WO2022017630A1 - GENE THERAPY VECTOR FOR eEF1A2 AND USES THEREOF - Google Patents

GENE THERAPY VECTOR FOR eEF1A2 AND USES THEREOF Download PDF

Info

Publication number
WO2022017630A1
WO2022017630A1 PCT/EP2020/071028 EP2020071028W WO2022017630A1 WO 2022017630 A1 WO2022017630 A1 WO 2022017630A1 EP 2020071028 W EP2020071028 W EP 2020071028W WO 2022017630 A1 WO2022017630 A1 WO 2022017630A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
eef1a2
polynucleotide sequence
raav virion
sequence encoding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2020/071028
Other languages
English (en)
French (fr)
Inventor
Simon Waddington
Rajvinder KARDA
Christopher Herzog
Joanne NG
Chester SACRAMENTO
Stephanie Schorge
David RICKS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
UCL Business Ltd
Original Assignee
UCL Business Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by UCL Business Ltd filed Critical UCL Business Ltd
Publication of WO2022017630A1 publication Critical patent/WO2022017630A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A61K48/0041Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/61Growth hormone [GH], i.e. somatotropin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14171Demonstrated in vivo effect
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/48Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • EEF1A2 encodes Eukaryotic elongation factor 1, alpha-2 (eEF1A2), a protein involved in protein synthesis, suppression of apoptosis, and regulation of actin function and cytoskeletal structure.
  • eEF1A2 is a potential oncogene, as it is overexpressed in ovarian cancer.
  • a lentiviral vector encoding EEF1A2 was used experimentally to transduce immortalized ovarian surface epithelial (IOSE) cells and thereby demonstrate that eEF1A2 promotes tumorigenesis in non-tumorigenic precursor cells.
  • IOSE immortalized ovarian surface epithelial
  • EEF1A2 is highly expressed in the central nervous system (CNS), as well as heart and muscle. Complete loss of Eefla2 in mice causes motor neuronal degeneration, a phenotype termed “wasted” whose genotype is termed wst. Davies et al. Sci Rep. 7:46019 (2017). Point mutations in the human EEF1A2 gene have recently been demonstrated to variously cause epilepsy, intellectual disability, and/or autism. Cao et al. Human Molecular Genetics. 26(18):3545-3552 (2017); Lam et al. Mol Genet Genomic Med. 4(4):465-74 (2016); Nakajima et al. Clin Genet. 87(4):356-61 (2015).
  • FEE1A2-related disease is rare. Only about 100 individuals worldwide have been identified as having a mutation in EEF1A2. The etiology of disease remains poorly understood. Consequently, whether rescue of the disease phenotype by postnatal expression of wild-type EEF1A2 could be achieved has been unclear. Furthermore, delivery of gene therapy to the CNS is challenging and unpredictable.
  • the present invention relates generally to gene therapy for neurological disease or disorders using adeno-associated vims (AAV)-based delivery of a polynucleotide encoding eEF1A2 or a functional variant thereof.
  • AAV adeno-associated vims
  • the disclosure provides a recombinant adeno-associated vims (rAAV) virion, comprising a capsid and a vector genome, wherein the vector genome comprises a polynucleotide sequence encoding an eEF1A2 protein or a functional variant thereof, operatively linked to a promoter.
  • the promoter may be a neuron-specific promoter, e.g., a human synapsin 1 (hSYN) promoter.
  • the capsid may be an AAV9 capsid or functional variant thereof. Other promoters or capsids may be used.
  • the disclosure provides a method of treating and/or preventing a neurological disease or disorder in a subject in need thereof, comprising administering the rAAV virion of the disclosure, or a pharmaceutical composition thereof, to the subject.
  • the rAAV virion may be administered intracerebrally and/or intravenously.
  • the disclosure provides polynucleotides (e.g., vector genomes), pharmaceutical compositions, kits, and other compositions and methods.
  • polynucleotides e.g., vector genomes
  • pharmaceutical compositions e.g., kits, and other compositions and methods.
  • FIG. 1 shows a domain diagram of eEF1A2 showing point mutations associated with disease.
  • FIG. 2 shows a vector diagram of a non-limiting example of a vector genome.
  • FIG. 3 shows a vector diagram of a non-limiting example of a vector genome.
  • FIG. 4 shows a vector diagram of a non-limiting example of a vector genome.
  • FIG. 5 shows a vector diagram of a non-limiting example of a vector genome.
  • FIG. 6 shows a vector diagram of a non-limiting example of a vector genome.
  • FIG. 7 shows immunofluorescence microscopy of mice after neonatal injection, intracerebrally (IC) or intravenously (IV), of AAV9-hSyn-eEF1A2-2A-eGFP or control. Scale bar, 300 ⁇ m .
  • FIG. 8A shows immunohistochemical analysis of mice after neonatal injection, intracerebrally (IC) or intravenously (IV), of AAV9-hSyn-eEF1A2-2A-eGFP or control.
  • FIG. 8B shows a magnified view of the same slides. Scale bar, 300 ⁇ m .
  • FIG. 9A shows survival in untreated wst/wst (null) mice compared to intracerebrally (IC), intravenously (IV) or a combination of both (IC+IV) treated mice.
  • FIG. 9B shows weight loss in untreated wst/wst (null) mice compared to intracerebrally (IC), intravenously (IV) or a combination of both (IC+IV) treated mice.
  • FIG. 9C shows rotarod testing in untreated wst/wst (null) mice compared to intracerebrally (IC), intravenously (IV) or a combination of both (IC+IV) treated mice.
  • FIG. 9D shows inverted grid testing in untreated wst/wst (null) mice compared to intracerebrally (IC), intravenously (IV) or a combination of both (IC+IV) treated mice.
  • FIG. 9E shows eEF1A2 expression in untreated wst/wst (null) mice compared to intracerebrally (IC), intravenously (IV) or a combination of both (IC+IV) treated mice.
  • Scale bar 125 ⁇ m.
  • FIG. 9F shows eEF1A2 expression in untreated wst/wst (null) mice compared to intracerebrally (IC), intravenously (IV) or a combination of both (IC+IV) treated mice.
  • any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
  • the term “about”, when immediately preceding a number or numeral, means that the number or numeral ranges plus or minus 10%.
  • the terms “a” and “an” as used herein refer to “one or more” of the enumerated components unless otherwise indicated.
  • the use of the alternative e.g ., “or” should be understood to mean either one, both, or any combination thereof of the alternatives.
  • the term “and/or” should be understood to mean either one, or both of the alternatives.
  • the terms “include” and “comprise” are used synonymously.
  • identity refers, with respect to a polypeptide or polynucleotide sequence, to the percentage of exact matching residues in an alignment of that “query” sequence to a “subject” sequence, such as an alignment generated by the BLAST algorithm. Identity is calculated, unless specified otherwise, across the full length of the subject sequence.
  • a query sequence “shares at least x% identity to” a subject sequence if, when the query sequence is aligned to the subject sequence, at least x% (rounded down) of the residues in the subject sequence are aligned as an exact match to a corresponding residue in the query sequence.
  • residues denoted X an alignment to any residue in the query sequence is counted as a match.
