WO2022029159A1 - Dosage d'adn ramifié à base de xéno-nucléotides pour la détection d'acides nucléiques - Google Patents

Dosage d'adn ramifié à base de xéno-nucléotides pour la détection d'acides nucléiques Download PDF

Info

Publication number
WO2022029159A1
WO2022029159A1 PCT/EP2021/071736 EP2021071736W WO2022029159A1 WO 2022029159 A1 WO2022029159 A1 WO 2022029159A1 EP 2021071736 W EP2021071736 W EP 2021071736W WO 2022029159 A1 WO2022029159 A1 WO 2022029159A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
sequence
nucleotides
xeno
interest
Prior art date
Application number
PCT/EP2021/071736
Other languages
English (en)
Inventor
Piet HERDEWYN
Original Assignee
Theraxen S.A.
Omne Possibile (Switzerland) Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Theraxen S.A., Omne Possibile (Switzerland) Ag filed Critical Theraxen S.A.
Publication of WO2022029159A1 publication Critical patent/WO2022029159A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/682—Signal amplification

Definitions

  • the present invention relates to a system for chemically amplifying nucleic acids of interest based on branched DNA (bDNA) systems in which xeno-nucleotides are employed, which results in an improved sensitivity of the amplification and reduced background noise.
  • bDNA branched DNA
  • the present invention is in the field of specific nucleic acid amplification and detection, in particular in the field of the chemical amplification of a target nucleic acid sequence.
  • a test should be easy to use and give rapid results, ideally, within one hour (from sample collection to assay result).
  • a diagnostic test should not use a complicated apparatus and should be suitable to be operated in remote places (low to moderately complex systems). Advances in chemistry, molecular biology, automation, immunology, engineering and nucleic acids amplification are needed to reach this goal (Caliendo et al., Clinical Infectious Diseases 57(S3) (2013), 139-170).
  • PCR polymerase chain reaction
  • other nucleic acids amplification systems can detect an infection with great sensitivity and specificity.
  • a real time PCR reaction takes several hours to perform. It is used for the detection of viral infections such as HIV, HBV, HCV, CMV, and this diagnostic method has also helped a lot in the management and treatment procedure of the infected person.
  • Nucleic acid based technologies are tuned to detect known sequences of the pathogen of interest, and may also be used to detect the emergence of mutants.
  • DNA polymerases enzymes
  • deoxynucleoside triphosphates in the amplification reaction so as to multiply the sequence of the viral target DNA or RNA.
  • detection methods were further improved using nanotechnology that does not require the use of amplification reagents.
  • DNA amplification can be avoided by using a chemical amplification system, so that the target nucleic acids can be directly detected, without the need for enzymatic amplification of the target itself.
  • An example for such a chemical amplification assay is the so-called “branched DNA” or “bDNA” assay as described e.g. in W02008/069884 or LIS2012/052498. In a typical bDNA assay, e.g.
  • a target mRNA whose expression is to be detected is released from cells and captured by a capture probe (CP) on a solid surface (e.g., a well of a microtiter plate) through synthetic oligonucleotide probes called capture extenders (CEs).
  • Each capture extender has a first polynucleotide sequence that can hybridize to the target mRNA and a second polynucleotide sequence that can hybridize to the capture probe.
  • two or more capture extenders are used.
  • Probes of another type, called label extenders (LEs) hybridize to different sequences on the target mRNA and to sequences on an amplification multimer.
  • a probe set for a given mRNA thus consists of CEs, LEs, and optionally BPs for the target mRNA.
  • the CEs, LEs, and BPs are complementary to nonoverlapping sequences in the target mRNA, and are typically, but not necessarily, contiguous.
  • Signal amplification begins with the binding of the LEs to the target mRNA. An amplification multimer is then typically hybridized to the LEs.
  • the amplification multimer has multiple copies of a sequence that is complementary to a label probe which contains a label which can be detected (the amplification multimer is typically, but not necessarily, a branched-chain nucleic acid; for example, the amplification multimer can be a branched, forked, or comb-like nucleic acid or a linear nucleic acid).
  • the label can be an enzyme or a nucleic acid which itself can be detected by various methods.
  • the label for example, alkaline phosphatase, is covalently attached to each label probe.
  • the label can be non-covalently bound to the label probes.
  • labeled complexes are detected, e.g., by the alkaline phosphatase-mediated degradation of a chemilumigenic substrate, e.g., dioxetane.
  • Luminescence is reported as relative light unit (RLUs) on a microplate reader. The amount of chemiluminescence is proportional to the level of mRNA expressed from the target gene.
  • RLUs relative light unit
  • Such a bDNA assay directly measures nucleic acids at physiological levels, by boosting the reporter signal. It avoids extraction and amplification errors. Its measurement threshold is as sensitive as 50 target molecules (Beld et al., J. Clin. Microbiol. 40 (2002), 788-793).
  • this assay fails to detect target nucleic acid sequences with low noise.
  • natural biological samples contain many nucleic acids, some of which complement DNA sequences that might be used to assemble the nanostructure of the assay. These can interact with the signaling molecules used in the assay.
  • This background noise was addressed, for example, by incorporating certain synthetic nucleobases (in particular iso-cytosine and iso-guanidine; Benner et al., Cold Spring Harb Perspect Biol. 2016; 8:a023770) which cannot complement any natural nucleotides into components of the bDNA assay. Consequently, oligonucleotides which contain such modified nucleobases are less prone to form structures that generate background noise. By this measure background noise could be dramatically decreased.
  • the method is applied by the DNA Diagnostics of Bayer Co for detecting viral infections such as HIV, HBV, HCV, improving health care of more than 400 000 patients a year.
  • the assay uses 96-well microplates and chemiluminiscent detection of the hybridized probes (Bushnell et al., Bioinformatics 15 (1999), 348-355; Elbeik et al. J. Clin. Microb. 42 (2004), 563-569; and Elbeik et al. J. Clin. Microb. 42 (2004), 3120-3127).
  • the present invention aims at further improving the above described bDNA assays, in particular the part which relates to the chemical amplification of the nucleic acid of interest, so as to make them more sensitive and/or more robust.
  • the present invention relates to a system for chemically amplifying one or more nucleic acids of interest, the system comprising: a solid support carrying one or more oligonucleotides which function as capture probe (CP); optionally, one or more oligonucleotides which function as capture extender (CE); optionally, one or more oligonucleotides which function as label extender (LE); one or more pre-amplifier molecules (PA) which are nucleic acid molecules comprising sequences complementary either to the nucleic acid of interest or to a label extender, and comprising a plurality of sequences PA1 complementary to at least one amplifier molecule; and one or more amplifier molecules (AM) which are nucleic acid molecules comprising sequences AM1 complementary to sequences PA1 in the preamplifier molecules; wherein the one or more oligonucleotides which function as capture extender (CE), if present, each comprise a first sequence CE1 which is complementary to a sequence in a nucleic acid of
  • the system for chemically amplifying one or more nucleic acids of interest corresponds to the amplification system known from classical bDNA assays, also known as bDNA systems or branched DNA assay.
  • the amplification components in the system according to the invention are chemically modified so as to contain at least two different types of xeno-nucleotides (having a modified sugar backbone), XN1 and XN2, which differ in their capability to hybridize with naturally occurring RNA or DNA.
  • those sequences of the amplification components of the system according to the invention that are intended to bind to the target nucleic acid of interest contain xeno-nucleotides XN1 (such as, e.g., hexitol nucleic acid), which is advantageous as these xeno-nucleotides XN1 hybridize particularly strongly with the target nucleic acid.
  • xeno-nucleotides XN1 such as, e.g., hexitol nucleic acid
