WO2022028535A1 - Procédé d'analyse de constituants dans une cellule immobilisée - Google Patents

Procédé d'analyse de constituants dans une cellule immobilisée Download PDF

Info

Publication number
WO2022028535A1
WO2022028535A1 PCT/CN2021/110898 CN2021110898W WO2022028535A1 WO 2022028535 A1 WO2022028535 A1 WO 2022028535A1 CN 2021110898 W CN2021110898 W CN 2021110898W WO 2022028535 A1 WO2022028535 A1 WO 2022028535A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
kit
capture
sequence
Prior art date
Application number
PCT/CN2021/110898
Other languages
English (en)
Chinese (zh)
Inventor
施威扬
Original Assignee
上海绾塍生物科技有限公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 上海绾塍生物科技有限公司 filed Critical 上海绾塍生物科技有限公司
Priority to CN202180060435.3A priority Critical patent/CN116323973A/zh
Publication of WO2022028535A1 publication Critical patent/WO2022028535A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N11/00—Carrier-bound or immobilised enzymes; Carrier-bound or immobilised microbial cells; Preparation thereof
    • C12N11/02—Enzymes or microbial cells immobilised on or in an organic carrier
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing

Definitions

  • the present application relates to the technical field of high-throughput sequencing, in particular to a method for analyzing components of fixed cells and applications thereof.
  • Cells are the basic unit of biological structure and function, and play an important role in studying the laws of motion of living organisms. Different types of cells have very different structures and functions. Single-cell genomes can display the characteristics of different cells, solve the problem of cellular heterogeneity, and have important significance for studying the behavior, mechanism and relationship with the organism of different types of single cells. At present, the application of high-throughput sequencing to single-cell research has become an effective research method.
  • Macosko et al. used Drop-Seq technology to separate individual cells into nanoliter-sized droplets, linking different barcodes to each cell's RNA to label living cells, and sequenced them together to achieve High-throughput transcriptome sequencing (see Macosko, EZ, Basu, A., Satija, R et al. (2015). Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets. Cell, 161(5), 1202– 1214).
  • the present application provides a method of analyzing the components of fixed cells and uses thereof.
  • the method provided in this application has the following characteristics: 1) can analyze fixed cells and their components; 2) can quantitatively analyze the transcriptome information of a single fixed cell with high throughput; 3) can quantitatively analyze high-throughput Proteomic information of fixed cells; 4) Proteomic and transcriptomic information of fixed cells can be obtained simultaneously.
  • the present application provides a method of analyzing the components of fixed cells, the method comprising the steps of: a) encapsulating at most 1 of the fixed cells together with particles comprising polynucleotides in a compartment , the polynucleotide contained in the particle contains at least one recognition sequence and at least one capture sequence, and the capture sequence is capable of directly or indirectly capturing a component or part thereof in the cell; b) in such a way that the De-crosslinking the cellular component or portion thereof in the compartment and incubating the compartment under conditions such that the de-crosslinked cellular component or portion thereof is captured by the capture sequence; c) from The particles are released in the compartment; d) the components of the immobilized cells or components thereof are analyzed by analyzing the polynucleotide sequence on the released particles.
  • the fixed cells are fixed with a fixative selected from one or more of the group consisting of formaldehyde, paraformaldehyde, methanol, ethanol, acetone, glutaraldehyde, Osmic acid and potassium dichromate.
  • a fixative selected from one or more of the group consisting of formaldehyde, paraformaldehyde, methanol, ethanol, acetone, glutaraldehyde, Osmic acid and potassium dichromate.
  • the concentration of the fixative is at least 0.1% v/v.
  • wherein the fixed cells to be analyzed comprise at least 105 cells.
  • At most one of the polynucleotide-containing particles is contained in each compartment.
  • the method prior to step a), further comprises the step of resuspending the cells in a buffer prior to fixation, and the buffer includes a PBS buffer.
  • the fixed temperature is 5-35°C. In certain embodiments, the fixed time is at least 5 minutes.
  • the method further comprises the step of adding a fixation terminator to the cells to terminate fixation, the fixation terminator comprising glycine.
  • the concentration of the fixation terminator is at least 0.1M.
  • the temperature at which the immobilization is terminated is 5-35°C.
  • the time to terminate the fixation is at least 3 minutes.
  • the method further comprises the step of: after the termination of fixation, storing the fixed cells at a temperature of at least 4°C or less.
  • the method further comprises the step of resuspending the fixed cells in a capture buffer, the capture buffer comprising a PBS buffer.
  • the capture buffer further includes BSA and an RNase inhibitor.
  • the concentration of the BSA is at least 0.1% v/v; and/or the concentration of the RNase inhibitor is at least 0.1 v/v.
  • the capture buffer has a pH of 6-9.
  • the cellular component comprises a protein
  • the method further comprises the step of combining the fixed cells with binding specifically to the protein
  • Co-incubation of the reagents allows the binding reagent to bind to the protein.
  • the binding reagents comprise antibodies and fragments or variants thereof that specifically bind to the protein.
  • the species of the binding reagent is at least one.
  • the temperature of the co-incubation is 1°C-10°C. In certain embodiments, the co-incubation time is 0.5 hours to 5 hours.
  • the antibody comprises an antibody tag.
  • the antibody tag comprises a DNA oligonucleotide tag comprising a barcode sequence, the barcode sequence being different from each other for each of the antibodies.
  • the method before the step a), further comprises the step of removing the protein that is not specifically bound to the protein in the fixed cells after the co-incubation is completed. binding reagents.
  • the method prior to step a), further comprises the step of resuspending the capture-incubated cells in the capture buffer after the co-incubation is complete.
  • the particles in step a), comprise microspheres.
  • the compartment is selected from the group consisting of micro-oil droplets, micro-emulsion droplets, and wells in a multi-well plate. In certain embodiments, the compartments are formed by a microfluidic device.
  • the recognition sequence comprises a cell-specific recognition sequence and a molecule-specific recognition sequence, wherein the cell-specific recognition sequence contained on the same particle is the same, and the cell-specific recognition sequence contained on the same particle is different
  • the cell-specific recognition sequences differ from each other.
  • the molecule-specific recognition sequences contained in each polynucleotide molecule contained on the same particle are different from each other.
  • the cellular component comprises a transcriptome
  • the capture sequence is capable of directly capturing the transcriptome.
  • the capture sequence captures the protein by specifically binding to the antibody tag on the antibody.
  • the capture sequence comprises poly T.
  • the number of the polynucleotides contained in each of the particles is at least 10 7 .
  • the compartment contains a cell lysate comprising a protease, a detergent, and a salt therein.
  • the protease comprises proteinase K.
  • the detergent is selected from the group consisting of SDS, Tween, Triton, sarkysol, and NP-40.
  • the salt is selected from the group consisting of sodium chloride, calcium chloride, potassium chloride, deoxycholate, and Tris-HCl.
  • the temperature of the incubation is 50°C-80°C. In certain embodiments, in step b), the incubation time is 0.5 hours to 3 hours.
  • step c) the releasing comprises rupturing the partition.
  • the method further comprises recovering the released particles.
  • the analyzing comprises extending and/or amplifying the polynucleotide on the recovered particle, resulting in an amplified polynucleotide.
  • the method of extension and/or amplification comprises PCR.
  • single-cell transcriptomic nucleic acids derived from the same fixed cell are identified by analyzing the amplified polynucleotides having the same cell-specific recognition sequence. In certain embodiments, by analyzing the single-cell transcriptome nucleic acid, the amplified polynucleotides having the same molecular-specific recognition sequence are identified from the same fixed cell. The number of each transcribed gene in . In certain embodiments, single cell antibody signature set nucleic acids derived from the same fixed cell are identified by analyzing the amplified polynucleotides having the same cell-specific recognition sequence. In certain embodiments, by analyzing said amplified polynucleotides having the same molecular specific recognition sequence in said single cell antibody signature set nucleic acid, it is identified from the same fixed cell the number of each protein in the .
  • the present application also provides a kit for analyzing components of fixed cells, comprising: 1) a particle comprising a polynucleotide comprising at least one recognition sequences and at least one capture sequence capable of directly or indirectly capturing components or portions thereof in the immobilized cells; and 2) an agent that de-crosslinks the cellular components or portions thereof.
  • the particles in the kit comprise microspheres.
  • the recognition sequences in the kit comprise cell-specific recognition sequences and molecule-specific recognition sequences, wherein the cell-specific recognition sequences contained on the same particle are the same and different The cell-specific recognition sequences contained on the particles are different from each other.
  • the molecule-specific recognition sequences contained in each polynucleotide molecule contained on the same particle are different from each other.
  • the capture sequence in the kit comprises poly T.
  • the number of the polynucleotides contained in each of the particles is at least 10 7 .
  • the agent for de-crosslinking the cellular components or portions thereof comprises a cell lysate comprising buffers, proteases, detergents and salts.
  • the buffer includes PBS and/or Tris.
  • the protease comprises proteinase K.
  • the detergent is selected from the group consisting of SDS, Tween, Triton, sarkysol, and NP-40.
  • the salt is selected from the group consisting of sodium chloride, calcium chloride, potassium chloride, deoxycholate, and Tris-HCl.
  • the kit further comprises a fixative for fixing the fixed cells, the fixative being selected from one or more of the group consisting of formaldehyde, paraformaldehyde, methanol, ethanol, Acetone, glutaraldehyde, osmic acid and potassium dichromate.
  • the concentration of the fixative is at least 0.1% v/v.
  • the kit further comprises a fixation buffer, the fixation buffer comprising a PBS buffer.
