WO2012002597A1

WO2012002597A1 - Diagnostic primer for the hepatitis b virus, probe, kit including same, and method for diagnosing the hepatitis b virus using the kit

Info

Publication number: WO2012002597A1
Application number: PCT/KR2010/004331
Authority: WO
Inventors: 구완림; 김성열; 박해준; 박한오; 변상진
Original assignee: (주)바이오니아
Priority date: 2010-07-02
Filing date: 2010-07-02
Publication date: 2012-01-05
Also published as: KR20140022971A; KR101498704B1

Abstract

The present invention relates to a diagnostic primer for the hepatitis B virus, to a probe, and to a detection method using same, and more particularly, to a hepatitis B virus surface antibody S gene-specific primer, to a probe, and to a method for diagnosing the hepatitis B virus using the primer and probe. When the primer and probe of the present invention are used, a small amount of hepatitis B viral DNA present in a biological sample can be quickly and accurately detected, stability in storage can be improved by means of the provision of a dried kit, and highly reproducible results can be obtained.

Description

Primer for hepatitis B virus, a probe, a kit comprising the same, and a method for diagnosing hepatitis B virus using the kit

The present invention relates to a hepatitis B virus primer, a probe and a method for diagnosing hepatitis B virus using the same, and more particularly, a primer, a probe for detecting hepatitis B virus present in a biological sample and an environmental sample, and a method of using the same. It relates to a virus detection method that can be used for the presence and quantitative diagnosis of the hepatitis B virus infection based on the polymerase chain reaction.

Hepatitis B virus is an enveloped virus, which has a small genome of 3.2 kb, and is composed of partially duplex circular DNA. From this, four proteins are expressed, each of which is a surface antigen, a core protein, a DNA polymerase, and an X protein. After the virus enters the host cell, the genome is moved to the nucleus and the double stranded double stranded DNA (also called cccDNA, covalently closed circular DNA, or Relaxed circular DNA), which was partially part of the host cell's repair system, do. After the pregenomic RNA is transcribed and encapsulated into the core, a replication process occurs by hepatitis B virus DNA polymerase using the prezinomic RNA as a template. The mature viral particles then exit the host cell and a new infection cycle is repeated (Ganem D, Varmus HE., 1987, Ann. Rev. Biochem .. 56, 651-93).

Hepatitis B Virus (hereinafter also referred to as 'HBV') is a virus belonging to the Hepadnaviridae family, which is specifically infected only with human liver cells. It is estimated that there are about 350 million chronic carriers worldwide, and in Korea, about 7% of the population is estimated to be about 3 million people. The distribution of infected patients worldwide is large in Africa, Southeast Asia and China, and relatively small in Australia, Western Europe and North America. In the United States, an estimated 140,000 to 320,000 people a year are infected with the hepatitis B virus, with 1.2 million chronic hepatitis patients. In Europe, it is known that 900,000 to 1 million people are infected with hepatitis B virus per year (Andre F, 2000, Vaccine, 18 Suppl S20-2; Tiollais P, Buendia MA, 1991, Sci. Am., 264). 4), 116-23; Fallows DA, Goff SP, 1996, AdvVirus Res., 46, 165-94; Maddrey WC, 2000, J. Med. Virol., 61 (3), 362-6).

Symptoms of hepatitis are mild, fatigue, jaundice in severe cases. In the late stage of chronic hepatitis, complications of cirrhosis occur, ascites, swelling, gastroesophageal variceal bleeding, hepatic encephalopathy, abnormal blood coagulation, spleen hyperplasia.

The prevalence of prenatal and neonatal infections in infected mothers, which are the main path of infection, reaches 90%, and chronic infection rates in adults of around 10%. When exposed to sexual intercourse or needles, it can be infected through wounds (Tiollais P, Buendia MA, 1991. Sci. Am., 264 (4), 116-23; Maddrey WC., 2000, J. Med. Virol, 61 (3), 362-6). In childhood infected patients, the immunity of virus propagation but no hepatitis symptoms lasts for 10-30 years, but these carriers (15-30 years) When the immune system acts to damage the liver cells and develop acute hepatitis. If seroconversion occurs quickly, viral proliferation is suppressed and the symptoms of hepatitis do not develop anymore, but if the virus proliferation is not effectively suppressed, cirrhosis develops, chronic hepatitis develops, and severe cancer develops.

As a treatment for hepatitis B virus, many drugs are being developed or under development for the DNA polymerase of the virus. Currently available drugs include interferon alpha and lamibudine (hereinafter referred to as '3TC'). Interferon alpha is expensive and has only 20% treatment rate (Hoofnagle JH, di Bisceglie AM, 1997. N Engl J Med 0336 (5): 347-56). Excellent and few side effects, but the resistance of the resistant virus is generated to reduce the therapeutic effect is required to develop new drugs (De Clercq E, 1999, Int. J. Antimicrob. Agents, 12 (2), 81-95) .