  • those sequences of the amplification components which are intended to bind to a complementary sequence in another amplification component of the system according to the invention, but not to the nucleic acid of interest contain xeno-nucleotides XN2 (such as, e.g., xylonucleic acid), which is advantageous as these xeno-nucleotides XN2 hybridize particularly strongly with corresponding complementary xeno-nucleotides XN2 but not with naturally occurring RNA or DNA.
  • xeno-nucleotides XN2 such as, e.g., xylonucleic acid
  • the different amplification components can be assembled in a more stable and more robust manner while, at the same time, an unspecific binding of these components to the nucleic acid of interest can be prevented.
  • a further advantage of the chemical amplification system provided herein consists in that both types of xeno-nucleotides XN1 and XN2 are more stable against chemical degradation as well as enzymatic degradation by RNases and DNases than naturally occurring RNA and DNA, which further contributes to the improved stability and robustness of the system according to the invention. This also allows to provide a chemical amplification system, or a diagnostic device based on such an amplification system, which is re-usable.
  • nucleotides As regards the nature of the nucleotides to be used in the different components of the amplification system according to the present invention, these will be described in detail further below.
  • the amplification system comprises a solid support carrying one or more oligonucleotides which function as capture probes (CP).
  • the solid support may be any solid support suitable for immobilizing an oligonucleotide such as a membrane, a glass or plastic slide, a silicon or quartz chip, a plate or other spatially addressable solid support.
  • membranes are, e.g., nylon, PVDF, and nitrocellulose membranes.
  • surface-modified and pre-coated slides with a variety of surface chemistries can be used as support, as well as silanated and silyated slides with free amino and aldehyde groups, respectively.
  • Such slides permit covalent coupling of molecules (e.g., polynucleotides with free aldehyde, amine, or other reactive groups) to the slides.
  • slides with surface streptavidin can be used and can bind biotinylated capture probes.
  • the solid support can comprise particles such as microspheres (e.g., beads), a conduit surface, or it can comprise a substantially planar and/or spatially addressable support. Different nucleic acids are optionally captured on different distinguishable subsets of particles or at different positions on a spatially addressable solid support. The nucleic acids are captured to the solid support through hybridization with capture probes and/or capture extenders.
  • the solid support can have a planar surface and is typically rigid.
  • the planar surface can be, e.g., the surface of a slide or an interior surface of a compartment or well.
  • Exemplary materials for the solid support include, but are not limited to, glass, silicon, silica, quartz, plastic, polystyrene, nylon, a metal, a ceramic, and nitrocellulose.
  • the solid support can, e.g., be a multiwell plate or a glass slide with an array of capture probes laid out in a grid pattern at selected positions.
  • the oligonucleotide which functions as a capture probe (CP) can be immobilized on the solid support by any suitable interaction, e.g. electrostatically or covalently bound, directly or via a linker or a ligand.
  • the capture probe can be covalently bound using functional groups such as amino or succinylated or (di)sulfide or hydrazine modified oligonucleotides on carboxylate or isothiocyanate or aminopropyl or iodoacetamide or mercaptosilanized or aldehyde modified solid support.
  • capture probe refers to an oligonucleotide which is attached to a solid support and which comprises a sequence useful to directly or indirectly specifically capture a particular nucleic acid of interest.
  • a capture probe in one embodiment includes a sequence which is complementary to a sequence in the nucleic acid of interest and which therefore can specifically hybridize directly to a nucleic acid of interest and capture it to the solid support.
  • a system for chemical amplification according to the present invention comprises two or more capture probes which bind to different sequences in the nucleic acid of interest.
  • the capture probe comprises at least one polynucleotide sequence that is complementary to a sequence in at least one capture extender (CE).
  • the capture probe is preferably single-stranded.
  • the length of the sequence CP1 in the capture probe can be in the range of 8 to 50 nucleotides, preferably in the range of 8 to 40 nucleotides or in the range of 8 to 30 nucleotides, more preferable between 10 and 30 nucleotides and even more preferably between 20 and 30 nucleotides.
  • the length of the capture probe may be the same as the length of the sequence CP1 (if the capture probe consists of CP1 ) but is typically greater than the length of CP1 , e.g., 2 to 30 (preferably 3 to 10) nucleotides greater than the length of CP1 .
  • the capture probe allows to either directly or indirectly (via a capture extender (CE)) bind the nucleic acid of interest to the solid support, thereby immobilizing it and making it accessible for chemical amplification and subsequent detection.
  • CE capture extender
  • the chemical amplification system of the present invention can also comprise a capture extender (CE).
  • CE capture extender
  • CE refers to an oligonucleotide that is capable of hybridizing to a nucleic acid of interest and to a capture probe.
  • a capture extender can bind a particular nucleic acid of interest to a particular solid support, through a capture probe, with high specificity.
  • the capture extender typically has a first nucleotide sequence CE1 , which is complementary to a (target) sequence of the nucleic acid of interest, and a second nucleotide sequence CE2, which is complementary to a sequence of the capture probe.
  • the first and second sequences are typically not complementary to each other.
  • the capture extender is preferably single-stranded.
  • the length of the capture extender it is not particularly limited as long as it allows hybridization to the target sequence and hybridization to the capture probe.
  • a typical length would be in the range of 18 to 150 nucleotides, preferably 20 to 150 nucleotides, more preferably 30 to 150 nucleotides.
  • the nucleotide sequence CE1 in the capture extender preferably has a length between 10 and 100 nucleotides, more preferably between 20 and 100 nucleotides or between 50 and 100 nucleotides.
  • the length of CE1 may be between 10 and 30 nucleotides, particularly about 20 nucleotides.
  • the nucleotide sequence CE2 in the capture extender can have the same length as the capture probe or it can be shorter than the capture probe and be only complementary to part of the capture probe.
  • CE2 has preferably a length in the range of 8 to 50 nucleotides, preferably in the range of 8 to 40 nucleotides or in the range of 8 to 30 nucleotides, more preferable between 10 and 30 nucleotides and even more preferably between 20 and 30 nucleotides.
  • the capture extender may comprise a sequence CE2 which consists of xylonucleic acid (XNA) of the sequence 5’-GUACCGAUUG-3’ (SEQ ID NO:1 ).
  • This sequence CE2 binds to the complementary XNA sequence 3’-CAUGGCUAAC-5’ (SEQ ID NO:2), which can be used as the sequence CP1 in the capture probe, with an advantageously high hybridization strength (as demonstrated in Example 2).
  • the capture extender allows for an indirect immobilization of the nucleic acid of interest to the solid support by acting as a link between the capture probe (CP) and the nucleic acid of interest.
  • a system for chemical amplification according to the present invention comprises two or more capture extenders which bind to different sequences in the nucleic acid of interest.
  • the chemical amplification system of the present invention can also comprise at least one label extender (LE).
  • label extender refers to an oligonucleotide that is capable of hybridizing to a nucleic acid of interest and to a pre-amplifier molecule.
  • a label extender can link a particular nucleic acid of interest to a pre-amplifier molecule.
  • the label extender typically has a first nucleotide sequence LE1 , which is complementary to a sequence of the nucleic acid of interest, and a second nucleotide sequence LE2, which is complementary to a sequence of a pre-amplifier molecule.
  • the label extender is preferably single-stranded.
  • the length of the label extender is not particularly limited as long as it allows hybridization to the target sequence (nucleic acid of interest) and hybridization to the pre-amplifier molecule.
  • a typical length would be in the range of 18 to 150 nucleotides, preferably 20 to 150 nucleotides, more preferably 30 to 150 nucleotides.
  • the nucleotide sequence LE1 in the label extender preferably has a length between 10 and 100 nucleotides, more preferably between 20 and 100 nucleotides or between 50 and 100 nucleotides.