  • the kit further comprises an immobilization terminator that terminates the immobilization, the immobilization terminator comprising glycine. In certain embodiments, the concentration of the fixation terminator is at least 0.1M. In certain embodiments, the kit further comprises a capture buffer, the capture buffer comprising a PBS buffer. In certain embodiments, the capture buffer further includes BSA and an RNase inhibitor. In certain embodiments, the concentration of the BSA is at least 0.1% v/v; and/or the concentration of the RNase inhibitor is at least 0.1 v/v. In certain embodiments, the capture buffer has a pH of 6-9.
  • the kit further comprises a binding reagent that specifically binds to a protein in the immobilized cells.
  • the binding reagents comprise antibodies and fragments or variants thereof that specifically bind to the protein.
  • the species of the binding reagent is at least one.
  • the antibody comprises an antibody tag.
  • the antibody tag comprises a DNA oligonucleotide tag comprising a barcode sequence, the barcode sequence of each of the antibodies being different from each other.
  • the cellular component comprises a transcriptome
  • the capture sequence is capable of directly capturing the transcriptome; and/or, wherein the capture sequence is specific for the antibody tag on the antibody by The protein is captured by sexual binding.
  • it also includes reagents required for amplifying the polynucleotide.
  • the reagents required to amplify a polynucleotide are selected from the group consisting of primers, Mg2+ , DNA polymerase, and reverse transcriptase.
  • the application provides a system for analyzing components of fixed cells, the system comprising: a) a separation module for separating the fixed cells and particles comprising polynucleotides together into a compartment, wherein the polynucleotide contained in the particle contains at least one recognition sequence and at least one capture sequence capable of directly or indirectly capturing a component or part thereof in the cell; b ) an incubation module for incubating the compartment so that the cellular components or parts thereof in the compartment are de-crosslinked and the de-crosslinked cellular components or parts thereof are the capture sequence capture; c) a cleavage module for releasing the particles from the compartment; d) an analysis module capable of analyzing the released particles by analyzing the polynucleotide sequences on the released particles Components of fixed cells.
  • the system further comprises i) a fixation module for obtaining the fixed cells.
  • the fixed cells are fixed with a fixative selected from one or more of the group consisting of formaldehyde, paraformaldehyde, methanol, ethanol, acetone, glutaraldehyde, Osmic acid and potassium dichromate.
  • the concentration of the fixative is at least 0.1% v/v.
  • the fixed temperature is 5-35°C.
  • the fixed time is at least 5 minutes.
  • the fixation module it can also be used to resuspend the cells in a buffer, and the buffer includes a PBS buffer, prior to fixation of the cells.
  • the fixation module it can also be used to terminate fixation of the cells using a fixation terminator comprising glycine.
  • the concentration of the fixation terminator is at least 0.1 mol.
  • the temperature at which the immobilization is terminated is 5-35°C.
  • the time to terminate the fixation is at least 3 minutes.
  • in the fixation module it can also be used to store the fixed cells below 4°C after the termination of fixation.
  • in the fixation module it can also be used to resuspend the fixed cells in a capture buffer, the capture buffer comprising a PBS buffer.
  • the capture buffer further includes BSA and an RNase inhibitor.
  • the concentration of the BSA is at least 0.1% v/v; and/or the concentration of the RNase inhibitor is at least 0.1 v/v.
  • the capture buffer has a pH of 6-9.
  • the cellular component comprises a protein, which can also be used in the immobilization module to co-incubate the immobilized cells with a binding reagent that specifically binds to the protein, so that the The binding reagent binds to the protein.
  • the binding reagents comprise antibodies and fragments or variants thereof that specifically bind to the protein.
  • the species of the binding reagent is at least one.
  • the temperature of the co-incubation is 1°C-10°C. In certain embodiments, the co-incubation time is 0.5 hours to 5 hours.
  • the antibody comprises an antibody tag.
  • the antibody tag comprises a DNA oligonucleotide tag comprising a barcode sequence, the barcode sequence of each of the antibodies being different from each other.
  • the immobilization module in the immobilization module, it can also be used to remove the binding reagent that is not specifically bound to the protein in the immobilized cells after the co-incubation is complete. In certain embodiments, in the immobilization module, it can also be used to resuspend the capture-incubated cells in the capture buffer after the co-incubation is complete.
  • the fixed cells to be analyzed comprise at least 105 cells.
  • the particles comprise microspheres.
  • the compartment is selected from the group consisting of micro-oil droplets, micro-emulsion droplets, and wells in a multi-well plate. In certain embodiments, the compartments are formed by a microfluidic device.
  • the recognition sequence comprises a cell-specific recognition sequence and a molecule-specific recognition sequence, wherein the cell-specific recognition sequence contained on the same particle is the same, and the cell-specific recognition sequence contained on the same particle is different
  • the cell-specific recognition sequences differ from each other.
  • the molecule-specific recognition sequences contained in each polynucleotide molecule contained on the same particle are different from each other.
  • the cellular component comprises a transcriptome
  • the capture sequence is capable of directly capturing the transcriptome.
  • the capture sequence captures the protein by specifically binding to the antibody tag on the antibody.
  • the capture sequence comprises poly T.
  • the number of the polynucleotides contained in each of the particles is at least 10 7 .
  • the compartment contains a cell lysate comprising a protease, a detergent and a salt therein.
  • the protease comprises proteinase K.
  • the detergent is selected from the group consisting of SDS, Tween and Triton.
  • the salt is selected from the group consisting of sodium chloride, calcium chloride, deoxycholate, and Tris-HCl.
  • the incubation temperature is 50°C-80°C. In certain embodiments, in the incubation module, the incubation time is 0.5 hours to 3 hours. In certain embodiments, in the lysis module, the releasing comprises rupturing the compartment.
  • system further comprises recovering the released particles.
  • the analysis comprises extending and/or amplifying the polynucleotides on the recovered particles, resulting in amplified polynucleotides.
  • the system of extension and/or amplification comprises PCR.
  • single-cell transcriptomic nucleic acids derived from the same fixed cell are identified by analyzing the amplified polynucleotides having the same cell-specific recognition sequence.
  • the amplified polynucleotides having the same molecular-specific recognition sequence are identified from the same fixed cell. The number of each transcribed gene in .
  • single cell antibody signature set nucleic acids derived from the same fixed cell are identified by analyzing the amplified polynucleotides having the same cell specific recognition sequence.
  • Figure 1 shows the comparison of single-cell transcriptome sequencing of fresh cells and formaldehyde-fixed cells of mammalian cell lines. Comparison of key parameters of the single-cell transcriptome of fixed cells and fresh cells.
  • Figure 2 shows the comparison of single-cell gene expression profiles of fresh cells and formaldehyde-fixed cells of mammalian cell lines. Dimensionality reduction analysis of fixed cells and fresh cells.
  • Figure 4 shows the results of the number of single cell transcripts assayed in fresh and fixed human and mouse cell lines. The number of genetic tests was similar.
  • Figure 5 shows the results of transcriptome correlation (R analysis) of human cell line bulk cells, fresh single cells and fixed single cells. Fixed single cells are highly correlated with fresh single cells.
  • Figure 6 shows a schematic diagram of the channels of the microfluidic chip.
  • fixed cells generally refers to cells obtained after fixation by a fixative.
  • Fixatives can coagulate proteins in cells, minimize or terminate the reaction of exogenous enzymes and endogenous enzymes, prevent autolysis of cells, and prevent antigens from diffusing into the interstitial tissue, thereby maintaining the inherent shape and structure of cells.
  • the fixative may be selected from one or more of the following group: formaldehyde, paraformaldehyde, methanol, ethanol, acetone, glutaraldehyde, osmic acid and potassium dichromate.
  • polynucleotide usually refers to a chain compound formed by the polymerization of nucleotides, which can generally be formed by the polymerization of more than 15 nucleotides, for example, more than 15, more than 16, or more than 17 More than 18, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more nucleotides are polymerized.
  • the polynucleotides of the present application may contain at least one recognition sequence and at least one capture sequence.
  • the term "particle” generally refers to a microparticle comprising the polynucleotide capable of directly or indirectly capturing components or parts thereof in the immobilized cells described herein, and may be about 0.1 to 100 ⁇ m in diameter .
  • the polynucleotide contained in the particle may contain at least one recognition sequence and at least one capture sequence capable of directly or indirectly capturing a component or part thereof in the cell.
  • the term "compartment” generally refers to a separate, tiny space that encloses the immobilized cells and the particles to be detected.
  • the partition may encapsulate at most 1 of the immobilized cells and particles comprising polynucleotides.
  • the compartments may be selected from the group consisting of micro-oil droplets, micro-emulsion droplets, and wells in multi-well plates.
  • the separation zone may be formed by a microfluidic device.
  • microfluidic device generally refers to the use of microfluidics (Microfluidics) to integrate basic operating units such as sample preparation, reaction, separation, and detection in biological, chemical, and medical analysis processes onto a micrometer-scale chip. , and complete the whole process of analysis automatically.
  • the microfluidic devices described in this application may include microfluidic chips.
  • the term "recognition sequence” generally refers to sequences carried on the particles that can specifically identify the immobilized cells and/or components or parts thereof in the immobilized cells.
  • the recognition sequences may be cell-specific recognition sequences and molecule-specific recognition sequences and capture sequences.
  • PCR processing sequence refers to a sequence common to all particles, the purpose of which is to facilitate PCR extension and/or amplification of the recognition sequence once the single cell transcriptome nucleic acid has been captured by the particle.
  • the term "cell-specific recognition sequence” generally refers to a nucleic acid sequence carried on the particle that can specifically recognize a certain cell.
  • the cell-specific recognition sequences contained on the same particle are the same, and the cell-specific recognition sequences contained on different particles are different from each other.
  • the cell-specific recognition sequence may comprise a cell barcode.
  • the term “barcode sequence” generally refers to a recognition sequence (eg, a recognition sequence comprising at least 12 bases) carried on a primer that recognizes cells.
