the degradation of extracellular matrix collagen fibers. .

As a method of diagnosing osteoarthritis mainly uses methods such as hospital visits or X-rays, research on the discovery of biomarkers for diagnosing osteoarthritis from the pathological mechanism of arthritis is in progress (US Patent Publication No. 2009- 0068656; Q. Zhang et al., Osteoarthritis and Cartilage, 23(12):2259-2268, 2015).

Therefore, in the present invention, in order to check the correlation between chondrocyte hypertrophy and osteoarthritis using the characteristics of osteoarthritis patients, an osteoarthritis patient-induced pluripotent stem cell line was prepared and differentiation into chondrocytes was induced. As a result, it was confirmed that the expression of inflammatory cytokines IL-6, MMP1 and MMP10 increased during the differentiation of induced pluripotent stem cells derived from osteoarthritis patients into chondrocytes. In addition, it was confirmed that the expression of COL1A1, RUNX2, VEGFA and ACAN and AQP1, which are cell hypertrophy markers, was increased, and the expression of COL2A1, a free cartilage marker, was decreased. That is, it was confirmed that various markers including IL-6 are suitable for diagnosing osteoarthritis, and the present invention was completed.

An object of the present invention is to provide a composition for diagnosing osteoarthritis using various markers including IL-6.

Another object of the present invention is to provide a method for providing information on the diagnosis of osteoarthritis using various markers including IL-6.

In order to achieve the above object,

The present invention provides a composition for diagnosing osteoarthritis comprising an agent for measuring the mRNA or protein level for IL-6.

In a preferred embodiment of the present invention, the composition is an agent for measuring mRNA or protein levels for one or more biomarkers selected from the group consisting of MMP1, MMP10, COL1A1, RUNX2, VEGFA, ACAN, AQP1, SOX9 and COL2A1 may further include.

In another preferred embodiment of the present invention, the composition may be a composition for early diagnosis of osteoarthritis.

In another preferred embodiment of the present invention, the composition can diagnose chondrocyte hypertrophy.

In addition, the present invention provides a kit for diagnosing osteoarthritis comprising the composition for diagnosing osteoarthritis.

In addition, the present invention comprises the steps of (a) measuring the mRNA or protein expression level of the IL-6 gene from the patient's biological sample; and

(B) provides a method for providing information on the diagnosis of osteoarthritis comprising the step of comparing the mRNA or protein expression level with a control sample.

In a preferred embodiment of the present invention, in step (a), mRNA or protein level for one or more biomarkers selected from the group consisting of MMP1, MMP10, COL1A1, RUNX2, VEGFA, ACAN, AQP1, SOX9 and COL2A1 Additional measurements can be made.

In another preferred embodiment of the present invention, when the expression level of mRNA or protein thereof of IL-6, RUNX2, VEGFA, MMP1 and MMP10 genes is increased compared to the control group, it is possible to provide information that chondrocyte hypertrophy is in progress. have.

In another preferred embodiment of the present invention, IL-6, MMP1, MMP10, ACAN, COL1A1, RUNX2, VEGFA and AQP1 gene mRNA or its protein expression level is increased compared to the control, COL2A1 gene mRNA or When the expression level of its protein is decreased compared to the control group, it can provide information that it is an early stage of osteoarthritis.

In another preferred embodiment of the present invention, the expression level of IL-6 and AQP1 gene mRNA or its protein is increased compared to the control, and the COL2A1, SOX9 and COL1A1 gene mRNA or its protein expression level is higher than that of the control. If it decreases, it may provide information that the osteoarthritis is in the intermediate or late stage.

The present invention relates to a composition for diagnosing osteoarthritis comprising an agent for measuring the mRNA or protein level for IL-6 from one point of view.

The composition may further include an agent for measuring mRNA or protein levels for one or more biomarkers selected from the group consisting of MMP1, MMP10, COL1A1, RUNX2, VEGFA, ACAN, AQP1, SOX9 and COL2A1, but is limited thereto Otherwise, it can be used in combination with other biomarkers suitable for the diagnosis of osteoarthritis.

The composition can be used for early diagnosis of osteoarthritis, in particular can be used for chondrocyte hypertrophy diagnosis.

The term "diagnosis" used in the present invention means to confirm the presence or characteristics of a pathological condition, and the term "diagnostic biomarker" used in the present invention refers to an individual with osteoarthritis or chondrocyte hypertrophy compared to a normal control group, Organic biomolecules such as polypeptides or nucleic acids (eg, mRNA), lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.), etc. includes

As used herein, the term “mRNA expression level measurement” refers to a process of determining the presence and expression level of mRNA of a biomarker for diagnosing osteoarthritis in a biological sample, and measuring the amount of mRNA. Analysis methods for this include reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR), real-time reverse transcription polymerase reaction (Real-time RT-PCR), RNase protection assay (RPA; RNase protection) assay), Northern blotting, and a DNA chip, but is not limited thereto.