  • the length of LE1 may be between 10 and 30 nucleotides, particularly about 20 nucleotides.
  • the nucleotide sequence LE2 in the label extender has preferably a length in the range of 8 to 50 nucleotides, preferably in the range of 8 to 40 nucleotides or in the range of 8 to 30 nucleotides, more preferable between 10 and 30 nucleotides and even more preferably between 20 and 30 nucleotides.
  • the label extender may comprise a sequence LE2 which consists of xylonucleic acid (XNA) of the sequence 5’-UGCUACGC-3’.
  • This sequence LE2 binds to the complementary XNA sequence 3’-ACGAUGCG-5’, which can be used as the sequence PA2 in the pre-amplifier molecules, with an advantageously high hybridization strength (as demonstrated in Example 2).
  • a system for chemical amplification comprises two or more label extenders which bind to different sequences in the nucleic acid of interest.
  • the one or more label extender(s) are designed in a manner that they hybridize to sequences on the nucleic acid of interest which are different from those to which the capture probe(s) or the capture extender(s) bind.
  • the amplification system may optionally also comprise blocking probes (BPs) which are nucleic acid molecules which hybridize to regions in the nucleic acid of interest not occupied by capture probes, capture extenders, label extenders or pre-amplifier molecules and which thereby reduce non-specific binding.
  • BPs blocking probes
  • the chemical amplification system comprises one or more pre-amplifier molecules (PA) which are nucleic acid molecules comprising sequences complementary either to the nucleic acid of interest or to a label extender and comprising a plurality of (preferably identical) sequences PA1 complementary to at least one amplifier molecule.
  • PA pre-amplifier molecules
  • the pre-amplifier molecules comprise a sequence PA3 which is complementary to a sequence in the nucleic acid of interest, thereby allowing the direct binding (via hybridization) of the pre-amplifier molecule to the nucleic acid of interest.
  • the pre-amplifier molecules comprise a sequence PA2 which is complementary to a sequence LE2 in the label extender.
  • the label extender links the nucleic acid of interest (via hybridization) to the pre-amplifier molecules, thereby immobilizing the pre-amplifier molecules on the solid support.
  • the pre-amplifier serves as an intermediate between one or more label extenders and amplifier molecules.
  • the preamplifier is capable of hybridizing simultaneously to at least two label extenders and to a plurality of amplifiers.
  • the pre-amplifier molecules may comprise repeating sequences PA1 , each of which consists of xylonucleic acid (XNA) of the sequence 5’-GUUGCAGA-3’.
  • This sequence PA1 binds to the complementary XNA sequence 3’-CAACGUCU-5’, which can be used as the sequence AM1 in the amplifier molecules, with an advantageously high hybridization strength (as demonstrated in Example 2).
  • the chemical amplification system comprises one or more amplifier molecules (AM) which are nucleic acid molecules comprising sequences AM1 complementary to sequences PA1 in the pre-amplifier molecules.
  • AM amplifier molecules
  • the preamplifier molecules comprise a plurality of (preferably identical) sequences PA1 complementary to a sequence in the amplifier molecules, hybridization of multiple amplifier molecules to the pre-amplifier molecules leads to a chemical amplification of the nucleic acid of interest and the pre-amplifier connects the amplifier molecules to the solid support.
  • the amplifier molecules furthermore comprise a plurality of sequences which allow the binding of a probe (label probe (LP)) which can then be detected in an assay capable of detecting bound amplifier molecules.
  • label probe LP
  • amplification in the context of the present invention refers to an accumulation of two or more molecules in a system, which accumulation is specifically associated with the presence of a nucleic acid of interest (e.g., a target nucleic acid of a sample) in the system (e.g., in solution or at a surface).
  • the amplification consists of an accumulation of another molecule dependent on the presence of the nucleic acid of interest.
  • the presence of a target nucleic acid of interest in the system can be amplified into a large number of detectable label probes (or amplification oligomers) bound to a solid support in association with the initial presence of the target nucleic acid in a sample.
  • detectable label probes or amplification oligomers
  • the term “chemical amplification” as used in the context of the present invention refers to an accumulation of molecules based on chemical interactions, such as binding of nucleic acid molecules to each other via hybridization, and is in contrast to enzymatic amplification such as in PCR reactions.
  • nucleic acid molecules "hybridize” when they associate to form a stable duplex, e.g., under relevant assay conditions.
  • Nucleic acids hybridize due to a variety of well characterized physico-chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like.
  • An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology Hybridization with Nucleic Acid Probes, Part 1 Chapter 2, "Overview of principles of hybridization and the strategy of nucleic acid probe assays" (Elsevier, New York).
  • complementary refers to a polynucleotide that forms a stable duplex with its "complement,” e.g., under relevant assay conditions.
  • two polynucleotide sequences that are complementary to each other have mismatches (mismatched base pairs) at less than about 20% of the bases, at less than about 10% of the bases, preferably at less than about 5% of the bases, one mismatch, and more preferably have no mismatches.
  • nucleic acid encompasses any physical string of monomer units that can be corresponded to a string of nucleotides, including a polymer of nucleotides (e.g. a typical DNA or RNA polymer).
  • the nucleotides of the nucleic acid can be deoxyribonucleotides, ribonucleotides or polymers of nucleotide analogs, can be natural or non-natural and can be unsubstituted, unmodified, substituted or modified.
  • nucleotides can be linked by phosphodiester bonds or by phosphorothioate linkages, methylphosphonate linkages, boranophosphate linkages or the like.
  • the nucleic acid can additionally contain non-nucleotide elements, such as labels, quenchers, blocking groups or the like.
  • nucleic acid preferably refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
  • a nucleic acid can be singlestranded or double-stranded.
  • the different components of the system for chemically amplifying a nucleic acid of interest comprise sequences containing xeno-nucleotides.
  • xeno-nucleotides refers to nucleotides that have a modified sugar moiety, i.e. that contain a chemical moiety which is different from ribose and deoxyribose as contained in naturally occurring RNA and DNA, respectively.
  • a xeno-nucleotide sequence thus comprises a sugarphosphate backbone (like natural nucleic acids), except that a chemical moiety different from ribose and deoxyribose is present instead of the sugar, wherein said chemical moiety carries a nucleobase. While this chemical moiety may be conveniently referred to as a “modified sugar” (i.e., a chemical moiety different from ribose and deoxyribose), it will be understood that the corresponding chemical moiety does not actually need to be a sugar (i.e., a saccharide or carbohydrate) in the strict chemical sense.
  • a xeno-nucleotide may contain a modified sugar such as threose or xylose but also cyclohexene which would not normally be regarded as a sugar.
  • xeno-nucleotides and “xeno-nucleotides having a modified sugar backbone” are used herein interchangeably.
  • Xeno-nucleotides preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • the capability of the corresponding xeno-nucleotides to base-pair (hybridize) with complementary natural RNA or DNA depends on the modified sugar backbone of the xeno-nucleotides (and its effect on the spatial arrangement of the nucleobases in the xeno-nucleotides).
  • some xeno-nucleotides may exhibit a stronger binding strength (hybridization strength) when hybridizing with a complementary RNA or DNA (as compared to the binding strength of a corresponding RNA or DNA duplex), while other xeno-nucleotides may exhibit a weaker binding strength when hybridizing with a complementary RNA or DNA or may not at all hybridize with complementary RNA or DNA.
  • the present invention is based on the use of at least two different types of xeno- nucleotides which are referred to as “XN1” and “XN2”, respectively.
  • the xeno-nucleotides XN1 are used in those sequences of the different components of the chemical amplification system according to the invention, which are intended to bind to the nucleic acid of interest.