  • the barcode sequence can be prepared by DNA oligonucleotide labeling during at least 12 rounds of sorting-pooling, in which the particles are first divided into four equal groups, and then each set of particles is divided into four equal groups. Four different bases of A, T, C and G were added to the medium, and then the four groups of particles were combined and mixed for the next round of labeling. After 12 rounds of sorting-pooling, at least 4 12 (16777216) permutations were obtained.
  • a total of at least 4 13 permutations were obtained; through at least 14 rounds of classification-convergence, at least 4 14 permutations were obtained; through at least 15 rounds of classification-convergence, A total of at least 4 15 permutations were obtained; at least 4 16 permutations were obtained through at least 16 rounds of classification-convergence; at least 4 17 permutations were obtained through at least 17 rounds of classification-convergence; at least 18 A total of at least 4 18 permutations were obtained through at least 19 rounds of classification-convergence; at least 4 20 permutations were obtained through at least 20 rounds of classification-convergence; permutations, etc.
  • the barcode sequence can also be obtained by other methods, for example, it can be obtained by combinatory labeling or several rounds of labeling.
  • each round of amplification can be accomplished with a fixed number of template sequences.
  • the method of marking rounds may be 96 ⁇ 96 ⁇ 96 marking.
  • the term "molecule-specific recognition sequence” generally refers to a nucleic acid sequence that can specifically recognize a molecule.
  • the molecular specific recognition sequence may comprise a unique molecular identifier (UMI).
  • UMI unique molecular identifier
  • the term "specific molecular identifier” refers to a recognition sequence with at least 8 bases on each molecule, and each base can have four choices of A, T, C and G, respectively, It shares at least 48 (65536) specific recognition sequences in permutations and combinations, and the specific recognition sequence is the UMI of the molecule.
  • each molecule has at least 9 bases, and there are at least 4 9 permutations; each molecule has at least 10 bases, and there are at least 4 10 permutations; each molecule has at least 11 permutations There are at least 4 11 permutations and combinations of bases; each molecule has at least 12 bases, and there are at least 4 12 permutations; each molecule has at least 13 bases, and there are at least 4 13 permutations combination; each molecule has at least 14 bases, and there are at least 4 14 permutations; each molecule has at least 15 bases, and there are at least 4 15 permutations.
  • the term "capture sequence” generally refers to a sequence capable of directly or indirectly capturing a component or part thereof in the immobilized cell.
  • the capture sequence can bind to mRNA in the immobilized cells.
  • the capture sequence may bind to a tag on an antibody capable of specifically binding to a protein in the immobilized cell.
  • the capture sequence may be located at the end of the recognition sequence, and may be a poly T sequence of about 30 bp in length.
  • poly T refers to an oligonucleotide having only repeated thymine residues.
  • the capture sequence may appear at the end of any of the sequences described herein and may be used to capture components or parts thereof in cells, such as mRNA or DNA oligonucleotides.
  • the term "component or part thereof in a cell” generally refers to the transcriptome and/or proteome of the fixed cell.
  • de-crosslinking generally refers to chemical crosslinking between proteins and proteins and between proteins and nucleic acids caused by the removal of fixatives.
  • de-crosslinking also includes the release of DNA oligonucleotide tags on antibodies that bind to antigens in cells.
  • capture generally refers to the specific recognition and binding of a component or part thereof in a cell by a recognition sequence on the particle.
  • capture can be performed with a capture buffer.
  • the term "release” generally refers to the detachment of microparticles that have specifically bound to a component or part thereof in the cell (eg, mRNA or DNA oligonucleotides) from the droplet or other form of separation the process of.
  • the releasing includes rupturing the separation zone.
  • fixing agent usually refers to a reagent used to fix cells or other components, which can prevent autolysis and spoilage of tissue cells, prevent the decomposition of proteins and RNA by enzymes in cells, and make Various components in cells such as nucleic acids, proteins, fats, carbohydrates, enzymes are converted into insoluble substances.
  • fixatives may include osmium tetroxide, formaldehyde, methanol, glutaraldehyde, and the like.
  • binding reagent generally refers to a solution comprising antibodies and fragments or variants thereof that specifically bind to the protein.
  • single cell transcriptome nucleic acid is generally the collection of transcripts of a single such fixed cell, including mRNA, rRNA, tRNA, and various other non-coding RNAs.
  • the amplified polynucleotides with the same molecular-specific recognition sequence can be identified from the same fixed cell. the number of each transcribed gene.
  • single cell antibody tag set nucleic acid generally refers to a collection of tags carried on binding reagents (eg, antibodies) that specifically bind to proteins in a single such immobilized cell.
  • binding reagents eg, antibodies
  • the term "single cell antibody tag set nucleic acid” generally refers to a collection of tags carried on binding reagents (eg, antibodies) that specifically bind to proteins in a single such immobilized cell.
  • binding reagents eg, antibodies
  • the term "separation module” generally refers to a module in the system described herein for separating the immobilized cells and the polynucleotide-containing particles together into a compartment, which may include microfluidic control Device-formed micro-oil droplets, micro-emulsion droplets, and wells in a multi-well plate.
  • the separation module may comprise microspheres.
  • the term "incubation module” generally refers to de-crosslinking a cellular component or part thereof obtained from a compartmentalized module by providing specific reaction conditions, and de-crosslinking said cellular component or its part. A module partially captured by the capture sequence.
  • lysis module generally refers to the module used to obtain the particles in the release partition module.
  • analysis module generally refers to a module for analyzing the released polynucleotide sequences on the particles and thus the components or parts of the immobilized cells.
  • fixation module generally refers to the module used to obtain the fixed cells.
  • the term "about” generally refers to a range of 0.5%-10% above or below the specified value, such as 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10%.
  • the term “comprising” or “comprising” means the inclusion of stated elements, integers or steps, but not the exclusion of any other elements, integers or steps.
  • the term “comprising” or “comprising” when used, unless otherwise indicated, it also covers situations consisting of the stated elements, integers or steps.
  • reference to an antibody variable region that "comprises” a particular sequence is also intended to encompass antibody variable regions that consist of that particular sequence.
  • the present application provides a method of analyzing the components of fixed cells, the method may comprise the steps of: a) encapsulating at most one of the fixed cells together with particles comprising polynucleotides in a compartment wherein the polynucleotide contained in the particle contains at least one recognition sequence and at least one capture sequence capable of directly or indirectly capturing a component or part thereof in the cell; b) in such a way that the De-crosslinking the cellular component or portion thereof in the compartment and incubating the compartment under conditions such that the de-crosslinked cellular component or portion thereof is captured by the capture sequence; c) Release the particles from the compartment; d) analyze the components of the immobilized cells or components thereof by analyzing the polynucleotide sequence on the released particles.
  • the fixed cells are fixed with a fixative
  • the fixative can be selected from one or more of the following group: formaldehyde, paraformaldehyde, methanol, ethanol, acetone, pentamethylene Dialdehyde, osmic acid and potassium dichromate.
  • the concentration of the fixative may be at least 0.1% v/v.
  • the concentration of the fixative can be at least 1.5% v/v, can be at least 2% v/v, can be at least 2.5% v/v, can be at least 3% v/v, can be at least 3.5% v /v, may be at least 4% v/v, may be at least 4.5% v/v, etc.
  • the concentration of the fixative may be at least 1% v/v.
  • the fixed cells to be analyzed may be at least 105 cells.
  • the fixed cells can be at least 1.1 ⁇ 10 5
  • the fixed cells can be at least 1.2 ⁇ 10 5
  • the fixed cells can be at least 1.3 ⁇ 10 5
  • the fixed cells can be at least 1.3 ⁇ 10 5
  • the fixed cells may be at least 1.4 x 10 5
  • the fixed cells may be at least 1.5 x 10 5
  • the fixed cells may be at least 1.6 x 10 5
  • the fixed cells may be at least 1.5 x 10 5 1.7 ⁇ 10 5
  • the fixed cells can be at least 1.8 ⁇ 10 5
  • the fixed cells can be at least 1.9 ⁇ 10 5
  • the fixed cells can be at least 2 ⁇ 10 5 one and so on.
  • At most one of the polynucleotide-containing particles may be contained in each compartment.
  • the method may further comprise the step of resuspending the cells in a buffer before fixing them, and the buffer includes a PBS buffer.
  • the fixed temperature may be 5-35°C, for example, the fixed temperature may be 10-30°C, the fixed temperature may be 15-28°C, the fixed temperature It can be 20-25°C, the fixed temperature can be 21-25°C, the fixed temperature can be 22-25°C, the fixed temperature can be 23-25°C, etc.
  • the fixed time may be at least 5 minutes, for example, the fixed time may be at least 10 minutes, the fixed time may be at least 15 minutes, the fixed time may be at least 20 minutes, the fixed time The time may be at least 25 minutes, the fixed time may be at least 30 minutes, and the like.
  • the method may further comprise the step of adding a fixation terminator to the cells to terminate fixation, the fixation terminator comprising glycine.
  • the concentration of the fixation terminator may be at least 0.1M.
  • the concentration of the fixation terminator may be at least 0.11M
  • the concentration of the fixation terminator may be at least 0.12M
  • the concentration of the fixation terminator may be at least 0.12M.
  • the fixation terminator can be at least 0.13M, etc.
  • the temperature for terminating immobilization may be 5-35°C, for example, the temperature for terminating immobilization may be 5-35°C, the temperature for terminating immobilization may be 10-30°C, the The temperature for terminating immobilization may be 15-28°C, the temperature for terminating immobilization may be 20-25°C, the temperature for terminating immobilization may be 21-25°C, and the temperature for terminating immobilization may be 22-25°C, The temperature at which the immobilization is terminated may be 23-25°C or the like.
  • the time to terminate the fixation may be at least 3 minutes, for example, the time of fixation may be at least 4 minutes, the time of fixation may be at least 5 minutes, the time of fixation may be at least 6 minutes, and the time of fixation may be at least 6 minutes.