The agent for measuring the mRNA level is characterized in that it is a primer pair, probe, or antisense nucleotide that specifically binds to a specific gene. Probes or antisense nucleotides can be designed.

As used herein, the term "primer" refers to a fragment recognizing a target gene sequence, including a pair of forward and reverse primers, but preferably a primer pair that provides analysis results with specificity and sensitivity.

As used herein, the term “probe” refers to a substance capable of specifically binding to a target substance to be detected in a sample, and refers to a substance capable of specifically confirming the presence of a target substance in a sample through the binding. do. The type of probe is not limited as a material commonly used in the art, but preferably PNA (peptide nucleic acid), LNA (locked nucleic acid), peptide, polypeptide, protein, RNA or DNA, and most preferably It is PNA.

As used herein, the term "antisense" means that an antisense oligomer hybridizes with a target sequence in RNA by Watson-Crick base pairing, and typically mRNA and RNA: oligomeric heteroduplex formation in the target sequence. It refers to an oligomer having a sequence and an inter-subunit backbone. An oligomer may have exact sequence complementarity or approximate complementarity to a target sequence.

As used herein, the term "measurement of protein expression level" is a process of confirming the presence and expression level of a protein expressed from a biomarker for diagnosing osteoarthritis in a biological sample. The amount of the protein can be confirmed using an antibody, an interacting protein, a ligand, nanoparticles, or an aptamer that specifically binds to a protein or peptide fragment of the gene.

The protein expression level measurement or comparative analysis method includes protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Desorption/Ionization Time of Flight Mass Spectrometry) analysis, SELDI-TOF (Sulface Enhanced Laser Desorption/Ionization Time) analysis. of Flight Mass Spectrometry analysis, radioimmunoassay, radioimmunodiffusion method, Ouchteroni immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, two-dimensional electrophoresis analysis, liquid chromatography-mass spectrometry (liquid chromatography) -Mass Spectrometry, LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/Mass Spectrometry), Western blot, ELISA (enzyme linked immunosorbent assay), etc., but are not limited thereto.

In another aspect, the present invention relates to a kit for diagnosing osteoarthritis comprising the composition for diagnosing osteoarthritis.

The kit may be prepared by a conventional manufacturing method known in the art. The kit may include, for example, a freeze-dried antibody, a buffer, a stabilizer, an inactive protein, and the like.

The kit may further include a detectable label. The term "detectable label" refers to an atom or molecule that allows for specific detection of a molecule comprising a label among molecules of the same type without a label.

In another aspect, the present invention, (a) measuring the mRNA or protein expression level of the IL-6 gene from a patient's biological sample; and

(b) relates to a method for providing information on the diagnosis of osteoarthritis, comprising the step of comparing the mRNA or protein expression level with a control sample.

In the above method, "biological sample" means a sample such as tissue, cells, blood, serum, plasma, saliva, cerebrospinal fluid or urine, and preferably means blood, plasma, or serum.

In the method for providing information on the diagnosis of osteoarthritis, the method for measuring the expression level of gene mRNA or protein thereof is as described above.

In the present invention, in the step (a), the mRNA or protein level for one or more biomarkers selected from the group consisting of MMP1, MMP10, COL1A1, RUNX2, VEGFA, ACAN, AQP1, SOX9 and COL2A1 can be further measured. have.

In the present invention, when the expression level of mRNA or protein thereof of IL-6, RUNX2, VEGFA, MMP1 and MMP10 genes is increased compared to the control group, it is possible to provide information that chondrocyte hypertrophy is in progress.

In the present invention, the expression level of mRNA or protein thereof of IL-6, MMP1, MMP10, ACAN, COL1A1, RUNX2, VEGFA and AQP1 genes is increased compared to the control, and the expression level of mRNA or protein thereof of the COL2A1 gene is a control group If decreased compared to , it can provide information that osteoarthritis is an early stage.

In the present invention, the expression level of IL-6 and AQP1 gene mRNA or its protein increases compared to the control, and the COL2A1, SOX9 and COL1A1 gene mRNA or its protein expression level decreases compared to the control. Information can be provided as it is a late stage.

In a specific embodiment of the present invention, osteoarthritis-derived induced pluripotent stem cells (HC) and osteoarthritis patient-derived induced pluripotent stem cell lines (efOA) were used to confirm the correlation between chondrocyte hypertrophy and osteoarthritis using the characteristics of osteoarthritis patients. produced, and when characterization of the produced induced pluripotent stem cells was performed, it was confirmed that both cell lines had pluripotency ( FIGS. 1A to 1C ).

