WO2022020259A1 - Methods and devices for detecting and sequencing sars-cov-2 - Google Patents

Abstract

The present disclosure provides methods, reagents, microarray, and software products for detecting and sequencing at least part of the SARS-CoV-2 viral RNA. The microarray and methods of the present disclosure can be used to perform simultaneous detection of SARS-CoV-2 virus and other pathogens including respiratory pathogens.

Description

METHODS AND DEVICES FOR DETECTING AND SEQUENCING SARS-COV-2

CROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Patent Application No.

63/053,687, filed July 19, 2020, which application is entirely incorporated herein by reference.

BACKGROUND

[0002] Viral infections are common among animals and humans. For example, coronaviruses are a large family of viruses that are common in people and many different species of animals, including humans, camels, cattle, cats, and bats. Human coronaviruses infect people and generally cause mild to moderate upper respiratory, lower respiratory and gastrointestinal tract illnesses. One example of such coronavirus is the novel coronavirus called “Coronavirus Disease 2019” (COVID-19), also known as SARS-CoV-2, which can infect people and then spread between people. The SARS-CoV-2 virus is a betacoronavirus, similar to “Middle East Respiratory Syndrome Coronavirus” (MERS-CoV or MERS) and “Severe Acute Respiratory Syndrome Coronavirus” SARS-CoV. Other human coronaviruses include 222E (alpha coronavirus), NL63 (alpha coronavirus), OC43 (beta coronavirus), and HKU 1 (beta coronavirus).

[0003] The COVID-19 pandemic has dramatically affected the lives of billions of people. While the pathogen SARS-CoV-2 was sequenced within a short period after its discovery, and many detection methods have been validated and deployed in the field, the world is still facing severe shortage of reliable, high throughput and accurate detection methods that could be deployed in the field. In addition, mutations of the SARS-CoV-2 have been accumulating. Thus, it is plausible that some of the mutations may become clinically significant. Therefore, detection of these mutations could become important.

[0004] High-throughput sequencing has found application in many areas of modern biology from ecology and evolution, to gene discovery and discovery medicine. For example, in order to move forward the field of personalized medicine, the complete genotype and phenotype information of all geo-ethnic groups may need to be garnered. Having such information may permit physicians to tailor the treatment to each patient.

[0005] New sequencing methods, commonly referred to as Next Generation Sequencing (NGS) technologies, have promised to deliver fast, inexpensive and accurate genome information through sequencing. For example, high throughput NGS (HT-NGS) methods may allow scientists to obtain the desired sequence of genes with greater speed and at lower cost. Clinically screening a full genome for an individual’s mutations may offer benefits both for pursuing personalized medicine and for uncovering genomic contributions to diseases. [0006] Certain regions of the genome are highly complex and repetitive. These regions tend to be difficult to sequence using the short read technology such as the reversible terminator sequencing technology available from various vendors including Illumina. Various methods of sequencing library construction can be used to sequence the human genome. However, some of the library construction methods may be biased towards certain sequence features and may not capture certain complex genomic regions.

SUMMARY

[0007] The present disclosure provides methods, reagents, microarray, and software products for detecting and sequencing at least part of the SARS-CoV-2 viral RNA or its variant. The microarray and methods of the present disclosure can be used to perform simultaneous detection of SARS-CoV-2 virus, its variants, and other pathogens including respiratory pathogens.

[0008] An aspect of the present disclosure provides a method for sequencing SARS-CoV-2 viral ribonucleic acid (RNA), comprising: (a) producing a plurality of labeled deoxyribonucleic acid (DNA) fragments by performing in a single reaction tube a reverse transcription polymerase chain reaction (RT-PCR) using (i) the SARS-CoV-2 viral RNA as a template, and (ii) at least one labeled nucleoside 5’ -triphosphate analog, thereby forming the plurality of labeled DNA fragments, wherein each of the plurality of labeled DNA fragments is complementary to or the same as a portion of the sequence of the SARS-CoV-2 viral RNA, and (b) hybridizing the plurality of labeled DNA fragments with a DNA array, wherein the DNA array comprises a plurality of probe sets, wherein a first probe set of the plurality of probe sets comprises probes targeting a single interrogation position on a target sequence; and (c) detecting hybridization signals, thereby calling the base at the single interrogation position.

[0009] In some embodiments of aspects provided herein, the target sequence is a fragment of the SARS-CoV-2 viral RNA. In some embodiments of aspects provided herein, the target sequence is a fragment of the SARS-CoV-2 viral RNA, a fragment of a variant of SARS-CoV-2 viral RNA, or a fragment of another pathogen, or a combination thereof. In some embodiments of aspects provided herein, the other pathogen is a respiratory pathogen. In some embodiments of aspects provided herein, the other pathogen is Adenovirus B/E, Adenovirus C, Chlamydophila, Pneumonia, Influenza A, Influenza A Subtype HI, Influenza A Subtype H3, Influenza A Subtype 2009, Influenza B, Mycoplasma Pneumonia, Respiratory Syncytial Virus A,

Respiratory Syncytial Virus B, Parainfluenza 1, Parainfluenza 2, Parainfluenza 3, Coronavirus 228E, Coronavirus OC43, Coronavirus NL63, Coronavirus HKU1, Rhinovirus/Enterovirus, Human Metapneumovirus, Human Bocavirus, or SARS-COV, or a combination thereof.

[0010] In some embodiments of aspects provided herein, the at least one labeled nucleoside 5’- triphosphate analog is labeled with biotin. In some embodiments of aspects provided herein, the plurality of labeled DNA fragments are labeled with biotin. In some embodiments of aspects provided herein, the at least one labeled nucleoside 5’ -triphosphate analog is biotin-dUTP. In some embodiments of aspects provided herein, the method further comprises, after (a), staining with fluorescence labeled streptavidin. In some embodiments of aspects provided herein, the staining is after (b). In some embodiments of aspects provided herein, the staining is before (b). [0011] In some embodiments of aspects provided herein, the at least one labeled nucleoside 5’- triphosphate analog is labeled with a fluorescence label. In some embodiments of aspects provided herein, the producing in (a) further comprising: fragmenting a plurality of RT-PCR products, thereby forming the plurality of labeled DNA fragments. In some embodiments of aspects provided herein, the fragmenting comprises treating the plurality of RT-PCR products with deoxyribonuclease digestion, ultrasonic fragmentation or thermal fragmentation.

[0012] In some embodiments of aspects provided herein, the method further comprises adding a control DNA before (b). In some embodiments of aspects provided herein, the control DNA is a negative template control, a positive template control, a positive extraction control, a negative extraction control, a human RNase P control, or an alignment marker, or a combination thereof. In some embodiments of aspects provided herein, the control DNA comprises the human RNase P control. In some embodiments of aspects provided herein, the control DNA comprises the alignment marker. In some embodiments of aspects provided herein, the alignment marker is Cy3-AM1. In some embodiments of aspects provided herein, the DNA array further comprises other probes complementary to the control DNA. In some embodiments of aspects provided herein, the control DNA comprises the alignment marker, wherein the DNA array further comprises another probe complementary to the alignment marker, wherein the method further comprising: after (b), determining provides positional information on the microarray based on hybridization signals between the alignment marker and the other probe complementary to the alignment marker.

[0013] In some embodiments of aspects provided herein, the method further comprises: before (a), obtaining the SARS-CoV-2 viral RNA from a biological sample. In some embodiments of aspects provided herein, the biological sample is saliva oropharyngeal swab, nasopharyngeal swab, environmental samples, whole blood, blood plasma, or frozen food. In some embodiments of aspects provided herein, the obtaining is not extracting the SARS-CoV-2 viral RNA from the biological sample.

[0014] In some embodiments of aspects provided herein, the hybridizing in (b) is for a duration of about 30 min. In some embodiments of aspects provided herein, the hybridizing in (b) is for a duration no longer than 120 min. In some embodiments of aspects provided herein, the hybridization in (b) is from 30 to 120 min. In some embodiments of aspects provided herein, the each probe of the plurality of probe sets is 18-35, 20-28, or about 25 bp in length. In some embodiments of aspects provided herein, the first probe set comprises a sense probe and an antisense probe for the target sequence. In some embodiments of aspects provided herein, the first probe set consists of four sense probes and four antisense probes for the target sequence. In some embodiments of aspects provided herein, the single interrogation position is between the 3’ -end and the 5’ -end of the target sequence. In some embodiments of aspects provided herein, the single interrogation position is not mor than 3, 2 or 1 bp from the midpoint the sequence of the target sequence. In some embodiments of aspects provided herein, the presence or absence of the SARS-CoV-2 viral RNA in clinical samples is determined with more than 94%, 95%, 96%, 97%, 98%, or 99% accuracy at 95% confidence intervals. In some embodiments of aspects provided herein, the clinical samples are more than 60. In some embodiments of aspects provided herein, the method can sequence at least 95% of the SARS-CoV-2 viral RNA with an average accuracy greater than 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%.

[0015] Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in this art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be realized, the present disclosure is capable of other and different embodiments, and its several details are capable of modifications in various obvious respects, all without departing from the disclosure.

Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive.

INCORPORATION BY REFERENCE

[0016] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS [0017] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

[0018] FIG. 1 illustrates an example flowchart of array sequencing-based pathogen detection. [0019] FIG. 2 shows another example flowchart of array sequencing-based pathogen detection. [0020] FIG. 3 depicts example VIRUSHUNTER QUARDCORE chip design. [0021] FIG. 4A illustrates the SARS-CoV-2 reference sequence gene locations on VIRUSHUNTER QUARDCORE Core 0. FIG. 4B illustrates the SARS-CoV-2 control locations on VIRUSHUNTER QUARDCORE Core 0.

[0022] FIG. 5A shows the strand locations on VIRUSHUNTER QUARDCORE Core 1. FIG. 5B shows the SARS-CoV-2 control locations on VIRUSHUNTER QUARDCORE Core 1. [0023] FIG. 6A shows the strand locations on VIRUSHUNTER QUARDCORE Core 2. FIG. 6B shows the SARS-CoV-2 control locations on VIRUSHUNTER QUARDCORE Core 2. [0024] FIG. 7A shows the other respiratory viruses rhinoviruses locations on VIRUSHUNTER QUARDCORE Core 2. FIG. 7B shows Other Respiratory viruses: Flu locations on VIRUSHUNTER QUARDCORE Core 2. FIG. 7C shows the coronavirus probes locations on VIRUSHUNTER QUARDCORE Core 2.

[0025] FIG. 8A shows the strand locations on VIRUSHUNTER QUARDCORE Core 3. FIG. 8B shows the SARS-CoV-2 control locations on VIRUSHUNTER QUARDCORE Core 3. [0026] FIG. 9A shows the other coronavirus probes locations on VIRUSHUNTER QUARDCORE Core 3. FIG. 9B shows Other Respiratory viruses: Rhinoviruses locations on VIRUSHUNTER QUARDCORE Core 3. FIG. 9C shows other respiratory viruses: Flu locations on VIRUSHUNTER QUARDCORE Core 3.

[0027] FIG. 10 depicts an example flowchart for the disclosed array sequencing-based pathogen detection methods up to the scanning step.

[0028] FIG. 11 illustrates an example flowchart for the pathogen detection step of the disclosed array sequencing-based pathogen detection methods after scanning.

[0029] FIG. 12 shows an illustration of the detection principle of the disclosed methods.

[0030] FIG. 13A depicts an example image of signals detected in the region designed for the four fragments for each base of the SARS-CoV-2 spike gene region. FIG. 13B depicts a consecutive 78 bases read which matches the reference genome.

[0031] FIG. 14 illustrates example KENI detection of SARS-COV-2 PCR fragment.

[0032] FIG. 15 shows example sub-image from VIRUSHUNTER QUADCORE’s Core 0, showing hybridization of a SARS-COV-2 whole genome sample.

[0033] FIG. 16 depicts the assay results of an example Limit of Detection (LOD) determination.

DETAILED DESCRIPTION

[0034] The second generation sequencing (NGS) approaches, involving sequencing by synthesis (SBS) have experienced a rapid development as data produced by these new technologies mushroomed exponentially. The SBS approach may have shown promise as a new sequencing platform. Despite remarkable progress in last two decades, there remains much room for the development for a clinically relevant NGS approach to perform high-throughput, accurate, and clinically relevant analysis of patient samples.

[0035] The terminology used herein is for the purpose of describing particular cases only and is not intended to be limiting. As used herein, the singular forms “a”, “an” and “the” can be intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof can be used in either the detailed description and/or the claims, such terms can be intended to be inclusive in a manner similar to the term “comprising”.

[0036] The term “about” or “approximately” can mean within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which may depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, the term “about” as used herein indicates the value of a given quantity varies by +/— 10% of the value, or optionally +/ 5% of the value, or in some embodiments, by +/-1% of the value so described. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, within 5-fold, or within 2-fold, of a value. Where particular values may be described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value should be assumed. Also, where ranges and/or subranges of values are provided, the ranges and/or subranges can include the endpoints of the ranges and/or subranges.

[0037] The term “substantially” as used herein can refer to a value approaching 100% of a given value. For example, an active agent that is “substantially localized” in an organ can indicate that about 90% by weight of an active agent, salt, or metabolite can be present in an organ relative to a total amount of an active agent, salt, or metabolite. In some cases, the term can refer to an amount that can be at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of a total amount. In some cases, the term can refer to an amount that can be about 100% of a total amount.