  • the fixed time may be at least 7 minutes, the fixed time may be at least 8 minutes, the fixed time may be at least 9 minutes, the fixed time may be at least 10 minutes, and the like.
  • the method may further comprise the step of: after the termination of fixation, the fixed cells may be stored at a temperature below 4°C.
  • the fixed cells can be stored below -20°C; alternatively, the fixed cells can be stored below -80°C.
  • the method may further comprise the step of resuspending the fixed cells in a capture buffer, which may include a PBS buffer.
  • the capture buffer may also include BSA and an RNase inhibitor.
  • the concentration of the BSA can be at least 0.1% v/v, (eg, the concentration of the BSA can be at least 0.2% v/v, at least 0.3% v/v, at least 0.4% v/v or at least 0.5% v/v or higher); and/or, the concentration of the RNase inhibitor can be at least 0.1 v/v (eg, the concentration of the RNase inhibitor can be at least 0.2% v/v, at least 0.3% v/v, at least 0.4% v/v or at least 0.5% v/v or higher).
  • the pH of the capture buffer may be 6-9 (eg, the pH of the capture buffer may be 6, may be 6.5, may be 7, may be 7.5, may be 8, may be 8.5 or can
  • the cellular component may comprise a protein
  • the method may further comprise the step of combining the fixed cells with specific binding to the protein Co-incubation of the reagents allows the binding reagent to bind to the protein.
  • the binding reagent may comprise antibodies and fragments or variants thereof that specifically bind to the protein.
  • the type of binding reagent may be at least one.
  • the temperature of the co-incubation may be 1°C-10°C, for example, the temperature of the co-incubation may be 2°C-9°C, the temperature of the co-incubation may be 3°C-8°C, and the The temperature of the co-incubation may be 3°C-7°C, the temperature of the co-incubation may be 3°C-6°C, the temperature of the co-incubation may be 3°C-5°C, and the like.
  • the co-incubation time may be 0.5 hours to 5 hours, for example, the co-incubation time may be 0.5 hours to 4 hours, the co-incubation time may be 0.5 hours to 3 hours, and the co-incubation time may be 0.5 hours to 3 hours. It can be 0.5 hours - 2 hours, etc.
  • the antibody may comprise an antibody tag.
  • the antibody tag may comprise a DNA oligonucleotide tag, and the DNA oligonucleotide may comprise a barcode sequence, the barcode sequence of each of the antibodies being different from each other.
  • the method may further comprise the step of removing the binding reagent not specifically bound to the protein in the immobilized cells after the co-incubation is completed.
  • the method may further comprise the step of resuspending the capture-incubated cells in the capture buffer after the co-incubation is completed.
  • the particles may comprise microspheres.
  • the compartments may be selected from the group consisting of micro-oil droplets, micro-emulsion droplets, and wells in multi-well plates.
  • the separation zone may be formed by a microfluidic device.
  • droplets can be formed by means of T junctions or flow focusing (see Xu, JH, Li, SW, Tan, J., & Luo, GS (2008). Correlations of droplet formation in T-junction microfluidic devices: From squeezing to dripping. Microfluidics and Nanofluidics, 5(6), 711–717).
  • droplets of dispersed phase can be created by shear forces and interfacial tension at the fluid-fluid interface, for example, droplets can be formed by the cross-flow shear method , which can be divided into extrusion regime, dripping regime and transient regime (see Xu, JH, Li, SW, Tan, J., & Luo, GS (2008). Correlations of droplet formation in T-junction microfluidic devices: From squeezing to dripping. Microfluidics and Nanofluidics, 5(6), 711–717).
  • droplets are formed by injecting the continuous phase through two outer channels and a dispersion stage, and then injecting it through a central channel into a narrow orifice (see Xu, JH, Li, SW, Tan). , J., & Luo, GS (2008). Correlations of droplet formation in T-junction microfluidic devices: From squeezing to dripping. Microfluidics and Nanofluidics, 5(6), 711–717).
  • the recognition sequence may comprise a cell-specific recognition sequence and a molecule-specific recognition sequence.
  • the cell-specific recognition sequences contained on the same particle can be the same, and the cell-specific recognition sequences contained on different particles can be different from each other.
  • the molecule-specific recognition sequences contained in each polynucleotide molecule contained on the same particle may be different from each other.
  • the cellular component may comprise a transcriptome, and the capture sequence may directly capture the transcriptome.
  • the capture sequence can capture the protein by specifically binding to the antibody tag on the antibody.
  • the capture sequence may comprise poly T.
  • the number of the polynucleotides contained in each of the particles may be at least 10 7 , for example, may be at least 1.1 ⁇ 10 7 , may be at least 1.2 ⁇ 10 7 , may be at least 1.3 ⁇ 10 7 , can be at least 1.4 ⁇ 10 7 , can be at least 1.5 ⁇ 10 7 , can be at least 2 ⁇ 10 7 , etc.
  • the compartment may contain a cell lysate, which may contain buffers, proteases, detergents, and salts.
  • the cell lysis solution can provide a suitable lysis environment and inhibit the destruction of nucleic acids by nucleases.
  • the detergents can disrupt membrane structure by denaturing proteins, and unravel proteins associated with nucleic acids.
  • the buffer may include PBS and/or Tris.
  • Proteases can digest proteins into smaller fragments, facilitate the separation of nucleic acids and proteins, and facilitate subsequent purification operations to obtain purer nucleic acids.
  • the protease may include proteinase K.
  • the proteinase K is a highly active protease of the subtilisin type, which can be used for the degradation of the protease.
  • the detergent may be selected from the group consisting of SDS, Tween, Triton, sarkysol, and NP-40.
  • the salt may be selected from the group consisting of sodium chloride, calcium chloride, potassium chloride, deoxycholate, and Tris-HCl.
  • the incubation temperature may be 50°C-80°C, for example, the incubation temperature may be 57°C-78°C, the incubation temperature may be 60°C-80°C, and the incubation temperature may be 50°C-80°C.
  • the temperature can be 65°C-75°C
  • the incubation temperature can be 50°C-78°C
  • the incubation temperature can be 55°C-78°C
  • the incubation temperature can be 50°C-75°C
  • the incubation temperature can be 55°C- 75°C
  • the incubation temperature may be 50°C-65°C or the incubation temperature may be 50°C-60°C.
  • the incubation time may be 0.5 hours to 3 hours, for example, the incubation time may be 0.6 hours to 2.9 hours, the incubation time may be 0.7 hours to 2.8 hours, the incubation time may be 1 hour to 2.5 hours, and the incubation time may be 1 hour to 2.5 hours.
  • the time can be 1 hour to 2 hours, etc.
  • the releasing may include breaking the separation zone, and the breaking may include the natural breaking of separation zones such as micro-oil droplets and micro-emulsion droplets under the action of shear stress; it may also include artificial ruptured under the applied external action.
  • partitions can be ruptured by precisely manipulating the rupture of charged droplets using electric fields (see Ruffert, C. (2016). Magnetic bead-magic bullet. Micromachines, 7(2)).
  • the compartments can be ruptured by adding organic solvents (eg, alkanes, perfluoroalcohols) and subjecting them to mechanical shock.
  • the methods described herein may also include recovering the released particles.
  • recovery can be performed using magnetic beads (see Ruffert, C. (2016). Magnetic bead-magic bullet. Micromachines, 7(2)), which can be recovered using biotin or streptomycin affinity systems (see Chodosh, Lewis A., and Stephen Buratowski. "Purification of DNA-Binding Proteins Using Biotin/Streptavidin Affinity Systems.” Current protocols in protein science 12.1(1998):9-7.).
  • the analysis may comprise extending and/or amplifying the polynucleotides on the recovered particles to obtain amplified polynucleotides.
  • the method of extension and/or amplification may comprise PCR.
  • single-cell transcriptomic nucleic acids derived from the same fixed cell can be identified by analyzing the amplified polynucleotides having the same cell-specific recognition sequence.
  • each transcribed gene derived from the same fixed cell can be identified Number of.
  • each compartment includes at most one particle with the same cell-specific recognition sequence on the same particle
  • the amplified DNA containing single-cell transcriptome nucleic acid captured by particles in the same compartment The cell-specific recognition sequences in the increased polynucleotides are identical.
  • the methods described herein can identify single-cell transcriptomic nucleic acids derived from the same fixed cell by analyzing the amplified polynucleotides having the same cell-specific recognition sequence.
  • the molecule-specific recognition sequences (eg, UMIs) in the polynucleotides on each of the particles can be generated by random permutations and combinations that differ, including single-cell transcripts captured by particles in the same compartment
  • the molecule-specific recognition sequences in the amplified polynucleotides of the set of nucleic acids are each different.
  • the number of each transcribed gene corresponding to the molecular-specific recognition sequences can be known. Therefore, by analyzing the amplified polynucleotides having the same molecular-specific recognition sequence in the single-cell transcriptome nucleic acid, the method described in the present application can identify those derived from the same fixed immobilized polynucleotide. The number of each transcribed gene in the cell.
  • single cell antibody signature set nucleic acids derived from the same fixed cell can be identified by analyzing the amplified polynucleotides having the same cell-specific recognition sequence.
  • Each protein derived from the same fixed cell can be identified by analyzing the amplified polynucleotides having the same molecular specific recognition sequence in the single cell antibody tag set nucleic acid Number of.
  • each compartment includes at most one particle, and the cell-specific recognition sequence on the same particle is the same, the protein containing the single-cell antibody tag group nucleic acid captured by the particles in the same compartment
  • the cell-specific recognition sequences in the amplified polynucleotides are identical.
  • the methods described herein can identify single cell antibody signature set nucleic acids derived from the same fixed cell by analyzing the amplified polynucleotides having the same cell-specific recognition sequence.
  • the molecular-specific recognition sequences eg, UMIs
  • the polynucleotides on each of the particles can be generated by random permutation and combinations, including single-cell antibodies captured by particles in the same compartment
  • the molecule-specific recognition sequences in the amplified polynucleotides of tag set nucleic acids are each different. By separately counting the different molecular-specific recognition sequences, the number of each protein corresponding to each antibody tag corresponding to the molecular-specific recognition sequence can be obtained.
  • the method described in the present application can identify the immobilized polynucleotides derived from the same the number of each protein in the cells.