In another specific embodiment of the present invention, when HC and efOA-induced pluripotent stem cells were differentiated into chondrocytes, the level of gene expression was observed. As a result, the expression levels of ACAN, AQP1, COL1A1, COL10A1, MMP13 and RUNX2 genes in cartilage pellets on the 21st day of differentiation into chondrocytes were further evaluated on the 7th day after inducing cell hypertrophy of the cartilage pellets, ACAN, AQP1, COL1A1, COL10A1 , MMP13 and RUNX2 gene expression levels were checked, and no significant differences were observed in ACAN, COL2A1 and AQP1 ( FIGS. 2a to 3b ).

No significant gene expression pattern change was observed after 21 days of induction of cartilage differentiation. In the present invention, the gene expression level was analyzed based on the start of cartilage hypertrophy. In the present invention, since it was confirmed that on the 7th day after differentiation of induced pluripotent stem cells into cartilage pellets, hypertrophy appeared in osteoarthritis cartilage pellets (FIG. 3a), the gene expression level was analyzed on the 7th day of cartilage differentiation. The expression of IL-6, MMP1 and MMP10 was significant in the culture medium of osteoarthritis patients when the inflammatory cytokine secretion pattern and MMP assay were confirmed with the conditioned media of the 7th day of cartilage differentiation osteoarthritis pellets and normal pellets. It was confirmed that the increase was significantly increased (FIG. 4).

In another specific embodiment of the present invention, as a result of checking the gene expression of osteoarthritis pellets and normal pellets on the 7th day of induction of cartilage differentiation, it was confirmed that COL2A1 (collagen type 2), a representative marker of free cartilage, was significantly reduced in the patient group. , it was confirmed that fibrocartilage and cell hypertrophy markers COL1A1, RUNX2, VEGFA and AQP1 expression were significantly increased ( FIGS. 3a and 3b ). Furthermore, as a result of confirming the gene expression of osteoarthritis pellets and normal pellets on the 21st day of induction of cartilage differentiation, AQP1 expression was significantly increased, and COL2A1 and COL10A1 expressions were significantly decreased, while the expression patterns of other biomarkers disappeared (Fig. 2a and 2b)

In addition, it was confirmed that the expression of the IL-6, MMP1 and MMP10 gene, which had increased protein expression in FIG. 4 , was also increased in the osteoarthritis pellet compared to the normal pellet, and the expression of the IL-1β and TNFα gene, which regulates IL-6 secretion, also increased significantly. confirmed that. However, it was confirmed that the MMP1 and MMP10 gene expression patterns were changed on the 21st day of induction of cartilage differentiation ( FIG. 5 ).

In the present invention, when differentiation of induced pluripotent stem cells derived from osteoarthritis patients into chondrocytes was induced, it was confirmed that the function of chondrocyte differentiation was impaired by the expression of IL-1β and IL-6 at the initial stage of differentiation. In the process, it was confirmed that RUNX2, VEGFA, MMP1 and MMP10 acted to induce cell hypertrophy.

That is, in the present invention, it was confirmed that the expression patterns of various markers including IL-6 change as chondrocyte hypertrophy or osteoarthritis progresses. It was confirmed that not only can early diagnosis of cell hypertrophy be possible, but it can also provide information on the progression stage of osteoarthritis/chondrocyte hypertrophy, and furthermore, it can provide information on a suitable treatment method according to the stage of osteoarthritis progression.

In the present invention, the expression of inflammatory cytokines IL-6, MMP1 and MMP10 and the cell hypertrophy markers COL1A1, RUNX2, VEGFA and ACAN and AQP1 are increased in the process of differentiation of stem cells into chondrocytes, such as induction of osteoarthritis patients. And, since it was confirmed that the expression of the free cartilage marker COL2A1 was decreased, it was confirmed that it is possible to use this to diagnose osteoarthritis including chondrocyte hypertrophy, especially osteoarthritis early. In addition, as the chondrocyte differentiation progressed, it was confirmed that the expression patterns of most biomarkers changed, the expression of IL-6 and AQP1 increased, and the expression of COL2A1, SOX9 and COL1A1 decreased. Therefore, the expression of various biomarkers According to the change in the amount, it is possible to provide information on the progression stage of osteoarthritis, and furthermore, it is possible to provide information on a suitable treatment method according to the stage of osteoarthritis progression.

1A is a result of characterization of osteoarthritis patient-derived induced pluripotent stem cells (efOA, early finger OA). (a) Schematic diagram showing osteoarthritis patient (efOA) and its sister, normal (HC), (b) finger x-ray comparison results, (c) HC distal interphalangeal joint x-ray A photograph, and (d) a distal interphalangeal joint x-ray photograph of the patient are shown.