HBV infection can be determined by measuring HBsAg (HBV surface antigen) in serum.However, to distinguish between chronic and active infections, it can be determined by quantitatively measuring the levels of HBV DNA and liver enzymes circulating in the blood. HBV DNA testing is required. In addition, rapid and accurate quantitative testing of DNA is required for the rapid discovery of hepatitis B virus infections and for monitoring drug resistance or therapeutic effects. However, the conventional methods not only require a lot of time and labor to purify the hepatitis B virus DNA, but also have a problem in that the reproducibility of the experiment is not high.

In order to solve this problem, Korean Patent Registration No. 10-0194003 treats the cell culture with sodium hydroxide and beta-mercaptoethanol, and then neutralizes and heats the polymerase chain reaction (hereinafter, referred to as 'PCR'). Although it succeeded in shortening the time and labor of DNA purification process and minimizing the concern about contamination during PCR reaction, the PCR reaction product was stained with electrophoresis and ethidium bromide on agarose gel. After analyzing the intensity with an image analyzer, it still takes a lot of time and labor when analyzing a large amount of compounds, and in this process, an experimental error occurs, which makes it difficult to obtain accurate results.

Accordingly, the present inventors have designed a novel primer and probe specific for hepatitis B virus, by performing a real-time polymerase chain reaction using the primer, a probe and a kit comprising the same, compared to conventional methods By detecting the hepatitis virus DNA quickly and accurately, and drying the polymerase chain reaction mixture required for the reaction, the storage period is improved while the performance of the solution in the solution state is equal to that of the solution, and the error is simplified by the simplification of the mixing process. The present invention has been completed by confirming that the results can be reduced as much as possible to obtain high reproducibility.

The present invention has been made in view of the above necessity, and an object of the present invention is to provide a primer and probe for hepatitis B virus DNA diagnosis used in real time polymerase chain reaction.

Another object of the present invention is a kit for detecting hepatitis B virus DNA without cross-reacting with other hepatitis viruses, in which all reagents required for the polymerase chain reaction are mixed, dispensed, and dried at one test dose. It is to provide a hepatitis B virus DNA diagnostic kit that does not require a tester's skill.

Still another object of the present invention is to provide a rapid and accurate hepatitis B virus infection and a quantitative diagnosis method of DNA.

In order to achieve the above object, the present invention provides primers and probes necessary for detecting hepatitis B virus DNA through real-time polymerase chain reaction or general polymerase chain reaction.

The real-time polymerase chain reaction of the present invention monitors the reaction results in real time by using oligonucleotide probes in which a primer and a fluorescent substance are chemically bound. During the polymerase chain reaction, the probe binds to the complementary sequence in the nucleic acid of the sample, like two primers. The binding position is slightly away from the primer. Probe of the present invention is a structure in which both the reporter (reporter) and the quencher (fluorescent material) is attached to both ends, if the reporter and the quencher is present in close proximity to each other to cancel the fluorescence of the reporter, but the amplification proceeds As the reporter falls from the quencher, the reporter's fluorescence is detected. Thus, the intensity of fluorescence increases gradually as the amplification cycle increases.

The inventors designed primers and probes at specific sequences of the surface antigen S gene of hepatitis B virus to detect hepatitis B virus of various genotypes as compared to conventional real time polymerase chain reaction products. Self-designed primers and probes are designed to not cross-react with other hepatitis viruses.

Primers and probes of the present invention include a portion of the hepatitis B virus surface antigen S gene (GeneBank Accession No .; X04615) or a portion of its complementary sequence, preferably within the 155th to 835th bases of the base sequence. It is a forward primer which comprises 5-40 base sequences, More preferably, it is a forward primer which is a base sequence shown by SEQ ID NO: 1-4, and a base sequence shown by SEQ ID NOs: 5-8. In addition, the probe is preferably a nucleotide sequence set forth in SEQ ID NOs: 9 to 12, all of which are forward probes.

In addition, the present invention provides a hepatitis B virus detection kit comprising the primer or probe.

The kit includes amplification buffers, dNTPs, controls, detection reagents, etc., in addition to the primers or probes of the present invention, and is preferably provided in a dry state, and includes additional components according to the purpose only when there is no effect on the reaction. can do. The kit, which is provided in a dry state, can be used for a long time due to improved storage stability, and a preparation process of the mixed solution can be omitted to obtain accurate and quantitative results with high reproducibility regardless of the skill of the experimenter.

The kit may further comprise primers and probes for internal control. During the polymerase chain reaction, internal positive control (hereinafter, also referred to as 'IPC') template and primers prepared according to the same can be easily confirmed whether PCR was performed well. The primers include, for example, a part of Mus musculus dishevelled, dsh homolog 1 (Drosophila) (Dvl1) gene (GenBank. Accession No. NM010091) or a part of its complementary sequence, preferably from 942 of the base sequence. It is a forward primer which contains 5 to 40 base sequences in the 1708th base, more preferably a base sequence described in SEQ ID NO: 13 to 15 and a base sequence described in SEQ ID NO: 16 to 18. In addition, the nucleotide sequence shown in SEQ ID NO: 19-21 is preferable, and a probe is all a forward probe.