  • the use of the xeno-nucleotides XN1 for this purpose is advantageous as they bind to (hybridize with) the nucleic acid of interest more strongly than a corresponding DNA (having the same nucleobases as the xeno- nucleotides XN1 ) which would be used in a conventional bDNA system. This allows the nucleic acid of interest to be amplified and subsequently detected with higher sensitivity and decreased noise.
  • the xeno-nucleotides XN1 are defined herein by the requirement that each single xeno-nucleotide XN1 can hybridize with a complementary ribonucleotide (i.e., a ribonucleotide containing a complementary nucleobase) and, when doing so, exhibits a greater hybridization strength than a corresponding deoxyribonucleotide (containing the same nucleobase as the xeno-nucleotide XN1 ) hybridizing with a complementary ribonucleotide.
  • a complementary ribonucleotide i.e., a ribonucleotide containing a complementary nucleobase
  • each xeno-nucleotide XN1 can form an XN1 :RNA base-pair having a greater hybridization strength than a corresponding DNA: RNA base-pair (with the same complementary nucleobases).
  • this definition of XN1 is fulfilled, e.g., by locked nucleic acid (LNA), hexitol nucleic acid (HNA), altritol nucleic acid (ANA), cyclohexene nucleic acid (CeNA), and 2'-O-(methoxyethyl)-ribonucleic acid (MOE-RNA).
  • LNA locked nucleic acid
  • HNA hexitol nucleic acid
  • ANA altritol nucleic acid
  • CeNA cyclohexene nucleic acid
  • MOE-RNA 2'-O-(methoxyethyl)-ribonucleic acid
  • RNAs of interest In a system for chemically amplifying one or more RNAs of interest, it is particularly preferred to use any of LNA, HNA, ANA and/or CeNA as xeno-nucleotides XN1. In a system for chemically amplifying one or more DNAs of interest, it is particularly preferred to use LNA as xeno-nucleotides XN1 .
  • the xeno-nucleotides XN2 are used in those sequences of the components of the chemical amplification system according to the invention, which are intended to bind to a complementary sequence in another component of the chemical amplification system but are not intended to bind to the nucleic acid of interest.
  • the use of the xeno-nucleotides XN2 for this purpose is advantageous as they bind to (hybridize with) the respective complementary XN2 sequences more strongly than a corresponding DNA:DNA duplex (which would be used in a conventional bDNA system), as also demonstrated in Example 2. This allows the different components of the chemical amplification system according to the invention to be assembled in a more stable and more robust manner.
  • the use of the xeno-nucleotides XN2 is also advantageous as they bind less strongly (or preferably do not at all bind) to complementary RNA or DNA (as may be contained in the nucleic acid of interest), in comparison to the binding strength of a corresponding DNA: RNA or DNA: DNA duplex.
  • an undesirable hybridization of the sequences containing xeno-nucleotides XN2 to the nucleic acid of interest can be prevented or reduced, whereby the nucleic acid of interest can be chemically amplified and subsequently detected with improved sensitivity and reduced noise.
  • the xeno-nucleotides XN2 are defined herein firstly by the requirement that each single xeno-nucleotide XN2, when hybridizing with a complementary ribonucleotide (i.e., a ribonucleotide containing a complementary nucleobase), exhibits a lower hybridization strength than a corresponding deoxyribonucleotide (containing the same nucleobase as the xeno-nucleotide XN2) hybridizing with a complementary ribonucleotide.
  • a complementary ribonucleotide i.e., a ribonucleotide containing a complementary nucleobase
  • a xeno-nucleotide XN2 which does not at all hybridize with a complementary ribonucleotide.
  • a xeno-nucleotide XN2 hybridizes with a complementary ribonucleotide at all, it will form an XN2:RNA base-pair having a lower hybridization strength than a corresponding DNA:RNA base-pair (with the same complementary nucleobases).
  • the xeno-nucleotides XN2 are secondly defined by the additional (cumulative) requirement that each single xeno- nucleotide XN2, when hybridizing with a complementary xeno-nucleotide XN2 (i.e., another xeno-nucleotide XN2 containing a complementary nucleobase), exhibits a greater hybridization strength than a corresponding DNA:DNA base-pair (containing the same complementary nucleobases as the XN2:XN2 base-pair).
  • this definition of XN2 is fulfilled, e.g., by xylonucleic acid (XNA), deoxyxylonucleic acid (dXNA), pyranosyl-ribonucleic acid (pRNA), pyranosyl- deoxyribonucleic acid (pDNA), and homo-deoxyribonucleic acid (homo-DNA).
  • XNA xylonucleic acid
  • dXNA deoxyxylonucleic acid
  • pRNA pyranosyl-ribonucleic acid
  • pDNA pyranosyl- deoxyribonucleic acid
  • homo-DNA homo-deoxyribonucleic acid
  • any of XNA, dXNA, pRNA, pDNA and/or homo-DNA can be employed as xeno- nucleotides XN2. It is particularly preferred that XNA and/or dXNA is employed as xeno-nucleotides XN2, and even more
  • At least 60% of the nucleotides comprised in each sequence CE1 , CP2, LE1 and PA3 are xeno-nucleotides XN1 having a modified sugar backbone.
  • at least 70%, more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, and yet even more preferably 100% of the nucleotides comprised in each sequence CE1 , CP2, LE1 and PA3 are xeno-nucleotides XN1 (such as, e.g., HNA, ANA, CeNA, or MOE-RNA).
  • the xeno-nucleotides XN1 in any of the sequences CE1 , CP2, LE1 and PA3 are locked nucleic acid (LNA), it is preferred that 60% to 95%, preferably 60 to 90%, more preferably 70 to 80% of the nucleotides comprised in the respective sequence are LNA nucleotides.
  • At least 60% of the nucleotides comprised in each sequence CE2, CP1 , LE2, PA1 , PA2 and AM1 are xeno-nucleotides XN2 having a modified sugar backbone.
  • at least 70%, more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, and yet even more preferably 100% of the nucleotides comprised in each sequence CE2, CP1 , LE2, PA1 , PA2 and AM1 are xeno-nucleotides XN2 (such as, e.g., XNA, dXNA, pRNA, pDNA, or homo-DNA).
  • hybridization strength refers to the binding strength between two nucleotides or between two nucleic acids, which interact with one another via their respective nucleobases.
  • a nucleotide hybridizes with another nucleotide (or a single-stranded nucleic acid hybridizes with another single-stranded nucleic acid) through the formation of hydrogen bonds between their respective complementary bases.
  • the hybridization strength can be determined by various methods known in the art.
  • the hybridization strength is determined by assessing the melting temperature (T m ) of the duplex (i.e., the hybridization product), whereby a higher melting temperature indicates a greater hybridization strength, and a lower melting temperature indicates a lower hybridization strength.
  • T m melting temperature
  • the melting temperature of a nucleotide or nucleic acid duplex is the temperature at which 50% of the duplexes are dissociated, i.e. half of the base pairs in a population of the duplex are dissociated and half are associated. Accordingly, in the case of a single nucleotide (forming a single base pair), the melting temperature of the corresponding duplex is the temperature at which half of the duplexes in the population are dissociated and half are associated.
  • the melting temperature for any particular duplex can be calculated and/or measured, e.g., by recording a thermal denaturation curve for the duplex (e.g., by subjecting a duplex in solution to gradually increasing temperature while monitoring the denaturation of the duplex) and determining the temperature corresponding to the midpoint in the observed transition from the double-stranded to the single-stranded form, whereby that midpoint temperature represents the melting temperature.
  • a thermal denaturation curve for the duplex e.g., by subjecting a duplex in solution to gradually increasing temperature while monitoring the denaturation of the duplex
  • determining the temperature corresponding to the midpoint in the observed transition from the double-stranded to the single-stranded form whereby that midpoint temperature represents the melting temperature.
  • Such an experiment can be easily conducted, e.g., using UV spectroscopy.
  • Alternative methods are known in the art and can likewise be used, e.g. , methods using nuclear magnetic resonance (NMR), circular dichroism (CD), or
  • the hybridization strength preferably refers to the melting temperature (T m ) of the corresponding duplex.
  • T m melting temperature
  • locked nucleic acid or “LN A” as used in the context of the present invention refers to any nucleic acid in which the sugar moiety (in the sugar-phosphate backbone) contains at least one bridge, so that the sugar is locked in a certain conformation.
  • Neighboring LNA nucleotides can be connected via a phosphodiester linkage between the 3’- and 5’-hydroxy groups of the respective nucleotides.