  • an “AAV vector” or “rAAV vector” refers to a recombinant vector comprising one or more polynucleotides of interest (or transgenes) that are flanked by AAV terminal repeat sequences (ITRs).
  • AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been transfected with a plasmid encoding and expressing rep and cap gene products.
  • AAV vectors can be packaged into infectious particles using a host cell that has been stably engineered to express rep and cap genes.
  • an “AAV virion” or “AAV viral particle” or “AAV vector particle” refers to a viral particle composed of at least one AAV capsid protein and an encapsidated polynucleotide AAV vector.
  • the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell), it is typically referred to as an “AAV vector particle” or simply an “AAV vector.”
  • production of AAV vector particle necessarily includes production of AAV vector, as such a vector is contained within an AAV vector particle.
  • promoter refers to a polynucleotide sequence capable of promoting initiation of RNA transcription from a polynucleotide in a eukaryotic cell.
  • vector genome refers to the polynucleotide sequence packaged by the vector (e.g ., an rAAV virion), including flanking sequences (in AAV, inverted terminal repeats).
  • expression cassette and “polynucleotide cassette” refer to the portion of the vector genome between the flanking ITR sequences.
  • Expression cassette implies that the vector genome comprises at least one gene encoding a gene product operable linked to an element that drives expression (e.g., a promoter).
  • the term “patient in need” or “subject in need” refers to a patient or subject at risk of, or suffering from, a disease, disorder or condition that is amenable to treatment or amelioration with a recombinant gene therapy vector or gene editing system disclosed herein.
  • a patient or subject in need may, for instance, be a patient or subject diagnosed with a disorder associated with central nervous system.
  • a subject may have a mutation in an EEF1A2 gene or deletion of all or a part of EEF1A2 gene, or of gene regulatory sequences, that causes aberrant expression of the eEF1A2 protein.
  • Subject and “patient” are used interchangeably herein.
  • the subject treated by the methods described herein may be an adult or a child. Subjects may range in age.
  • variant or “functional variant” refer, interchangeably, to a protein that has one or more amino-acid substitutions, insertions, or deletion compared to a parental protein that retains one or more desired activities of the parental protein.
  • genetic disruption refers to a partial or complete loss of function or aberrant activity in a gene.
  • a subject may suffer from a genetic disruption in expression or function in the EEF1A2 gene that decreases expression or results in loss or aberrant function of the eEF1A2 protein in at least some cells (e.g., neurons) of the subject.
  • treating refers to ameliorating one or more symptoms of a disease or disorder.
  • preventing refers to delaying or interrupting the onset of one or more symptoms of a disease or disorder or slowing the progression of eEF1A2 related neurological disease or disorder.
  • EEF1A2 Elongation factor 1-alpha 2
  • FIG. 1 Various mutations in EEF1A2, illustrated in FIG. 1, are known to be associated with neurological disorders, including epilepsy, intellectual disability, and/or autism. Both inherited and de novo mutations have been observed. In some cases, a heterozygous missense mutation is sufficient to cause disease.
  • polypeptide sequence of eEF1A2 is as follows:
  • the eEF1A2 protein comprises a polypeptide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1).
  • the disclosure provides a recombinant adeno-associated vims (rAAV) virion, comprising a capsid and a vector genome, wherein the vector genome comprises a polynucleotide sequence encoding the eEF1A2 protein or a functional variant thereof, operatively linked to a promoter.
  • the disclosure provides a recombinant adeno-associated virus (rAAV) virion, comprising a capsid and a vector genome, wherein the vector genome comprises a polynucleotide sequence encoding an eEF1A2 protein, operatively linked to a promoter.
  • the polynucleotide encoding the eEF1A2 protein may comprise a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • polynucleotide sequence encoding the eEF1A2 protein may be codon optimized.
  • the polynucleotide encoding the eEF1A2 protein may comprise a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the polynucleotide encoding the eEF1A2 protein may comprise a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the polynucleotide encoding the eEF1A2 protein may comprise a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the polynucleotide encoding the eEF1A2 protein may comprise a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the polynucleotide encoding the eEF1A2 protein may comprise a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the polynucleotide sequence encoding the vector genome may comprise a Kozak sequence, including but not limited to GCCACCATGG (SEQ ID NO: 10).
  • Kozak sequence may overlap the polynucleotide sequence encoding an eEF1A2 protein or a functional variant thereof.
  • the vector genome may comprise a polynucleotide sequence (with Kozak underlined) at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to: gccaccATGGGCAAGGAGAAGACCCACATCAACATCGTGGTCATCGGCCACGTGGACT
  • the Kozak sequence is an alternative Kozak sequence comprising or consisting of any one of:
  • the vector genome comprises no Kozak sequence.
  • the AAV virions of the disclosure comprise a vector genome.
  • the vector genome may comprise an expression cassette (or a polynucleotide cassette for gene-editing applications not requiring expression of the polynucleotide sequence). Any suitable inverted terminal repeats (ITRs) may be used.
  • ITRs may be from the same serotype as the capsid or a different serotype ( e.g ., AAV2 ITRs may be used).
  • the 5' ITR comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the 5' ITR comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the 5' ITR comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the 3' ITR comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the 3' ITR comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the vector genome comprises one or more filler sequences, e.g., at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • the polynucleotide sequence encoding an eEF1A2 protein or functional variant thereof is operably linked to a promoter.
  • the present disclosure contemplates use of various promoters.
  • Promoters useful in embodiments of the present disclosure include, without limitation, a cytomegalovirus (CMV) promoter, phosphoglycerate kinase (PGK) promoter, or a promoter sequence comprised of the CMV enhancer and portions of the chicken beta-actin promoter and the rabbit beta-globin gene (CAG).
  • CMV cytomegalovirus
  • PGK phosphoglycerate kinase
  • CAG rabbit beta-globin gene
  • the promoter may be a synthetic promoter. Exemplary synthetic promoters are provided by Schlabach et al. PNAS USA. 107(6):2538-43 (2010).
  • the promoter comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to:
  • a polynucleotide sequence encoding an eEF1A2 protein or functional variant thereof is operatively linked to an inducible promoter.