The internal control primers and probes are positive controls in the test, and when the (real-time) polymerase chain reaction is performed using the present invention, a negative judgment is obtained, that is, when the hepatitis B virus is not present in the sample. Is necessary to verify whether it is an experimental mistake or that no actual hepatitis B virus is present, and should not interfere with the detection of hepatitis B virus gene when amplified with the hepatitis B virus gene primer set of the present invention. If the internal control is positive, the polymerase chain reaction itself indicates no problem.

The primers and probes may be any combination as long as two primers (one forward and one reverse) and one probe, but are preferably a forward primer as shown in SEQ ID NO: 1 and a reverse primer as shown in SEQ ID NO: 5 And forward probes set forth in SEQ ID NO: 9. The primer of the present invention can be used not only for real-time polymerase chain reaction but also for general polymerase chain reaction. In addition, a sample for use in the present invention may be obtained from a clinical sample or an environmental sample, but is not limited thereto. The reporter of the hepatitis B virus probe is preferably FAM (6-carboxyfluorescein), the quencher is BHQ1, the reporter of the internal control probe is TAMRA (Carboxy-tetramethyl-hod-amine), and the quencher is BHQ1. Preferably, but not limited thereto.

In addition, the present invention

1) performing a polymerase chain reaction or a real time polymerase chain reaction using the hepatitis B virus detection primer and the hepatitis B virus detection probe as a template; And

2) provides a method for detecting hepatitis B virus comprising the step of examining the fluorescence value of the presence or absence of amplification or amplification product of step 1).

According to the detection method of the present invention, even if a very small amount of hepatitis B virus is present in the sample due to its high sensitivity, especially in real time polymerase chain reaction, the amplification can be observed immediately during the amplification process. There is no need for a separate amplification product identification step, which reduces detection time. In the present polymerase chain reaction or real time polymerase chain reaction, it is preferable to further use IPC, but is not limited thereto. In the polymerase chain reaction, it is easy to check whether the PCR was performed well by preparing the IPC template and the primers corresponding thereto. In addition, the sample may be obtained from a clinical sample or an environmental sample, but is not limited thereto.

By using the primers, probes and detection methods of the present invention, hepatitis B virus genes can be detected quickly and simply, and even at very low concentrations of hepatitis B virus present in the sample with high sensitivity can be detected accurately. In addition, the development of the hepatitis B virus DNA diagnostic kit of the present invention is expected to be able to accurately diagnose the initial stage of infection, it is expected to greatly contribute to the confirmation of drug resistance and treatment effect of hepatitis B virus through monitoring the drug treatment. do.

Figures 1 and 2 align the hepatitis B virus surface antigen S sequence using BLAST of the National Center for Biotechnology Information (NCBI) to identify the high homology parts, 100% matched to black Indicated. The primers and probes of the present invention were prepared based on the homologous sequences.

FIG. 1 confirms homology based on the genotype C sequences found in Korea, and FIG. 2 compares the sequences of primers and probes prepared based on genotype C with various genotype sequences.

3 to 8 is a real time polymerase chain reaction using a 7500 Fast Real-Time PCR System (manufactured by Applied Biosystems, USA) with all combinations of the HBV primers and probes of the present invention as set forth in SEQ ID NO: 1 to SEQ ID NO: 8 Figure 9 is a graph showing the results, Figure 9 is a combination of primers and probes of the DNA for the internal control of the present invention described in SEQ ID NO: 13 to SEQ ID NO: 21 7500 Fast Real-Time PCR System (manufactured by Applied Biosystems, USA) instrument Graph showing the results of real-time polymerase chain reaction using.

Figure 3: Graphs amplified with primers and probes of set 1

4: Standard curve of graph amplified with primers and probes of set 1

5: Graphs amplified with primers and probes of set 2

Figure 6: Standard curves of graphs amplified with primers and probes of set 2

7: Graph amplified with primers and probes of set 3

8: Standard curve of graph amplified with primers and probes of set 3

9: Graph amplified with eight combinations of primers and probes for internal control. The numbers on the right side of the graph represent test set numbers 1-8.

10 to 12 is a combination of the primers and probes of the present invention described in SEQ ID NO: 4, 8, 12 in which 1 base of SEQ ID NO: 1, 5, 9 is replaced with a mixbase Real-time polymerase chain reaction apparatus Exicycler ^TM This graph shows the results of real-time polymerase chain reaction of HBV standard template using 96 Real-Time Quantitative Thermal Block. In addition, FIG. 13 is a synthetic polymerase chain reaction apparatus Exicycler ^TM 96 Real by synthesizing an inner dT probe of the form in which BHQ, a quencher of the probe described in SEQ ID NO: 9, is bound to an internal T sequence, and synthesized with SEQ ID NOs: 1 and 5 This graph shows the results of real-time polymerase chain reaction of HBV standard template using -Time Quantitative Thermal Block.