[0038] The term “array” as used herein, when describing a device, a system, sensors, sample chambers, etc., refers to a one-dimensional or two-dimensional set of microstructures. An array may be any shape. For example, an array may be a series of microstructures arranged in a line, such as the array of squares. An array may be arranged in a square or rectangular grid. There may be sections of the array that are separated from other sections of the array by spaces. An array may have other shapes. For example, an array may be a series of microstructures arranged in a series of concentric circles, in a series of concentric squares, a series of concentric triangles, a series of curves, etc. The spacing between sections of an array or between microstructures in any array may be regular or may be different between particular sections or between particular pairs of microstructures. The microstructure arrays of the present invention may be comprised of microstructures having zero-dimensional, one-dimensional or two-dimensional shapes. The microstructures having two-dimensional shapes may have shapes such as squares, rectangles, circles, parallelograms, pentagons, hexagons, irregular shapes, etc.

[0039] The term “fragment” as used herein generally refers to a fraction of the original DNA sequence or RNA sequence of the particular region.

[0040] As used herein, nucleotides are abbreviated with 3 letters. The first letter indicates the identity of the nitrogenous base (e.g. A for adenine, G for guanine), the second letter indicates the number of phosphates (mono, di, tri), and the third letter is P, standing for phosphate. Nucleoside triphosphates that contain ribose as the sugar, ribonucleoside triphosphates, are conventionally abbreviated as NTPs, while nucleoside triphosphates containing deoxyribose as the sugar, deoxyribonucleoside triphosphates, are abbreviated as dNTPs. For example, dATP stands for deoxyribose adenine triphosphate. NTPs are the building blocks of RNA, and dNTPs are the building blocks of DNA.

[0041] The term “target nucleic acid” or “target sequence” as used herein generally refers to the nucleic acid fragment targeted for detection using hybridization assays of the present disclosure. Sources of target nucleic acids may be isolated from organisms, including mammals, or pathogens to be identified, including viruses and bacteria. Additionally target nucleic acids may also be from synthetic sources. Target nucleic acids may be or may not be amplified via standard replication/amplification procedures to produce nucleic acid sequences.

[0042] The term “nucleic acid sequence” or “nucleotide sequence” or “sequence” as used herein generally refers to nucleic acid molecules with a given sequence of nucleotides, of which it may be desired to know the presence or amount. The nucleotide sequence can comprise ribonucleic acid (RNA) or DNA, or a sequence derived from RNA or DNA. Examples of nucleotide sequences are sequences corresponding to natural or synthetic RNA or DNA including genomic DNA and messenger RNA. The length of the sequence can be any length that can be amplified into nucleic acid amplification products, or amplicons, for example up to about 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 1,000, 1,200, 1,500, 2,000, 5,000, 10,000 or more than 10,000 nucleotides in length.

[0043] The term “template” as used herein generally refers to individual polynucleotide molecules from which another nucleic acid, including a complementary nucleic acid strand, may be synthesized by a nucleic acid polymerase. In addition, the template may be one or both strands of the polynucleotides that are capable of acting as templates for template-dependent nucleic acid polymerization catalyzed by the nucleic acid polymerase. Use of this term may not be taken as limiting the scope of the present disclosure to polynucleotides which are actually used as templates in a subsequent enzyme-catalyzed polymerization reaction.

[0044] The term “PCR” or “Polymerase chain reaction” as used herein generally refers to the enzymatic replication of nucleic acids, which uses thermal cycling for example to denature, extend and anneal the nucleic acids.

[0045] The term “RT-PCR” as used herein generally refers to reverse transcribing the target RNA molecule in a sample that contains a mixture of RNA and DNA molecules to produce a mixture that contains the cDNA molecule of the target RNA, and then simultaneously PCR amplifying particular target sequences from the cDNA molecule in a single reaction mixture. In RT-PCR, the RNA template is converted to a cDNA molecule due to the reverse transcriptase activity of an enzyme, and then amplified using the polymerizing activity of the same or a different enzyme. Stable, thermostable or thermolabile reverse transcriptase and polymerase can be used.

[0046] The terms “single tube”, “single reaction tube”, or “single reaction vessel” as used herein generally refers to performing two or more reactions in the same reaction container or reaction vessel or reaction tube without changing the reaction container or reaction vessel or rection tube. [0047] The terms a “forward primer” and a “reverse primer as used herein generally refer to a pair of primers that can bind to a template nucleic acid, and under proper amplification conditions produce an amplification product. If the forward primer is binding to the sense strand, then the reverse primer is binding to antisense strand. Alternatively, if the forward primer is binding to the antisense strand then the reverse primer is binding to sense strand. The forward or reverse primer can bind to either strand as long as the other reverse or forward primer binds to the opposite strand.

[0048] A “forward primer” and a “reverse primer” constitute a pair of primers that can bind to a template nucleic acid and under proper amplification conditions produce an amplification product. If the forward primer is binding to the sense strand, then the reverse primer is binding to antisense strand. Alternatively, if the forward primer is binding to the antisense strand then the reverse primer is binding to sense strand. In essence, the forward or reverse primer can bind to either strand as long as the other reverse or forward primer binds to the opposite strand [0049] The term “label” or “detectable label” as used herein generally refers to any moiety or property that is detectable, or allows the detection of an entity which is associated with the label. For example, a nucleotide, oligo- or polynucleotide that comprises a fluorescent label may be detectable. In some cases, a labeled oligo- or polynucleotide permits the detection of a hybridization complex, for example, after a labeled nucleotide has been incorporated by enzymatic means into the hybridization complex of a primer and a template nucleic acid. A label may be attached covalently or non-covalently to a nucleotide, oligo- or polynucleotide. In some cases, a label can, alternatively or in combination: (i) provide a detectable signal; (ii) interact with a second label to modify the detectable signal provided by the second label, e.g., FRET;

(iii) stabilize hybridization, e.g., duplex formation; (iv) confer a capture function, e.g., hydrophobic affinity, antibody/antigen, ionic complexation, or (v) change a physical property, such as electrophoretic mobility, hydrophobicity, hydrophilicity, solubility, or chromatographic behavior. Labels may vary widely in their structures and their mechanisms of action. Examples of labels may include, but are not limited to, fluorescent labels, non-fluorescent labels, colorimetric labels, chemiluminescent labels, bioluminescent labels, radioactive labels, mass- modifying groups, antibodies, antigens, biotin, haptens, enzymes (including, e.g., peroxidase, phosphatase, etc.), and the like. Fluorescent labels may include dyes of the fluorescein family, dyes of the rhodamine family, dyes of the cyanine family, or a coumarine, an oxazine, a boradiazaindacene or any derivative thereof. Dyes of the fluorescein family include, e.g., FAM, HEX, TET, JOE, NAN and ZOE. Dyes of the rhodamine family include, e.g., Texas Red, ROX, R110, R6G, and TAMRA. FAM, HEX, TET, JOE, NAN, ZOE, ROX, R110, R6G, and TAMRA are commercially available from, e.g., Perkin-Elmer, Inc. (Wellesley, Mass., USA), Texas Red is commercially available from, e.g., Thermo Fisher Scientific, Inc. (Grand Island, N.Y., USA). Dyes of the cyanine family include, e.g., CY2, CY3, CY5, CY5.5 and CY7, and are commercially available from, e.g., GE Healthcare Life Sciences (Piscataway, N.J., USA).

[0050] The term “DNA polymerase” as used herein generally refers to a cellular or viral enzyme that synthesizes DNA molecules from their nucleotide building blocks.

[0051] As used herein, the solid substrate used can be biological, non-biological, organic, inorganic, or a combination of any of these. The substrate can exist as one or more particles, strands, precipitates, gels, sheets, tubing, spheres, containers, capillaries, pads, slices, films, plates, slides, or semiconductor integrated chips, for example. The solid substrate can be flat or can take on alternative surface configurations. For example, the solid substrate can contain raised or depressed regions on which synthesis or deposition takes place. In some examples, the solid substrate can be chosen to provide appropriate light-absorbing characteristics. For example, the substrate can be a polymerized Langmuir Blodgett film, functionalized glass (e.g., controlled pore glass), silica, titanium oxide, aluminum oxide, indium tin oxide (ITO), Si, Ge, GaAs, GaP, SiO₂, SiN₄, modified silicon, the top dielectric layer of a semiconductor integrated circuit (IC) chip, or any one of a variety of gels or polymers such as (poly)tetrafluoroethylene, (poly)vinylidenedifluoride, polystyrene, polycarbonate, polydimethylsiloxane (PDMS), polymethylmethacrylate (PMMA), polycyclicolefms, or combinations thereof. [0052] Solid substrates can comprise polymer coatings or gels, such as a polyacrylamide gel or a PDMS gel. Gels and coatings can additionally comprise components to modify their physicochemical properties, for example, hydrophobicity. For example, a polyacrylamide gel or coating can comprise modified acrylamide monomers in its polymer structure such as ethoxylated acrylamide monomers, phosphorylcholine acrylamide monomers, betaine acrylamide monomers, and combinations thereof.

[0053] The term “complementary” as used herein generally refers to a polynucleotide that forms a stable duplex with its “complement,” e.g., under relevant assay conditions. Typically, two polynucleotide sequences that are complementary to each other have mismatches at less than about 20% of the bases, at less than about 10% of the bases, preferably at less than about 5% of the bases, and more preferably have no mismatches.

[0054] A “polynucleotide sequence” or “nucleotide sequence” as used herein generally refers to a polymer of nucleotides (an oligonucleotide, a DNA, a nucleic acid, etc.) or a character string representing a nucleotide polymer, depending on context. From any specified polynucleotide sequence, either the given nucleic acid or the complementary polynucleotide sequence (e.g., the complementary nucleic acid) can be determined.

[0055] Two polynucleotides “hybridize” when they associate to form a stable duplex, e.g., under relevant assay conditions. Nucleic acids hybridize due to a variety of well characterized physico chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, part I chapter 2, “Overview of principles of hybridization and the strategy of nucleic acid probe assays” (Elsevier, New York), as well as in Ausubel, infra.

[0056] The term “polynucleotide” (and the equivalent term “nucleic acid”) encompasses any physical string of monomer units that can be corresponded to a string of nucleotides, including a polymer of nucleotides, e.g., a typical DNA or RNA polymer, peptide nucleic acids (PNAs), modified oligonucleotides, e.g., oligonucleotides comprising nucleotides that are not typical to biological RNA or DNA, such as 2'-0-methylated oligonucleotides, and the like. The nucleotides of the polynucleotide can be deoxyribonucleotides, ribonucleotides or nucleotide analogs, can be natural or non-natural, and can be unsubstituted, unmodified, substituted or modified. The nucleotides can be linked by phosphodiester bonds, or by phosphorothioate linkages, methylphosphonate linkages, boranophosphate linkages, or the like. The polynucleotide can additionally comprise non-nucleotide elements such as labels, quenchers, blocking groups, or the like. The polynucleotide can be, e.g., single-stranded or double-stranded. [0057] The term “oligonucleotide” as used herein generally refers to a nucleotide chain. In some cases, an oligonucleotide is less than 200 residues long, e.g., between 15 and 100 nucleotides long. The oligonucleotide can comprise at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25,

30, 35, 40, 45, or 50 bases. The oligonucleotides can be from about 3 to about 5 bases, from about 1 to about 50 bases, from about 8 to about 12 bases, from about 15 to about 25 bases, from about 25 to about 35 bases, from about 35 to about 45 bases, or from about 45 to about 55 bases. The oligonucleotide (also referred to as “oligo”) can be any type of oligonucleotide (e.g., a primer). Oligonucleotides can comprise natural nucleotides, non-natural nucleotides, or combinations thereof.

[0058] The term “accuracy” as used herein regarding sequencing is the number of correctly called positions divided by the number of base calls.

Targets for Assays

[0059] Genetic materials useful as targets for the present disclosure may include, but are not limited to, DNA and RNA. There may be many different types of RNA and DNA, all of which have been and continue to be the subject of great study and experimentation. Targets of DNA may include, but are not limited to, genomic DNA (gDNA), chromosomal DNA, mitochondrial DNA (mtDNA), plasmid DNA, ancient DNA (aDNA), all forms of DNA including A-DNA, B- DNA, and Z-DNA, branched DNA, and non-coding DNA. Forms of RNA that may be sequenced using the present methods and compositions include, but are not limited to, messenger RNA (mRNA), ribosomal RNA (rRNA), microRNA, small RNA, snRNA and non- coding RNA. {See, Limbach et al, “Summary: The modified nucleosides of RNA,” Nuc. Acids Res., 22(12):2183-2196, 1994).

[0060] Nucleotides may include, but are not limited to, the naturally occurring nucleotides G, C, A, T and U, as well as rare forms, such as, Inosine, Xanthosine, 7-methylguanosine, dihydrouridine, 5-methylcytosine, and pseudouridine, including methylated forms of G, A, T, and C, and the like. {See, for instance, Korlach et al., “Going beyond five bases in DNA sequencing,” Curr. Op. Struct. Biol., 22(3):251-261, 2012; and US Pat. No. 5,646,269). Nucleosides may also be non-naturally occurring molecules, such as those comprising 7- deazapurine, pyrazolo[3,4-d]pyrimidine, propynyl-dN, or other analogs or derivatives. Example nucleosides include ribonucleosides, deoxyribonucleosides, dideoxyribonucleosides, carbocyclic nucleosides, and the like.