  • An inducible promoter may be configured to cause the polynucleotide sequence to be transcriptionally expressed or not transcriptionally expressed in response to addition or accumulation of an agent or in response to removal, degradation, or dilution of an agent.
  • the agent may be a drug.
  • the agent may be tetracycline or one of its derivatives, including, without limitation, doxycycline.
  • the inducible promoter is a tet-on promoter, a tet-off promoter, a chemically-regulated promoter, a physically-regulated promoter (i.e., a promoter that responds to presence or absence of light or to low or high temperature).
  • Inducible promoters include heavy metal ion inducible promoters (such as the mouse mammary tumor vims (mMTV) promoter or various growth hormone promoters), and the promoters from T7 phage which are active in the presence of T7 RNA polymerase. This list of inducible promoters is non-limiting.
  • the promoter is a tissue-specific promoter, such as a promoter capable of driving expression in a neuron to a greater extent than in a non-neuronal cell.
  • tissue-specific promoter is a selected from any various neuron- specific promoters including but not limited to hSYNl (human synapsin), INA (alpha-intemexin), NES (nestin), TH (tyrosine hydroxylase), FOXA2 (Forkhead box A2), CaMKII (calmodulin-dependent protein kinase II), and NSE (neuron-specific enolase).
  • the promoter is a ubiquitous promoter.
  • a “ubiquitous promoter” refers to a promoter that is not tissue-specific under experimental or clinical conditions.
  • the ubiquitous promoter is any one of CMV, CAG, UBC, PGK, EFl-alpha, GAPDH, SV40, HBV, chicken beta-actin, and human beta-actin promoters.
  • the promoter sequence is selected from Table 3.
  • the promoter comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOS 3, 14, 16-17, and 25-30. Table 3
  • the vector genome comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3.
  • promoters are the SV40 late promoter from simian virus 40, the Baculovirus polyhedron enhancer/promoter element, Herpes Simplex Virus thymidine kinase (HSV tk), the immediate early promoter from cytomegalovirus (CMV) and various retroviral promoters including LTR elements.
  • HSV SV40 late promoter from simian virus 40 the Baculovirus polyhedron enhancer/promoter element
  • HSV tk Herpes Simplex Virus thymidine kinase
  • CMV cytomegalovirus
  • retroviral promoters including LTR elements.
  • a large variety of other promoters are known and generally available in the art, and the sequences of
  • vectors of the present disclosure further comprise one or more regulatory elements selected from the group consisting of an enhancer, an intron, a poly-A signal, a 2A peptide encoding sequence, a WPRE (Woodchuck hepatitis virus posttranscriptional regulatory element), and a HPRE (Hepatitis B posttranscriptional regulatory element).
  • regulatory elements selected from the group consisting of an enhancer, an intron, a poly-A signal, a 2A peptide encoding sequence, a WPRE (Woodchuck hepatitis virus posttranscriptional regulatory element), and a HPRE (Hepatitis B posttranscriptional regulatory element).
  • the vector comprises a CMV enhancer.
  • the vectors comprise one or more enhancers.
  • the enhancer is a CMV enhancer sequence, a GAPDH enhancer sequence, a b- actin enhancer sequence, or an EF1- ⁇ enhancer sequence. Sequences of the foregoing are known in the art. For example, the sequence of the CMV immediate early (IE) enhancer is:
  • the vectors comprise one or more introns.
  • the intron is a rabbit globin intron sequence, a chicken ⁇ -actin intron sequence, a synthetic intron sequence, or an EF1- ⁇ intron sequence.
  • the vectors comprise a polyA sequence.
  • the polyA sequence is a rabbit globin polyA sequence, a human growth hormone polyA sequence, a bovine growth hormone polyA sequence, a PGK polyA sequence, an SV40 polyA sequence, or a TK polyA sequence.
  • the poly-A signal may be a bovine growth hormone polyadenylation signal (bGHpA).
  • the vectors comprise one or more transcript stabilizing element.
  • the transcript stabilizing element is a WPRE sequence, a HPRE sequence, a scaffold-attachment region, a 3' UTR, or a 5' UTR.
  • the vectors comprise both a 5' UTR and a 3' UTR.
  • the vector comprises a 5' untranslated region (UTR) selected from Table 4.
  • the vector genome comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOS 32-40.
  • the vector comprises a 3' untranslated region selected from Table 5.
  • the vector genome comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOS 41-49.
  • the vector comprises a polyadenylation (polyA) signal selected from Table 6.
  • the polyA signal comprises a polynucleotide sequence at least 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOS 50-54.
  • Illustrative vector genomes are depicted in FIG. 2-5 and provided as SEQ ID NOs: 55-58.
  • the vector genome comprises, consists essentially of, or consists of a polynucleotide sequence that shares at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
  • Vector Genome - 3,263 bp (SEQ ID NO: 57) gcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgc ccggcctcagtgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct tgtagttaatgattaacccgccatgctacttatctacgtaAGTGCAAGTGGGTTTTAGGACCAG GATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACC CCCATTCCAAATTGCGCATCCCCTATCAGAGAGGGGGAGGGGAAACAGGATGCGGCGAGGCG CGTGCACTGCCAGCTTCAGCACCGCGGACAGTGCCTTCGCCCCCCCGC
  • Vector Genome - 4,299 bp (FIG. 5) (SEQ ID NO: 58) gcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgc ccggcctcagtgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct tgtagttaatgattaacccgccatgctacttatctacgtaCTCTGGAGACGCGTTACATAACTT
  • TTTCTGCTCACTGCA ACCTCCTCCTCCCTGGGTTCtacgtagataagtagcatggcgggttaat cattaactacaaggaacccctagtgatggagttggccactccctctgcgcgctcgctcctc actgaggccgggcgaccaaaggtcgcccgacgcccgggctttgccgggcggcctcagtgagcgagcgcgcgcgcccgggcggcctcagtgagcgagcgcgcgcc
  • the expression cassette comprises, in 5' to 3' order, HuBA promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(x), and pAGlobin-Oc.
  • the expression cassette comprises, in 5' to 3' order, CMV promoter, TPL-eMLP enhancer, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(r), and pAGlobin-Oc.
  • the expression cassette comprises, in 5' to 3' order, Syn promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(r), 3'UTR (globin), and pAGH-Bt.
  • the expression cassette comprises, in 5' to 3' order, CBA promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, and pAGH-Bt.
  • the expression cassette comprises, in 5' to 3' order, EFla promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, and pAGlobin-Oc.
  • the expression cassette comprises, in 5' to 3' order, HuBA promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, R2V17, and pAGH-Bt.
  • the expression cassette comprises, in 5' to 3' order, Syn promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(x), 3'UTR (globin), and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, CaMKIIa promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(r), and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, CMV promoter, TPL-eMLP enhancer, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(r), and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, HuBA promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, CMV promoter, TPL/eMLP enhancer, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, R2V17, 3'UTR (globin), and pAGH-Bt.
  • the expression cassette comprises, in 5' to 3' order, EFla promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(r), and pAGH-Bt.