  • the present application provides a kit for analyzing components of fixed cells, which may include: 1) a particle comprising a polynucleotide, the polynucleotide comprising at least one recognition sequence and at least one capture sequence capable of directly or indirectly capturing a component or portion thereof in the immobilized cells; and 2) an agent that de-crosslinks the cellular component or portion thereof.
  • the particles may comprise microspheres.
  • the microspheres can be magnetic microparticles, hydrogel microparticles, agarose microparticles, and the like.
  • the surface of the microspheres can be coated and modified, for example, can be modified with biotin (including fluorescein biotin modification, streptavidin modification or horseradish peroxide modification, etc.); anti-glutathione antibody can be used Coating, which can be coated with aptamers or modified with immobilized targeting DNA, etc. (see Sugaya, Sari et al.
  • Microfluidic Production of Single Micrometer-Sized Hydrogel Beads Utilizing Droplet Dissolution in a Polar Solvent Biomicrofluidics 7.5 (2013): 054120. PMC; Ruffert, C. (2016). Magnetic bead-magic bullet. Micromachines, 7(2); Thompson, JA, & Bau, HH (2010). Microfluidic, bead-based assay: Theory and experiments . Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 878(2), 228–236).
  • the diameter of the microspheres may be less than 50 ⁇ m, the diameter of the microspheres may be less than 25 ⁇ m, the diameter of the microspheres may be less than 10 ⁇ m, the diameter of the microspheres may be less than 5 ⁇ m, the diameter of the microspheres may be less than 2 ⁇ m,
  • the diameter of the microspheres may be less than 1 ⁇ m, the diameter of the microspheres may be less than 500nm, the diameter of the microspheres may be less than 400nm, the diameter of the microspheres may be less than 300nm, the diameter of the microspheres may be less than 200nm , the diameter of the microspheres may be less than 100 nm, the diameter of the microspheres may be less than 50 nm, and the like.
  • the recognition sequences may comprise cell-specific recognition sequences and molecule-specific recognition sequences.
  • the cell-specific recognition sequences contained on the same particle may be the same, and the cell-specific recognition sequences contained on different particles may be different from each other.
  • the molecule-specific recognition sequences contained in each polynucleotide molecule contained on the same particle may be different from each other.
  • the capture sequence may comprise poly T.
  • the number of the polynucleotides contained in each of the particles may be at least 10 7 .
  • the reagent for de-crosslinking the cell component or part thereof may include a cell lysate, which may include a buffer, a protease, a detergent and a salt.
  • the buffer may include PBS and/or Tris.
  • the protease may include proteinase K.
  • the detergent may be selected from the group consisting of SDS, Tween, Triton, sarkysol and NP-40.
  • the salt may be selected from the group consisting of sodium chloride, calcium chloride, deoxycholate, and Tris-HCl.
  • the kit may further comprise a fixative for fixing the fixed cells, the fixative may be selected from one or more of the group consisting of formaldehyde, paraformaldehyde, methanol, Ethanol, acetone, glutaraldehyde, osmic acid and potassium dichromate.
  • a fixative for fixing the fixed cells the fixative may be selected from one or more of the group consisting of formaldehyde, paraformaldehyde, methanol, Ethanol, acetone, glutaraldehyde, osmic acid and potassium dichromate.
  • the concentration of the fixative may be at least 0.1% v/v.
  • the concentration of the fixative may be at least 1% v/v.
  • the kit may further include a fixation buffer, and the fixation buffer may include a PBS buffer.
  • the kit may further comprise an immobilization terminator for terminating the immobilization, and the immobilization terminator may comprise glycine.
  • the concentration of the fixation terminator may be at least 0.1M.
  • the kit may further include a capture buffer, and the capture buffer may include a PBS buffer.
  • the capture buffer may also include BSA and an RNase inhibitor.
  • the concentration of the BSA can be at least 0.1% v/v (eg, the concentration of the BSA can be at least 0.2% v/v, at least 0.3% v/v, at least 0.4% v/v or at least 0.5% v/v or higher); and/or, the concentration of the RNase inhibitor can be at least 0.1 v/v (eg, the concentration of the RNase inhibitor can be at least 0.2% v/v, at least 0.3% v/v, at least 0.4% v/v or at least 0.5% v/v or higher).
  • the pH of the capture buffer may be 6-9 (eg, the pH of the capture buffer may be 6, may be 6.5, may be 7, may be 7.5, may be 8, may be 8.5 or may be 9).
  • the kit may further comprise binding reagents that can specifically bind to proteins in the fixed cells.
  • the binding reagents may comprise antibodies and fragments or variants thereof that specifically bind to the protein.
  • the type of the binding reagent may be at least one.
  • the antibody may comprise an antibody tag.
  • Antibody tags may include tag peptides, which may include fusion proteins or recombinant proteins, such as anti-Flag-tag antibodies, anti-His-tag antibodies, anti-GST-tag antibodies, anti-Myc-tag antibodies, anti-HA-tag antibodies, and the like.
  • Antibody tags may also include oligonucleotides (see CN102732512B).
  • the antibody tag may comprise a DNA oligonucleotide tag, and the DNA oligonucleotide may comprise a barcode sequence, and the barcode sequence of each of the antibodies may be different from each other.
  • the cellular component may comprise a transcriptome, and the capture sequence may directly capture the transcriptome; and/or, wherein the capture sequence may interact with the antibody on the antibody
  • the antibody tag specifically binds to capture the protein.
  • the kits described herein may also include reagents required for amplifying the polynucleotides.
  • the reagents required to amplify polynucleotides may be selected from the group consisting of primers, Mg 2+ , DNA polymerase, and reverse transcriptase.
  • the kits in this application can use DNA polymerases, which can be relatively thermostable, with a half-life of about 40 minutes at 95°C and a rate of 60 bases per second at 70°C Introducing nucleotides, the amplified length can be about 5 kb.
  • the DNA polymerase can be Taq DNA polymerase.
  • the kit in this application can use reverse transcriptase, the reverse transcriptase can withstand 42-50°C, and the length of the synthesized cDNA fragment can reach 13kb, and the kit can contain recombinant RNase inhibitor, which can withstand 55 °C high temperature to prevent RNA degradation, the kit can contain oligo(dT)18 and random hexamer primers, the random hexamer primers can non-specifically bind to the template, and use any RNA in the total RNA as a template to synthesize cDNA. oligo(dT)18 can selectively bind to the 3' poly(A) of RNA, and synthesize cDNA using only mRNA with poly(A) tail as a template.
  • kits in this application can also use sequence-specific primers, and the synthesized first-strand cDNA can be directly used as a template for PCR or fluorescence quantitative PCR, the synthesis of second-strand cDNA or linear RNA amplification, and can also be used for Experiments with first-strand cDNA labelled with radioactive or non-radioactive nucleotides.
  • the Mg in the kits in this application acts as a cofactor for DNA polymerase activity, facilitating the binding of dNTPs during polymerization.
  • the application also provides a system for analyzing components of fixed cells
  • the system may include: a) a compartmentalization module, which may be used to compartmentalize the fixed cells and particles comprising polynucleotides together into compartments region, wherein the polynucleotide that the particle may comprise may contain at least one recognition sequence and at least one capture sequence that may capture, directly or indirectly, a component or part thereof in the cell; b ) an incubation module, which can be used to incubate the compartment, thereby de-crosslinking the cellular components or parts thereof in the compartment and allowing the de-crosslinked cellular components or parts thereof to be The capture sequence captures; c) a lysis module that can be used to release the particles from the compartment; d) an analysis module that can analyze the released particles by analyzing the polynucleotide sequences on the released particles Components of fixed cells.
  • the system may further comprise i) a fixation module for obtaining the fixed cells.
  • the fixed cells are first obtained in a fixation module; the cells are resuspended in buffer prior to fixing the cells; fixation can be utilized Fixatives for cells fix cells; terminate fixation of the cells; after the termination of fixation, store the fixed cells at at least -80°C; resuspend the fixed cells in capture buffer ; co-incubating the immobilized cells with a binding reagent that specifically binds to the protein, so that the binding reagent binds to the protein; after the co-incubation is completed, remove the cells that are not bound to the immobilized cells The binding reagent that specifically binds the protein in the cell; after the co-incubation is complete, the cells incubated with the capture are resuspended in the capture buffer.
  • the fixative may be selected from one or more of the following group: formaldehyde, paraformaldehyde, methanol, ethanol, acetone, glutaraldehyde, osmic acid and potassium dichromate.
  • the concentration of the fixative may be at least 0.1% v/v.
  • the concentration of the fixative is at least 1% v/v (eg the concentration of the fixative may be at least 1.5% v/v, may be at least 2% v/v, may be at least 2.5% v /v, may be at least 3% v/v, may be at least 3.5% v/v, may be at least 4% v/v, may be at least 4.5% v/v, etc.).
  • the fixed temperature may be 5-35°C (eg, the fixed temperature may be 10-30°C, the fixed temperature may be 15-28°C, the fixed temperature may be 20-25°C, the fixed temperature may be 21-25°C, the fixed temperature may be 22-25°C, the fixed temperature may be 23-25°C, etc.).
  • the fixed time may be at least 5 minutes (eg, the fixed time may be at least 10 minutes, the fixed time may be at least 15 minutes, the fixed time may be at least 20 minutes , the fixed time may be at least 25 minutes, the fixed time may be at least 30 minutes, etc.).
  • the buffer may include PBS buffer.
  • the termination of immobilization may utilize an immobilization terminator, and the immobilization terminator may include glycine.
  • the concentration of the fixation terminator may be at least 0.1M (eg, the concentration of the fixation terminator may be at least 0.11M, the concentration of the fixation terminator may be at least 0.12M, the concentration of the fixation terminator may be at least 0.12M, the The concentration of the fixation terminator may be at least 0.125M, the concentration of the fixation terminator may be at least 0.13M, etc.).
  • the temperature for terminating immobilization may be 5-35°C (for example, the temperature for terminating immobilization may be 5-35°C, the temperature for terminating immobilization may be 10-30°C, and the temperature for terminating immobilization may be 10-30° C.
  • the temperature at which the temperature of The temperature at which the fixation is terminated may be 23-25°C, etc.).
  • the fixed time to terminate may be at least 3 minutes (eg, the fixed time may be at least 4 minutes, the fixed time may be at least 5 minutes, the fixed time may be at least 6 minutes) minutes, the fixed time may be at least 7 minutes, the fixed time may be at least 8 minutes, the fixed time may be at least 9 minutes, the fixed time may be at least 10 minutes, etc.).