1B is a result of characterization of osteoarthritis patient-derived induced pluripotent stem cells (efOA, early finger OA). Alkaline phosphatase-stained hiPSCs of HC(e) and efOA(f), (g) Normal karyotype of HC-hiPSC, (h) Normal karyotype of efOA-hiPSC, HC-hiPSC(i) and efOA- with pluripotency markers The results of immunofluorescence staining of hiPSCs (j) (all scale bars = 200 μm) are shown.

1C is a result of characterization of osteoarthritis patient-derived induced pluripotent stem cells (efOA, early finger OA). Relative expression levels of OCT4(k), KLF4(l), NANOG(m) and LIN28(n) are shown (*P <0.05, **P <0.01).

Figure 2a shows the characteristics of fully differentiated CP on the 21st day after differentiation of osteoarthritis patient-derived pluripotent stem cells into cartilage pellets.

Figure 2b shows the characteristics of fully differentiated CP on the 21st day after differentiation of osteoarthritis patient-derived induced pluripotent stem cells into cartilage pellets. (b) relative expression of SOX9, (c) relative expression of ACAN, (d) relative expression of COL2A1, (e) relative expression of COL1A1, (f) relative expression of COL10A1, (g) relative expression of RUNX2, (h) ) Relative expression of MMP13, (i) relative expression of VEGFA, and (j) relative expression of AQP1. The expression of each gene was normalized to the expression of GAPDH (*P <0.05, **P <0.01, ***P <0.001).

Figure 3a shows the characteristics of the initial chondrogenic pellet (CP) 7 days after induction of cell hypertrophy of the cartilage pellet. (a) Images of 7-day CP. (b) Alcian blue staining result of CP on day 21 (scale bar = 200 μm).

Figure 3b shows the characteristics of the initial chondrogenic pellet (CP) 7 days after induction of cell hypertrophy of the cartilage pellet. (c) Relative expression of SOX9. (d) Relative expression of ACAN. (e) Relative expression of COL2A1. (f) Relative expression of COL1A1. (g) Relative expression of COL10A1. (h) Relative expression of RUNX2. (i) Relative expression of MMP13. (j) Relative expression of VEGFA. (k) Relative expression of AQP1. The expression of each gene was normalized to the expression of GAPDH (*P <0.05, **P <0.01, ***P <0.001).

Figure 4 shows the inflammatory cytokine secretion pattern and MMP analysis results in culture medium (conditioned media) of osteoarthritis pellets and normal pellets on the 7th day after differentiation of induced pluripotent stem cells derived from osteoarthritis patients into cartilage pellets. (A) Results of inflammatory cytokine arrays of HC- and efOA-CP culture supernatants. (b) Results of MMP arrays of HC- and efOA-CP culture supernatants. Measured intensity change levels of (c) IL-6, (d) MMP1 and (e) MMP10 (* Po0.05).

5 shows the results of analysis of selected inflammatory cytokines and MMPs using real-time PCR. (a) Relative expression of day 7 IL6. (b) Relative expression of day 7 MMP1. (c) Relative expression of day 7 MMP10. (d) Relative expression of day 21 IL6. (e) Relative expression of day 21 MMP1. (f) Relative expression of MMP10 at day 21. (g) Relative expression of day 7 IL1B. (h) Relative expression of day 21 IL1B. (i) Relative expression of day 7 TNFA. (j) Relative expression of day 21 TNFA. The expression of each gene was normalized to the expression of GAPDH (*P <0.05, **P <0.01, ***P <0.001).

6 shows the results of confirming gene expression in IL-1β-treated CP. (a) Relative expression of RUNX2. (b) Relative expression of VEGFA. (c) Relative expression of IL1B. (d) Relative expression of IL6. (e) Relative expression of MMP1. (f) Relative expression of MMP10. Statistically significant differences between normal control (NC) and treatment groups are indicated by hash symbols (one-way ANOVA, Dunnett's test, # P <0.05, ## P <0.01, ### P <0.001).

[Example 1]

Production of induced pluripotent stem cells derived from osteoarthritis patients

1-1: Production of induced pluripotent stem cells derived from osteoarthritis patients

In the present invention, a patient with early osteoarthritis (efOA; early finger OA) was selected, and a healthy control (HC) of the patient was selected as a control group ( FIG. 1A ). As a result of comparing their finger x-ray photographs, it was confirmed that, in the case of osteoarthritis (efOA, early finger OA), the cartilage in the knuckle was worn away and the bones were joined ( FIG. 1 a ).

After obtaining fibroblasts from selected normal individuals and osteoarthritis patients, induced pluripotent stem cells (iPSCs) were prepared using a known method (Jaecheol Lee et al., Arthritis Res Ther, 16). (1):R41. 2014).