  • the expression cassette comprises, in 5' to 3' order, Syn promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, R2V17, and pAGlobin-Oc.
  • the expression cassette comprises, in 5' to 3' order, CaMKIIa promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, R2V17, and pAGlobin-Oc.
  • the expression cassette comprises, in 5' to 3' order, CBA promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(x), 3'UTR (globin), and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, CBA promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, 3'UTR (globin), and pAGlobin-Oc.
  • the expression cassette comprises, in 5' to 3' order, CaMKIIa promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, R2V17, and pAGH-Bt.
  • the expression cassette comprises, in 5' to 3' order, EFla promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, R2V17, 3'UTR (globin), and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, CMV promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, R2V17, 3'UTR (globin), and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, CMV promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, hSYN promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(x), and pAGH-Bt.
  • the expression cassette comprises, in 5' to 3' order, hSYN promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(x), and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, hSYN promoter, Kozak, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(x), and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, CAG promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(x), and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, CAG promoter, Kozak, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(x), and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, hSYN promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, WPRE(x), and pAGH-Bt.
  • the expression cassette comprises, in 5' to 3' order, hSYN promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, hSYN promoter, Kozak, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, CAG promoter, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, and pAGH-Hs.
  • the expression cassette comprises, in 5' to 3' order, CAG promoter, Kozak, the polynucleotide sequence encoding eEF1A2 or a functional variant thereof, and pAGH-Hs.
  • Adeno-associated vims is a replication-deficient parvovirus, the single- stranded DNA genome of which is about 4.7 kb in length including two ⁇ 145-nucleotide inverted terminal repeat (ITRs).
  • ITRs inverted terminal repeat
  • AAV serotypes when classified by antigenic epitopes.
  • the nucleotide sequences of the genomes of the AAV serotypes are known.
  • the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J.
  • the sequence of the AAVrh.74 genome is provided in U.S. Patent 9,434,928, incorporated herein by reference.
  • Cis-acting sequences directing viral DNA replication (rep), encapsidation/packaging and host cell chromosome integration are contained within the AAV ITRs.
  • Three AAV promoters (named p5, pl9, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes.
  • the two rep promoters (p5 and pi 9), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene.
  • Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome.
  • the cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1, VP2, and VP3.
  • Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins.
  • a single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).
  • AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy.
  • AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic.
  • AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo.
  • AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element).
  • the AAV proviral genome is inserted as cloned DNA in plasmids, which makes construction of recombinant genomes feasible.
  • the signals directing AAV replication and genome encapsidation are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA.
  • the rep and cap proteins may be provided in trans.
  • Another significant feature of AAV is that it is an extremely stable and hearty vims. It easily withstands the conditions used to inactivate adenovirus (56° to 65°C for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.
  • AAV DNA in the rAAV genomes may be from any AAV variant or serotype for which a recombinant virus can be derived including, but not limited to, AAV variants or serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV- 10, AAV-11, AAV- 12, AAV-13 and AAVrhlO.
  • Production of pseudotyped rAAV is disclosed in, for example, WO 01/83692.
  • Other types of rAAV variants, for example rAAV with capsid mutations, are also contemplated. See, for example , Marsic et al., Molecular Therapy, 22(11): 1900-1909 (2014).
  • the nucleotide sequences of the genomes of various AAV serotypes are known in the art.
  • the rAAV comprises a self-complementary genome.
  • an rAAV comprising a “self-complementary” or “double stranded” genome refers to an rAAV which has been engineered such that the coding region of the rAAV is configured to form an intra-molecular double-stranded DNA template, as described in McCarty et al.
  • Self complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Therapy. 8 (16): 1248-54 (2001).
  • the present disclosure contemplates the use, in some cases, of an rAAV comprising a self complementary genome because upon infection (such transduction), rather than waiting for cell mediated synthesis of the second strand of the rAAV genome, the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription.
  • dsDNA double stranded DNA
  • the rAAV vector comprises a single stranded genome.
  • a “single standard” genome refers to a genome that is not self-complementary. In most cases, non-recombinant AAVs are have singled stranded DNA genomes. There have been some indications that rAAVs should be sc AAVs to achieve efficient transduction of cells. The present disclosure contemplates, however, rAAV vectors that maybe have singled stranded genomes, rather than self-complementary genomes, with the understanding that other genetic modifications of the rAAV vector may be beneficial to obtain optimal gene transcription in target cells.
  • the present disclosure relates to single-stranded rAAV vectors capable of achieving efficient gene transfer to anterior segment in the mouse eye. See Wang et al. Single stranded adeno-associated vims achieves efficient gene transfer to anterior segment in the mouse eye. PLoS ONE 12(8): e0182473 (2017).
  • the rAAV vector is of the serotype AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrhlO, or AAVrh74.
  • Production of pseudotyped rAAV is disclosed in, for example, WO 01/83692.
  • Other types of rAAV variants, for example rAAV with capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11): 1900-1909 (2014).
  • the rAAV vector is of the serotype AAV9.
  • said rAAV vector is of serotype AAV9 and comprises a single stranded genome. In some embodiments, said rAAV vector is of serotype AAV9 and comprises a self-complementary genome. In some embodiments, a rAAV vector comprises the inverted terminal repeat (ITR) sequences of AAV2. In some embodiments, the rAAV vector comprises an AAV2 genome, such that the rAAV vector is an AAV-2/9 vector, an AAV-2/6 vector, or an AAV-2/8 vector.
  • ITR inverted terminal repeat