  • the capture buffer may include PBS buffer. In the systems described herein, the capture buffer may also include BSA and RNase inhibitors.
  • the concentration of the BSA may be at least 0.1% v/v (eg, the concentration of the BSA may be at least 0.2% v/v, at least 0.3% v/v, at least 0.4% v/v) % v/v or at least 0.5% v/v or higher); and/or, the concentration of the RNase inhibitor may be at least 0.1 v/v (eg, the concentration of the RNase inhibitor may be at least 0.2% v/v, at least 0.3% v/v, at least 0.4% v/v or at least 0.5% v/v or higher).
  • the pH of the capture buffer may be 6-9 (eg, the pH of the capture buffer may be 6, may be 6.5, may be 7, may be 7.5, may be 8 , can be 8.5 or can be 9).
  • the cellular components may comprise proteins.
  • the binding reagent may comprise antibodies and fragments or variants thereof that specifically bind to the protein.
  • the type of the binding reagent may be at least one.
  • the temperature of the co-incubation may be 1°C-10°C (for example, the temperature of the co-incubation may be 2°C-9°C, the temperature of the co-incubation may be 3°C-8°C, and the The temperature of the co-incubation may be 3°C-7°C, the temperature of the co-incubation may be 3°C-6°C, the temperature of the co-incubation may be 3°C-5°C, etc.).
  • the co-incubation time may be 0.5 hours-5 hours (for example, the co-incubation time may be 0.5 hours-4 hours, the co-incubation time may be 0.5 hours-3 hours, so the The co-incubation time can be 0.5 hours to 2 hours, etc.).
  • the antibody may comprise an antibody tag.
  • the antibody tag may comprise a DNA oligonucleotide tag, and the DNA oligonucleotide may comprise a barcode sequence, and the barcode sequence of each of the antibodies may be different from each other.
  • the fixed cells to be analyzed comprise at least 10 5 cells (eg, the fixed cells may be at least 1.1 ⁇ 10 5 , the fixed cells may be at least 1.2 ⁇ 10 5 , the fixed cells can be at least 1.3 ⁇ 10 5 , the fixed cells can be at least 1.4 ⁇ 10 5 , the fixed cells can be at least 1.5 ⁇ 10 5 , so The fixed cells can be at least 1.6 ⁇ 10 5 , the fixed cells can be at least 1.7 ⁇ 10 5 , the fixed cells can be at least 1.8 ⁇ 10 5 , the fixed cells Can be at least 1.9 x 105, the fixed cells can be at least 2 x 105 , etc.).
  • 10 5 cells to be fixed can be resuspended in PBS buffer containing 0.1% v/v BSA, 0.1 v/v RNase inhibitor, pH 8, followed by the addition of 1% formaldehyde at Fix at 5-35°C for at least 5 minutes, then add fixation terminator containing 0.1 M glycine to stop fixation at 5-35°C for at least 3 minutes, then store the fixed cells at -80°C.
  • a separation zone is formed by a microfluidic device, and the immobilized cells and the polynucleotide-containing particles are separated into the separation zone together.
  • the particles may comprise microspheres.
  • the compartments may be selected from the group consisting of micro-oil droplets, micro-emulsion droplets, and wells in multi-well plates.
  • the separation zone may be formed by a microfluidic device.
  • the recognition sequence may comprise a cell-specific recognition sequence and a molecule-specific recognition sequence.
  • the cell-specific recognition sequences contained on the same particle may be the same, and the cell-specific recognition sequences contained on different particles may be different from each other.
  • the molecule-specific recognition sequences contained in each polynucleotide molecule contained on the same particle may be different from each other.
  • the cellular component may comprise a transcriptome, and the capture sequence may directly capture the transcriptome.
  • the capture sequence may capture the protein by specifically binding to the antibody tag on the antibody.
  • the capture sequence may comprise poly T.
  • the number of the polynucleotides contained in each of the particles may be at least 10 7 (eg, may be at least 1.1 ⁇ 10 7 , may be at least 1.2 ⁇ 10 7 , may be at least 1.3 ⁇ 10 7 , can be at least 1.4 ⁇ 10 7 , can be at least 1.5 ⁇ 10 7 , can be at least 2 ⁇ 10 7 , etc.).
  • the compartment may contain a cell lysate, which may contain proteases, detergents and salts.
  • the protease may include proteinase K.
  • the detergent may be selected from the group: SDS, Tween and Triton.
  • the salt may be selected from the group consisting of sodium chloride, calcium chloride, deoxycholate and Tris-HCl.
  • a binding reagent containing a DNA oligonucleotide tag creates a compartment in a microfluidic device.
  • the cellular components or portions thereof in the compartment are de-crosslinked and the de-crosslinked cellular components or portions thereof are captured by the capture sequence.
  • the incubation temperature is 50°C-80°C (for example, the incubation temperature may be 57°C-78°C, the incubation temperature may be 60°C-80°C, and the incubation temperature may be 50°C-80°C).
  • the temperature can be 65°C-75°C
  • the incubation temperature can be 50°C-78°C
  • the incubation temperature can be 55°C-78°C
  • the incubation temperature can be 50°C-75°C
  • the incubation temperature can be 55°C- 75°C
  • the incubation temperature may be 50°C-65°C or the incubation temperature may be 50°C-60°C).
  • the incubation time is 0.5 hours to 3 hours (for example, the incubation time may be 0.6 hours to 2.9 hours, the incubation time may be 0.7 hours to 2.8 hours, and the incubation time may be 0.7 hours to 2.8 hours).
  • the time can be from 1 hour to 2.5 hours, the incubation time can be from 1 hour to 2 hours, etc.).
  • the compartments formed from the microfluidic device are incubated at 1-10°C for 0.5-5 hours.
  • the particles are released from the compartment and the released particles are recovered.
  • the releasing may include rupturing the separation zone.
  • shear stress is used to rupture the partitions and then the particles are released and recovered.
  • the polynucleotides on the recovered particles are extended and/or amplified to obtain amplified polynucleotides; the amplified polynucleotides having the same cell-specific recognition sequence are analyzed
  • the increased polynucleotides identify single cell transcriptome nucleic acids derived from the same fixed cell; analyze the single cell transcriptome nucleic acids, the amplified nucleic acid having the same molecular specific recognition sequence Polynucleotides, identifying the number of each transcribed gene derived from the same fixed cell; analyzing the single cell transcriptome nucleic acid, the amplified having the same molecular specific recognition sequence the polynucleotides, identify the number of each transcribed gene derived from the same fixed cell; analyze the amplified polynucleotides with the same cell-specific recognition sequence, identify the Single cell antibody tag group nucleic acid of the same said fixed cell; analyzing said amplified polynucleotide having the same said cell-specific recognition sequence
  • the analysis unit may include reagents and devices for analyzing the results of the nucleic acid sequencing, for example, may include devices and devices required for analysis by BLAST (Basic Local Alignment Search Tool), BioEdit software or MEGA software .
  • the system of extension and/or amplification includes PCR.
  • the polynucleotides on the recovered particles are extended and/or amplified using PCR, and the nucleic acid sequences contained therein are sequenced and data analyzed using BLAST.
  • Antibody tag DNA oligonucleotide primers are 5'amino-modified oligo sequences, 5'-amino-PCR handle-antibody barcode base sequence-dA30 sequence, through commercial antibody-protein coupling kits, such as Thunderlink, etc., The DNA oligonucleotide primers and specific tag antibodies are coupled and purified to obtain DNA-tagged antibodies for subsequent steps.
  • oligo sequence is 5'-amino-C6-CCCTACACGACGCTCTTCCGATCT (as shown in SEQ ID NO: 1)-6bp barcode base sequence-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (as shown in SEQ ID NO: 2).
  • Example 1 The cells prepared in Example 1 were taken out from -80°C and resuspended in a mixed solution of PBS and 0.1% BSA (which may contain 0.1 v/v RNase inhibitor).
  • the antibody-tagged binding reagent prepared in Example 2 was incubated with the cells for 1 hour at 4°C, followed by elution with PBS to remove the antibody for further protein quantification. Then, the cells were resuspended in a mixed solution of PBS and 0.1% BSA (which may contain 0.1 v/v RNase inhibitor).
  • Example 4 Isolation of fixed cells by a microfluidic device
  • the cells obtained from Example 3 were suspended in the addition of 10 mM Tris ⁇ Cl; 50 mM KCl; 1.5 mM MgCl 2 ; 0.45% Tween 20; 0.5% Triton X-100, 1% SDS, 10 ug /ml proteinase K cell lysate was slowly added from the central channel of the microfluidic chip, and the cells, cell lysate and cell labeling microspheres were packaged into droplets.
  • de-crosslinking is performed, and the droplets, etc., including cells and microspheres, are separated and heated to 65 °C for 180 minutes to release the cross-linking of proteins and nucleic acids and release DNA oligonucleotide tags on antibodies that bind to antigens in cells .
  • the compartments are incubated at 25°C for 0.5-3 hours. Subsequently, perfluorooctanol was added to break up the emulsion droplets, releasing the microspheres from the compartment and recovering the particles that specifically bound the mRNA in the cells as well as the antibody-labeled DNA oligonucleotides.
  • Example 5 The microspheres obtained in Example 5 were reverse transcribed to obtain cDNA, and then the cDNA was amplified to obtain a single-cell cDNA library and an antibody tag library, which were constructed as an Illumina NGS sequencing library for sequencing, and then analyzed by bioinformatics methods. Amplified polynucleotides with the same molecular-specific recognition sequence in the cell transcriptome nucleic acid identify the number of each transcribed gene derived from the same one of the fixed cells.
  • Reverse transcription The reaction system was set up in a test tube as follows: microspheres, 1xRT buffer, 1mM dNTP, 1uM primer (AAGCAGTGGTATCAACGCAGAGTACATGGG, as shown in SEQ ID NO: 3), 2.5mM MgCl2 , 1u/ul Reverse Transcriptase, reaction process : 30 minutes at 25 degrees Celsius, 90 minutes at 42 degrees Celsius.
  • microspheres were washed with 10 mM Tris solution and proceeded to the next reaction.
  • reaction system for cDNA amplification, the following reaction system was established in a test tube: microspheres after washing, 1xPCR Taq Buffer, 1mM dNTP, 0.5uM primer CCCTACACGACGCTCTTCCGATCT (as shown in SEQ ID NO: 4), 0.5uM primer AAGCAGTGGTATCAACGCAGAGT (as shown in SEQ ID NO: 5) shown), 2.5 mM MgCl2 , 1 u/ul PCR Taq enzyme.
  • Step 1. 94 degrees Celsius for 3 minutes
  • Step 3. 94 degrees Celsius for 30sec
  • This step 18 loops
  • the PCR product was purified to obtain the final sequencing library for PE150 sequencing.
  • the single-cell transcriptomes of about 150 cells were taken for analysis and comparison, and their gene data reads, molecular-specific recognition sequence numbers (UMI numbers) and mitochondrial gene percentages were recorded. The results are shown in Figure 1.
  • transcriptome genes of the 150 cells obtained in Example 7 were analyzed together for two-dimensional expression analysis (tSNE), and the data were classified according to groups. The results are shown in FIG. 2 .
  • 293 cells were prepared and resuspended in 1xPBS, 10 volumes of pre-frozen 100% methanol at -20°C was added to the cells, mixed and stored at -20°C.
  • Example 13 Correlation analysis between single cell transcriptome of methanol-fixed human cell line and fresh cell gene detection