  • a locked nucleic acid refers to a nucleic acid comprising ribose as the sugar, wherein the 2’-oxygen atom of said ribose is connected via a methylene (-CH2-) group to the 4’-carbon atom of said ribose (resulting in a 2’-C,4’-C oxymethylene bridge), e.g., as illustrated in the following:
  • Locked nucleic acids preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly bases selected from adenine (A), thymine (T) or uracil (U), guanine (G), and cytosine (C).
  • LNA nucleotides can be used as xeno-nucleotides XN1 in accordance with the present invention. Further information on locked nucleic acids can be found, e.g., in Singh SK et al., Chem Commun 4 (1998), 455-456.
  • hexitol nucleic acid refers to any nucleic acid containing a hexitol group, particularly a 1 ,5-anhydrohexitol group, as the sugar moiety in the sugar-phosphate backbone.
  • the nucleobase can be attached to the 2’-position of the hexitol group, and neighboring HNA nucleotides can be connected via a phosphodiester linkage between the 4’- and 6’-hydroxy groups of the respective nucleotides.
  • a corresponding exemplary HNA nucleotide is illustrated in the following:
  • Hexitol nucleic acids preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly bases selected from adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • HNA nucleotides can be used as xeno-nucleotides XN1 in accordance with the present invention. Further information on hexitol nucleic acids can be found, e.g., in: Hendrix C et al., Chem Eur J 3(1 ) (1997), 110-120; or Hendrix C et al., Chem Eur J 3(9) (1997), 1513-1520.
  • altritol nucleic acid refers to any nucleic acid containing an altritol group, particularly a D-altritol group, as the sugar moiety in the sugar-phosphate backbone.
  • the nucleobase can be attached to the 2’-position of the altritol group, and neighboring ANA nucleotides can be connected via a phosphodiester linkage between the 4’- and 6’-hydroxy groups of the respective nucleotides.
  • a corresponding exemplary altritol nucleic acid is illustrated in the following:
  • Altritol nucleic acids preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly bases selected from adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • ANA nucleotides can be used as xeno-nucleotides XN1 in accordance with the present invention. Further information on altritol nucleic acids can be found, e.g., in Allart B et al., Chem Eur J 5(8) (1999), 2424-2431.
  • cyclohexene nucleic acid or “CeNA” as used in the context of the present invention refers to any nucleic acid containing a cyclohexene group in place of the sugar moiety in the sugar-phosphate backbone.
  • CeNA nucleotide A corresponding exemplary CeNA nucleotide is illustrated in the following:
  • Cyclohexene nucleic acids preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly bases selected from adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • CeNA nucleotides can be used as xeno-nucleotides XN1 in accordance with the present invention. Further information on cyclohexene nucleic acids can be found, e.g., in Wang J et al., J Am Chem Soc 122(36) (2000), 8595-8602.
  • MOE-RNA 2'-O-(methoxyethyl)-ribonucleic acid
  • MOE-RNA 2'-O-(methoxyethyl)-ribonucleic acid
  • a corresponding exemplary MOE-RNA nucleotide is illustrated in the following:
  • 2'-O-(Methoxyethyl)-ribonucleic acids preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly bases selected from adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • MOE-RNA nucleotides can be used as xeno-nucleotides XN1 in accordance with the present invention. Further information on 2'-O-(methoxyethyl)-ribonucleic acids can be found, e.g., in Teplova M et al., Nat Struct Biol 6(6) (1999), 535-539.
  • xylonucleic acid or “XNA” as used in the context of the present invention refers to any nucleic acid containing a xylose group, particularly D-xylose, as the sugar moiety in the sugar-phosphate backbone.
  • XNA nucleotide is illustrated in the following:
  • Xylonucleic acids preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly bases selected from adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • XNA nucleotides can be used as xeno-nucleotides XN2 in accordance with the present invention. Further information on xylonucleic acids can be found, e.g., in Maiti M et al., Nucleic Acids Research 43(15) (2015), 7189-7200.
  • deoxyxylonucleic acid or “dXNA” as used in the context of the present invention refers to any nucleic acid containing a deoxyxylose group, particularly D-deoxyxylose, as the sugar moiety in the sugar-phosphate backbone.
  • dXNA nucleotide is illustrated in the following:
  • Deoxyxylonucleic acids preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly bases selected from adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • dXNA nucleotides can be used as xeno-nucleotides XN2 in accordance with the present invention. Further information on deoxyxylonucleic acids can be found, e.g., in: Maiti M et al., Chemistry - A European Journal 18(3) (2012), 869-879; or Maiti M et al., Nucleic Acids Research 43(15) (2015), 7189-7200.
  • pyranosyl-ribonucleic acid refers to any nucleic acid containing a ribopyranose group as the sugar moiety in the sugar-phosphate backbone, and particularly to the ribopyranosyl isomer (in particular the [3-D-ribopyranosyl isomer) of RNA which contains the phosphodiester linkage between the 4’-C and 2’-C positions of neighboring ribopyranosyl units.
  • ribopyranosyl isomer in particular the [3-D-ribopyranosyl isomer
  • a corresponding pRNA nucleotide is illustrated in the following:
  • Pyranosyl-ribonucleic acids preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly bases selected from adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • pRNA nucleotides can be used as xeno-nucleotides XN2 in accordance with the present invention.
  • pyranosyl-deoxyribonucleic acid or “pDNA” as used in the context of the present invention refers to any nucleic acid containing a deoxyribopyranose group as the sugar moiety in the sugar-phosphate backbone, and particularly to the deoxyribopyranosyl isomer (in particular the 3’-deoxy-[3-D-ribopyranosyl isomer) of DNA which contains the phosphodiester linkage between the 4’-C and 2’-C positions of neighboring deoxyribopyranosyl units.
  • a corresponding pDNA nucleotide is illustrated in the following:
  • Pyranosyl-deoxyribonucleic acids preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly bases selected from adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • pDNA nucleotides can be used as xeno-nucleotides XN2 in accordance with the present invention. Further information on pyranosyl-deoxyribonucleic acids can be found, e.g., in Eschenmoser A, Science 284 (1999), 2118-2124.
  • homo-deoxyribonucleic acid or “homo-DNA” as used in the context of the present invention refers to any nucleic acid containing a 2’,3’-dideoxyribopyranose group as the sugar moiety in the sugar-phosphate backbone, and particularly to the 2’,3’-dideoxyribopyranosyl isomer (in particular the 2’,3’-dideoxy-[3-D-ribopyranosyl isomer) of DNA which contains the phosphodiester linkage between the 4’-C and 6’-C positions of neighboring 2’,3’-dideoxyribopyranosyl units.
  • a corresponding exemplary homo-DNA nucleotide is illustrated in the following:
  • Homo-deoxyribonucleic acids preferably contain the same nucleobases as in naturally occurring nucleic acids (RNA or DNA), particularly bases selected from adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • RNA or DNA naturally occurring nucleic acids
  • bases selected from adenine (A), thymine (T) or uracil (II), guanine (G), and cytosine (C).
  • Homo-DNA nucleotides can be used as xeno-nucleotides XN2 in accordance with the present invention.
  • the different components of the system for chemically amplifying a nucleic acid of interest each comprise sequences containing xeno-nucleotides XN1 and/or sequences containing xeno- nucleotides XN2.
  • some components - namely those components that are intended to bind both to the target nucleic acid of interest and to another component of the system - comprise sequences containing XN1 (in order to bind to the nucleic acid of interest) and also sequences containing XN2 (in order to bind to another component of the system for chemical amplification).
  • CE capture extender
  • the one or more pre-amplifier molecules (PA) each comprise a sequence PA3 that contains at least 60% xeno-nucleotides XN1 , and a plurality of sequences PA1 that contain at least 60% xeno-nucleotides XN2.
  • the corresponding sequences can either be directly connected (i.e., a xeno-nucleotide XN1 can be directly connected to a neighboring xeno-nucleotide XN2, or vice versa), or they can be separated by one or more (e.g., 1 to 10) nucleotides (particularly by unmodified nucleotides, preferably by deoxyribonucleotides, i.e. DNA; for example, by a sequence of 2 to 10 deoxythymidine (dT) nucleotides), or they can be separated by a linker group.