  • AAV vectors may comprise wild-type AAV sequence or they may comprise one or more modifications to a wild-type AAV sequence.
  • an AAV vector comprises one or more amino acid modifications, e.g., substitutions, deletions, or insertions, within a capsid protein, e.g., VP1, VP2 and/or VP3.
  • the modification provides for reduced immunogenicity when the AAV vector is provided to a subject.
  • Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons or more particularly a dopaminergic neuron.
  • a particular target tissue of interest such as neurons or more particularly a dopaminergic neuron.
  • the rAAV is directly injected into the substantia nigra of the subject.
  • the rAAV virion is an AAV2 rAAV virion.
  • the capsid many be an AAV2 capsid or functional variant thereof.
  • the AAV2 capsid shares at least 98%, 99%, or 100% identity to a reference AAV2 capsid, e.g.,
  • the rAAV virion is an AAV9 rAAV virion.
  • the capsid many be an AAV9 capsid or functional variant thereof.
  • the AAV9 capsid shares at least 98%, 99%, or 100% identity to a reference AAV9 capsid, e.g.,
  • the rAAV virion is an AAV-PHP.B rAAV virion or a neutrotrophic variant thereof, such as, without limitation, those disclosed in Int’l Pat. Pub. Nos. WO 2015/038958 A1 and WO 2017/100671 Al.
  • the AAV capsid may comprise at least 4 contiguous amino acids from the sequence TLAVPFK (SEQ ID NO:61) or KFPVALT (SEQ ID NO:62), e.g., inserted between a sequence encoding for amino acids 588 and 589 of AAV9.
  • the capsid many be an AAV-PHP.B capsid or functional variant thereof.
  • the AAV-PHP.B capsid shares at least 98%, 99%, or 100% identity to a reference AAV-PHP.B capsid, e.g.,
  • AAV capsids used in the rAAV virions of the disclosure include those disclosed in Pat. Pub. Nos. WO 2009/012176 A2 and WO 2015/168666 A2.
  • the disclosure provides pharmaceutical compositions comprising the rAAV virion of the disclosure and one or more pharmaceutically acceptable carriers, diluents, or excipients.
  • aqueous solutions For purposes of administration, e.g., by injection, various solutions can be employed, such as sterile aqueous solutions. Such aqueous solutions can be buffered, if desired, and the liquid diluent first rendered isotonic with saline or glucose.
  • Solutions of rAAV as a free acid (DNA contains acidic phosphate groups) or a pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as PluronicTM F-68 at 0.001% or 0.01%.
  • a dispersion of rAAV can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.
  • the pharmaceutical forms suitable for injectable use include but are not limited to sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form is sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions may be prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization.
  • dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and the freeze-drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.
  • the disclosure comprises a kit comprising an rAAV virion of the disclosure and instructions for use.
  • the disclosure provides a method of increasing eEF1A2 activity in a cell, comprising contacting the cell with an rAAV of the disclosure. In another aspect, the disclosure provides a method of increasing eEF1A2 activity in a subject, comprising administering to an rAAV of the disclosure.
  • the cell and/or subject is deficient in eEF1A2 expression levels and/or activity and/or comprises a loss-of-function mutation in eEF1A2.
  • the cell may be a neuron, e.g. a dopaminergic neuron.
  • the method promotes survival of neurons in cell culture and/or in vivo.
  • the disclosure provides a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of an rAAV virion of the disclosure.
  • the disease or disorder is a neurological disease or disorder.
  • the subject suffers from a genetic disruption in eEF1A2 expression or function.
  • the disease or disorder is an eEF1A2 deficiency and/or an eEF1A2-related neurological disease (OMIM #617309, 616393, 616409) phenotypic spectrum, such as intellectual disability, mental retardation, epileptic encephalopathy and autism spectrum disorder.
  • the AAV-mediated delivery of eEF1A2 protein to the CNS may increase life span, prevent neuronal degeneration, prevent or attenuate neurobehavioral deficits, degenerative epileptic-dyskinetic encephalopathy, epilepsy, and dystonia.
  • Combination therapies are also contemplated by the invention. Combinations of methods of the invention with standard medical treatments (e.g., corticosteroids or topical pressure reducing medications) are specifically contemplated, as are combinations with novel therapies.
  • a subject may be treated with a steroid to prevent or to reduce an immune response to administration of a rAAV described herein.
  • a therapeutically effective amount of the rAAV vector e.g. for intracerebroventricular (ICV) or intra-cisterna magna (ICM) injection, is a dose of rAAV ranging from about 1e12 vg/kg to about 5e12 vg/kg, or about 1e13 vg/kg to about 5e13 vg/kg, or about 1e14 vg/kg to about 5e14 vg/kg, or about 1e15 vg/kg to about 5e15 vg/kg, by brain weight.
  • the invention also comprises compositions comprising these ranges of rAAV vector.
  • a therapeutically effective amount of rAAV vector is a dose of about 1e10 vg, about 2e10 vg, about 3e10 vg, about 4e10 vg, about 5e10 vg, about 6e10 vg, about 7e10 vg, about 8e10 vg, about 9e10 vg, about 1e12 vg, about 2e12 vg, about 3e12 vg, about 4e12 vg and 5e12 vg.
  • the invention also comprises compositions comprising these doses of rAAV vector.
  • a therapeutically effective amount of rAAV vector is a dose in the range of 1e10vg/hemisphere to 1e13 vg/hemisphere, or about 1e10 vg/hemisphere, about lell vg/hemisphere, about 1e12 vg/hemisphere, or about 1e13 vg/hemisphere.
  • a therapeutically effective amount of rAAV vector is a dose in the range of 1e10 vg total to 1e14 vg total, or about 1e10 vg total, about 1e11 vg total, about 1e12 vg total, about 1e13 vg total, or about 1e14 vg total.
  • the therapeutic composition comprises more than about 1e9, 1e10, or 1e11 genomes of the rAAV vector per volume of therapeutic composition injected. In embodiments cases, the therapeutic composition comprises more than approximately lelO, lell, 1e12, or 1e13 genomes of the rAAV vector per mL. In certain embodiments, the therapeutic composition comprises less than about 1e14, 1e13 or 1e12 genomes of the rAAV vector per mL.
  • Evidence of functional improvement, clinical benefit or efficacy in patients may be assessed by the analysis of surrogate markers of reduction in seizure frequency (myoclonic and generalized tonic clonic seizures), brain growth and body growth using UK- WHO paediatric head circumference, height and weight percentile charts. Measures in cognition, motor, speech and language function using standard disease rating scales, such as Childhood seizure inventory and medication log. Cognitive and Developmental Assessments including the Peabody Developmental Motor Scales 2 nd edition (PDMS-2) and Bayley Scales of Infant Development, 3 rd edition applied as appropriate to level of child’s disability. Gross motor function measure (GFMF-88), Pediatric Evaluation of Disability Inventory (PEDI).
  • GFMF-88 Gross motor function measure
  • PEDI Pediatric Evaluation of Disability Inventory
  • CGICSD Caregiver Global Impression of Change in Seizure Duration
  • PedsQLTM Pediatric Quality of Life Inventory
  • Vineland Adaptive Behavior Scales-2nd may demonstrate improvements in components of the disease.