NTC: blank as negative control

10: Amplification graphs using SEQ ID NOs: 4, 8, 12

11: Standard curve of amplification graph using SEQ ID NOs: 4, 8, 12

12: Comparative amplification graph of SEQ ID NO: 1, 5, 9 set and SEQ ID NO: 4,8,12 set

13: Graph amplified by the set of SEQ ID NO: 1, 5, 9 (inner dT)

14-17 shows concentration-specific HBV standard template real-time using Exicycler ^™ 96 Real-Time Quantitative Thermal block with a combination of primers and probes of the invention set forth in SEQ ID NOs: 1, 5, 9 and SEQ ID NOs: 13, 16, 19 Graphs and standard curves show the results of polymerase chain reaction.

14: Amplification graphs using sets of SEQ ID NOs: 1, 5, 9

15: Standard curve of amplification graphs using sets of SEQ ID NOs: 1, 5, 9

16: Amplification graph of mixed use of SEQ ID NO: 1, 5, 9 and SEQ ID NO: 13, 16, 19

17: Standard curve of the mixed use amplification graph of SEQ ID NO: 1, 5, 9 set and SEQ ID NO: 13, 16, 19

FIG. 18 shows the results of real-time polymerase chain reaction of HBV standard templates with a dry PCR composition comprising primers and probes of the invention set forth in SEQ ID NOs: 1, 5, 9 and SEQ ID NOs: 13, 16, 19 As a graph, a real-time polymerase chain reaction device Exicycler ^™ 96 Real-Time Quantitative Thermal block was used.

Black curve: Amplification curve of HBV template DNA at 10 to 10 ⁷ copy concentrations

Blue curve: Amplification curve by internally prepared DNA for internal control

NTC: blank as negative control

FIG. 19 shows a standard curve of a real-time polymerase chain reaction graph applying HBV standard template by concentration to a dry PCR mixture using Exicycler ^™ 96 Real-Time Quantitative Thermal Block (Slope: −0.3024, R ² : 0.9994) .

20 is a graph showing the results of real-time polymerase chain reaction of HBV standard template using a dry PCR mixture, using a real-time polymerase chain reaction device Exicycler ^™ 96 Real-Time Quantitative Thermal block.

Black curve: Amplification curve of HBV standard template at ^{10 to} 10 ¹⁰ copy concentrations

NTC: blank as negative control

21 to 25 are real-time polymerase chains using PCR mixtures immediately after drying and at 40 ° C. constant temperature storage days (2 days, 4 days, 6 days, 8 days, respectively) for storage stability testing of PCR mixtures in a dry state. This graph shows the result of the reaction. A real-time polymerase chain reaction device, Exicycler ^™ 96 Real-Time Quantitative Thermal Block, was used and tested on a standard HBV template with a concentration of 10 ¹ to 10 ⁷ copies.

Black curve: Amplification curve of HBV template DNA by concentration

Blue curve: Amplification curve of DNA for internal control

NTC: Public Charge as Negative Control

The formula at the bottom of the graph shows the standard curve of the real-time polymerase chain reaction graph applying the HBV standard template for each concentration.

26 and 27 are graphs showing the results of DNA extraction from HBV genotype panel and real-time polymerase chain reaction using a dried PCR mixture. Results obtained using Exicycler ^™ 96 Real-Time Quantitative Thermal block to be.

26: Amplification curves of genotype panel DNA

27: Type information and concentration measurement results of genotype panel

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are only for illustrating the present invention, and the contents of the present invention are not limited by the following examples.

Example 1. Template DNA Preparation

Then, in order to perform real-time polymerase chain reaction, template DNA was prepared first. The surface antigen S sequence of the hepatitis B virus was aligned to identify a high homology portion (FIG. 1). Subsequently, in the hepatitis B virus surface antigen S gene (GeneBank Accession No .; X04615), one of the highly homologous sequences, 680 bp, the 155 th to 835 th sequences including the primer and probe sequences, were synthesized ( NBiochem. Biophys). Res. Commun. 1998, 248, 200-203) and cloned into pGEM-T-Easy Vector (Cat: A1360, manufactured by Promega, USA).

Specifically, 5 μl of 2X rapid ligation buffer (manufactured by Promega, USA), 1 μl of T-Easy Vector (manufactured by Promega, USA), 1 μl of T4 DNA ligase (manufactured by Promega, USA), 3 μl of gene synthesis material (8 ng). The mixture was put in the same tube, and then placed at a constant temperature of 1 hour at 37 ° C. Subsequently, 5 μl of the reaction solution placed at the constant temperature was placed in 50 μl of E. coli pluripotent cells (competent cells), placed on ice for 30 minutes, incubated for 90 seconds at 42 ° C., and then placed on ice for 2 minutes. The reaction solution was inoculated into LB plates containing ampicillin, IPTG, and X-Gal, followed by incubation at 37 ° C for 16 hours.

Color colonies were taken, incubated for 16 hours in LB liquid medium, centrifuged, the supernatant was discarded, and plasmid DNA was extracted from the pellets using an Accuprep plasmid DNA prep kit (Bioneer, Korea). Plasmid DNA was measured by UV spectrometer (manufactured by Shimazu Co., Japan) and the purity was confirmed to be between 1.8 and 2.0. Based on the concentration measurement results, the DNA copy number was calculated by the following formula. It was.