[0061] Array based resequencing of multiple pathogens had been successfully demonstrated and used for public health monitoring and disease control in the past. However, more rapid and improved methods are needed to address the current pandemic. [0062] Array based sequencing of pathogens have been reported in, e.g. Arch Virol. 2017; 162(12): 3769-3778, J Clin Virol. 2013;56(3):238-243, Front Microbiol. 2015;6:532, J Clin Virol. 2010;47(3):282-285, Microb Biotechnol. 2008;l(l):79-86, J Clin Microbiol. 2007;45(2):443-452, BMC Genom. 2008;9:577, J Clin Microbiol. 2009;47(4):988-993, Nucleic Acids Res. 2008;36(10):3194-3201, Genome Res. 2006;16(4):527-535, each of which is entirely incorporated herein by reference. However, adaption of array based sequencing in clinical settings has been limited because of, among other things, the assay limitations. As illustrated by the examples below, assay protocol and array design have been designed and dramatically improved workflow. In some embodiments, single tube amplification can be used to label the PCR product, and the PCR products can be used directly in array -based hybridization. The assay protocol, array design and data analysis pipeline has been used to detect SARS-CoV-2 in clinical samples and to sequence the whole genome of the SARS-CoV-2 virus as shown in examples below.

[0063] FIG. 1 shows one embodiment of the array sequencing-based pathogen detection method. A biological sample, such as, for example, saliva oropharyngeal, nasopharyngeal swabs, environmental samples, whole blood sample, or blood plasma samples, can be obtained in Step 101. A single tube amplification and labeling of nucleic acids of pathogen RNAs can be done in Step 102. An array -based hybridization assay of the amplification products can detect target nucleic acid sequences in Step 103. Then a determination of whether there is a sequence match of pathogen RNA and the known RNA sequence can be performed in Step 104. The methods of this disclosure is not limited to any particular type of samples. For example, in some embodiments, the method of the disclosure could be used to monitor the presence or absence of pathogen nucleic acids in frozen food.

[0064] FIG. 2 shows another embodiment of the array sequencing-based pathogen detection methods comprising: Step 201: extracting RNAs from the samples; Step 202: performing RT- PCR on the extracted RNAs; Step 203 : hybridizing PCR products with Quad-Core Arrays; Step 204: staining and imaging the array plate; Step 205: making base detection calls; and Step 206: reviewing the control signal results and the sample signal results.

[0065] A. Sample Process

[0066] In order to detect pathogens in clinical samples, pathogen nucleic acids may be amplified. Pathogen nucleic acids may be amplified by a variety of Polymerase Chain Reaction (PCR) methods as well as isothermal amplification methods. For pathogen with ribonucleic acid (RNA) genome, pathogen RNAs may be reverse transcribed to complementary deoxyribonucleic acids (DNAs) in order to facility subsequent processing including amplification and labeling. [0067] In some embodiments, the nucleic acids of pathogens, such as the viral RNA of the SARS-CoV-2 virus, can be extracted using, for example, bead-based protocol (MAGMAX Pathogen RNA/DNA Kit, ThermoFisher, USA) or cartridge-based protocol (e.g., QIAMP Viral RNA mini kit, Qiagen, Germany). In other embodiments, nucleic acid extractions may not be necessary. For example, SARS-CoV-2 viral RNA can be directly reverse transcribed and amplified from sample, such as, for example, nasopharyngeal swabs or saliva samples, without first extracting pathogen nucleic acids from such samples. Methods for direct viral RNA rRT- PCR without RNA extraction have been reported in, for example, Journal of Clinical Virology Vol. 128, July 2020, 104423, which is incorporated herein by reference in its entirety.

[0068] Specifically, a Vermont team discovered that a pilot experiment using nasopharyngeal (NP) swabs from two COVID-19 patients who had previously been verified for S ARS-CoV-2 infection by the Vermont Department of Health Laboratory (VDHL) using the CDC’s recommended reverse transcription-quantitative polymerase chain reaction (RT-qPCR) test.

Both patient samples, which were originally collected as NP swabs in 3 mL of M6 viral transport medium (termed diluent hereafter), were pooled (equi -volume). RNA was extracted from 140 μL of the pooled sample using the QIAamp Viral RNA Mini kit, and purified RNA representing 11.3 μL of the original swab diluent was detected as positive via standard RT-qPCR using the CDC 2019-nCoV N3 primer/probe set, with a threshold cycle (Ct) of 18.7. In parallel, 7 μL of the pooled COVID-19 patient NP swab diluent was added directly to the RT-qPCR reaction (without RNA extraction), and SARS-CoV-2 RNA was successfully detected in the absence of an RNA extraction step. Compared to the same pooled NP swab diluent extracted with the QIAamp Viral RNA Mini kit (after adjusting for the quantity of swab diluent added in each case), adding the NP diluent directly into the RT-qPCR reaction resulted in an about 4 Ct drop in sensitivity. Preheating the NP diluent for five minutes at 70 °C prior to RT-qPCR had no impact on viral RNA detection. These results provided proof-of-principle that successful detection of SARS-CoV-2 RNA from an NP swab sample by RT-qPCR could be done in the absence of an RNA extraction step.

[0069] The Vermont team further' validated this direct RT-qPCR approach on additional samples, determine the optimal volume of NP swab diluent for use in the direct RT-qPCR assay, and further address the potential impact of a prior heating step on assay sensitivity. NP samples from three COVID-19 patients who had previously been shown to be positive for SARS-CoV-2 RNA at high, intermediate, or low copy load by the Department of Laboratory' Medicine at the University of Washington (UW) in Seattle were heated or not at 95 °C for 10 minutes and then directly loaded into RT-qPCR reactions at 1, 3, or 5 μL volumes, or subjected to RNA extraction via the Roche MagNA Pure 96 platform prior to loading the equivalent of about 20 μL of swab diluent into the RT-qPCR reaction. The main findings of this experiment were that i) SARS- CoV-2 RNA could be detected in all three viral copy level samples at either input volume by direct RT-qPCR, provided they were heated first, and ii) addition of less NP diluent led to more sensitive detection of target RNA, Thus, heating appears important for subsequent detection of low viral copy samples, presumably by denaturing inhibitors of the RT and/or PCR enzymes present in the NP diluent. The best sensitivity for SARS-CoV-2 detection was achieved when 3 m,E of swab diluent was used for direct RT-qPCR.

[0070] Another research group disclosed a research summary entitled “Saliva is more sensitive for SARS-CoV-2 detection in COVID-19 patients than nasopharyngeal swabs” on April 22, 202 at medRxiv. They used the following method to detecting SARS-CoV-2 in saliva samples. On arrival at the research lab, total nucleic acid was extracted from 300 μl of viral transport media from the nasopharyngeal swab or 300 μl of whole saliva using the Mag MAX Viral/Pathogen Nucleic Acid Isolation kit (ThermoFisher Scientific) following the manufacturer^’s protocol and eluted into 75 μl of elution buffer. For SARS-CoV-2 RNA detection, 5 μl of RNA template was tested using the US CDC real-time RT-PCR primer/probe sets for 2019-nCoV _N1 and 2019- nCoV_N2 and the human RNase P (RP) as an extraction control. Samples were classified as positive for SARS-CoV-2 when both N1 and N2 primer-probe sets were detected <38 Ct. Virus copies were quantified using a 10-fold dilution standard curve of RNA transcri pts that we previously generated!!. As results from N1 and N2 were comparable, all virus copies are shown as calculated using the N1 primer-probe set.

[0071] A different research group disclosed their method in a publication entitled “An alternative workflow for molecular detection of SARS-CoV-2 - escape from the NA extraction kit-shortage” in March 2020 at MedRxiv. Three simplified approaches without NA purification were performed before RT-qPCR for SARS-CoV2: 1) Direct: the saline/transport solution from the throat-swap, 2) PBS diluted: the saline/transport solution was further diluted 1:1 with phosphate-buffered saline (PBS), and 3) Heat-processed: We tested four different heat- processes: an aliquot of the saline/transport solution was heat-processed for a) 5 min. at 95 °C; b) 10 min. at 95 °C; c) 5 min. at 98 °C; and d) 10 min. at 98 °C, respectively. All heat-processed clinical samples were cooled for 2 min. at 4 °C before being used in the RT-qPCR reaction. Two SARSCoV-2 RT-qPCR assays were used; a) The published and widely used RT-qPCR assay for the E-gene combined with the SensiFASTTM Probe No-ROX One-Step Real-time PCR kit (BIOLINE), and b) the commercial REALSTAR SARS-CoV-2 RT-PCR kit 1.0 (Altona diagnostics, Hamburg, Germany). The RT-qPCR results (number of positives and Ct values) from the different approaches were compared to the RT-qPCR results from MagNA Pure purified samples. During this experiment the gravity of the limited supply for the MagNA Pure 96 system highlighted itself as our routine diagnostic laboratory became critically low on processing cartridges to the MagNA Pure 96 system, and we therefore had to switch to the QIAcube connect system (Qiagen, Hilden, Germany) to finish this study. Analysis of SARS- CoV-2 positive and negative oropharyngeal swaps using the SensiFASTTM kit showed a 97.4% sensitivity, 100% specificity and 98.3% accuracy when samples were heat-processed for 5 min. at 98 °C before the RT-qPCR reaction and compared to MagNA Pure purified samples.

[0072] A Chilean research group disclosed methods in a publication entitled “SARS-CoV-2 detection from nasopharyngeal swab samples without RNA extraction” in March 2020. Nasopharyngeal swabs samples (NSS) from two laboratory-diagnosed COVID-19 positive individuals (both confirmed by the Chilean Institute of Public Health) were obtained from the Servicio de Laboratorio Clinico, Hospital Clinico de la Universidad de Chile "Dr. Jose Joaquin Aguirre", Santiago, Chile. FLOQswabs (Copan Diagnostics Inc) containing the nasopharyngeal samples were added to a 4 ml tube containing 3 ml of UTM-RT mini transport media (Copan Diagnostics Inc). A volume of 5 μl of the NSS was used to perform the RT-qPCR detection using the TAQMAN 2019-nCoV Assay Kit vl (ThermoFisher) and the 2019-nCoV CDC qPCR Probe Assay (Integrated DNA Technologies). RTqPCR detections using 5 μl of RNA extracted with the QIAAMP Viral RNA Mini Kit (Qiagen) were processed in parallel in order to perform comparisons. In both cases, the cycling protocol recommended by each supplier was used in the QuantStudio3 Real Time PCR System (Thermo Fisher Scientific) using the samples obtained from the two COVID-19 positive individuals, the positive control provided by each kit together with SARS-CoV-2-free RNA obtained from human embryonic kidney (HEK293T) cells, which was used as a negative control. We first tested the suitability of the TaqMan™ 2019-nCoV Assay Kit vl to detect the SARS-CoV-2 genes Orflab, S and N. We observed that the three viral genes were readily detected in the NSS of both COVID-19 positive samples and the positive control but not in RNA from HEK293T cells. Interestingly, detection of SARS-CoV-2 genes from the NSS was as efficient as RNA samples extracted with the QIAAMP Viral RNA Mini Kit with differences between 1 to 5 Ct values depending on the viral gene and the sample. These results strongly indicate that the TAQMAN 2019-nCoV Assay Kit vl from Thermo Fisher Scientific is fully compatible with the direct use of NSS without any RNA extraction step.

[0073] B. Amplification and Labeling Nucleic Acids

[0074] Viral RNA could be reverse transcribed and then amplified using DNA amplification methods. While the reverse transcription step can be performed independently and the resulting cDNA can be optionally isolated before amplification, in some embodiments, the reverse transcription and the ensuing amplification steps can be combined in a single tube reaction, i.e., both reaction are conducted concurrently or in tandem in the same single reaction tube (or reaction vessel/container/flask) without isolation or purification of the PCR products or other intermediates.. Commercial RT-PCR reaction kits such as the QIAGEN OneStep RT-PCR Kit (Qiagen, Germany) or Superscript III Platinum One-Step qRT-PCR Kit (Therm oFisher, USA), and similar kits can be used for some embodiments.

[0075] Nucleic acid amplifications can be performed using target-specific PCR, random primer PCR, or a mixture of different primers in the PCR. In addition, a variety of isothermal amplification methods can be used as well. Some DNA polymerase can use both RNA and DNA as templates. For example, Bst 3 DNA Polymerase (New England BioLabs, USA) is an engineered polymerase that can be used to perform single tube reverse transcription and the ensuing isothermal amplification.

[0076] Prior to hybridization, nucleic acid samples can be labeled with fluorescence labels. While label free detection methods are available, fluorescence label detection can be used in many embodiments. In one aspect of the invention, labeling is performed in conjunction with reverse transcription and/or amplification. In one embodiment, a biotin dUTP or similar label nucleotide such as DIG labeled nucleotide, is incorporated during the amplification process. In such embodiments, a staining step either before or after hybridization (see example below) can used to generate fluorescence signal. Alternatively, direct incorporation of fluorescence labeled nucleotide during amplification can be used to eliminate the staining step. In this application, labeling and signal detection are often illustrated using either biotin streptavidin labeling or fluorescence detection. This invention is not limited to any particular signal detection system. [0077] Optionally, these labeled or unlabeled amplification products can be fragmented to enhance hybridization. DNA fragmentation can be performed using DNase digestion, ultrasonic fragmentation or thermal fragmentation. A variety of DNA fragmentation systems and protocols are available. The optimal fragmentation size range can be obtained by varying fragmentation conditions and measuring the size of resulting products using, for example, gel electrophoresis. Comparing the ultimate sequencing performance with fragmentation size range can be used to optimize fragmentation process. In some embodiments, it is desirable to fragment the DNA to 50-120 bp range for hybridization. If the PCR target region is within this range, it is not necessary to fragment the DNA before the next step. Viral sequences can be successfully detected where the target regions are larger than this size region (see examples below).

[0078] While simultaneous labeling and amplification provides advantages, it can be possible to label amplification products, using methods such as, terminal transferase and labeled nucleotide (See examples below). In such cases, the fragmentation products can be labeled unless fragmentation is not used in the process.