Specifically, skin tissue was collected from normal subjects and osteoarthritis patients, cut into small pieces, and then DMEM containing 0.01% collagenase was added, and cultured in a shaker at 37° C. for 4 hours. The isolated cells were washed with PBS and then resuspended in DMEM supplemented with 20% FBS and antibiotics, and then proliferation was induced.

When the cells proliferated, trypsin/EDTA was added to detach the cells, and then resuspended in DMEM containing 20% FBS so as to become 3 x 10 ⁵ cells, and then aliquoted in a 6-well plate. Then, 30 μl of Sendai virus containing Yamanaka factor was added, centrifuged at 1160 x g for 30 minutes, incubated at 37° C. overnight, and coated with vitronectin. Cells were transferred to 6-well plates. Then, after centrifugation at 1160 x g for 10 minutes, the adhered cells were cultured in E8 medium (Essential 8 media) to obtain fibroblast-derived iPSCs.

1-2: Characterization of induced pluripotent stem cells derived from osteoarthritis patients

Cell observation and genetic analysis were performed to characterize the osteoarthritis patient-derived induced pluripotent stem cells and normal human-derived pluripotent stem cells prepared above.

To observe the characteristics of induced pluripotent stem cells, the expression levels of SSEA4, OCT4, TRA-1-60, SOX2, TRA-1-81, KLF4, NANOG and LIN28 were observed through a fluorescence microscope.

In addition, the mRNA expression levels of OCT4, KLF4, NANOG and LIN28 were confirmed by PCR using the primer sequences in Table 1 below according to a method known in the art.

primer sequence

Description	Target Name	REFSEQ_ID	Direction	Primer Sequence	order number	Size
Pluripotency Marker	OCT4	NM_203289.5	Forward	GGGAAATGGGAGGGGTGCAAAAGAGG	One	151
			Reverse		TTGCGTGAGTGTGGATGGGATTGGTG		2
	KLF4	NM_004235.4	Forward		TTCCCATCTCAAGGCACAC	3	158
			Reverse		GGTCGCATTTTTGGCACT	4
	NANOG	NM_024865.2	Forward		AAAGGCAAACAACCCACT	5	270
			Reverse		GCTATTCTTCGGCCAGTT	6
	LIN28	NM_024674.4	Forward		GTTCGGCTTCCTGTCCAT	7	122
			Reverse		CTGCCTCACCCTCCTTCA	8
House Keeping Gene	GAPDH	NM_002046.5	Forward		ACCCACTCCTCCACCTTTGA	9	101
			Reverse		CTGTTGCTGTAGCCAAATTCGT	10

As a result, as shown in [Fig. 1b] and [Fig. 1c], the expression levels of SSEA4, OCT4, TRA-1-60, SOX2, TRA-1-81, KLF4, NANOG and LIN28, which are characteristics of induced pluripotent stem cells, were evaluated. It was confirmed that both cell lines had pluripotency.

[Example 2]

Chondrocyte differentiation and gene expression analysis

2-1: Chondrocyte differentiation

First, the normal human-derived iPSCs (indicated as “HC” in the drawing) and osteoarthritis patient-derived iPSCs (indicated as “efOA” in the drawing) obtained in Example 1-1 above were mixed with E8 medium and aggrewell medium in a 1:1 ratio. An embryo body (EB) was obtained by culturing in the mixed medium. The obtained embryos were maintained in E8 medium for 3 days, and in E7 medium for additional 3 days.

Then, the embryoid body was cultured in DMEM supplemented with 20% FBS and 10% penicillin/streptomycin, which is an OG induction medium. To induce the proliferation of OG cells, 50 to 70 embryoid bodies per cm ² were cultured in a gelatin-coated dish, and incubated at 5% CO ₂ , 37° C. for 3 days to induce OG formation from the embryo bodies. did.

Thereafter, the formed OG cells were isolated and harvested, and then cultured in a vertical gelatin-coated dish (1-5 x 10 ⁴ cells per cm ² ). For the characterization of osteoarthritis, only passage 1 of OG cells was used. Cells were harvested in 15 mL tubes and chondrogenic differentiation medium (CDM; DMEM supplemented with 20% knockout serum replacement, 1x non-essential amino acids, 1 mM L-glutamine, 1% sodium pyruvate, 1 mM L-glutamine, 1% TGFβ containing 10 ng/ml TGFβ % ITS+ Premix, 10-7 M dexamethasone, 50 mM ascorbic acid, 40 μg/mL L-proline). Cells resuspended in CDM were centrifuged at 750 x g for 5 min, then the resulting pellet was maintained for 21 days and the medium was replaced every 3 days.