6.02 × 10 ²³ × concentration (concentration g / ml measured by UV spectrometer) / (3015 + 830) × 660 [3015 bp: size of T-easy vector, 680 bp: size of malaria template DNA]

The copy number of the template DNA was calculated and then diluted 10 × with 1 × TE buffer (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA) and stored at −70 ° C. until use.

Internal control DNA was prepared in the same manner as the template DNA preparation. Internal control DNA is needed to confirm that when a negative result is obtained, the negative result is not due to an amplification error.

Gene was synthesized from the musculus dishevelled, dsh homolog 1 (Drosophila) (Dvl1) gene (GenBank Accession No. NM010091) using the 767 bp region, which is the 928th to 1647th sequence including the primer and probe sequences, for the internal control DNA preparation. Based on the concentration measurement results of the extracted plasmid DNA, DNA copy number was calculated by the following formula.

6.02 × 10 ²³ × concentration (concentration g / ml measured by UV spectrometer) / (3015 + 767) × 660 [3015 bp: size of T-easy vector, 767 bp: size of internal control DNA]

The copy number of the DNA for the internal control was calculated and then diluted 10 × with 1 × TE buffer (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA) and stored at −70 ° C. until use.

Example 2. Primer and Probe Design

The nucleotide sequence 155 to 835 of the hepatitis B virus surface antigen S gene (GeneBank Accession No .; X04615) has a length of 19 to 27 bp and a Tm value of 55 to 65 ° C. It was set as. In addition, between nucleotide sequences 155 to 835, the length was between 20 and 30 bp, and the Tm value was arbitrarily selected as a probe, and the Tm value was checked using the Primer3Plus program (Table 1). .

Internal length of the musculus dishevelled, dsh homolog 1 (Drosophila) (Dvl1) gene (GenBank. Accession No. NM010091), between 942 and 1708, length 17-23 bp, Tm value 55-62 ℃ The base sequence was arbitrarily selected to be a forward and reverse primer. In addition, between nucleotide sequences 942 to 1708, the length was between 19 and 30 bp, and the Tm value was selected between 67 and 72 ° C. at random, and the Tm value was checked using the Primer3Plus program (Table 2). .

First, two primers and one probe of the hepatitis B virus gene were combined into a set, followed by real-time polymerase chain reaction using a 7500 Fast Real-Time PCR System (manufactured by Applied Biosystems, USA). Specifically, 5 μl of 10X Buffer, wTfi polymerase 2.5U, 5 μm of dNTP, 5 μl, Thermostable Pyrophosphatase, PPi, stabilizer, etc. were added to one tube, and the HBV template DNA synthesized in Example 1, the probe and probe for detecting HBV, and distilled water The mixture was mixed to a total volume of 50 μl and then aliquoted into a 96-well plate. At this time, the concentration of the forward primer, the reverse primer and the probe contained in the total dose of 50µl was used 15pmole, respectively. After 10 minutes of denaturation at 95 ° C., 45 cycles of 20 seconds at 95 ° C. and 30 seconds at 55 ° C. were reacted. The amplified fluorescence value was continuously measured once after 55 ° C. 30 second reaction as each PCR cycle proceeded. As a result, it was found that the PCR amplification efficiency of the primers and probes was the highest of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 5, the forward probe of SEQ ID NO: 9 (Table 3, Figures 3 to 13) .

In order to increase the detection efficiency of various genotypes of hepatitis B virus, the 20th base of the forward primer of SEQ ID NO: 1 having the highest PCR amplification efficiency, the 18th base of the reverse primer of SEQ ID NO: 5, and the 7 of the forward probe of SEQ ID NO: 9 Real-time polymerase chain reaction was carried out in the same manner as described above using the forward primer of SEQ ID NO: 4, the reverse primer of SEQ ID NO: 8, and the forward probe of SEQ ID NO: 12 in which each base of the first base was replaced with mixbase (Table 5 ). In the case of using the substituted sequences as described above, there is an advantage in that various subtypes can be detected by additionally matching sequences that are not 100% identical by 1base difference (FIG. 2). As a result of the reaction, the forward primer of SEQ ID NO: 4 replacing T base with Y (T + C), the reverse primer of SEQ ID NO: 8 replacing T base with K (T + G), and Y (T + C) for T base Although the gene amplification proceeded well using the forward probe of SEQ ID NO: 12, the higher amplification efficiency in the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 5, and the forward probe of SEQ ID NO: 9 before substitution Is shown (FIGS. 10-13).

In addition, after combining all the primers and probes for the internal control DNA and the internal control synthesized in Example 1 in a set was carried out in real time reverse transcription polymerase chain reaction in the same manner as described above.