[0079] C. Array Design and Manufacturing

[0080] In a typical sequencing array design, each base of a target sequence is tiled by four probes against the sense or antisense strand (the sense and antisense strands often refer to cDNA or amplification products). The group of (typically four) probes in a probe set targets a single base (interrogation base). In one embodiment, the probes are 18-35, 20-28, or 25 bp in length. In some embodiments, the probes are about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 bp in length. In some embodiments, the interrogation base is the middle base. In other embodiments, the interrogation base is not the middle base. In some embodiments, the interrogation base is located within 1, 2, 3, 4, or 5 bp of the middle base. In some embodiments, the interrogation base is located not mor than 5, 4, 3, 2 or 1 bp from the middle base. The probes in the probe set may vary in a single base, i.e., the interrogation base, which might be the middle base. The variation in the interrogation position is typically A, C, G, T. While the probes are often complementary with the target sequence except for the interrogation base (one of the probes could have complete complementary sequence against the target), in some embodiments, some bases other the interrogation base can be altered to change hybridization thermodynamics. Computational modeling or experimental approaches can be used to optimize the probe design.

In some embodiments, however, it is not necessary to alter the bases of most, if not all, probes to adjust hybridization properties of the probes.

[0081] Optionally, probe sets against sense or antisense strands can be used together to enhance detection. Also, probe set replicates may be used to further enhance the robustness of detection. [0082] An example of the probe design can be 8 probes designed to interrogate a single base. Probes are generally complementary to the sense or antisense strand except for the interrogation base. The interrogation base position in the 8 probes are different, i.e., typically A, C, G, T. [0083] Selection of the target sequence may be important because some pathogens may have similar sequences in certain regions. If two pathogens share sequence identity in certain region, these regions can be removed from the actual probes during the probe design. For example, the Kenai MultiPathogen Chip (example shown below) targets subregions of SARS-CoV-2 genes and sequence regions or probes that are similar among a coronavirus, for example, are removed from the chip design. In some other embodiments, the entire pathogen genome other than perhaps the very beginning or the very end is interrogated by probes.

[0084] Because nucleic acid extraction or amplification may fail, probes against control sequences may be included. Control materials, either naturally present in clinical samples or spiked in, may be used to assess whether a sample may have failed in the extraction or the amplification step. In the VIRUSHUNTER QUADCORE chip design (example shown below), a part of the human RNaseP gene is interrogated. If viral RNA signal is not detected in a sample, it could be due to that the sample is negative or that nucleic acid extraction or amplification steps failed. If the human saliva sample does not have the signals for the control gene (i.e., the signal is RNaseP negative), the assay may need to be repeated. This scheme is similarly used in for example, in an FDA publication entitled “CDC 2019-Novel Coronavirus (2019-nCoV) Real- Time RT-PCR Diagnostic Panel ”, that is available at FDA website, which is incorporated herein by reference.

[0085] Sequencing arrays can be manufactured using a variety of array manufacturing technologies. In one embodiment, photolithographic methods may be used to fabricate arrays. For example, viral detection arrays can be fabricated by photo directed in situ synthesis with resolution of 3 micron (Omni Metagenomic Array, Centrillion Tech, USA), 5 micron (VIRUSHUNTER QUADCORE, Centrillion Tech, USA) or other larger feature sizes. Optionally, a border between features may be used to facilitate, for example, image analysis. [0086] D. Hybridization and Optional Staining

[0087] A variety of DNA hybridization protocols may be used in the current methods. In one aspect of the invention, using conditions of a simple 4X SSC hybridization buffer in a 30 min to 2 hr hybridization process at 45 °C can be sufficient to detect SARS-COV-2 viral RNA. Longer hybridization time, such as, for example, overnight hybridization or about 16 hr hybridization, may be used as well. After hybridization, a single or multiple washings can be used to improve specificity of the hybridization assay. Hybridization can be performed in a temperature and, optionally, moisture-controlled oven. Other hybridization conditions can also be used. For example, hybridization can be performed in a flow cells with a controlled heating pad to maintain the hybridization temperature.

[0088] E. Array Scanning and Targeted Scanning

[0089] Array scanning methods can be performed using for example SUMMIT Scanner (available from Centrillion Tech, USA). After scanning, feature intensity can be extracted using, for example, the commercially available Magpie software’s SummitGrid module (Centrillion Tech, USA).

[0090] Adaptive Scanning: In some embodiments, an array may not be scanned fully. A user can select a pathogen of interest for detection. Because in some clinical settings, a majority of the samples could be negative. A fast scanning of the interest virus probes can quickly establish the negative samples and no further scanning is needed.

[0091] FIG. 10 shows an embodiments of the above steps A-E. The methods of the present disclosure may comprises Step 1001: obtaining samples to be analyzed; Step 1002: optionally, extracting RNA from the obtained samples; Step 1003: performing RT-PCR on the RNA of the samples, optionally labeling the PCR products; Step 1004: optionally fragmenting the PCR products or derivatives thereof and labeling the fragments obtained; Step 1005: hybridizing either the processing PCR products or the fragments of the PCR project, or derivatives thereof with the probe sets on the hybridization array; Step 1006: optionally staining the hybridized PCR products, fragments thereof, and Step 1007, scanning the samples thus obtained.

[0092] F. Data Analysis and Viral Detection [0093] (a) Sequence Read

[0094] A variety of hybridization based sequencing read algorithms can be used and have been reported ( e.g (1) “Microarray-based resequencing of multiple Bacillus anthracis isolates”, Genome Biol. 2005; 6(1): R10; and (2) “High-Throughput Variation Detection and Genotyping Using Microarray”, Genome Res. 2001 Nov; 11(11): 1913-1925; each of which is incorporated by reference). For SARS-CoV-2 viral RNA detection, however, a simple algorithm may be sufficient. Starting with feature intensity of the probe sets described above, the probe with the highest intensity may be assumed to be complementary to the target sequence, and thus, the interrogation base of the highest intensity probe may be considered as base in the target. If the difference in intensities between different interrogation bases in too small (such as, for example, lower than 2%, 5%, or 10%), the base cannot be called reliably, and thus, should be called as “N” or cannot be read.

[0095] In cases where multiple probe sets are used to target different strands, the quality of the calls of the different probe sets can be compared and the highest quality call is used. In one example, the quality can be assessed by the strength of the signal and the difference between the highest intensity and the second highest intensity. For example, the bigger the difference between the highest intensity and the second highest intensity, the higher quality the call is for the determination of the interrogation base.

[0096] While it is not required, particularly for pathogen detection or identification, signal processing methods such as machine learning methods can be used to improve base call accuracy, especially when large amount of data are available for training the data and validate the call accuracy.

[0097] Sequence reads can be stored/outputted in Standard sequence file format such as fasta fastq file format.

[0098] (b) Pathogen Detection

[0099] FIGURE 11 shows the workflow for pathogen detection. Raw images obtained from an array scanner is analyzed in Step 1101 to generate probe/feature intensity. Gridding the intensities of probes/features and extracting intensities in Step 1102. Comparing intensities of probes/features to generate base read (as described above) in Step 1103. The resulting sequence reads can be compared with pathogen references in Step 1104 to detect the presence or absence of a particular pathogen. This comparison can be performed by simple string comparison or using a sequence match algorithm (for example, using National Center for Biotechnology Information’s BLAST program). Coverage, identity and gap numbers can be used as criteria for the match in Step 1105. If criteria are met, a pathogen can be called present. If not, the pathogen can be called absent.

[00100] In some embodiments, the methods disclosed herein is also known as VIRUSHUNTER SARS-CoV-2 Assay. It is a molecular assay based on reverse transcription polymerase chain reaction (RT-PCR) and microarray resequencing. The methods are intended for the qualitative detection of RNA from the SARS-CoV-2 viral genome in samples, such as, for example, nasopharyngeal swabs from individuals suspected of COVID-19.

[00101] By using the disclosed methods, results are for the identification of SARS-CoV-2 RNA. The SARS-CoV-2 RNA is generally detectable in upper respiratory specimens (such as nasopharyngeal or oropharyngeal swabs or aspirate) during the acute phase of infection. Positive results are indicative of the presence of SARS-CoV-2 RNA; clinical correlation with patient history and other diagnostic information is necessary to determine patient infection status. Negative results do not preclude SARS-CoV-2 infection. Negative results must be combined with clinical observations, patient history, and epidemiological information for conclusive determination.

[00102] In some embodiments, reverse transcription polymerase chain reaction (RT-PCR) is used to amplify RNA from the SARS-CoV-2 obtained from upper respiratory specimens (such as nasopharyngeal or oropharyngeal swabs or aspirate) from patients suspected of COVTD-19 by their healthcare provider.

[00103] In some cases, the methods may comprise:

[00104] a) Single Tube Viral RT-PCT and Labeling

[00105] Viral RNA is reverse transcribed, PCR amplified and labeled simultaneously in a single reaction tube. The single tube reaction has two stages. In stage 1, viral and control RNA (Human RNase P in the sample) molecules are reverse transcribed into single stranded cDNA. In stage 2, target regions are amplified by PCR. Biotinylated dUTP is added during both stage 1 and stage 2.

[00106] b) Hybridization with VIRUSHUNTER QUADCORE DNA microarray chip [00107] The RT-PCR products are directly hybridized to the VIRUSHUNTER QUADCORE DNA Microarray for detection (as used herein, the terms “microarray” and “chip” may be used interchangeably). See FIG. 3. The QUADCORE DNA Microarray has four cores. Core 0 is used for the VIRUSHUNTER SARS-CoV-2 Assay. Core 0 contains tiling probes that interrogate the entire genome of SARS-CoV-2 sequence, except for the first and last 13 bp (GISAID accession EPI ISL 402125). In addition to the viral sequences, the VIRUSHUNTER QUADCORE DNA Microarray contains two control probe sets:

[00108] 1) Human RNaseP sequence. The Human RNaseP target sequence for the assay is the same as the Human RNaseP control sequence of the EUA approved CDC SARS-CoV-2 Assay.

[00109] 2) AM1E alignment marker. This control is used for the orientation of designated coordinates during image quality control of the assay. A fluorescent synthetic alignment marker target oligonucleotide that is complementary to the AM1E probes, (Cy3-AM1), is spiked into the RT-PCR products prior to hybridization [00110] c) Microarray Imaging

[00111] After hybridization and washing, the microarray is stained with Cy3-streptavidin for the detection of biotin-containing RT-PCR products. Microarrays are imaged using fluorescent scanning microscopy (SUMMIT Scanner, Centrillion Tech, USA). The fluorescence image pattern from the alignment marker sequences is used to assign X. Y coordinates, the grid, to the images. After gridding, the intensity of each probe/feature is extracted using the SUMMITGRID software (Centrillion Tech, USA).

[00112] d) Data Analysis

[00113] For each base in the SARS-CoV-2 genome and for part of the human RNase P gene, there are four probes on the VIRUSHUNTER QUADCORE DNA Microarrays with A, T, C, or G at the interrogated base position for both the sense and the antisense strands. The VIRUSHUNTER SARS-CoV-2 Assay uses RT-PCR with the CDC Nl, N2, and RP primer sets against two SARS-CoV-2 N gene sequences and a part of the human RNase P gene.

[00114] For Nl and N2 regions of the N gene, sense probes are used for base calls and for the Human RNaseP target, antisense probes are used for putative base calls. Furthermore, to avoid any potential primer dimer signal or primer sequence contamination, only the target sequence between the primers is used for analysis. For qualitative detection of the presence of viral RNA, a simple base calling method is used: the nucleotide is called for the probe with the highest intensity among the four probes querying that position in the sequence. The VIRUSHUNTER SARS-CoV-2 Assay uses putative base calls for the qualitative detection of the presence of the virus. These putative base calls should not be used for other sequence analysis such as mutation detection. Sequence identity with the target reference sequence is analyzed using a binomial test to make detection calls. A synthetic fluorescent alignment marker is added after RT-PCR to the PCR products, and samples are hybridized to the microarrays. Alignment marker fluorescence provides positional information on the microarray. Partial sequences of the SARS-CoV-2 N gene are shown in FIG. 12 and base readout is called according to probe intensity as illustrated below. Intensity can be extracted automatically using the VIRUS HUNTER software, and bases are automatically called according to parameters described below.

[00115] In some embodiments, a synthetic alignment marker sequence, “Cy3-AM1”, is added to the hybridization mixture containing the RT-PCR products and hybridization buffer. This sequence hybridizes in a square pattern at predetermined regularly spaced locations across the chip, as illustrated in FIG. 12 as Alignment Markers. The images are stitched together and gridded to create a composite image and using the positional information from the Cy3-AM1 sequences, and intensities for each feature on the chip are extracted from the image and stored in a. csv text file. Each base has two corresponding probe sets: one for the sense strand and one for the antisense strand. Each probe set consists of four features, one for each base, ATCG; thus, there are a total of eight features per base position. The intensity for each feature is stored in the. csv file. Feature intensities within a probe set are ranked separately for the sense and antisense probe sets for each base

[00116] In some embodiments, the steps of the methods comprises the following sequentially from specimen collection to detection. Some of the steps may be omitted.