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé d'analyse des constituants d'une cellule immobilisée. Le procédé comprend les étapes suivantes : encapsulation d'au plus une cellule immobilisée et d'une particule contenant un polynucléotide dans un même compartiment, dans lequel le polynucléotide contenu dans la particule contient au moins une séquence de reconnaissance et au moins une séquence de capture, la séquence de capture étant capable de capturer directement ou indirectement des composants de la cellule ou d'une partie de celle-ci ; incubation du compartiment dans des conditions telles que les composants de la cellule ou d'une partie de celle-ci dans le compartiment sont dissociés et les composants dissociés de la cellule ou de la partie de celle-ci sont capturés au moyen de la séquence de capture ; libération de la particule du compartiment ; et analyse des composants de la cellule immobilisée ou des ingrédients de celle-ci au moyen de l'analyse d'une séquence polynucléotidique sur la particule libérée. L'invention concerne en outre un kit pour analyser les constituants d'une cellule immobilisée et un système pour analyser les composants d'une cellule immobilisée.
PCT/CN2021/110898 2020-08-06 2021-08-05 Procédé d'analyse de constituants dans une cellule immobilisée WO2022028535A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202180060435.3A CN116323973A (zh) 2020-08-06 2021-08-05 一种分析经固定的细胞的组分的方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202010782545 2020-08-06
CN202010782545.8 2020-08-06