The reaction conditions were denatured at 95 ° C for 10 minutes, and then reacted with 45 cycles of 20 seconds at 95 ° C and 30 seconds at 55 ° C. As a result, primers and probes for the internal control were selected for efficient PCR amplification (Table 4), and the highest PCR amplification efficiency among the primers and probes was the forward primer of SEQ ID NO: 13 and the reverse primer of SEQ ID NO: 16 It was found that the forward probe of SEQ ID NO: 19 (FIG. 9).

Subsequent experiments showed the highest PCR amplification efficiency among the HBV primers and probes (the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 5, the forward probe of SEQ ID NO: 9) and the best of the internal control primers and probes. (Forward primer of SEQ ID NO: 13, reverse primer of SEQ ID NO: 16, forward probe of SEQ ID NO: 19) was used.

The forward probe of SEQ ID NO: 9 has a structure in which FAM is bound as a reporter at the 5 'end and BHQ1 is bound as a quencher at the 3' end. On the other hand, an inner dT probe having a quencher coupled to the eighth base sequence T of the probe sequence was prepared, and real-time polymerase chain reaction was performed by the same method. At this time, the primer was set with the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 5 having the highest amplification efficiency, and performed a real-time polymerase chain reaction using Exicycler ^™ Quantitative Thermal Block (Bionia, Korea). The reaction conditions were denatured at 95 ° C. for 10 minutes, and then reacted 45 cycles at 95 ° C. for 20 seconds and 55 ° C. for 30 seconds. As a result, it can be seen that even when using the inner dT probe in which the position of the quencher (BHQ1) is bound to the 8th T base in the sequence, the amplification efficiency maintains almost the same performance (FIGS. 10 to 13).

Table 1

HBV	Sequence	SEQ ID NO:
Forward primer	CAATCACTCACCAACCTC T TGT	One
	AGTCCCCAACCTCCAATCACCT
		2
	CGTGGTGGACTTCTCTCAATTTT	3
CCAATCACTCACCAACCTC Y TGT	4
Reverse primer	AGCAGGATGAAGAGGAA T ATGATAAAA	5
	CAGGATGAAGAGGAATATGATAAAACG	6
	GCAGACACATCCAGCGATAGC	7
	AGCAGGATGAAGAGGAA K ATGATAAAA	8
TaqMan Probe (Forward)	TCCTGG C TATCGCTGGATGTGTCTGC	9
	TCCTGGCTATCGCTGGATGTGTCTGC	10
	TCCTGGCCAAAATTCGCAGTCCC	11
	TCCTGG Y TATCGCTGGATGTGTCTGC	12

TABLE 2

IPC	Sequence	SEQ ID NO:
Forward primer	ACGCACCAGCTCTTCCTCACT		13
	AGCCGGGCGACATGTTG	14
	GCACCTCCTCTCGGCTAGTTC	15
Reverse primer	CGCGGACAATGGCACTCAT		16
	GACACGATCTCCCGAAGCA	17
	AGGAGGATGCCCGGTCTGT	18
TaqMan Probe (Forward)	CAGCTCAGTGCCTGGCGCCC	19
	CAACTTTGAGAACATGAGCAATGACGACG	20
	ACAGACCGGGCATCCTCCT	21

TABLE 3

HBV	Sequence	SEQ ID NO:
Set1	CAATCACTCACCAACCTC T TGT	One
	AGCAGGATGAAGAGGAA T ATGATAAAA	5
	TCCTGG C TATCGCTGGATGTGTCTGC	9
Set2	AGTCCCCAACCTCCAATCACCT
		2
	CAGGATGAAGAGGAATATGATAAAACG	6
TCCTGGCTATCGCTGGATGTGTCTGC	10
Set3	CGTGGTGGACTTCTCTCAATTTT		3
	GCAGACACATCCAGCGATAGC	7
	TCCTGGCCAAAATTCGCAGTCCC	11

Table 4

IPC	SEQ ID NO:	IPC	SEQ ID NO:	IPC	SEQ ID NO:
Set1	13	Set4	14	Set7	14
	16		17		17
	19		20		21
Set2	14	Set5	15	Set8	15
	17		18		18
	19		20		21
Set3	15	Set6	13
	18		16
	19		21

Table 5

HBV	Sequence	SEQ ID NO:
Set4	CCAATCACTCACCAACCTC Y TGT	4
	AGCAGGATGAAGAGGAA K ATGATAAAA	8
	TCCTGG Y TATCGCTGGATGTGTCTGC	12

Example 3 Standard Template Real-Time Polymerase Chain Reaction

HBV DNA and internal control DNA prepared in Example 1 as a template, HBV primers and probes described in SEQ ID NO: 1, 5, and 9 selected in Example 2, and SEQ ID NO: 13, 16 and 19 Exicycler ^™ Quantitative Thermal Block (manufactured by Bioneer, Korea) real-time polymerase chain reaction was performed by applying primers and probes for internal control described. This is because the amplification of the internal control DNA is independent without affecting the amplification efficiency of the HBV DNA even if the polymerase chain reaction is performed by mixing the internal control DNA, the internal control primer and the probe with the HBV DNA, the HBV primer and the probe. This is to confirm the occurrence. Reaction conditions were carried out 45 cycles of real-time polymerase chain reaction in the same composition and method as in Example 2.