[00117] As shown in FIG. 2, in Step 201 nucleic acids are isolated and, optionally, purified from upper respiratory specimens (such as nasopharyngeal or oropharyngeal swabs or aspirate) using the MagMax Viral/Pathogen Nucleic Acid Isolation Kit (Cat# A42352), optionally, with the automated Thermo Scientific KingFisher Flex Purification System. Samples are extracted according to the manufacturer’s protocol using an about 400 μL input volume and an about 50 μL elution volume. In Step 202 the purified nucleic acid is reverse transcribed and amplified using the SUPERSCRIPT IV One-Step RT-PCR System using an about 5 μL sample volume in an about 25 μL reaction volume. A final concentration of about 50 pM biotin-11- dUTP (Jena Biosciences) is added to the RT-PCR master mix. Following RT-PCR, in Step 203 the product is hybridized to a QUADCORE DNA Microarray in a buffer containing a fluorescent synthetic alignment marker oligonucleotide (Cy3-AM1). In Step 204 the hybridized microarray is stained with Cy3-streptavidin, which binds to biotin in the PCR product. The fluorescence of the streptavidin is detected during imaging using the SUMMIT scanner. The VIRUSHUNTER software uses the alignment marker probes to correctly align the images to design features for the extraction of the fluorescent intensities of each feature in the SARS-CoV- 2 N gene and human RNase P target sequences. [00118] QUADCORE DNA Microarrays work by the same principles as some other DNA microarrays that implement target enrichment and hybridization to query contiguous sequences to make base calls, also known as “resequencing”. Analysis is carried out in two steps. First, the microarray is imaged, and the fluorescent intensity of the relevant probe set is obtained to produce a putative base call. This is carried out for each position of the queried target region to create a putative sequence read. Second, the resulting putative sequence is compared with the target region reference sequence for base identity to determine the presence or absence of the virus genome.

[00119] In some embodiments, control materials can be used with the VIRUSHUNTER SARS-CoV-2 assay of the present disclosure.

[00120] In some cases, the controls to be used with the VIRUSHUNTER assay include:

[00121] a) A “no template” (negative) control” or “NTC” (using nuclease-free water) is needed to ensure that there is no reagent or environmental contamination. The NTC is used at least once per RT-PCR and microarray batch. If the NTC is taken through all steps including extraction, an additional PCR NTC is not required. If there is no extracted NTC on n RT-PCR plate, nuclease-free water may be used as a sample blank, a PCR NTC. If there are two separate RNA controls, one containing human SARS-CoV-2 RNA, and one containing SARS-CoV-2 RNA without human RNA, these may make a PCR NTC redundant. It is recommended that at least one or NTC wells are used per plate for high volume laboratories to detect potential PCR contamination as well as at least one microarray per batch.

[00122] b) A positive template control ensures of helps faithful extraction and amplification of targeted sequences in the samples. The positive template control is used once per extraction batch. One positive control is required per RT-PCR plate.

[00123] Twist Bioscience SARS-CoV-2 RNA control (GenBank ID: MT007544.1) is a commercially available RNA control that contains positive control material, synthetic whole genome RNA. Labs may use the positive RT-PCR control at concentrations between 100 and 10,000 copies per 25 μL PCR reaction.

[00124] c) A negative control is required using Total Human RNA (ThermoFisher) at 0.5 ng per 25 μL PCR reaction. If the no template control and a previously positive patient sample control containing both N1 and N2 as well as human RNaseP are taken through the entire sample processing procedure, including the extraction, then a separate extraction control is not required.

[00125] d) The human RNase P gene is used as an internal control during PCR and ensures or helps proper storage, handling, extraction, reverse-transcription, and amplification of samples. [00126] e) An additional internal control is used for hybridization. The alignment marker oligonucleotide, “Cy3-AM1,” is a fluorescent synthetic oligonucleotide that is spiked into samples after RT-PCR before the hybridization step. The sequence of this oligonucleotide has no sequence similarity with human or SARS-CoV-2 genomic sequence probes on the microarray. The Cy3-AM1 target hybridizes to QUADCORE AM1E control probes that support x,y coordinate assignment and accurate imaging alignment. This control is used for orientation of designated coordinates during image collection as well as quality control of the assay.

[00127] In some embodiments, the scanning results are interpreted. For qualitative detection of the presence of viral RNA, a simple base call method is used where the base is called if it has the highest fluorescent intensity of the probes within the four-probe set for that query position in the target region sequence. The VIRUSHUNTER SARS-CoV-2 Assay uses putative base calls as intermediate data and are not be used for sequence analysis, such as mutation detection, other than for making detection calls as follows. The target sequence between the primers is used for analysis for each of the three RT-PCR products.

[00128] Target region base calls are aligned to the reference sequence. A binomial test is used to calculate the P value with the null hypothesis that the sequence match is by chance. A combined N1 and N2 region sequence identity with their own reference sequences are analyzed. For detecting the presence of SARS-CoV-2 viral RNA, a P value of 0.0001 is used as a threshold. For detecting RNaseP RNA, the P value threshold is 0.05. While a putative base call or sequence read is made as an intermediate using a simple call method, the putative calls are only useful for the sequence identity binomial test. Table 1 summaries the number of probes used to make the calls in one example.

[00129] Table 1. Number of Probes Representing Each Target Region

[00130] For analysis of controls and patient samples, putative base calls for sequencing results generated from microarray images are aligned to the reference sequences for SARS-CoV- 2 and human RNase P, NC 045512.2 Wuhan seafood market pneumonia virus isolate Wuhan- Hu-1, complete genome (GISAID accession EPI ISL 402125) and NM 006413.5 Homo sapiens ribonuclease P/MRP subunit p30 (RPP30), transcript variant 2, mRNA. A target is called present/detected.

[00131] If the target region (after removing primer sequences) base calls match the reference sequence, the target is detected, otherwise, the target is not detected. A binomial test of base identity is used to assess a positive sequence match.

[00132] 1) VIRUSHUNTER SARS-CoV-2 Assay Controls - Positive, Negative and

Internal

[00133] The synthetic oligonucleotide alignment marker, Cy3-AM1, is used as an internal hybridization control. The Cy3-AM1 oligonucleotide hybridizes with the AM1E alignment mark probes. The resulting signal is the distinct pattern of a dotted square with round comers. Four alignment mark patterns fluoresce in each field of view (also called sub-images). At least 3 of the four alignment mark patterns are required for further processing of the images. Absence of fluorescent signal or weakly fluorescing AM1E alignment mark, patterns indicate a failure of the assay and termination of the analysis. Assay of these “failed” samples must be repeated from the RT-PCR and/or extraction steps.

[00134] Each RT-PCR plate requires a minimum of one negative (human) control, and one positive (SARS-CoV-2) control and each batch requires at least one NTC. The expected results for controls are described in Table 2.

[00135] Table 2. Expected results for controls.

[00136] In Table 2, expected detected sequences are indicated as “+” and not-detected sequences are indicated as for controls.

[00137] If an unexpected sequence is detected on a control microarray (for example, if any sequences are detected on the NTC), the RT-PCR plate is considered a fail and all samples on the same plate must be repeated from RT-PCR and/or extraction. Contamination during PCR can be caused by, among other reasons, improper pipetting or failure to properly seal plates. If any expected sequences are not detected on a control microarray (for example, if a positive control does not detect one or more sequences), the RT-PCR plate is considered a fail and all samples on the same plate must be repeated from RT-PCR and/or extraction. PCR failure can be caused by, among other reasons, improper pipetting when preparing the master mix, reagent degradation (for example, if a PCR enzyme is accidentally left at room temperature), and/or environmental contamination.

[00138] 2) Examination and Interpretation of Patient Specimen Results

[00139] Assessment of clinical specimen test results should be performed after the positive and negative controls have been examined and determined to be valid and acceptable. If the controls are not valid, the patient results cannot be interpreted. Interpretation of results is described in Table 3.

[00140] Table 3. Interpretation of results

[00141] In Table 2 expected detected sequences are indicated as “+” and undetected sequences are indicated as for CDC Nl, N2, and RP primer sets. Results, report, and follow- up actions are described for all possible outcomes.

[00142] In some embodiments, the DNA microarrays are manufactured according to the following attributes:

[00143] 1) Overview

[00144] DNA microarrays and plasticware required for carrying out the laboratory assay including hybridization, staining, and wash steps, are manufactured at Centrillion Technologies Taiwan Co. Ltd. by Centrillion Technologies Taiwan Co. Ltd. personnel consistent with practices for the production of oligonucleotide microarrays based on ISO 9001. At present, Centrillion Technologies assembles core molecular biology reagents used with the microarrays. Manufacturers of the reagents are listed in Table 4d below.

[00145] 2) Components included with the test

[00146] Table 4a. QUADCORE DNA Microarrays and Compatible Components Provided with the VIRUSHUNTER SARS-CoV-2 Assay

[00147] Table 4b. Oligonucleotides Provided with the VIRUSHUNTER SARS-CoV-2

Assay

[00148] The primers used in the VIRUSHUNTER SARS-CoV-2 Assay are from the

CDC-developed test (CDC-006-00019, Revision: 05). Sequences of all oligonucleotides used with the VIRUSHUNTER SARS-CoV-2 Assay are provided in Table 4c. [00149] Table 4c. Oligonucleotide Sequences Provided with the VIRU SHUNTER SARS-

CoV-2 Assay

[00150] able 4d. Molecular Reagents Provided with the VIRUSHUNTER SARS-CoV-2

Assay

[00151] 3) Other Components

[00152] Table 5a. Equipment Required

[00153] Table 5b. Reagents Required

[00154] 4) Software Validation

[00155] The VIRUSHUNTER SARS-CoV-2 assay uses three software products, MAGPIE, SUMMIT GRID, and VIRUSHUNTER. The MAGPIE scanner control software is used to control the SUMMIT scanner. The resulting images are analyzed with the SUMMIT GRID software for fluorescent intensity extraction. The intensity values are analyzed using VIRUSHUNTER Lab software to produce detection calls.

[00156] A) Magpie scanner control software has been validated using a variety of different microarray formats including Centrillion’s Research Use Only microarrays for genotyping and resequencing.

[00157] The Magpie scanner control software was tested and validated in connection with the SUMMIT Scanner. Software and hardware validation reports on record.

[00158] No patient information is used by the MAGPIE software.

[00159] B) SUMMIT Grid performs fluorescent intensity extraction of image outputs from the SUMMIT Scanner. SUMMIT Grid was tested and validated to perform its intended functions. Intensity extraction was validated with feature inspection and a python script intensity extraction method.

[00160] C) VIRUSHUNTER Lab is a software to analyze probe intensity and calculate final qualitative detection calls. The software is tested with a variety of experimental images to validate that it produces expected results.

[00161] Separately, a python script implementing the same algorithm was developed by a scientist who was independent of the SARS-CoV-2 Assay and algorithm development. This python script was used to produce calls independent of the VIRUSHUNTE Lab software and the results of the VIRUSHUNTE Lab and the python scrip are concordant for four sets of samples including the clinical validation data set below.

[00162] 5) Testing Capabilities

[00163] With the King Fisher MagMAXTM automated extraction system (Thermo Scientific), 96 samples can be extracted per batch, requiring approximately 45 minutes per batch. RT-PCR requires approximately 30 minutes to set up. The thermal cycling protocol requires approximately 1 hour, hybridization requires 90 mins, and imaging requires approximately one and a half hours for 96 samples with a single scanner. Therefore, the results of 96 samples including control samples can be obtained in less than 6 hours. With four scanners and four thermal cyclers, two operators would be able to complete eight plates or 768 samples within 8 hours. This extrapolates to between 2304 samples in a 24-hr continuous work period. [00164] In some embodiments, validation studies are performed to evaluation performance according to the following attributes:

[00165] 1) Limit of Detection (LoD) - Analytical Sensitivity

[00166] Testing was done in partnership with a CLIA certified high-complexity laboratory (Molecular Vision Laboratory (MVL), Hillsboro, OR) currently authorized to perform TaqPath rRT-PCR test for SARS-CoV-2 and the lab is authorized by the state of Oregon and had passed Oregon public health proficiency test for SARS-CoV-2 test. NP swab samples were provided by healthcare providers in California and sent to MVL for testing. All steps through RT-PCR were performed at MVL and hybridization and scanning were performed at Centrillion Technologies in Palo Alto, CA. NP samples that had previously tested negative through rRT-PCR were selected and spiked with the equivalent amount of positive control (ZeptoMetrix Isolate USA-WA1/2020, lot# 324332, quantitated as 5.82xl0⁴ cp/mL) varying from 0.05-18 copies/μL. All samples were then extracted using the KingFisher SOP with MS2 Phage Control and tested using the VIRUSHUNTER Assay. The N1 and N2 PCR products were detected for all samples except one at all titers tested during the Limit of Detection Finding Test. 2 copies per μL was chosen as the LoD for validation testing. 2 copies per μL is significantly lower than many other commercial assays. An additional 20 samples were tested at 2 copies/μL. Results for each chip can be found in Appendix K. They are briefly Summarized in Tables 6a and 6b.

[00167] Table 6a. Summary of Initial Testing Results to Determine the Limit of Detection.

[00168] Table 6b. Summary of Results of the Validation of the Limit of Detection.

[00169] 2) Inclusivity (analytical sensitivity)

[00170] The VIRUSHUNTER SARS-CoV-2 Assay uses PCR primers that are the same as the forward and reverse primers in EUA authorized CDC SARS-CoV-2 test according to CDC. See Table 6c. [00171] Table 6c. Real-time RT-PCR Primers and Probes.

[00172] Additional BLAST analysis was performed using the NCBI SARS-CoV-2 database on September 18, 2020. Less than 0.29% of each of the primer sequences had one or two putative mismatches, with none of the mismatches occurring at the 3’ end. While the database contains sequences with putative mutations in the PCR primer regions, verification of these mismatches were not found. At least some of these putative mutations could be due to sequencing or alignment errors. Even if these putative mutations are validated, these primers capture the majority of the viral sequences. However, it may be important to monitor the viral sequence database to detect additional variants and possible changes in the frequency of these putative mutations.

[00173] 3) Cross-reactivity (Analytical Specificity)

[00174] In-silico cross-reactivity analysis was conducted against the pathogens listed in Table 7. The parameters for searching are defined as:

• Primer must have at least 2 total mismatches to unintended targets, including at least 2 mismatches within the last 5 bps at the 3' end.