  • a linker group e.g. 1 to 10
  • the respective hybridizing sequences can be directly connected to one another, or they can be connected via one or more (e.g., 1 to 10) xeno-nucleotides XN1 and/or one or more (e.g., 1 to 10) xeno-nucleotides XN2 that are not intended to hybridize to other components of the amplification system.
  • a sequence containing XN1 and a sequence containing XN2 which are present in the same molecule are separated by a linker group, which is advantageous as it facilitates the transition between the different helical or ladder-like structures of XN1 and XN2.
  • the linker group is not particularly limited and may, in principle, be any chemical group providing a distance of one or more (e.g., 1 to 30) atoms between the sequence containing XN1 and the sequence containing XN2.
  • the linker group may be a C3-30 alkylene group, wherein one or more non- adjacent -CH2- units may each be replaced by -O-.
  • the linker group may be, e.g., a (poly)ethylene glycol (PEG) group (which may be composed of, e.g., 1 to 10 PEG units).
  • the linker may also be a group consisting of ethylene glycol units (e.g., 1 to 10 ethylene glycol units) which are connected to each other by a phosphodiester bond.
  • a corresponding linker having two ethylene glycol units connected via a phosphodiester bond can be prepared, for example, using the reagent DMTrO-(CH2CH2O)2P(OCH2CH2CN)(NiPr2).
  • the linker group can be coupled to the sequence containing XN1 and to the sequence containing XN2 via any suitable chemical linkage, e.g., via an ether, ester or amide linkage.
  • the linker group is coupled to the sequence containing XN1 and to the sequence containing XN2 via an ester or amide linkage, more preferably via a phosphodiester linkage or a phosphoric amide (i.e., phosphoram idate) linkage, even more preferably via a phosphodiester linkage.
  • the system for chemical amplification of a nucleic acid of interest can, in principle, be used for the amplification of any type of nucleic acid, for example DNA (e.g., a cDNA) or RNA.
  • the system is used for the amplification of RNA, more preferably mRNA or viral RNA (e.g., human immunodeficiency virus (HIV) RNA, hepatitis B virus (HBV) RNA, hepatitis C virus (HCV) RNA, cytomegalovirus (CMV) RNA, influenza virus RNA, or coronavirus (e.g., SARS-CoV-2 I Covid-19) RNA).
  • HIV human immunodeficiency virus
  • HBV hepatitis B virus
  • HCV hepatitis C virus
  • CMV cytomegalovirus
  • influenza virus RNA or coronavirus (e.g., SARS-CoV-2 I Covid-19) RNA).
  • the present invention also relates to a system for detecting one or more nucleic acids of interest, wherein such a system comprises an amplification system according to the present invention as described above and further comprises components which allow for the detection of the amplifier molecules.
  • the components which allow for detection of the amplifier molecules may comprise a label probe (LP) which itself is a single-stranded nucleic acid molecule which comprises a sequence which is complementary to a repeating sequence in the amplifier molecule and thereby allows hybridization of the label probe to the amplifier molecule.
  • LP label probe
  • the label probe can be designed so as to comprise a label or to bind to a label which directly or indirectly provides a detectable signal. All means known to the person skilled in the art could be employed for allowing detection of the label probe, such as fluorescence, enzymes, dyes or electronic detectors.
  • the label probe may be linked, preferably covalently, to an enzyme such as alkaline phosphatase, which, when contacted with a suitable substrate, produces a detectable signal.
  • an enzyme such as alkaline phosphatase
  • alkaline phosphatase such a substrate may be a chemilumigenic substrate, such as dioxetane.
  • the label probe can also be a probe which is then detected by a non- enzymatic nucleic acid assay, for example assays as described in W02008/069884.
  • the sample can be derived from an animal, a human, a plant, a cultured cell, a virus, a bacterium, a pathogen, and/or a microorganism.
  • the sample optionally includes a cell lysate, an intercellular fluid, a bodily fluid (including, but not limited to, blood, serum, saliva, urine, sputum, or spinal fluid), and/or a conditioned culture medium, and is optionally derived from a tissue (e.g., a tissue homogenate), a biopsy, and/or a tumor.
  • the nucleic acid(s) of interest can be derived from one or more of an animal, a human, a plant, a cultured cell, a microorganism, a virus, a bacterium, or a pathogen.
  • the present invention also relates to a method of detecting one or more nucleic acids of interest in a sample, said method comprising:
  • step (c) detecting the amplifier molecules present in the complex which is obtained in the amplification process in step (b).
  • step (b) of such a method are well-known to the person skilled in the art.
  • steps comprise:
  • the present invention also relates to a kit for detecting one or more nucleic acids of interest, wherein the kit comprises: a capture probe (CP); optionally, one or more oligonucleotides which function as capture extender (CE); optionally, one or more oligonucleotides which function as label extender (LE); one or more pre-amplifier molecules (PA) which are nucleic acid molecules comprising sequences complementary either to the nucleic acid of interest or to a label extender, and comprising a plurality of sequences PA1 complementary to at least one amplifier molecule; and one or more amplifier molecules (AM) which are nucleic acid molecules comprising sequences AM1 complementary to sequences PA1 in the preamplifier molecules; wherein the capture probe (CP), the capture extender (CE), the label extender (LE), the pre-amplifier molecules (PA) and the amplifier molecules (AM) are defined as described above in connection with the system according to the present invention.
  • a capture probe CP
  • CE capture extender
  • LE label extend
  • the kit may also include a solid support as described above in connection with the system according to the present invention.
  • the capture probe (CP) may already be immobilized on the solid support.
  • the kit may also comprise blocking probes and/or label probes as described above.
  • the present invention relates to a system for chemically amplifying one or more nucleic acids of interest, as described and defined herein above, except that the nucleotides comprised in each sequence CE1 , CP2, LE1 and PA3 are not particularly limited and may also be, e.g., deoxyribonucleotides (as in DNA); in this aspect, at least 60% of the nucleotides comprised in each sequence CE2, CP1 , LE2, PA1 , PA2 and AM1 are xeno-nucleotides XN2, as described above.
  • the present invention relates to a system for chemically amplifying one or more nucleic acids of interest, as described and defined herein above, except that the nucleotides comprised in each sequence CE2, CP1 , LE2, PA1 , PA2 and AM1 are not particularly limited and may also be, e.g., deoxyribonucleotides (as in DNA); in this aspect, at least 60% of the nucleotides comprised in each sequence CE1 , CP2, LE1 and PA3 are xeno-nucleotides XN1 , as described above.
  • Figure 1 shows a scheme illustrating the operation of an exemplary system for chemical amplification according to the invention.
  • Example 1 Hybridization strength of hexitol nucleic acid (HNA)
  • hybridization strength of an exemplary hexitol nucleic acid (HNA) sequence, 6’ -AG G GAG AG GAGA-4’ (SEQ ID NO:3), when hybridizing to a complementary RNA sequence (3’-UCCCUCUCCUCU-5’) (SEQ ID NO:4) is determined, and is compared to the hybridization strength of a corresponding DNA sequence (5’-AGGGAGAGGAGA-3’) (SEQ ID NO:5) hybridizing to the complementary RNA sequence.
  • the HNA:RNA duplex has a T m of 84.0°C whereas the corresponding DNA:RNA duplex has a T m of only 47.6°C, which indicates that the HNA:RNA duplex has a considerably greater hybridization strength and is thus more stable than the DNA:RNA duplex.
  • the hybridization strength of an HNA having the sequence 6’-CGACGGCG-4’ hybridizing to a complementary RNA sequence (3’-GCUGCCGC-5’) is determined, and is compared to a corresponding DNA:RNA duplex.
  • the HNA: RNA duplex is found to have a T m of 65°C while the corresponding DNA:RNA duplex has a T m of only 46°C, indicating again that the HNA:RNA duplex is much more stable.
  • HNA hexitol nucleic acid
  • Example 2 Hybridization strength of xylonucleic acid (XNA)
  • T m melting temperature
  • an XNA (5’-UGCUACGC-3’) and either a complementary RNA (3’-ACGAUGCG-5’) or a complementary DNA (3’-ACGATGCG-5’) are incubated under the same conditions but are found to have no melting temperature because no hybridization occurs.
  • an XNA having the sequence 5’-GUACCGAUUG-3’ (SEQ ID NO:1 ) binds to the complementary XNA sequence 3’-CAUGGCUAAC-5’ (SEQ ID NO:2) with a T m of 82°C.