As a result, in the reaction that does not include the internal control DNA, the internal control primer and the probe, the number of copies was calculated according to the method of Example 1, HBV template DNA was able to detect up to 10 copies (Fig. 14), the standard template When a standard graph of the real-time reverse transcription polymerase chain reaction was prepared, the slope was -0.3121 and the R ² value was 0.9992 (FIG. 15). Here, R ² is a correlation coefficient indicating the linearity of the graph when the standard graph of the real-time polymerase chain reaction is drawn, which means that the closer to 1 (the closer to the straight line), the PCR proceeded properly. In addition, when 10 ⁵ copies of the internal control DNA and the internal control primer and the probe were reacted with the HBV DNA, the HBV primer and the probe, the number of copies was calculated according to the method of Example 1, and the HBV template DNA was obtained up to 10 copies. Detection was possible (FIG. 16), and when the standard graph of the standard template real-time reverse transcription polymerase chain reaction was prepared, the slope was -0.2912 and the R ² value was 0.9998 (FIG. 17). This confirmed that the internal control amplification was independently performed without affecting the amplification of the HBV DNA template.

Example 4 Standard Template Real-Time Polymerase Chain Reaction Using PCR Premix Dried

In order to examine the thermal stability of the PCR mixture (premix) dried, PCR mixtures of the same composition as in Example 2 were prepared, dried, and subjected to real-time reverse transcription polymerase chain reaction using an Exicycler ^TM Quantitative Thermal Block (manufactured by Bioneer, Korea). Was executed.

Specifically, 5 µl of 10X Buffer, 2.5 µl of wTfi polymerase, 5 µl of dNTP, 5 µm of Thermostable Pyrophosphatase, PPi, stabilizer, etc., were added to a tube and mixed with distilled water to a total volume of 25 µl. , SuperCentra2 (manufactured by Bioneer, Korea) was dried for 50 to 60 minutes. After mixing the HBV primers and probes described in SEQ ID NOs: 1, 5 and 9, and also the internal control primers and probes described in SEQ ID NOs: 13, 16, and 19 to a total volume of 5 μl. The first dried product was further dispensed and dried for 25 to 30 minutes.

HBV DNA and internal control DNA prepared in Example 1 were added to the dry PCR mixture as a template, and the mixture was dispensed with distilled water to have a total volume of 50 μl and thoroughly mixed to loosen the dry matter. 45 cycles of real-time polymerase chain reaction were performed using Exicycler ^™ Quantitative Thermal Block (manufactured by Bioneer, Korea) under the same conditions and components as in Example 2.

As a result, HBV template DNA was detected as low as 10 copies by counting the copy number according to the method of Example 1 (FIG. 18). When a standard graph of the standard template real-time reverse transcription polymerase chain reaction was prepared, the slope was − 0.3024, the R ² value was 0.9994 (Figure 19). Here, R ² is a correlation coefficient indicating the linearity of the graph when the standard graph of the real-time polymerase chain reaction is drawn, which means that the closer to 1 (the closer to the straight line), the PCR proceeded properly.

From the above results, it can be seen that the same performance is maintained in the two methods using the PCR mixture in the solution state and the real time reverse transcription polymerase chain reaction using the dry mixture.

Using a dry PCR mixture in the same manner as described above, the Exicycler ^™ Quantitative Thermal Block (manufactured by Bioneer, Korea) was used to finally determine the dynamic range (concentration range of HBV DNA that can be detected in one reaction). 45 cycles of real time reverse transcription polymerase chain reaction were carried out under the same conditions as in Example 2. HBV template DNA was calculated by copying the number of copies according to the method of Example 1 from 10 to ¹⁰ copies at the lowest 10 copy concentration range was used, it was confirmed that the HBV DNA detection is normally performed in the 10 log range (Fig. 20) .

Example 6 Stability Test According to Storage Period of Dry Type PCR Compositions

PCR in dry state comprising HBV primers and probes as set forth in SEQ ID NOs: 1, 5 and 9 and primers and probes for internal control as set forth in SEQ ID NOs: 13, 16 and 19, using the same composition and method as in Example 4 above After the mixture was prepared, it was placed at a constant temperature for 8 days at 40 ° C. for 2 days, and the dry type PCR composition for each storage period was subjected to the same conditions as in Example 2 using Exicycler ^™ Quantitative Thermal Block (manufactured by Bioneer, Korea). Real time polymerase chain reaction was performed. This is a method that can be predicted in a short time through accelerated experiments to maintain the performance of the dry PCR composition at -20 ℃, which is the recommended storage temperature, which is considered to be stored at -20 ℃ for about 64 days when stored for 1 day at 40 ℃. (Table 6).