Publications (1)

Publication Number Publication Date
WO2022028535A1 true WO2022028535A1 (fr) 2022-02-10

Family

ID=80117035

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2021/110898 WO2022028535A1 (fr) 2020-08-06 2021-08-05 Procédé d'analyse de constituants dans une cellule immobilisée

Country Status (2)

Country Link
CN (1) CN116323973A (fr)
WO (1) WO2022028535A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106574925A (zh) * 2014-05-23 2017-04-19 萤火虫生物股份有限公司 用于生物测定的底物介导的反应器
CN107463801A (zh) * 2017-07-31 2017-12-12 浙江绍兴千寻生物科技有限公司 一种Drop‑seq数据质量控制和分析方法
WO2019005763A1 (fr) * 2017-06-26 2019-01-03 Phase Genomics Inc. Procédé permettant de regrouper des séquences d'adn

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106574925A (zh) * 2014-05-23 2017-04-19 萤火虫生物股份有限公司 用于生物测定的底物介导的反应器
WO2019005763A1 (fr) * 2017-06-26 2019-01-03 Phase Genomics Inc. Procédé permettant de regrouper des séquences d'adn
CN107463801A (zh) * 2017-07-31 2017-12-12 浙江绍兴千寻生物科技有限公司 一种Drop‑seq数据质量控制和分析方法

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ELLIOT R THOMSEN, ET AL.: "Fixed single-cell transcriptomic characterization of human radial glial diversity", NATURE METHODS, vol. 13, no. 1, 16 November 2015 (2015-11-16), New York, pages 87 - 93, XP055454989, ISSN: 1548-7091, DOI: 10.1038/nmeth.3629 *
EVAN Z. MACOSKO, ANINDITA BASU, RAHUL SATIJA, JAMES NEMESH, KARTHIK SHEKHAR, MELISSA GOLDMAN, ITAY TIROSH, ALLISON R. BI: "Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets", CELL, vol. 161, no. 5, 1 May 2015 (2015-05-01), Amsterdam NL , pages 1202 - 1214, XP055586617, ISSN: 0092-8674, DOI: 10.1016/j.cell.2015.05.002 *
JONATHAN ALLES, NIKOS KARAISKOS, SAMANTHA D. PRAKTIKNJO, STEFANIE GROSSWENDT, PHILIPP WAHLE, PIERRE-LOUIS RUFFAULT, SALAH AYOUB, L: "Cell fixation and preservation for droplet-based single-cell transcriptomics", BMC BIOLOGY, vol. 15, no. 1, 1 December 2017 (2017-12-01), XP055521622, DOI: 10.1186/s12915-017-0383-5 *
PHAN, H. V. ET AL.: "Fixed single-cell RNA sequencing for understanding virus infection and host response (Preprint)", BIORXIV, 17 September 2020 (2020-09-17), pages 1 - 34, XP055894845 *
WANG, QUAN ET AL.: "Overview of the Technology of Single Cell Sequencing", CHINESE JOURNAL OF MEDICINAL GUIDE, vol. 22, no. 7, 31 July 2020 (2020-07-31), pages 433 - 439, XP055894854 *

Also Published As

Publication number Publication date
CN116323973A (zh) 2023-06-23

Similar Documents

Publication Publication Date Title
US11932849B2 (en) Whole transcriptome analysis of single cells using random priming
EP3788171B1 (fr) Analyse multi-omique d'échantillons à haut débit
US11161087B2 (en) Methods and compositions for tagging and analyzing samples
EP3837378B1 (fr) Codage à barres par aptamères
US11492660B2 (en) Selective extension in single cell whole transcriptome analysis
US11649497B2 (en) Methods and compositions for quantitation of proteins and RNA
US11661631B2 (en) Oligonucleotides associated with antibodies
EP4345172A2 (fr) Indexation d'échantillon pour cellules individuelles
WO2018172726A1 (fr) Séquençage d'adn de cellule unique
EP4095256A1 (fr) Séquençage de cellule unique à base de microfluidique de gouttelettes et applications
US20240132958A1 (en) Multi-omic analysis in monodisperse droplets
WO2022028535A1 (fr) Procédé d'analyse de constituants dans une cellule immobilisée
CN111801428B (zh) 一种获得单细胞mRNA序列的方法
US20230143290A1 (en) Methods for barcoding macromolecules in individual cells
US11976325B2 (en) Quantitative detection and analysis of molecules
US20220025430A1 (en) Sequence based imaging
WO2022188827A1 (fr) Indexation chimique des échantillons pour l'analyse unicellulaire à haut débit
WO2024097719A1 (fr) Application pour bloqueur d'acide nucléique peptidique (pna)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21853350

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21853350

Country of ref document: EP

Kind code of ref document: A1