  • Baseline and post treatment Brain magnetic resonance imaging may show improvements in myelination and brain volume.
  • Clinical benefit could be observed as increase in life-span, meeting normal neurodevelopmental milestones, decreases in frequency or magnitude of epileptic seizure activity (including myoclonic, clonic, generalized tonic-clonic and/or epileptic spasm), improvement in, or lack of developing hypotonia or movement disorders such as choreoathetosis, dystonia, and/or ataxia.
  • Evidence of neuroprotective and/or neurorestorative effects may be evident on magnetic resonance imaging (MRI) by characterizing degree of myelination across development, thickness of corpus callosum, and degree of cortical and/or cerebellar atrophy.
  • Beneficial changes in electroencephalogram (EEG) activity would be evident by decreases in multifocal discharge and/or generalized spike activity.
  • Administration of an effective dose of the compositions may be by routes standard in the art including, but not limited to, systemic, local, direct injection, intravenous, cerebral, cerebrospinal, intrathecal, intracisternal, intraputaminal, intrahippocampal, intra-striatal (putamen and/or caudate), intracortical, or intra-cerebroventricular administration.
  • administration comprises intravenous, cerebral, cerebrospinal, intrathecal, intracisternal, intraputaminal, intrahippocampal, intra-striatal (putamen and/or caudate), or intra- cerebroventricular injection.
  • Administration may be performed by intrathecal injection with or without Trendelenberg tilting.
  • systemic administration may be administration into the circulatory system so that the entire body is affected.
  • Systemic administration includes parental administration through injection, infusion or implantation.
  • administration of rAAV of the present invention may be accomplished by using any physical method that will transport the rAAV recombinant vector into the target tissue of an animal.
  • Administration includes, but is not limited to, injection into the central nervous system (CNS) or cerebrospinal fluid (CSF) and/or directly into the brain.
  • CNS central nervous system
  • CSF cerebrospinal fluid
  • the methods of the disclosure comprise intracerebroventricular, intracistemal magna, intrathecal, or intrap arenchymal delivery.
  • Infusion may be performed using specialized cannula, catheter, syringe/needle using an infusion pump.
  • targeting of the injection site may be accomplished with MRI-guided imaging.
  • Administration may comprise delivery of an effective amount of the rAAV virion, or a pharmaceutical composition comprising the rAAV virion, to the CNS.
  • compositions of the disclosure may further be administered intravenously.
  • Direct delivery to the CNS could involve targeting the intraventricular space, either unilaterally or bilaterally, specific neuronal regions or more general brain regions containing neuronal targets.
  • Individual patient intraventricular space, brain region and/or neuronal target(s) selection and subsequent intraoperative delivery of AAV could by accomplished using a number of imaging techniques (MRI, CT, CT combined with MRI merging) and employing any number of software planning programs (e.g., Stealth System, Clearpoint Neuronavigation System, Brainlab, Neuroinspire etc).
  • Intraventricular psace or brain region targeting and delivery could involve us of standard stereotactic frames (Leksell, CRW) or using frameless approaches with or without intraoperative MRI.
  • Actual delivery of AAV may be by injection through needle or cannulae with or without inner lumen lined with material to prevent adsorption of AAV vector (e.g. Smartflow cannulae, MRI Interventions cannulae).
  • Delivery device interfaces with syringes and automated infusion or microinfusion pumps with preprogrammed infusion rates and volumes.
  • the syringe/needle combination or just the needle may be interfaced directly with the stereotactic frame.
  • Infusion may include constant flow rate or varying rates with convection enhanced delivery.
  • hSYN human synapsin
  • EXAMPLE 2 AAV9 GENE THERAPY RESCUE OF AN EEF1A2 KNOCKOUT MOUSE MODEL
  • EEF1A2 Eukaryotic translation elongation factor 1 alpha 2
  • eEF1A2 Eukaryotic translation elongation factor 1 alpha 2
  • Mutations in the EEF1A2 gene have been associated with severe intellectual disability, autism and epilepsy. There are currently no effective treatments.
  • An EEF1A2 knockout mouse model (wasted mice) has been well-characterized. The wasted ( wst/wst ) mice exhibit gait disturbances and tremor after weaning, followed by paralysis and motor neuron degeneration by 23 days of age.
  • adeno-associated vims 9 (AAV9) using a pan neuronal promoter, human Synapsin, to drive expression of the human EEF1A2 cDNA (hSyn- eEF1A2).
  • An eGFP marker gene was included to track expression of the construct in vivo.
  • Immunofluorescence (FIG. 7) revealed neuronal targeting after neonatal IC or IV injection of AAV9-hSyn-eEF1A2-T2A-eGFP.
  • Immunohistochemical staining (FIG. 8) confirmed widespread transgene expression in the CNS after both routes of administration from a single injection of a rAAV (for both eEF1A2-2A-eGFP or eGFP marker alone).
  • the gene therapy vector proved effective in treating wasted ( wst/wst ) mice.
  • Eefla2 -/“ knockout mice ( wst/wst ) mostly survived (3/4) when injected IC and all survived when injected both IC and IV (FIG. 9A).
  • Untreated mice died by P23.
  • IC or IC/IV mice similarly showed no weight loss compared to WT mice, whereas untreated control mice exhibit weight loss leading to death by P23 (FIG. 9B).
  • Rotarod and inverted grid analysis demonstrated no decline in performance in the treated (FIG. 9C and FIG. 9D). The results were significant by both two-way ANOVA and Dunnett’s multiple comparison tests.
  • eEF1A2 expression was observed throughout the brain in wild-type, IC and combined treatment (FIG. 9E and FIG. 9F). eEF1A2 expression was present in spinal cord tissue of wild- type, IC and combined treated groups. However, expression was absent in the untreated wasted group and IV treated groups (F).
  • EXAMPLE 3 AAV9 GENE THERAPY RESCUE OF EEF1A2 D252H OR EEF1A2 G70S OR EEF1A2 e122K MOUSE MODELS
  • Efficacy of vector designs shown in FIGS. 2-5 and FIG. 6, as well as various codon- optimizations, are compared to identity the vectors that have superior efficacy.
  • Experiments are performed in mouse models that recapitulate three mutations found in humans (D252H, G70S and or E122K) and/or a mouse model with a severe neurodegenerative phenotype (Del.22.ex3).
  • Experiments are performed in both neonatal mice and at later stages of development through adult to confirm AAV vectors encoding eEF1A2 can rescue survival, weight loss, and behavioral phenotypes.
  • a collective neuroscore on a battery of tests may be obtained to assess neurobehavioral function of AAV9- eEF1A2 injected mice relative to nontreated controls, that includes analysis of hindlimb clasping, gait, kyphosis and ability to walk along a ledge.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Endocrinology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/EP2020/071028 2020-07-23 2020-07-24 GENE THERAPY VECTOR FOR eEF1A2 AND USES THEREOF Ceased WO2022017630A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063055775P 2020-07-23 2020-07-23
US63/055,775 2020-07-23