2-2: gene expression analysis

On day 21 of chondrogenesis induction, differentiation-induced chondrocytes were obtained, total RNA was isolated, and then PCR was performed using the primers in Table 2 below according to a method known in the art.

primer sequence

Description	Target Name	REFSEQ_ID	Direction	Primer Sequence	SEQ ID NO:	Size
Chondrogenic Markers	SOX9	NM_000346	Forward		GACTTCCGCGACGTGGAC	11	99
			Reverse		GTTGGGCGGCAGGTACTG	12
	COL2A1	NM_001844	Forward		GGCAATAGCAGGTTCACGTACA	13	79
			Reverse		CGATAACAGTCTTGCCCCACTTA	14
	COL1A1	NM_000088.3	Forward		TCTGCGACAACGGCAAGGTG	15	146
			Reverse		GACGCCGGTGGTTTCTTGGT	16
	ACAN	NM_001135.3	Forward		TCGAGGACAGCGAGGCC	17	85
			Reverse		TCGAGGGTGTAGCGTGTAGAGA	18
Hypertrophy Marker	COL10A1	NM_000493.3	Forward		CAGGCATAAAGGCCCAC	19	108
			Reverse		GTGGACCAGGAGTACCTTGC	20
	RUNX2	NM_001024630	Forward		CCAGATGGGACTGTGGTTACTG	21	65
			Reverse		TTCCGGAGCTCAGCAGAATAA	22
	VEGFA	NM_003376.6	Forward	CTACCTCCACCATGCCAAGT	23	109
			Reverse		GCAGTAGCTGCGCTGATAGA		24
	MMP13	NM_002427.4	Forward	TCCCAGGAATTGGTGATAAAGTAGA	25	123
			Reverse	CTGGCATGACGCGAACAATA	26
	AQP1	NM_198098.3	Forward	TCTCAGGCATCACCTCCTCC	27	71
			Reverse	CGAGTTCACACCATCAGCCA	28
Inflammatory Cytokines	IL-1β	NM_000576.2	Forward	ACAGATGAAGTGCTCCTTCCA	29	73
			Reverse		GTCGGAGATTCGTAGCTGGAT		30
	IL-6	NM_000600.5	Forward	GGTACATCCTCGACGGCATCT	31	81
			Reverse	GTGCCTCTTTGCTGCTTTCAC	32
	TNFα	NM_000594.4	Forward	CTTCTCCTTCCTGATCGTGG	33	266
			Reverse	GCTGGTTATCTCTCAGCTCCA	34
MMPs	MMP1	NM_002421.4	Forward	CTGGCCCACAACTGCCAAATG	35	103
			Reverse	CTGTCCCTGAACAGCCCAGTACTTA	36
	MMP10	NM_002425.3	Forward	CATTCCTTGTGCTGTTGTGTC	37	225
			Reverse	TGTCTAGCTTCCCTGTCACC	38
House Keeping Gene	GAPDH	NM_002046.5	Forward		ACCCACTCCTCCACCTTTGA	9	101
			Reverse		CTGTTGCTGTAGCCAAATTCGT	10

As a result, on the 7th day after differentiation of osteoarthritis patient-derived pluripotent stem cells into cartilage pellets, the expression levels of SOX9, ACAN, COL2A1, COL1A1, COL10A1, RUNX2, VEGF, MMP13 and AQP1 genes in osteoarthritis and normal pellets were confirmed. , it was confirmed that COL2A1 (collagen type 2), a representative marker of free cartilage, was significantly decreased in the patient group, and it was confirmed that the expression of COL1A1, RUNX2, VEGFA and AQP1, which are markers of fibrocartilage and cell hypertrophy, was significantly increased (Fig. 3a). and Figure 3b).

Furthermore, as a result of checking the gene expression of osteoarthritis pellets and normal pellets on the 21st day of induction of cartilage differentiation, AQP1 expression was significantly increased, and COL2A1 and COL10A1 expressions were significantly decreased, while the expression patterns of other biomarkers disappeared (Fig. 2a and 2b).

[Example 3]

Analysis of cytokine secretion in the early stage of cartilage differentiation

No significant gene expression pattern change was observed after 21 days of induction of cartilage differentiation. In the present invention, the gene expression level was analyzed based on the start of cartilage hypertrophy.

Differentiation of induced pluripotent stem cells into cartilage pellets was induced in the same manner as in Example 2-1, and as a result of observing cartilage pellets on the 7th day of induction of differentiation, it was confirmed that hypertrophy appeared in osteoarthritis pellets (FIG. 3a),

Therefore, in the present invention, on the 7th day of cartilage differentiation, inflammatory cytokine secretion pattern analysis and MMP assay were performed using conditioned media of osteoarthritis pellets and normal pellets.

Inflammation cytokine array (Human Inflammation Antibody Array Membrane; ab134002, Abcam) and MMP array kit (Human MMP Antibody Array - Membrane (10 Targets); ab134004, Abcam) were all purchased from Abcam, and experiments were performed according to the product manual. .