Specifically, the dry-type PCR composition was prepared in 8 batches at once in the same batch, and then a part of the mixture immediately after drying was used for 45 cycles of real-time polymerase chain reaction under the same conditions as in Example 2 to obtain a control result. Got it. All other dry type PCR compositions were placed in a 40 ° C. incubator at the same time, and were taken out at intervals of 2 days as needed for the reaction, and each polymerase chain reaction was performed in real time. At this time, the HBV template DNA was counted in the number of copies according to the method of Example 1, and the reaction was carried out using 7 concentrations from the highest 10 ⁷ to the lowest 10 ¹ copy. From the results of real-time reverse transcription polymerase chain reaction of each dry days obtained using Exicycler ^™ Quantitative Thermal Block (manufactured by Bioneer, Korea), the slope value and R ² value were compared with the control result, The performance of the dry mixtures was compared according to days of storage.

The experiments were conducted at a constant temperature for 8 days at 40 ° C. for 2 days. As a result, the slope of the control group, which is a liquid PCR mixture, was -0.3161, and the R ² value was 0.9992, and the dry type PCR composition stored at 40 ° C was -0.29. --0.31 and the value of R ² were found to be 0.9994 to 0.9999 (FIGS. 21 to 25). This resulted in an equivalent level to the result immediately after drying even after 8 days at 40 ° C constant temperature, which means that the result can be stably obtained almost similar to that immediately after drying for about 512 days when converted to -20 ° C storage days.

Table 6

N.Temp: Normal temperature means normal temperature.

Example 7 Real-Time Polymerase Chain Reaction of HBV Genotype Positive Specimens Using Dry Type PCR Compositions

PCR in dry state comprising HBV primers and probes as set forth in SEQ ID NOs: 1, 5 and 9 and primers and probes for internal control as set forth in SEQ ID NOs: 13, 16 and 19, using the same composition and method as in Example 4 above After the mixture was prepared, real-time polymerase chain reaction was performed at 45 cycles using the Exicycler ^™ Quantitative Thermal Block (manufactured by Bioneer, Korea) under the same conditions as in Example 2. At this time, the reaction was carried out using positive DNA extracted from the HBV genotype panel (PHD201 (M), SeraCare Life Sciences, Inc, USA) to use different HBV genotypes using HBV primers and probes as shown in SEQ ID NOs: 1, 5, and 9. It was confirmed whether the detection was possible.

As a result of the reaction, except for PHD201-01, which was a negative sample, HBV gene detection was possible in all of PHD201-02 to PHD201-09 which were positive samples of the A to F genotype (Figs. 26 and 27). This means that detection of various HBV genotypes is possible by using dry PCR mixtures comprising HBV primers and probes set forth in SEQ ID NOs: 1, 5 and 9.

Claims

A primer for detecting an HBV gene comprising 5 to 40 base sequences within the 155th to 835th bases of the hepatitis B virus surface antigen S gene.
A primer selected from the group consisting of nucleotide sequences set forth in SEQ ID NO: 1 to SEQ ID NO: 8.
A probe for detecting an HBV gene comprising 5 to 40 base sequences within the 155th to 835th bases of the hepatitis B virus surface antigen S gene.
A probe selected from the group consisting of nucleotide sequences set forth in SEQ ID NO: 9 to SEQ ID NO: 12.
The method according to claim 3 or 4,

Probe with structure of reporter and quencher.
The method according to claim 5,

The reporter is a FAM probe.
The method according to claim 5,

The quencher is BHQ1.
HBV gene detection kit comprising a primer for detecting the HBV gene of claim 1 or 2 and a probe for detecting the HBV gene of claim 3 or 4.
The method according to claim 8,

The kit for detecting the HBV gene further comprises a HBV gene detection kit further comprises an internal control gene, primer and probe.
The method according to claim 8,

The HBV gene detection kit is a dry type HBV gene detection kit.
The method according to claim 9,

The internal control genes, primers and probes are derived from the base sequence of Mus musculus dishevelled, dsh homolog 1 (Drosophila) (Dvl1) gene (GenBank. Accession No. NM010091).
The method according to claim 11,

The primer is selected from the group consisting of nucleotide sequences set forth in SEQ ID NOs: 13 to 18, and the probe is selected from the group consisting of nucleotide sequences set forth in SEQ ID NOs: 19 to 21 kit for detecting HBV gene.
1) performing a polymerase chain reaction or a real-time polymerase chain reaction using the HBV gene detection primer of claim 1 and the HBV gene detection probe of claim 3 as a template; And

2) HBV gene detection method comprising the step of examining the fluorescence value for the presence or absence of amplification or amplification product of step 1).
The method according to claim 13,

The step of performing the chain reaction is an HBV gene detection method performed by using a gene for the internal control, primers, probes.
The method according to claim 13,

The internal control genes, primers and probes are derived from the base sequence of Mus musculus dishevelled, dsh homolog 1 (Drosophila) (Dvl1) gene (GenBank. Accession No. NM010091).
The method according to claim 15,

The primer is selected from the group consisting of nucleotide sequences set forth in SEQ ID NOs: 13-18, and the probe is selected from the group consisting of nucleotide sequences set forth in SEQ ID NOs: 19-21.