• Ignore targets that have 6 or more mismatches to the primer.

• Maximum target size: 1000 bp.

• Allow splice variants.

• Allow primer to amplify mRNA splice variants (requires refseq mRNA sequence as PCR template input).

[00175] Table 7. Organisms analyzed for cross-reactivity in-silico.

[00176] In addition to in-silico testing, a panel of 19 respiratory viruses was selected to assay cross-reactivity. Table 8 shows some of these viruses. Viral transport media was spiked with viral RNA using the Natrol Respiratory Verification Panel (ZeptoMetrix; Ref# NATRVP- IDI). The prepared spiked samples were extracted and analyzed in triplicate. Neither SARS- CoV-2 product was detected in any of the 19 pathogens assayed for cross-reactivity.

[00177] Table 8. Pathogens analyzed for Cross-Reactivity in vitro.

[00178] 4) Endogenous Interfering Substances:

[00179] The VIRUSHUNTER Assay uses conventional well-established nucleic acid extraction methods and based on the CDC’s other EUA assays including RT-PCR against MERS- CoV and Influenza A/H7 that are both intended for use with a number of respiratory specimens, we do not anticipate interference from common endogenous substances.

[00180] 5) Clinical Evaluation

[00181] Clinical testing was done in partnership with a CLIA certified high-complexity laboratory (Molecular Vision Laboratory (MVL), Hillsboro, OR) currently authorized to perform EUA authorized TaqPath rRT-PCR test for SARS-CoV-2 by the state of Oregon. All steps through RT-PCR were performed at MVL and hybridization and scanning were performed at Centrillion Technologies in Palo Alto, CA. Sixty-one NP Swab samples that had previously tested using TaqPath rRT-PCR were used for the clinical evaluation. Among the 61 samples, 31 previously tested negative and 30 previously tested positive.

[00182] The results are shown in Table 9a-c below. There was 100% agreement between the Thermo TaqPath Assay performed at MVL and the VIRUSHUNTER Assay. Positive Percentage Agreement (PPA), Negative Percentage Agreement (NPA) and Overall Agreement are all 100% (Table 1 lb) and their 95% confidence intervals (Cl) are listed in table 9b.

[00183] Table 9a. Clinical Sample Evaluation Summary.

[00184] Table 9b. Clinical Sample Evaluation Statistics.

[00185] Table 9c. Clinical Sample Evaluation Results.

[00186] Example 1. Design of Kenai Chip

[00187] KENAI Chip was designed to detect SARS-CoV-2 and a variety of respiratory and other pathogens. The array was fabricated using photo-directed synthesis (Centrillion Tech, USA) with 25mer Probes at 9 pm pitch, lpm space. Table 10 shows the design of the Kenai Chip.

[00188] Table 10. Design of the KENAI Chip

[00189] Example 2. Detection of SARS-CoV-2 PCR Fragment with Kenai Chip [00190] KENAI chip is designed for the identification and sequencing of SARS-CoV-2 and other human pathogenic viruses. In this experiment, the synthetic DNA of SARS-CoV-2 was used as a template to verify the capability of the Kenai chip to identify viruses and sequence the viral genome.

[00191] Methods :

[00192] The following DNA oligos are purchased from Integrated DNA Technologies (USA):

[00193] The following DNA fragments are designed according to the sequence of spike

(S) protein of SARS-CoV-2 , and ordered from Integrated DNA Technologies:

[00194] Spike Fragment 1 (SEQ ID NO ):

[00195] ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAA

TCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGT

TTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTC

TTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATG

GTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTC

CACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAA

GACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGA

ATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAG

TTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCAC [00196] Spike Fragment 2 (SEQ ID NO ):

[00197] TCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTA

TGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAG

AATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGT

GATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATT

AACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTG

ATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACC

TAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTG

TGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTAGAAAA

AGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGT

[00198] Spike Fragment 3 (SEQ ID NO ):

[00199] CCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTG

CCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAG

GAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATT

TTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACT

AATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCA

GGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGG

CTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAA

TTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTC

AACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTA

[00200] Spike Fragment 4 (SEQ ID NO ):

[00201] GTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGG

TTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTT

GAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTT

AAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACT

GAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACT

ACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCT

TTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTT

CTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTT

ACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGT

[00202] PCR reactions with Q5® High-Fidelity DNA Polymerase (New England Biolabs,

Catalog #M0491S) were setup to amplify the synthetic DNA fragments with designed primers. [00203] PCR components:

[00204] Sixteen PCR reactions were set up in total, for each PCR reaction, the templates and primers used were:

[00205] PCR tubes were transferred to an ABI 9700 GEMEAMP PCR System. The thermocycling conditions are according to the following program:

[00206] For each amplified fragment, 22 μl PCR solution was collected from each of the four reactions and added into a 1.5 mL centrifuge tube. 12 μl of nuclease-free water was added into each tube to make the final volume of about 100 μl. About 0.4 μl of GLYCOBLUE Coprecipitant (Thermo Fisher Scientific, Catalog # AM9516), 7.2 μl of 7.5 M ammonium acetate, and 215.2 μl chilled ethanol, 200 proof (absolute), for molecular biology (Millipore Sigma, Catalog # E7023-500ML) were added to each tube. The tubes were placed at -20 °C freezer for 30 minutes.

[00207] The tubes were then centrifuge at 18,000 g at 4 °C in a microcentrifuge for 30 min. The resulting DNA pellets were washed twice with 70% ethanol, air dried and eluted with 20 μl of the nuclease-free water. The dsDNA concentration of each fragment was measured by Qubit fluorometric quantitation (Thermo Fisher Scientific).

[00208] About 2.5 μg of each purified PCR fragment was added to a PCR tube for fragmentation. 10 μl of lOx DNase I buffer and a proper amount of DNase I (Thermo Fisher Scientific, Catalog # EN0521), determined by a pre-experiment to ensure the average size of the fragment to be around 50 bp, was added to each tube, and the final volume was adjusted to 100 μl by adding nuclease-free water. The tube was incubated for 15 minutes at 37 °C in an ABI 9700 GeneAmp PCR System for fragmentation.

[00209] After fragmentation, 1 μl of EDTA was added into the each of the tubes to stop the reaction. The solutions were transferred to 1.5 mL tubes, 0.4 μl of GLYCOBLUE Coprecipitant (Thermo Fisher Scientific, Catalog # AM9516), 7.2 μl of 7.5 M ammonium acetate, and 215.2 μl chilled ethanol, 200 proof (absolute), for molecular biology (Millipore Sigma, Catalog # E7023-500ML) was added to each tube. The tubes were stored at -20 °C freezer for 2 hours. [00210] A Terminal Transferase buffer with Terminal Transferase (New England Biolabs, Catalog # M0315S) and ChromaTide Alexa Fluor 568-5-dUTP (Thermo Fisher Scientific, Catalog # Cl 1399) were prepared as follows:

[00211] The tube was centrifuged at 18,000 g at 4 °C for 30 min. The DNA pellets were washed twice with 70% ethanol and air-dried and elute with 50 μl of the Terminal Transferase buffer. The tubes were incubated in a 37 °C incubator for 3 hours.

[00212] After incubation, 47 μl from each tube were used for hybridization. 12 μl of 20X SSC buffer and 1 μl of ULTRAPURE Salmon Sperm DNA Solution (Thermo Fisher Scientific, Catalog #: 15632011) was added to each tube. The hybridization solution was denatured in an ABI 9700 GeneAmp PCR System for fragmentation at 95 °C for 10 minutes and incubated at 45 °C for 5 minutes.

[00213] Hybridization with the KENAI chip was performed by placing the chip in a humidity chamber at 48 °C for 2 hours.

[00214] After incubation, the chip was washed with 2 x 5 min with 200 μl of wash buffer A (2X SSC, 0.1% Tween-20) at room temperature, and 2 x 5 min with 200 μl of wash buffer B (0.5X SSC, 0.1% Tween-20) at 39 °C.

[00215] The chip was scanned with an automatic imaging microscope (a microscope from Keyence, Japan, with 20 x Objective, with TRITC channel).

[00216] Result: Figure 13 A shows one representative image from Keyence, Signals were detected in the region designed for the four fragments for each base of the SARS-CoV-2 spike gene region.

[00217] The sequence can be read out directly with manual analysis in ImageJ without any other software or reference genome. The base read is based upon the highest intensity probe. FIGURE 13B shows a consecutive 78 bases read which perfectly matches the reference genome (Kenai Reference Genome is EPI-ISL-402125 from GISAID) [00218] Example 3. Level of Detection Test with KENAI Chip

[00219] This experiment is to perform a preliminary assessment of detection level of the

KENAI Chip.

[00220] Kenai Chip was assembled in a 96 well plate (Centrillion TECH, USA).

[00221] The following DNA oligos are purchased from Integrated DNA Technologies: [00222] Primer Sequence:

[00223] Spike Frag 1-F: 5’-ATGTTTGTTTTTCTTGTTTTATTGCCACTAG-3’

[00224] Spike Frag 1 -R: 5 ’ -GTGC AATTATTCGC ACTAGA-3 ’

[00225] Following is the sequence of Spike Fragment 1, which is designed according to the sequence of spike (S) protein of SARS-CoV-2 , and ordered from Integrated DNA Technologies.

[00226] Spike Fragment 1 :

[00227] ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAA

TCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGT

TTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTC

TTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATG

GTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTC

CACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAA

GACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGA

ATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAG

TTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCAC

[00228] About 10 ng / μl of the Spike Fragment 1 was diluted with a serial dilution process to reach a final concentration of 1000 copies/mL (1 copy per μl).

[00229] PCR reactions with Q5® High-Fidelity DNA Polymerase (New England Biolabs, Catalog #M0491S) were set up to amplify the synthetic DNA fragments with designed primers. Biotin- 11-dUTP (Jena Bioscience, Catalog #: NU-803-BIOX) was added into the solution to incorporate biotin into the PCR product directly.

[00230] PCR Reaction Components:

[00231] PCR was performed using an ABI 9700 GeneAmp PCR System with the following program:

[00232] After thermocycling, DNase I (Thermo Fisher Scientific, Catalog # EN0521) was added to fragment the PCR products for 15 minutes at 37°C in an ABI 9700 GeneAmp PCR System to achieve about fragment size of about 50 bp.

[00233] About 1 μl of EDTA was added into the tube to stop the reaction. After fragmentation, add 1 μl of EDTA into the tube to stop the reaction. Prepare the hybridization mix in a PCR tube according to the following table:

[00234] After denaturation at 95 °C for 10 minutes, hybridization was performed at 48 °C for 2 hours.

[00235] The chip was washed 2 x5 min with 200 μl of wash buffer A (2X SSC, 0.1% Tween-20) at room temperature, and 2 x 5 min with 200 μl of wash buffer B (0.5X SSC, 0.1% Tween-20) at 39°C in an incubator.

[00236] The chip was then stained with Streptavidin-CY3 and Biotinylated Anti- Streptavidin in three steps. The chip was scanned with SUMMI scanner (Centrillion TECH, USA) and with Keyence Automatic Image.

[00237] Result:

[00238] The Spike fragment was clearly detected. One representative image from Keyence Scanning is show in FIGURE 14. This experiment suggests that SARS-CoV-2 viral nucleic acid of 1000 copies/mL or 5 copies per reaction may be detectable. FIGURE 14 shows several rows with signals.

[00239] Example 4. VIRUSHUNTER QUADCORE Chip Design

[00240] The VIRUSHUNTER QUADCORE Chip was designed and manufactured for the detection of the presence of SARS-CoV-2 RNA as well as a variety of respiratory viral pathogens. The Chip has four cores (individual chip regions) Core 0-3. Each of the cores can be individual dices and can be used accordingly. Each core targets a specific detection function. As discussed previously, FIG. 3 illustrate one arrangement of the cores in packaging.

[00241] FIGS. 4A and 4B show arrangement of the probes on Core 0. This core has probes interrogating the entire SARS-CoV-2 genome except for the very beginning and the very last nucleic acids. In general, each base of the SARS-CoV-2 genome is interrogated with 8 probes, four against sense strand and four against the antisense strand with the interrogating base at the middle of the 25mer probes. The probes can any length from 16 to 32 bp. Further, at the beginning and the end of the SARS-CoV-2 genome, the probe arrangement is different. This chip does not interrogate the junction of the viral genome RNA’s poly A tail.

[00242] In addition to probes targeting SARS-CoV-2 , a variety of control probes are also included. For example, probes against Human RNaseP (RBASECTRL) are included in all cores of this chip. Some probe sets are replicated in this core. Probes against SARS-CoV-2 are designed using SARS-CoV-2 reference genome accession number EPI-ISL-402125, from GISAID. [00243] For Cores 1 and 2 (FIGS. 5A, 5B, 6A and 6B), most probes are interrogating reported variants of the SARS-CoV-2, including both sense and antisense probes as indicated in the legends of the figures. Both Cores 1 and 2 comprise control probes as indicated by the names of the controls in the legends of the figures. Many of these variants are single nucleotide polymorphisms or SNPs. However, some insertion and deletions are included. The presence of interrogating probes against variants in addition to probes targeting the reference genome in Core 1 is used to enhance the robustness of the detection and sequencing of virus variants. In addition to SARS-CoV-2 variants, Core2 also targets a variety of other respiratory viruses. For example, FIGS. 7A, 7B, and 7C shows an example arrangement of probes targeting Rhinoviruses, flu viruses, and coronaviruses, respectively.