First, a membrane to which a specific antibody is attached was placed in each tray, and then the membrane was blocked at room temperature for 30 minutes. Culture medium from each group was added to the membranes and incubated for 2 h at room temperature. After washing several times, the membranes were incubated with biotin-conjugated anti-cytokine antibodies at room temperature for 2 hours. After washing, streptavidin to which HRP was attached was added to the membrane and incubated at room temperature for 2 hours. The membrane was washed again and placed on a plastic sheet for imaging, and a detection buffer mixture was added to each membrane and left for 2 minutes. Another plastic sheet was placed on top of the membrane, excess solution was removed, and the signal was measured using a Fusion SL imaging system (Viber Lourmat).

As a result, as shown in a and b of [Fig. 4], when the inflammatory cytokine secretion pattern and MMP assay were confirmed with the conditioned media of the 7 day osteoarthritis pellet and the normal pellet of cartilage differentiation, It was confirmed that the expression of IL-6, MMP1 and MMP10 was significantly increased in the culture medium of osteoarthritis patients.

[Example 4]

Analysis of gene expression in the early stage of chondrogenesis

In the present invention, gene expression in osteoarthritis pellets and normal pellets was confirmed on the 7th day of induction of cartilage differentiation in which hypertrophy, which is the initial stage of cartilage differentiation, was confirmed. The gene expression level was confirmed. Gene expression was analyzed in the same manner as in Example 2-2.

It was confirmed that the expression of IL-6, MMP1 and MMP10 genes, which had increased protein expression in FIGS. 4 a and b, also increased in osteoarthritis pellets compared to normal pellets, and IL-1β and TNFα gene expression regulating IL-6 secretion were also significantly increase was confirmed. However, it was confirmed that the MMP1 and MMP10 gene expression patterns were changed on the 21st day of induction of cartilage differentiation (FIG. 5).

[Example 5]

Analysis of gene expression in the early stage of chondrogenesis

After treating CP with IL-1β, we tried to check the gene expression pattern over time. Gene expression was analyzed in the same manner as in Example 2-2.

As a result, as shown in FIG. 6 , it was confirmed that the expression levels of RUNX2, VEGFA, IL-1β, IL-6, MMP1 and MMP10 increased and then decreased with time.

In the present invention, the expression of inflammatory cytokines IL-6, MMP1 and MMP10 and the cell hypertrophy markers COL1A1, RUNX2, VEGFA and ACAN and AQP1 are increased in the process of differentiation of stem cells into chondrocytes, such as induction of osteoarthritis patients. And, since it was confirmed that the expression of COL2A1, a free cartilage marker, was reduced, it was confirmed that early diagnosis of osteoarthritis including chondrocyte hypertrophy, especially osteoarthritis, was possible using this. In addition, as the chondrocyte differentiation progressed, the expression patterns of most biomarkers changed, the expression of IL-6 and AQP1 increased, and the expression of COL2A1, SOX9 and COL1A1 decreased. As it was confirmed that the expression of various biomarkers According to the change in amount, information on the progression stage of osteoarthritis can be provided, and furthermore, information on a suitable treatment method according to the progression stage of osteoarthritis can be provided, so it has industrial applicability.

SEQ ID NO: 1 is a forward primer sequence of OCT4 as a pluripotency marker.

SEQ ID NO: 2 is a reverse primer sequence of OCT4 as a pluripotency marker.

SEQ ID NO: 3 is a forward primer sequence of KLF4 as a pluripotency marker.

SEQ ID NO: 4 is a reverse primer sequence of KLF4 as a pluripotency marker.

SEQ ID NO: 5 is a forward primer sequence of NANOG as a pluripotency marker.

SEQ ID NO: 6 is a reverse primer sequence of NANOG as a pluripotency marker.

SEQ ID NO: 7 is a forward primer sequence of LIN28 as a pluripotency marker.

SEQ ID NO: 8 is a reverse primer sequence of LIN28 as a pluripotency marker.

SEQ ID NO: 9 is a forward primer sequence of GAPDH as a house keeping gene.

SEQ ID NO: 10 is a reverse primer sequence of GAPDH as a house keeping gene.

SEQ ID NO: 11 is a reverse primer sequence of SOX9 as a chondrogenic marker.

SEQ ID NO: 12 is a reverse primer sequence of SOX9 as a chondrogenic marker.

SEQ ID NO: 13 is a forward primer sequence of COL2A1 as a chondrogenic marker.

SEQ ID NO: 14 is a reverse primer sequence of COL2A1 as a chondrogenic marker.

SEQ ID NO: 15 is a forward primer sequence of COL1A1 as a chondrogenic marker.