  • the T m of the corresponding double-stranded DNA:DNA sequence is only 26°C.
  • the XNA sequence 5’-UGCUACGC-3’ binds to the complementary XNA sequence 3’-ACGAUGCG-5’ with a T m of 71 °C, while the T m of the corresponding doublestranded DNA:DNA sequence is 23°C.
  • the XNA sequence 5’-GUUGCAGA-3’ hybridizes with the complementary XNA sequence 3’-CAACGUCU-5’, and the T m of the resulting XNA:XNA hybrid is 69°C.
  • the T m of the corresponding double-stranded DNA:DNA duplex is merely 16°C.
  • Example 3 Chemical amplification and detection of TNF-a mRNA from Covid19 patients
  • a system according to the present invention is used to chemically amplify and subsequently detect TNF-a mRNA from Covid19 patients.
  • the amplification system used is a bDNA assay, in which hexitol nucleotides (HNA) are used as xeno-nucleic acid XN1 , and xylonucleotides (XNA) are used as xeno-nucleic acid XN2, for the respective probes and extenders.
  • HNA hexitol nucleotides
  • XNA xylonucleotides
  • oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems) using standard phosphoram idite chemistry. HNA and XNA building blocks are used for the synthesis of xeno-nucleotides XN1 and XN2, respectively (Hendrix et al., Chemistry Eur J, 1997, 3, 110; and Maiti et al., Nucleic Acids Res, 2015, 43, 7189).
  • Capture probes 120 pL solution of synthetic oligonucleotides in buffered solution at pH 7 with sodium azide are covalently bound to a microwell plate.
  • the sequence CP1 comprised in the capture probes is composed of XNA and has the following sequence: AAUGCUGACUCA (SEQ ID NO:6).
  • the sequence of the capture probes is dTdTdTdTdTdTdTAAUGCUGACUCA (SEQ ID NO:7), wherein the partial sequence dTdTdTdTdTdTdTdTdTdT is composed of DNA and the partial sequence AAUGCUGACUCA (SEQ ID NO:6) (CP1 ) is composed of XNA.
  • sequences of the capture extenders, label extenders and blocking probes are as follows:
  • CAATTCTCTTTTTGA SEQ ID NO:8 and CGGGCCGATTGATC (SEQ ID NO:9) and CAGATAGATGGGCT (SEQ ID NO: 10) and GTAGGAGACGGCG (SEQ ID NO: 11 ) and
  • CTGCCCCTTCAGCT SEQ ID NO: 12
  • AGATGATCTGACTGC SEQ ID NO:13
  • XN1 all nucleotides are HNA: GCTTGGGTTCCGA (SEQ ID NO: 15) and CAGAAGAGGTTGA (SEQ ID NO: 16) and TCCTCACAGGGCAA (SEQ ID NO: 17) and CAAAGAGACCTGC (SEQ ID NO: 18) and
  • CTCGGCAAAGTCGAG SEQ ID NO: 19
  • CTGAGTCGGTCACC SEQ ID NQ:20
  • TCCAGCTGGAAGACC SEQ ID NO:21
  • GGGCTTGGCCTC SEQ ID NO:22
  • GAGAGGAGGTTGACC SEQ ID NO:23
  • GGCTGATGGTGTG SEQ ID NO:24
  • GAGCACATGGGTGG SEQ ID NO:25
  • AGGTACAGGCCCTCT SEQ ID NO:26
  • GGTTCAGCCACTGG SEQ ID NQ:30
  • TGCTACAACATGGGC SEQ ID NO:31
  • ACTCCAAAGTGCAGC SEQ ID NO:32
  • Blocking probes BP (all nucleotides are DNA):
  • TGGGGCAGGGGAGGC (SEQ ID NO:35) and GTTTGCGAAGGTTGGATGTTC (SEQ ID NO:36) and CCCCTCTGGGGTCTCCCTC (SEQ ID NO:37) and TGGCAGGGGCTCTTGATG (SEQ ID NO:38) and GGGCAGCCTTGGCCCT (SEQ ID NO:39) and TGAAGAGGACCTGGGAGTAGATG (SEQ ID NQ:40) and AGGCTTGTCACTCGGGGTT (SEQ ID N0:41) and GGCCAGAGGGCTGATTAGAGA (SEQ ID NO:42) and GAGGTCCCTGGGGAACTCTT (SEQ ID NO:43) and CCCTCTGGGGGCCGA (SEQ ID NO:44).
  • sequences CE1 and CE2 in the capture extender (CE), as well as the sequences LE1 and LE2 in the label extender (LE), are linked using the reagent DMTrO-(CH2CH2O)2P(OCH2CH 2 CN)(NiPr2).
  • PBMCs peripheral blood mononuclear cells
  • the peripheral blood is supplemented with anticoagulants (EDTA-K2), and PBMCs are harvested by density gradient centrifugation.
  • RNA is extracted from the isolated PBMCs using the RNeasy® Micro Kit from Qiagen in accordance with the manufacturer’s instructions.
  • Samples ( ⁇ 5 x 10 5 cells) are first lysed (addition of lysis buffer and enzymes) and homogenized (vortex). Ethanol is added to the lysate.
  • the lysate is loaded to the RNeasy® MinElute® spin column and RNA (up to 55 pg) binds to the silica membrane. DNase and contaminants are washed away and RNA is eluted in 10-15 pL water.
  • the RNA yield is determined by using a NanoDrop spectrometer. The eluate thus obtained is applied to the chemical amplification system.
  • the pipettors and the benchtop are cleaned with 70 % EtOH before starting the procedure.
  • the eluate containing the target RNA is incubated under hybridizing conditions with capture extenders (CE), label extenders (LE), and blocking probes (BP).
  • This complex is added under hybridization conditions to the microwell plate carrying the capture probe (CP).
  • the RNA concentration is between 0.001 and 200 amol [attomol].
  • the hybridization temperature is greater than the melting temperature T m . Nuclease free water is used.
  • the hybridization plate is sealed and incubated at 60 °C overnight into a VorTempTM shaking incubator.
  • pre-amplifier (XN2), amplifier (XN2) and label probe (XN2) solution are warmed individually at 37 °C for 30 min.
  • Pre-amplifier and amplifier probes are 130 pL solution of synthetic oligonucleotides in buffered solution at pH 7 with sodium azide.
  • Label probe is 140 pL of enzyme-labeled synthetic oligonucleotides in buffered solution at pH 7 with sodium azide.
  • PA1 repeat (which binds to the AM1 , amplifier leader, 25 x): CGGCCCUAGGCA (SEQ ID NO:45) (all nucleotides are XNA; repeats are sequential).
  • amplifier repeat (which binds to the alkaline phosphatase probes, 35 x): CGUACCAAGUGC (SEQ ID NO:46) (all nucleotides are XNA; repeats are sequential).
  • the preamplifier repeating units are connected to each other by a dTdTdTdT linker (which is composed of DNA) using T4 DNA ligase (Kestemont D et al., Chem Commun (Camb), 2018, 54, 6408-6411 ).
  • the amplifier repeating units are likewise connected to each other via a dTdTdTdT linker (composed of DNA) using T4 DNA ligase.
  • the hybridization plate is removed from the VorTempTM incubator and temperature is adjusted to 55 °C. Washing buffer (NaCI, Na Citrate, SDS) is added, subsequently removed, and this procedure is repeated two more times.
  • Pre-amplifier (100 fmol [femtomol]) solution is transferred and incubated for 1 hour at 55 °C while shaking, before repeating the washing procedure.
  • Amplifier (100 fmol) solution is again transferred and incubated for 1 hour at 55 °C with shaking.
  • Between 15 to 30 amplifiers are hybridized to one pre-amplifier.
  • the washing procedure is repeated, then the alkaline-phosphatase- conjugated label probe solution (200 fmol) is transferred and incubated for 1 hour at 55 °C while shaking, followed by cooling and washing three times with 0.1 x SSC buffer. Between 3 and 10 label probes are connected to one amplifier.
  • Substrate dioxetane alkaline phosphatase substrate solution, Lumiphos
  • Substrate dioxetane alkaline phosphatase substrate solution, Lumiphos
  • Noise - mRNA
  • the target TNF-a mRNA is thus detected in peripheral blood from Covid19 patients with high sensitivity and low noise.
  • the same procedure is repeated using a bDNA assay system with the same probes and extenders as described above, but wherein all xeno-nucleic acid sequences XN1 and XN2 are replaced by corresponding DNA sequences.
  • the target TNF-a mRNA is also amplified and detected with this conventional bDNA assay system, but only a very faint signal can be obtained.
  • the chemical amplification system according to the present invention which utilizes two different types of xeno-nucleic acids (XN1 and XN2), thus allows a robust amplification and subsequent detection of nucleic acids of interest with advantageously improved sensitivity and reduced noise.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Système de détection d'acides nucléiques basé sur des systèmes d'ADN ramifié (ADNb) et utilisant des nucléotides avec un résidu de sucre modifié. La sensibilité est améliorée et le bruit de fond réduit. Un premier type de xéno-nucléotides à forte hybridation à l'ADN ou à l'ARN est utilisé dans la partie des sondes qui s'hybrident aux acides nucléiques cibles et un second type de xéno-nucléotides, qui s'hybrident faiblement à l'ADN ou à l'ARN, mais fortement aux nucléotides du même type, est utilisé dans les parties des sondes qui se lient à d'autres sondes. Le premier type de xéno-nucléotides est choisi parmi l'acide nucléique verrouillé (LNA), l'acide nucléique hexitol (HNA), l'acide nucléique altritol (ANA), l'acide nucléique cyclohexène (CeNA), et l'acide 2'-0-(méthoxyéthyl)-ribonucléique (MOE-ARN) et le second type de xéno-nucléotides est choisi parmi l'acide xylonucléique (XNA), l'acide désoxyxylonucléique (dXNA), l'acide pyranosyl-ribonucléique (pARN), l'acide pyranosyl-désoxyribonucléique (pADN) et l'acide homo-désoxyribonucléique (homo-ADN). L'invention concerne l'utilisation de l'acide nucléique hexitol (HNA) comme premier type et de l'acide nucléique xylo (XNA) comme second type.
PCT/EP2021/071736 2020-08-04 2021-08-04 Dosage d'adn ramifié à base de xéno-nucléotides pour la détection d'acides nucléiques WO2022029159A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP20189484.7 2020-08-04
EP20189484 2020-08-04