Publications (1)

Publication Number Publication Date
WO2022017630A1 true WO2022017630A1 (en) 2022-01-27

Family

ID=71786970

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/EP2020/071028 Ceased WO2022017630A1 (en) 2020-07-23 2020-07-24 GENE THERAPY VECTOR FOR eEF1A2 AND USES THEREOF
PCT/EP2021/070455 Ceased WO2022018171A1 (en) 2020-07-23 2021-07-21 GENE THERAPY VECTOR FOR eEF1A2 AND USES THEREOF

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/EP2021/070455 Ceased WO2022018171A1 (en) 2020-07-23 2021-07-21 GENE THERAPY VECTOR FOR eEF1A2 AND USES THEREOF

Country Status (10)

Country Link
US (1) US20230330265A1 (https=)
EP (1) EP4185332A1 (https=)
JP (1) JP2023535576A (https=)
KR (1) KR20230039669A (https=)
CN (1) CN116171325A (https=)
AU (1) AU2021312320A1 (https=)
CA (1) CA3186700A1 (https=)
IL (1) IL299955A (https=)
MX (1) MX2023000995A (https=)
WO (2) WO2022017630A1 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11883506B2 (en) 2020-08-07 2024-01-30 Spacecraft Seven, Llc Plakophilin-2 (PKP2) gene therapy using AAV vector
US12163151B2 (en) 2016-04-20 2024-12-10 Centro de Investigaciones Energéticas, Medioambientales y Tecnológicas O.A, M.P. Methods of treating or preventing pyruvate kinase deficiency
US12378576B2 (en) 2018-04-27 2025-08-05 Spacecraft Seven, Llc Gene therapy for CNS degeneration
US12496359B2 (en) 2017-10-16 2025-12-16 Centro de Investigaciones Energéticas, Medioambientales y Tecnológicas, O.A, M.P. Lentiviral vectors for delivery of PKLR to treat Pyruvate Kinase Deficiency
US12539316B2 (en) 2018-04-11 2026-02-03 Spacecraft Seven, Llc Compositions and methods for stem cell transplant
WO2026006785A3 (en) * 2024-06-28 2026-03-05 Adverum Biotechnologies, Inc. Melanopsin variants for vision restoration

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2026044087A1 (en) 2024-08-21 2026-02-26 Shape Therapeutics Inc. Increased cellular stability for aav production
WO2026073032A1 (en) 2024-09-27 2026-04-02 Shape Therapeutics Inc. Constructs for improved aav production

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6180613B1 (en) 1994-04-13 2001-01-30 The Rockefeller University AAV-mediated delivery of DNA to cells of the nervous system
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
WO2009012176A2 (en) 2007-07-14 2009-01-22 The University Of Iowa Research Foundation Methods and compositions for treating brain diseases
US20120082650A1 (en) 2010-04-02 2012-04-05 Ceregene, Inc. Methods for treating parkinson's disease and other disorders of dopaminergic neurons of the brain
US8524446B2 (en) 2001-11-13 2013-09-03 The Trustees Of The University Of Pennsylvania Method for detecting adeno-associated virus
WO2015038958A1 (en) 2013-09-13 2015-03-19 California Institute Of Technology Selective recovery
WO2015168666A2 (en) 2014-05-02 2015-11-05 Genzyme Corporation Aav vectors for retinal and cns gene therapy
US9434928B2 (en) 2011-11-23 2016-09-06 Nationwide Children's Hospital, Inc. Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides
WO2017049252A1 (en) * 2015-09-17 2017-03-23 Switch Bio, Inc. Compositions and methods for treating neurological disorders
WO2017100671A1 (en) 2015-12-11 2017-06-15 California Institute Of Technology TARGETING PEPTIDES FOR DIRECTING ADENO-ASSOCIATED VIRUSES (AAVs)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7122350B2 (en) * 2003-12-12 2006-10-17 Zymogenetics, Inc. Methods for enhancing expression of recombinant proteins
EP3285788B1 (en) * 2015-04-23 2024-12-18 University of Massachusetts Modulation of aav vector transgene expression
KR102918544B1 (ko) * 2018-07-12 2026-01-27 로켓 파마슈티컬스, 리미티드 다논병을 치료하기 위한 유전자 요법 벡터
CA3120923A1 (en) * 2018-11-26 2020-06-04 Universitat Autonoma De Barcelona Fibroblast growth factor 21 (fgf21) gene therapy

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6180613B1 (en) 1994-04-13 2001-01-30 The Rockefeller University AAV-mediated delivery of DNA to cells of the nervous system
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
US8524446B2 (en) 2001-11-13 2013-09-03 The Trustees Of The University Of Pennsylvania Method for detecting adeno-associated virus
WO2009012176A2 (en) 2007-07-14 2009-01-22 The University Of Iowa Research Foundation Methods and compositions for treating brain diseases
US20120082650A1 (en) 2010-04-02 2012-04-05 Ceregene, Inc. Methods for treating parkinson's disease and other disorders of dopaminergic neurons of the brain
US9434928B2 (en) 2011-11-23 2016-09-06 Nationwide Children's Hospital, Inc. Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides
WO2015038958A1 (en) 2013-09-13 2015-03-19 California Institute Of Technology Selective recovery
WO2015168666A2 (en) 2014-05-02 2015-11-05 Genzyme Corporation Aav vectors for retinal and cns gene therapy
WO2017049252A1 (en) * 2015-09-17 2017-03-23 Switch Bio, Inc. Compositions and methods for treating neurological disorders
WO2017100671A1 (en) 2015-12-11 2017-06-15 California Institute Of Technology TARGETING PEPTIDES FOR DIRECTING ADENO-ASSOCIATED VIRUSES (AAVs)