SEQ ID NO: 16 is a reverse primer sequence of COL1A1 as a chondrogenic marker.

SEQ ID NO: 17 is a forward primer sequence of ACAN as a chondrogenic marker.

SEQ ID NO: 18 is a reverse primer sequence of ACAN as a chondrogenic marker.

SEQ ID NO: 19 is a forward primer sequence of COL10A1 as a hypertrophic marker.

SEQ ID NO: 20 is a reverse primer sequence of COL10A1 as a hypertrophic marker.

SEQ ID NO: 21 is a forward primer sequence of RUNX2 as a hypertrophic marker.

SEQ ID NO: 22 is a reverse primer sequence of RUNX2 as a hypertrophic marker.

SEQ ID NO: 23 is a forward primer sequence of VEGFA as a cell hypertrophy marker (Hypertrophic Marker).

SEQ ID NO: 24 is a reverse primer sequence of VEGFA as a cell hypertrophy marker (Hypertrophic Marker).

SEQ ID NO: 25 is a forward primer sequence of MMP13 as a cell hypertrophy marker (Hypertrophic Marker).

SEQ ID NO: 26 is a reverse primer sequence of MMP13 as a hypertrophic marker.

SEQ ID NO: 27 is a forward primer sequence of AQP1 as a hypertrophic marker.

SEQ ID NO: 28 is a reverse primer sequence of AQP1 as a hypertrophic marker.

SEQ ID NO: 29 is a forward primer sequence of IL-1β as an inflammatory cytokine.

SEQ ID NO: 30 is a reverse primer sequence of IL-1β as an inflammatory cytokine.

SEQ ID NO: 31 is a forward primer sequence of IL-6 as an inflammatory cytokine.

SEQ ID NO: 32 is a reverse primer sequence of IL-6 as an inflammatory cytokine.

SEQ ID NO: 33 is a forward primer sequence of TNF-α as an inflammatory cytokine.

SEQ ID NO: 34 is a reverse primer sequence of TNF-α as an inflammatory cytokine.

SEQ ID NO: 35 is the forward primer sequence of MMP1 as MMPs.

SEQ ID NO: 36 is the reverse primer sequence of MMP1 as MMPs.

SEQ ID NO: 37 is the forward primer sequence of MMP10 as MMPs.

SEQ ID NO: 38 is the reverse primer sequence of MMP10 as MMPs.

Claims (10)

1. A composition for diagnosing osteoarthritis comprising an agent for measuring mRNA or protein levels for IL-6.
2. The method of claim 1, wherein the composition further comprises an agent for measuring mRNA or protein levels for one or more biomarkers selected from the group consisting of MMP1, MMP10, COL1A1, RUNX2, VEGFA, ACAN, AQP1, SOX9 and COL2A1 A composition for diagnosis of osteoarthritis, characterized in that
3. The composition for diagnosing osteoarthritis according to claim 1, wherein the composition is a composition for early diagnosis of osteoarthritis.
4. The composition for diagnosing osteoarthritis according to claim 1, wherein the composition diagnoses chondrocyte hypertrophy.
5. A kit for diagnosing osteoarthritis comprising the composition for diagnosing osteoarthritis of claim 1.
6. (a) measuring the mRNA or protein expression level of the IL-6 gene from the patient's biological sample; and

   (B) A method for providing information on the diagnosis of osteoarthritis comprising the step of comparing the mRNA or protein expression level with a control sample.
7. According to claim 6, wherein the step (a) is MMP1, MMP10, COL1A1, RUNX2, VEGFA, ACAN, AQP1, SOX9 and COL2A1 For further measuring mRNA or protein levels for one or more biomarkers selected from the group consisting of A method for providing information on the diagnosis of osteoarthritis, characterized in that.
8. According to claim 6, IL-6, RUNX2, VEGFA, MMP1 and MMP10 gene mRNA or the expression level of its protein is increased compared to the control group, osteoarthritis diagnosis information, characterized in that the information is provided as osteoarthritis. Method for providing information .
9. According to claim 6, IL-6, MMP1, MMP10, ACAN, COL1A1, RUNX2, VEGFA, and the expression level of the mRNA of the AQP1 gene or its protein is increased compared to the control, and the expression level of the COL2A1 gene mRNA or its protein is When it decreases compared to the control group, providing information as an early stage of osteoarthritis is an information providing method for diagnosing osteoarthritis.
10. According to claim 6, IL-6 and AQP1 gene mRNA or the expression level of its protein is increased compared to the control, COL2A1, SOX9 and COL1A1, and the expression level of the COL1A1 gene mRNA or its protein is decreased compared to the control, when the expression level is reduced, the middle stage of osteoarthritis Or providing information as being in the terminal stage is a method of providing information on the diagnosis of osteoarthritis.

Images