Publications (1)

Publication Number Publication Date
WO2022029159A1 true WO2022029159A1 (fr) 2022-02-10

Family

ID=71950435

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2021/071736 WO2022029159A1 (fr) 2020-08-04 2021-08-04 Dosage d'adn ramifié à base de xéno-nucléotides pour la détection d'acides nucléiques

Country Status (1)

Country Link
WO (1) WO2022029159A1 (fr)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010026918A1 (en) * 1994-08-30 2001-10-04 Collins Mark L. Reduction of nonspecific hybridization by using novel base-pairing schemes
US6306643B1 (en) 1998-08-24 2001-10-23 Affymetrix, Inc. Methods of using an array of pooled probes in genetic analysis
WO2008069884A2 (fr) 2006-12-01 2008-06-12 Panomics, Inc. Amplification d'acide nucléique en deux étapes utilisant un oligomère d'amplification
US20090130657A1 (en) * 2004-09-10 2009-05-21 Human Genetic Signatures Pty Ltd. Amplification blocker comprising intercalating nucleic acids (ina) containing intercalating pseudonucleotides (ipn)
US20090286691A1 (en) * 2006-01-20 2009-11-19 Genein Co., Ltd. Oligonucleotide for Detection of Bacteria Associated with Sepsis and Microarrays and Method for Detection of the Bacteria Using the Oligonucleotide
US20120052498A1 (en) 2010-07-01 2012-03-01 Affymetrix, Inc. Detection of Nucleic Acids
WO2020213800A1 (fr) * 2019-04-19 2020-10-22 주식회사 제노헬릭스 Technique de détection d'arn court basée sur l'amplification d'un module de capteur xeno amorcée par un arn court

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010026918A1 (en) * 1994-08-30 2001-10-04 Collins Mark L. Reduction of nonspecific hybridization by using novel base-pairing schemes
US6306643B1 (en) 1998-08-24 2001-10-23 Affymetrix, Inc. Methods of using an array of pooled probes in genetic analysis
US6852490B2 (en) 1998-08-24 2005-02-08 Affymetrix, Inc. Methods of using an array of pooled probes in genetic analysis
US20090130657A1 (en) * 2004-09-10 2009-05-21 Human Genetic Signatures Pty Ltd. Amplification blocker comprising intercalating nucleic acids (ina) containing intercalating pseudonucleotides (ipn)
US20090286691A1 (en) * 2006-01-20 2009-11-19 Genein Co., Ltd. Oligonucleotide for Detection of Bacteria Associated with Sepsis and Microarrays and Method for Detection of the Bacteria Using the Oligonucleotide
WO2008069884A2 (fr) 2006-12-01 2008-06-12 Panomics, Inc. Amplification d'acide nucléique en deux étapes utilisant un oligomère d'amplification
US20120052498A1 (en) 2010-07-01 2012-03-01 Affymetrix, Inc. Detection of Nucleic Acids
WO2020213800A1 (fr) * 2019-04-19 2020-10-22 주식회사 제노헬릭스 Technique de détection d'arn court basée sur l'amplification d'un module de capteur xeno amorcée par un arn court

Non-Patent Citations (38)

* Cited by examiner, † Cited by third party
Title
ABRAMOV ET AL., BIOSENSORS AND BIOELECTRONICS, vol. 23, 2008, pages 1728
ALLART B ET AL., CHEM EUR J, vol. 5, no. 8, 1999, pages 2424 - 2431
BELD ET AL., J. CLIN. MICROBIOL., vol. 40, 2002, pages 788 - 793
BENNER ET AL., COLD SPRING HARB PERSPECT BIOL, vol. 8, 2016, pages a023770
BLIN A ET AL., SCI REP, vol. 4, 2014, pages 4194
BUSHNELL ET AL., BIOINFORMATICS, vol. 15, 1999, pages 348 - 355
CALIENDO ET AL., CLINICAL INFECTIOUS DISEASES, vol. 57, no. S3, 2013, pages 139 - 170
CONNOLLY ET AL., NUCL ACIDS RES, vol. 13, 1985, pages 4483
EGLI M ET AL., CHEM SOC REV, vol. 36, 2007, pages 31 - 45
EGLI M ET AL., J AM CHEM SOC, vol. 128, no. 33, 2006, pages 10847 - 10856
ELBEIK ET AL., J. CLIN. MICROB., vol. 42, 2004, pages 3120 - 3127
ESCHENMOSER A, SCIENCE, vol. 284, 1999, pages 2118 - 2124
GHOSH ET AL., NUCL ACIDS RES, vol. 15, 1987, pages 5353
GUO ET AL., NUCL ACIDS RES, vol. 22, 1994, pages 5456
HENDRIX C ET AL., CHEM EUR J, vol. 3, no. 1, 1997, pages 110 - 120
HENDRIX C ET AL., CHEM EUR, vol. 3, no. 9, 1997, pages 1513 - 1520
HENDRIX ET AL., CHEMISTRY EUR J, vol. 3, 1997, pages 110
JOOS ET AL., ANAL BIOCHEM, vol. 247, 1997, pages 96
KESTEMONT D ET AL., CHEM COMMUN (CAMB, vol. 54, 2018, pages 6408 - 6411
LE NOVERE N, BIOINFORMATICS, vol. 17, no. 12, 2001, pages 1226 - 1227
LEE KH ET AL., BIOSENSORS AND BIOELECTRONICS, vol. 26, 2010, pages 1373 - 1379
MAITI ET AL., NUCLEIC ACIDS RES, vol. 43, 2015, pages 7189
MAITI M ET AL., NUCLEIC ACIDS RESEARCH, vol. 43, no. 15, 2015, pages 7189 - 7200
MARKHAM NR ET AL., NUCLEIC ACIDS RES, vol. 33, 2005, pages W577 - W581
MASKOS ET AL., NUCL ACIDS RES, vol. 20, 1992, pages 1679
PITSCH S ET AL., HELV CHIM ACTA, vol. 76, 1993, pages 2161 - 2183
PITSCH S ET AL., HELV CHIM ACTA, vol. 78, 1995, pages 1621 - 1635
PROUDNIKOV ET AL., ANAL BIOCHEM, vol. 259, 1998, pages 34
RASMUSSEN ET AL., ANAL BIOCHEM, vol. 198, 1991, pages 138
RAUZAN B ET AL., BIOCHEMISTRY, vol. 52, no. 5, 2013, pages 765 - 772
REHMAN ET AL., NUCL ACIDS RES, vol. 27, 1999, pages 1970
ROGERS ET AL., ANAL BIOCHEM, vol. 266, 1999, pages 23
SINGH SK ET AL., CHEM COMMUN, vol. 4, 1998, pages 455 - 456
STEINERT HS ET AL., BIOPHYS J, vol. 102, no. 11, 2012, pages 2564 - 2574
TEPLOVA M ET AL., NAT STRUCT BIOL, vol. 6, no. 6, 1999, pages 535 - 539
TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology Hybridization with Nucleic Acid Probes", 1993, ELSEVIER, article "Overview of principles of hybridization and the strategy of nucleic acid probe assays"
TSUBOI M, BULL CHEM SOC JPN, vol. 37, no. 10, 1964, pages 1514 - 1522
WANG J ET AL., J AM CHEM SOC, vol. 122, no. 36, 2000, pages 8595 - 8602

Similar Documents

Publication Publication Date Title
US7927798B2 (en) Detection of nucleic acids from whole blood
EP2099928B1 (fr) Amplification d'acide nucleique en deux etapes utilisant un oligomere d'amplification
US7803541B2 (en) Multiplex branched-chain DNA assays
US7709198B2 (en) Multiplex detection of nucleic acids
EP1991694B1 (fr) Analyse de l'expression d'un gène oligonucléotidique marqué par un élément
US20070009915A1 (en) Microarray analysis of RNA
CA2606723A1 (fr) Capture multiplex d'acides nucleiques
EP1668158B1 (fr) Detection et quantification d'arn
WO2013080307A1 (fr) Jeu d'amorces pour amplifier les virus transmis par les moustiques, kit de dosage pour détecter les virus transmis par les moustiques, et procédé de détection faisant appel audit jeu d'amorces et audit kit de dosage
WO2022029159A1 (fr) Dosage d'adn ramifié à base de xéno-nucléotides pour la détection d'acides nucléiques
JP5676846B2 (ja) ヘリコバクター属の微生物由来の核酸を特異的に増幅するためのプライマーセット、前記微生物を検知および／または分類するための方法
US20100113298A1 (en) Detection of rna with micro-arrays
AU2013203360B2 (en) Multiplexed analyses of test samples

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21758631

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21758631

Country of ref document: EP

Kind code of ref document: A1