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
ALBERT ET AL.: "AAV Vector-Mediated Gene Delivery to Substantia Nigra Dopamine Neurons: Implications for Gene Therapy and Disease Models", GENES, 8 February 2017 (2017-02-08)
CAO ET AL., HUMAN MOLECULAR GENETICS, vol. 26, no. 18, 2017, pages 3545 - 3552
DAVIES ET AL., SCI REP., vol. 7, 2017, pages 46019
GAO ET AL., J. VIROL., vol. 78, 2004, pages 6381 - 6388
LAM ET AL., MOL GENET GENOMIC MED., vol. 4, no. 4, 2016, pages 465 - 74
MARSIC ET AL., MOLECULAR THERAPY, vol. 22, no. 11, 2014, pages 1900 - 1909
MCCARTY ET AL.: "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", GENE THERAPY, vol. 8, no. 16, 2001, pages 1248 - 54, XP002992255, DOI: 10.1038/sj.gt.3301514
MOL. THER., vol. 13, no. 1, 2006, pages 67 - 76
MUZYCZKA, CURRENT TOPICS IN MICROBIOLOGY AND IMMUNOLOGY, vol. 158, 1992, pages 97 - 129
NAKAJIMA ET AL., CLIN GENET., vol. 87, no. 4, 2015, pages 356 - 61
NEWBURY ET AL., J. BIO. CHEM., vol. 282, 2007, pages 2891 - 50
NG J ET AL: "OR02: AAV9 gene therapy rescue of an eEF1A2 knockout mouse model", vol. 30, no. 8, 1 August 2019 (2019-08-01), pages A10, XP009527089, ISSN: 1043-0342, Retrieved from the Internet <URL:http://online.liebertpub.com/loi/hum> [retrieved on 20190816], DOI: 10.1089/HUM.2019.29087.ABSTRACTS *
NG JOANNE ET AL: "194. AAV9 Gene Therapy Rescue of an eEF1A2 Knockout Mouse Model", vol. 28, no. 4, Suppl. 1, 28 April 2020 (2020-04-28), pages 95 - 96, XP009527090, ISSN: 1525-0016, Retrieved from the Internet <URL:https://www.cell.com/molecular-therapy-family/molecular-therapy/fulltext/S1525-0016(20)30200-8> [retrieved on 20200428], DOI: 10.1016/J.YMTHE.2020.04.019 *
SCHLABACH ET AL., PNAS, vol. 107, no. 6, 2010, pages 2538 - 43
SRIVASTAVA ET AL., J. VIROL., vol. 45, 1983, pages 555 - 564
SUN ET AL., INT J CANCER., vol. 123, no. 8, 2008, pages 1761 - 176
SUN YU ET AL: "The eukaryotic translation elongation factor eEF1A2 induces neoplastic properties and mediates tumorigenic effects of ZNF217 in precursor cells of human ovarian carcinomas", INTERNATIONAL JOURNAL OF CANCER, vol. 123, no. 8, 15 October 2008 (2008-10-15), US, pages 1761 - 1769, XP055798826, ISSN: 0020-7136, DOI: 10.1002/ijc.23708 *
VIROLOGY, vol. 330, no. 2, 2004, pages 375 - 383
WANG ET AL.: "Single stranded adeno-associated virus achieves efficient gene transfer to anterior segment in the mouse eye", PLOS ONE, vol. 12, no. 8, 2017, pages e0182473

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12163151B2 (en) 2016-04-20 2024-12-10 Centro de Investigaciones Energéticas, Medioambientales y Tecnológicas O.A, M.P. Methods of treating or preventing pyruvate kinase deficiency
US12496359B2 (en) 2017-10-16 2025-12-16 Centro de Investigaciones Energéticas, Medioambientales y Tecnológicas, O.A, M.P. Lentiviral vectors for delivery of PKLR to treat Pyruvate Kinase Deficiency
US12539316B2 (en) 2018-04-11 2026-02-03 Spacecraft Seven, Llc Compositions and methods for stem cell transplant
US12378576B2 (en) 2018-04-27 2025-08-05 Spacecraft Seven, Llc Gene therapy for CNS degeneration
US11883506B2 (en) 2020-08-07 2024-01-30 Spacecraft Seven, Llc Plakophilin-2 (PKP2) gene therapy using AAV vector
WO2026006785A3 (en) * 2024-06-28 2026-03-05 Adverum Biotechnologies, Inc. Melanopsin variants for vision restoration

Also Published As

Publication number Publication date
CN116171325A (zh) 2023-05-26
WO2022018171A1 (en) 2022-01-27
US20230330265A1 (en) 2023-10-19
AU2021312320A1 (en) 2023-03-16
IL299955A (en) 2023-03-01
EP4185332A1 (en) 2023-05-31
JP2023535576A (ja) 2023-08-18
MX2023000995A (es) 2023-06-16
KR20230039669A (ko) 2023-03-21
CA3186700A1 (en) 2022-01-27

Similar Documents

Publication Publication Date Title
WO2022017630A1 (en) GENE THERAPY VECTOR FOR eEF1A2 AND USES THEREOF
JP7853952B2 (ja) Glut1発現のためのアデノ随伴ウイルスベクターおよびその使用
WO2022032226A1 (en) Plakophilin-2 (pkp2) gene therapy using aav vector
US20230257431A1 (en) Csrp3 (cysteine and glycine rich protein 3) gene therapy
US20230174994A1 (en) Engineered parkin and uses thereof
US20250135040A1 (en) Adeno-associated viral vector for glut1 expression and uses thereof
US20230151390A1 (en) Vectors for the treatment of acid ceramidase deficiency
JP7781057B2 (ja) Irf2bpl遺伝子の変異に関連する障害の治療のための材料および方法
JP7826334B2 (ja) 髄腔内送達によってピット・ホプキンス症候群を治療するためのメチル-cpg結合タンパク質2をコードする組換えアデノ随伴ウイルス
US20250382593A1 (en) Adeno-Associated Virus Delivery of CLN1 Polynucleotide
JP2026503144A (ja) 発現を調節するための物質及び方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20746201

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20746201

Country of ref document: EP

Kind code of ref document: A1