[00244] Core 3, shown in FIGS 8 A, 8B, 9 A, 9B, and 9C, are designed to interrogate still other respiratory viruses. As shown in FIGS. 8A and 8B, probes can include both sense and antisense probes as indicated in the legends of the figures for Core 3. Control probes are present as well on Core 3. FIGS. 9A, 9B, and 9C depict locations of probes against other coronaviruses, Rhinoviruses, and flu viruses, respectively.

[00245] Both 5’ up or 3’ up chips were manufactured at 4 micron feature, 5 micron pitch arrangement. Chips were glued to 96 well plate with posts. The four core assembly fits into one well in a custom 96 well hybridization plate (Centrillion TECH, USA). Both 3’ up and 5’ up chips were shown to hybridize with SARS-CoV-2 PCR fragments. For example, at least 97% base read accuracy in a 200 bp region was required for a wafer to pass QC for further experiments. Base calling was performed using simple highest intensity base calling method. VIRUSHUNTER CommandLine 1.0 was used for QC assessment (Centrillion, USA).

[00246] Example 5. Technical LOD Assessment of Single Tube RT-PCR Assay and VIRUSHUNTER QUADCORE Sequencing Chip for SARS-CoV-2 RNA Detection [00247] A single tube RT-PCR-Labeling reaction from viral RNA (reference viral RNA or extracted viral RNA) had been tested and optimized to simplify workflow for SARS-COV viral RNA detection. See FIG. 1.

[00248] The followings are RT-PCR-labeling protocols:

[00249] Materials Provided :

[00250] Primer Sequences:

[00251] Primers required to be used with the VIRUSHUNTER SARS-CoV-2 Assay are shown below.

[00252] Catalog #CEN-SARS-CoV-2-01

[00253] The primers used in the VIRUSHUNTER SARS-CoV-2 Assay are from the CDC test. The CDC provides a list of acceptable commercial primers. Please note that premixed primer and probe sets for TaqMan assays are not compatible with the VIRUSHUNTER SARS- CoV-2 Assay. Primers Recommended for use with the VIRUSHUNTER SARS-CoV-2 Assay are listed in the table below.

[00254] Precautions:

• Prepare the run plate on ice and keep it on ice until it is loaded into the PCR instrument.

• Run the plate immediately after preparation. Failure to do so could result in degraded RNA samples.

• To prevent contamination, prepare reagents in a PCR workstation or equivalent amplicon-free area. Do not use the same pipette for controls and samples, and always use aerosol barrier pipette tips.

• Maintain an RNase-free environment.

• Keep samples and components on ice during use.

• For each RT-PCR plate, include the following controls: a. One SARS-CoV-2 PCR Positive Control b. One Human PCR Negative Control c. PCR Controls contain a standardized nucleic acid input that can aid in the interpretation of results. These controls are suggested but not required if running the extraction controls with the samples from start to finish. d. One No Template Control (NTC) using Nuclease-free water e. One SARS-CoV-2 Positive Extraction Control from each set of extraction samples f. One Human Negative Extraction Control from each set of extraction samples g. For example, if samples from 4 extraction runs are being combined on one plate, then 4 Positive and 4 Negative Control wells need to be run on that RT-PCR plate.

• Thaw all reagents on ice unless otherwise noted.

• Keep enzymes at -20°C until immediately before use.

[00255] The followings are some general steps:

[00256] 1. Thaw the following reagents on ice:

[00257] Biotin- 11-dUTP

[00258] 2X Platinum SuperFi RT-PCR Master Mix

[00259] MPM-JDOl lOpM primer mix or individual lOOpM primers: Nl-F, Nl-R, N2-F,

N2-R, RP-F, RP-R

[00260] Internal control (Thermo Human Total RNA Control (4307281))

[00261] Positive control (Twist Synthetic SARS-CoV-2 genome GenBank ID:

MT007544.1)

[00262] 2.. Keep the SSIV RT-PCR Enzyme Mix at -20 °C when not in use.

[00263] 3. Gently vortex and spin reagents prior to use.

[00264] 4. If necessary, prepare dilutions of your primers:

To prepare a mix containing 1 OmM dilution of each primer, add 80μL of NF-H₂O to a LoBind microcentrifuge tube. Add 20 μL each 100 pM forward and reverse Nl, N2, and RP primers (6 primers total, lOOμL final volume), pipetting up and down very slowly three times. Flick tube ten times and quickly spin.

Dilutions can be stored at -20°C. Estimated shelf life: 6 months. Avoid freeze/thaw cycles.

[00265] 5. If necessary, prepare dilutions of your controls: c. To prepare a lng/μL dilution of your human total RNA control, add 5μL of the stock to 245 μL of NF-H₂O, pipetting up and down very slowly three times. Flick tube ten times and quickly spin. d. To prepare a l,000x dilution of the Twist Synthetic SARS-CoV-2 genome GenBank ID: MT007544.1 (1,000,000 copies/μL), add 2μL of the stock to 1998μL of NF-H₂O, pipetting up and down very slowly three times. Flick tube ten times and quickly spin. This dilution is 1,000 copies/μL. e. Prepare a lOx dilution of each of these using 90μL NF-H₂O, and 10 μL of the Ing/μL and 1,000 copies/μL tubes. These are now at O.lng/μL and 100 copies/μL. f. Dilutions can be stored at -20°C. Estimated shelf life: 2 weeks. Avoid freeze/thaw cycles.

[00266] 6. Prepare master mix (MM) on ice, adding reagents in the order listed. Gently vortex and spin.

[00267] 7. Aliquot 15μL of the mastermix to desired wells on a 96-well plate. Return reagent stocks to the freezer before handling controls.

[00268] 8. Prepare samples: add lOμL of sample or control to the mastermix, pipetting up and down once to mix. Prepare one of each of the PCR controls per plate in addition to your extraction controls. a. NTC (use NF-H₂O instead of sample) b. Positive control (TWIST Synthetic SARS-CoV-2 RNA genome MT007544.1). Dilution at 100 copies/μL c. Internal control (Thermo Human Total RNA Control (4307281)). Dilution at O.lng/μL, Vortex and briefly centrifuge plate.

[00269] 9. Transfer plate to ABI 9700 thermal cycler and run on the following program

[00270] Hybridization Staining and Scanning

[00271] The followings are the general steps:

[00272] 1. Thaw the following reagents on ice:

[00273] 4x Hybridization Buffer (or Cy3-AM1)

[00274] 2. Preheat two hybridization ovens to 38°C and 43°C for 30 minutes prior to use or until temperature is stable.

[00275] 3. Prepare reagents listed below as necessary:

[00276] Prepare 1L Wash A (2X SSC, 0.1% Tween-20): a. Using a 1 -liter graduated cylinder, measure 899 mL of nuclease-free water. b. Add 100 mL 20X SSC to the 1 L graduated cylinder. c. Pour contents of graduated cylinder into 1 L screw cap bottle. d. Using a 5 mL serological pipette, add 1 mL of 100% Tween-20 to the bottle. Pipette with care, as Tween-20 is very viscous. Pipette up and down to ensure entire volume is added. e. Cap the bottle and invert 10-20 times to thoroughly mix. f. Storage temperature: Room temperature (18°C-25°C). Estimated shelf life: 2 months.

[00277] Prepare 1L Wash B (0.5X SSC, 0.1% Tween-20): a. Using a 1 -liter graduated cylinder, measure 974 mL of nuclease-free water. b. Using a 25mL serological pipette, add 25 mL 20X SSC to the 1 L graduated cylinder. c. Pour contents of graduated cylinder into 1 L screw cap bottle. d. Using a 5 mL serological pipette, add 1 mL of 100% Tween-20 to the bottle. Pipette with care, as Tween-20 is very viscous. Pipette up and down to ensure entire volume is added. e. Cap the bottle and invert 10-20 times to thoroughly mix. f. Storage temperature: Room temperature (18°C-25°C). Estimated shelf life: 2 months.

[00278] Prepare 1L Scan buffer (4X SSC): a. Using a 1 -liter graduated cylinder, measure 800 mL of nuclease-free water. b. Add 200 mL 20X SSC to the 1 L graduated cylinder. c. Pour contents of graduated cylinder into 1 L screw cap bottle. d. Cap the bottle and invert 10-20 times to thoroughly mix. e. Storage temperature: Room temperature (18°C-25°C). Estimated shelf life: 2 months.

[00279] Prepare 1.6mL of 4x hybridization buffer: a. Using a 2mL Lo-bind microcentrifuge tube, add 256uL NF-H20. Add in order, pipetting up and down to mix: 64uL 0.5M EDTA, 80uL 500mM HEPES pH 8.0, 400uL 5M NaCl, 400uL 20% Ficoll 4000, 400uL 8nM Cy3-AM1 b. Gently vortex and centrifuge briefly before using. c. Storage temperature: Room temperature (-10°C to -30°C). Avoid freeze/thaw cycles. Estimated shelf life: 2 months.

[00280] 4. Prepare samples for hybridization: add 20uL of NF-H20 to the 25uL sample.

Add 15uL of the 4x hybridization solution to each well, pipetting up and down to mix. See table at beginning of protocol.

[00281] 5. Vortex and briefly centrifuge plate.

[00282] 6. Set an ABI 9700 to incubate at 95°C for 10 minutes followed by 43°C forever.

[00283] 7. After cycler has reached 95°C, transfer plate to cycler.

[00284] 8. After samples have reached 43°C, transfer samples to the desired wells of the hybridization tray.

[00285] 9, Transfer Lassen (Virus Hunter QuadCore) chips to tray and transfer then plate to 43°C.

[00286] 10. Incubate at 43°C for 60 minutes.

[00287] 11. During this time prepare staining master mix. Store on ice, dark:

[00288] 12. Pipette 20mL of Wash A into Wash Tray A. After hybridization, transfer the chips to this tray for 5 minutes at room temperature. [00289] 13. Pipette 20mL of warm Wash B into Wash Tray B. Transfer the chips to this tray for 10 minutes at 38°C.

[00290] 14. Pipette 50uL of stain MM into desired wells of a staining tray. Transfer chips to this tray. Incubate for 30 minutes at room temperatures, dark.

[00291] 15. Pipette 20mL of 4x SSC to Wash Tray C. Transfer chips to this tray for 5 minutes at room temperature, dark.

[00292] 16. Image using scan tray on Summit: 0.25ms BF, Is Green channel (green-

AMLe)

[00293] Virus Hunter CommandLine 20 calling algorithm [00294] Intensity for each probe is analyzed as follows:

[00295] 1) Assign zero quality score to bases for forward PCR primer sequence (this is to avoid potential primer dimer or other PCR artifacts that could generate false positive signals) for the sense probe (as used herein, sense probes target the antisense strand), similarly, a quality score of zero is assigned to reverse PCR primer sequences for the antisense probe.

[00296] 2) Rank the probe intensity, (I0, I1, I2, I3} sense and (10, II, 12, 13}antisense. 13 is the highest intensity.

[00297] 3) Calculate a quality score using:

[00298] D =13-12

[00299] 13 base is the putative base.

[00300] 4) Compare sense and antisense base quality score and use the base with the highest quality. If the quality score is lower than a threshold, the base is called “N”.

[00301] 5) The resulting sequence is outputted and a NCBI blast comparison with the

SARS-COV-2 reference genome is performed to obtain match statistics. The following blast parameters are used: a. -word size 11 b. -reward 2 c. -penalty -3 d. -gapopen 5 e. -gapextend 2

[00302] 6) Positive Calls. Analyze the blast results to identify matches within the expected region. If overlap size - mismatch size> 30, the targeted sequence is called detected. [00303] TECHNICAL LOD:

[00304] Viral RNA were diluted according to the table below. Assays were performed as described above. The result is shown in FIG. 16. [00305] Example 6: Validation of Detection of SARS-COV-2 in Saliva Samples with VIRUSHUNTER QUADCORE Sequencing Chip

[00306] The QUARDCORE Sequencing Chip may comprise controls that will be provided with the test kit:

[00307] a) A “no template” (negative) control is needed to ensure there is no cross- contamination between samples and is used once per RT-PCR plate. If the NTC is taken through all steps including extraction, an additional PCRNTC is not required. If there is no extracted NTC on a PCR plate, nuclease-free water may be used in place of a sample as a PCR NTC. [00308] b) A positive template control is needed to ensure faithful extraction and amplification of samples and is used once per extraction run. One positive control is required per RT-PCR plate.

[00309] Commercially available extraction controls that can be used are the Zeptometrix NATSARS(COV2)-ERC or the Sera Care AccuPlex™ SARS-CoV-2 Reference Material Kit. NATSARS(COV2)-ERC contains positive and negative controls formulated with purified, intact viral particles (Positive control) and human A549 cells (Negative control). The AccuPlex SARS- CoV-2 Reference Material Kit contains positive reference material directed against the published CDC and WHO consensus sequences. Also included are negative controls targeting the human RNAse P gene. Labs may choose to pool samples that have previously tested negative and spike in an RNA control such as the Twist Synthetic SARS-CoV-2 RNA control to create a positive control.

[00310] Positive extraction controls should be diluted using negative controls to 6 copies per microliter such that it is close to the lowest concentration measured for LoD studies of the Virus Hunter™ SARS-CoV-2 Assay.

[00311] If a positive extraction control is run on the RT-PCR plate, a PCR positive control is not required. Labs may choose to run an additional positive RT-PCR control using the Twist Synthetic SARS-CoV-2 RNA control at concentration of 300 to 10,000 copies per 25 μL PCR reaction. This is not necessary, but may provide additional assurance of assay fidelity.

[00312] c) A negative extraction control using the negative control samples from either the Zeptometrix NATSARS(COV2)-ERC kit or the Sera Care AccuPlex™ SARS-CoV-2 Reference Material Kit or pooled previously negative patient samples is needed to ensure faithful extraction and amplification without cross-contamination and is used once per extraction run. If a negative extraction control is run on the RT-PCR plate, a PCR negative control is not required. Labs my choose to run an addition negative RT-PCR control using Total Human RNA from Thermo at 0.5ng per 25 μL PCR reaction. This is not necessary, but may provide additional assurance of assay fidelity. Please note that if the no template control and positive control, are taken through the entire sample processing procedure, including the extraction, then a separate extraction control is not required.

[00313] d) The human RNase P gene is used as an internal control during PCR and is used to ensure proper storage, handling, extraction, reverse-transcription, and amplification of samples.

[00314] e) An additional internal control is used for hybridization. The alignment marker sequence, “Cy3-AM1,” is a fluorescent synthetic oligo that is spiked into samples after RT-PCR before hybridization to chips. This sequence does not align to human or SARS-CoV-2 genomic regions and is not visible in those regions on the Lassen™ arrays. Cy3-AM1 hybridizes to the chip at evenly spaced locations in a square pattern as illustrated in Figure 1. This provides positional context on the arrays.

[00315] Controls that are required but not provided with the test kit include the Zeptometrix NATSARS(COV2)-ERC or the Sera Care ACCUPLEX SARS-CoV-2 Reference Material Kit. Labs may choose to pool samples that have previously tested negative. They may use pooled negative sample and spike in an RNA control such as the Twist Synthetic SARS- CoV-2 RNA control to create a positive control. These controls are needed to ensure fidelity of extraction, RT-PCR, and microarray hybridization and are used once per extraction run.

[00316] The synthetic oligonucleotide alignment marker, Cy3-AM1, is used as an internal hybridization control. Chips for which Cy3-AM1 is not visible will not be gridded by the Virus Hunter™ software, and no data will be output by the software. Individual images of the chip taken during scanning may be reviewed to troubleshoot. Failure to read out the Cy3-AM1 sequences may be due to hybridization failure caused by human error, large bubbles on the chip surface, or scratches on the chip surface from handling. These samples are considered “failed” and must be repeated from the RT-PCR and/or extraction steps.

[00317] Each RT-PCR plate requires a minimum of one NTC, one negative (human) control, and one positive (SARS-CoV-2) control. If the NTC and a positive (human plus SARS- CoV-2) are taken through all steps of the protocol including extraction, no additional controls are required. Labs may choose to run additional PCR controls. Expected results for controls are described in Table 1. If extraction controls are not run on the same RT-PCR plate as all other extracted samples, an additional NTC, positive control, and negative control are required for each RT-PCR plate run.

[00318] Expected results for controls:

[00319] Expected detected sequences are indicated as “+” and not-detected sequences are indicated as for controls.

[00320] If an unexpected sequence is detected on a control chip (for example, if any sequences are detected on the NTC), the RT-PCR plate is considered a fail and all samples run on the same plate must be repeated from RT-PCR and/or extraction. Contamination during PCR can be caused by, among other reasons, improper pipetting or failure to properly seal plates. If any expected sequences are not detected on a control chip (for example, if a positive control does not detect one or more sequences), the RT-PCR plate is considered a fail and all samples run on the same plate must be repeated from RT-PCR and/or extraction. PCR failure can be caused by, among other reasons, improper pipetting when preparing the master mix, reagent degradation (for example, if a PCR enzyme is accidentally left at room temperature), and/or environmental contamination.

[00321] Interpretation of the results:

[00322] Expected detected sequences are indicated as “+” and not-detected sequences are indicated as for CDC Nl, N2, and RP primer sets. Results, report, and follow-up actions are described for all possible outcomes.

[00323] Saliva specimen were collected from 30 volunteers showing no symptoms of the COVID-19 infections. Samples incubated at room temperature for 24-72 hours to simulate expected shipping conditions. The 30 samples were extracted and tested in the rRT-PCR assay to verify that all were negative for COVID-19 as expected.

[00324] Twenty of these samples were randomly selected and spiked with the equivalent amount varying from 6-50 copies/μL. All samples were then extracted and tested in the rRT- PCR assay with ThermoFisher TaqPath COVID-19 Combo Kit (Therm oFisher, USA). The results of the Centrillion Virus Hunter Assay is 100% concordant with the TaqPath kit, except for one sample which was initially invalid because none of the targets were detected including the human extraction control. Per Virus Hunter workflow, this sample was repeated, and the result of this sample is concordant with the result of ThermoFisher TaqPath results. The final result is shown in the table below:

[00325] Cross reactivity test was performed by preparing contrived samples using the Natrol Respiratory Verification Panel (ZeptoMetrix; Ref# NATRVP-IDI). The prepared spiked samples with the organisms listed in Table below were extracted and analyzed in triplicate to determine the cross reactivity. The samples were also verified with ThermoFisher TagPath kit assays.

[00326] Cross-Reactivity with the Natrol Respiratory Verification Panel:

[00327] Example 7. Whole Genome Sequencing of SARS-CoV-2 from Patient Samples

[00328] Samples were prepared as previously described using the ARTIC sequencing methods (available at: artic.network/ncov-2019, last accessed on 7/19/2020). In brief, cDNA was prepared from total RNA extracted from clinical samples using Superscript IV (SSIV, Thermo Scientific) and random hexamer priming. The resultant cDNA was amplified in two PCR reactions using either the ARTIC Pooll or Pool2 SARS-CoV-2 v3 primer sets and Q5 High Fidelity DNA Polymerase (NEB). Following PCR, samples were purified using AMPure XP SPRI beads (Beckman Coulter). Illumina adaptors were added using the NEBNEXT ULTRA II DNA Library Prep Kit (NEB) and SPRI bead purification was repeated. Libraries were amplified using KAPA HiFi HotStart ReadyMix (KAPA) and unique dual indexed (UDI) tag plates, which deviates from the NEBNext Ultra II protocol, which uses Q5 polymerase [00329] To prepare samples for hybridization to the Virus Hunter QuadCore arrays, 0.05μL of purified PCR product was amplified using the ARTIC protocol and Pooll or Pool2 v3 primer sets for 35 cycles with 50mM biotin- 11-dUTP (Jena Biosciences) added to the reaction mixture. Pooll and Pool2 were combined for each sample and fragmented using DNase I (D4263, Sigma). 2,000 Kunitz units of lyophilized DNase I was resuspended on ice using 2mL of lx DNase I Buffer (lOmM Tris-HCl pH 7.5, 2.5mM MgC12, O.lmM CaC12). The resuspended enzyme was diluted 1,000 fold using lx DNase I Buffer, and an equal volume was added to samples prewarmed to 37°C. Samples were incubated for 30 minutes at 37°C and the reactions were stopped by adding EDTA to a final concentration of 12.5mM and incubating for 20 minutes at 75°C.

[00330] 45 μL of the fragmented sample was hybridized overnight at 45°C to the Lassen array in a 60μL final volume containing 5mM EDTA, 6.25mM HEPES pH 8.0, 312.5mM NaCl, 1.25% FIcoll 400, 0.5nM Cy3-AM1. Following hybridization, chips were washed for 10 minutes at room temperature in Wash A (2x SSC, 0.1% TWEEN-20) and then for 10 minutes at 39°C in Wash B (0.5xSSC, 0.1% TWEEN-20). Chips were stained for 15 minutes at room temperature using 0.02mg/mL Cy3-Streptavidin (Thermo) in 4x SSC and washed for 5 minutes at room temperature using 4xSSC. Chips were scanned using the Summit Imager for 1 second and 4 seconds in the green (Cy3) channel in 4x SSC.

[00331] AMI sequence: GCTGTATCGGCTGAATCGTA [00332] Base Calling was performed as described in Example 5.

[00333] Fasta files for sequencing results generated from microarray images are aligned to the reference sequences for SARS-CoV-2 and human RNase P, NC_045512.2 Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome (GISAID accession EPI ISL 402125) and also compared with Illumina Sequencing results. The results for two samples have greater than 99% concordance with the result of Illumina sequencing result cover over 98% of the entire genome (in one of the two samples, the Illumina sequencing results contains a stretch of Ns, and this region was excluded from the analysis).

[00334] FIG. 15 shows imaging results for one sample sequenced using this method. The four “squares” at the four comers are signals for the Alignment Markers (Cy3-AM1).

[00335] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

CLAIMS WHAT IS CLAIMED IS:

1. A method for sequencing SARS-CoV-2 viral ribonucleic acid (RNA), comprising:

(a) producing a plurality of labeled deoxyribonucleic acid (DNA) fragments by performing in a single reaction tube a reverse transcription polymerase chain reaction (RT-PCR) using (i) the SARS-CoV-2 viral RNA as a template, and (ii) at least one labeled nucleoside 5’ -triphosphate analog, thereby forming the plurality of labeled DNA fragments, wherein each of the plurality of labeled DNA fragments is complementary to or the same as a portion of the sequence of the SARS-CoV-2 viral RNA, and

(b) hybridizing the plurality of labeled DNA fragments with a DNA array, wherein the DNA array comprises a plurality of probe sets, wherein a first probe set of the plurality of probe sets comprises probes targeting a single interrogation position on a target sequence; and

(c) detecting hybridization signals, thereby calling the base at the single interrogation position.

2. The method of claim 1, wherein the target sequence is a fragment of the SARS-CoV-2 viral RNA.

3. The method of claim 1, wherein the target sequence is a fragment of the SARS-CoV-2 viral RNA, a fragment of a variant of SARS-CoV-2 viral RNA, or a fragment of another pathogen, or a combination thereof.

4. The method of claim 3, wherein the other pathogen is a respiratory pathogen.

5. The method of claim 3, wherein the other pathogen is Adenovirus B/E, Adenovirus C, Chlamydophila, Pneumonia, Influenza A, Influenza A Subtype HI, Influenza A Subtype H3, Influenza A Subtype 2009, Influenza B, Mycoplasma Pneumonia, Respiratory Syncytial Virus A, Respiratory Syncytial Virus B, Parainfluenza 1, Parainfluenza 2, Parainfluenza 3, Coronavirus 228E, Coronavirus OC43, Coronavirus NL63, Coronavirus HKU1, Rhinovirus/Enterovirus, Human Metapneumovirus, Human Bocavirus, or SARS- COV, or a combination thereof.

6. The method of claim 1, wherein the at least one labeled nucleoside 5’ -triphosphate analog is labeled with biotin.

7. The method of claim 6, wherein the plurality of labeled DNA fragments are labeled with biotin.

8. The method of claim 6, wherein the at least one labeled nucleoside 5’ -triphosphate analog is biotin-dUTP.

9. The method of claim 7, further comprising, after (a), staining with fluorescence labeled streptavidin.

10. The method of claim 9, wherein the staining is after (b).

11. The method of claim 9, wherein the staining is before (b).

12. The method of claim 1, wherein the at least one labeled nucleoside 5’ -triphosphate analog is labeled with a fluorescence label.

13. The method of claim 1, wherein the producing in (a) further comprising: fragmenting a plurality of RT-PCR products, thereby forming the plurality of labeled DNA fragments.

14. The method of claim 13, wherein the fragmenting comprises treating the plurality of RT- PCR products with deoxyribonuclease digestion, ultrasonic fragmentation or thermal fragmentation.

15. The method of claim 1, further comprising: adding a control DNA before (b).

16. The method of claim 15, wherein the control DNA is a negative template control, a positive template control, a positive extraction control, a negative extraction control, a human RNase P control, or an alignment marker, or a combination thereof.

17. The method of claim 15, wherein the control DNA comprises the human RNase P control.

18. The method of claim 15, wherein the control DNA comprises the alignment marker.

19. The method of claim 18, wherein the alignment marker is Cy3-AM1.

20. The method of claim 15, wherein the DNA array further comprises other probes complementary to the control DNA.

21. The method of claim 15, wherein the control DNA comprises the alignment marker, wherein the DNA array further comprises another probe complementary to the alignment marker, wherein the method further comprising: after (b), determining provides positional information on the microarray based on hybridization signals between the alignment marker and the other probe complementary to the alignment marker.

22. The method of any one of claims 1-21, further comprising: before (a), obtaining the SARS-CoV-2 viral RNA from a biological sample.

23. The method of claim 22, wherein the biological sample is saliva oropharyngeal swab, nasopharyngeal swab, environmental samples, whole blood, blood plasma, or frozen food.

24. The method of claim 22, wherein the obtaining is not extracting the SARS-CoV-2 viral RNA from the biological sample.

25. The method of any one of claims 1-24, wherein the hybridizing in (b) is for a duration of about 30 min.

26. The method of any one of claims 1-24, wherein the hybridizing in (b) is for a duration no longer than 120 min.

27. The method of any one of claims 1-24, wherein the hybridization in (b) is from 30 to 120 min.

28. The method of any one of claims 1-27, wherein each probe of the plurality of probe sets is 18-35, 20-28, or about 25 bp in length.

29. The method of any one of claims 1-28, wherein the first probe set comprises a sense probe and an antisense probe for the target sequence.

30. The method of claim 29, wherein the first probe set consists of four sense probes and four antisense probes for the target sequence.

31. The method of any one of claims 1-30, wherein the single interrogation position is between the 3’ -end and the 5’ -end of the target sequence.

32. The method of claim 31, wherein the single interrogation position is not mor than 3, 2 or 1 bp from the midpoint the sequence of the target sequence.

33. The method of any one of claims 1-32, wherein the presence or absence of the SARS- CoV-2 viral RNA in clinical samples is detected with more than 94%, 95%, 96%, 97%, 98%, or 99% accuracy at 95% confidence intervals.

34. The method of claim 33, wherein the clinical samples are more than 60.

35. The method of claim 33, wherein the method sequences at least 95% in length of the SARS-CoV-2 viral RNA with an average accuracy greater than 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%.